>Feature sequence001 1284 265 gene locus_tag LOCUS_00010 gene recA 1284 265 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851424.1 protein_id gnl|my_center|LOCUS_00010 2750 1371 gene locus_tag LOCUS_00020 gene argH 2750 1371 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891895.1 protein_id gnl|my_center|LOCUS_00020 3555 2758 gene locus_tag LOCUS_00030 gene mscS 3555 2758 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_00030 4646 3666 gene locus_tag LOCUS_00040 4646 3666 CDS product iron-sulfur cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051995.1 protein_id gnl|my_center|LOCUS_00040 5894 4698 gene locus_tag LOCUS_00050 5894 4698 CDS product NifS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858709.1 protein_id gnl|my_center|LOCUS_00050 6024 6761 gene locus_tag LOCUS_00060 gene dapF 6024 6761 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851173.1 protein_id gnl|my_center|LOCUS_00060 6751 7497 gene locus_tag LOCUS_00070 6751 7497 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003040026.1 protein_id gnl|my_center|LOCUS_00070 7494 8549 gene locus_tag LOCUS_00080 gene lpxB 7494 8549 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142178.1 protein_id gnl|my_center|LOCUS_00080 8803 9171 gene locus_tag LOCUS_00090 gene rpsM 8803 9171 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800121.1 protein_id gnl|my_center|LOCUS_00090 9181 9573 gene locus_tag LOCUS_00100 gene rpsK 9181 9573 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779544.1 protein_id gnl|my_center|LOCUS_00100 9583 10209 gene locus_tag LOCUS_00110 gene rpsD 9583 10209 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135250.1 protein_id gnl|my_center|LOCUS_00110 10235 11239 gene locus_tag LOCUS_00120 10235 11239 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851403.1 protein_id gnl|my_center|LOCUS_00120 11259 11609 gene locus_tag LOCUS_00130 gene rplQ 11259 11609 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851332.1 protein_id gnl|my_center|LOCUS_00130 11719 15270 gene locus_tag LOCUS_00140 gene dnaE 11719 15270 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852165.1 protein_id gnl|my_center|LOCUS_00140 15589 15831 gene locus_tag LOCUS_00150 15589 15831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15836 17092 gene locus_tag LOCUS_00160 gene hipA 15836 17092 CDS product type II toxin-antitoxin system toxin serine/threonine-protein kinase HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071024.1 protein_id gnl|my_center|LOCUS_00160 17325 18437 gene locus_tag LOCUS_00170 17325 18437 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943101.1 protein_id gnl|my_center|LOCUS_00170 18430 18624 gene locus_tag LOCUS_00180 18430 18624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18645 19118 gene locus_tag LOCUS_00190 18645 19118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19115 19408 gene locus_tag LOCUS_00200 19115 19408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20171 19434 gene locus_tag LOCUS_00210 gene fliP 20171 19434 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852529.1 protein_id gnl|my_center|LOCUS_00210 20919 20161 gene locus_tag LOCUS_00220 20919 20161 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852725.1 protein_id gnl|my_center|LOCUS_00220 22308 20920 gene locus_tag LOCUS_00230 22308 20920 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852810.1 protein_id gnl|my_center|LOCUS_00230 22930 22298 gene locus_tag LOCUS_00240 22930 22298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23695 23069 gene locus_tag LOCUS_00250 23695 23069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 23979 23692 gene locus_tag LOCUS_00260 23979 23692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 25209 23980 gene locus_tag LOCUS_00270 25209 23980 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853125.1 protein_id gnl|my_center|LOCUS_00270 25388 25206 gene locus_tag LOCUS_00280 25388 25206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 25879 25424 gene locus_tag LOCUS_00290 gene rpiB 25879 25424 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_00290 26664 25879 gene locus_tag LOCUS_00300 gene lepB 26664 25879 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852457.1 protein_id gnl|my_center|LOCUS_00300 27519 26665 gene locus_tag LOCUS_00310 gene folD 27519 26665 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864845.1 protein_id gnl|my_center|LOCUS_00310 28206 27583 gene locus_tag LOCUS_00320 28206 27583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 28661 28275 gene locus_tag LOCUS_00330 28661 28275 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279208.1 protein_id gnl|my_center|LOCUS_00330 29052 28759 gene locus_tag LOCUS_00340 29052 28759 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953389.1 protein_id gnl|my_center|LOCUS_00340 29613 29095 gene locus_tag LOCUS_00350 29613 29095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 31170 29632 gene locus_tag LOCUS_00360 31170 29632 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940453.1 protein_id gnl|my_center|LOCUS_00360 31913 31173 gene locus_tag LOCUS_00370 31913 31173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 32305 31928 gene locus_tag LOCUS_00380 32305 31928 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858673.1 protein_id gnl|my_center|LOCUS_00380 32568 32305 gene locus_tag LOCUS_00390 32568 32305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 33077 32565 gene locus_tag LOCUS_00400 gene moaC 33077 32565 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131513.1 protein_id gnl|my_center|LOCUS_00400 33161 33340 gene locus_tag LOCUS_00410 gene rpsU 33161 33340 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780697.1 protein_id gnl|my_center|LOCUS_00410 33413 33489 gene locus_tag LOCUS_t00010 33413 33489 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 34380 33613 gene locus_tag LOCUS_00420 34380 33613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 34990 34367 gene locus_tag LOCUS_00430 34990 34367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 35667 34987 gene locus_tag LOCUS_00440 35667 34987 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963568.1 protein_id gnl|my_center|LOCUS_00440 36847 35660 gene locus_tag LOCUS_00450 36847 35660 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671214.1 protein_id gnl|my_center|LOCUS_00450 37031 36840 gene locus_tag LOCUS_00460 37031 36840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 37590 37210 gene locus_tag LOCUS_00470 37590 37210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 37785 38963 gene locus_tag LOCUS_00480 37785 38963 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 protein_id gnl|my_center|LOCUS_00480 38979 39272 gene locus_tag LOCUS_00490 38979 39272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 39418 39801 gene locus_tag LOCUS_00500 39418 39801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 42112 39842 gene locus_tag LOCUS_00510 42112 39842 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404537.1 protein_id gnl|my_center|LOCUS_00510 43590 42226 gene locus_tag LOCUS_00520 43590 42226 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355104.1 protein_id gnl|my_center|LOCUS_00520 43780 45150 gene locus_tag LOCUS_00530 43780 45150 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868347.1 protein_id gnl|my_center|LOCUS_00530 45166 45939 gene locus_tag LOCUS_00540 45166 45939 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096887.1 protein_id gnl|my_center|LOCUS_00540 45939 47399 gene locus_tag LOCUS_00550 45939 47399 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_00550 47408 48850 gene locus_tag LOCUS_00560 47408 48850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 48861 50069 gene locus_tag LOCUS_00570 48861 50069 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930671.1 protein_id gnl|my_center|LOCUS_00570 50070 51992 gene locus_tag LOCUS_00580 50070 51992 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249504.1 protein_id gnl|my_center|LOCUS_00580 52110 52322 gene locus_tag LOCUS_00590 52110 52322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 52319 55180 gene locus_tag LOCUS_00600 52319 55180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 55164 58496 gene locus_tag LOCUS_00610 55164 58496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 58788 62144 gene locus_tag LOCUS_00620 58788 62144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 62365 62733 gene locus_tag LOCUS_00630 62365 62733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 62833 63753 gene locus_tag LOCUS_00640 62833 63753 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483126.1 protein_id gnl|my_center|LOCUS_00640 63826 64605 gene locus_tag LOCUS_00650 63826 64605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 64640 65131 gene locus_tag LOCUS_00660 64640 65131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 65961 65185 gene locus_tag LOCUS_00670 65961 65185 CDS product TIGR04219 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942519.1 protein_id gnl|my_center|LOCUS_00670 67210 65948 gene locus_tag LOCUS_00680 67210 65948 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714010.1 protein_id gnl|my_center|LOCUS_00680 68330 67275 gene locus_tag LOCUS_00690 68330 67275 CDS product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851090.1 protein_id gnl|my_center|LOCUS_00690 70576 68354 gene locus_tag LOCUS_00700 gene bamA 70576 68354 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851708.1 protein_id gnl|my_center|LOCUS_00700 70796 71431 gene locus_tag LOCUS_00710 gene nssR 70796 71431 CDS product nitrosative stress-sensitive transcriptional regulator NssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851096.1 protein_id gnl|my_center|LOCUS_00710 72782 71448 gene locus_tag LOCUS_00720 72782 71448 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857990.1 protein_id gnl|my_center|LOCUS_00720 72882 73487 gene locus_tag LOCUS_00730 gene rdgB 72882 73487 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853680.1 protein_id gnl|my_center|LOCUS_00730 73595 74971 gene locus_tag LOCUS_00740 73595 74971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 74986 76758 gene locus_tag LOCUS_00750 74986 76758 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266723.1 protein_id gnl|my_center|LOCUS_00750 76767 77762 gene locus_tag LOCUS_00760 76767 77762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 77752 79068 gene locus_tag LOCUS_00770 gene vpoC 77752 79068 CDS product efflux RND transporter outer membrane protein VpoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455451.1 protein_id gnl|my_center|LOCUS_00770 79068 80102 gene locus_tag LOCUS_00780 gene gmd 79068 80102 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074056622.1 protein_id gnl|my_center|LOCUS_00780 80105 80983 gene locus_tag LOCUS_00790 80105 80983 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963753.1 protein_id gnl|my_center|LOCUS_00790 80973 82082 gene locus_tag LOCUS_00800 80973 82082 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 protein_id gnl|my_center|LOCUS_00800 82084 83199 gene locus_tag LOCUS_00810 82084 83199 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765279.1 protein_id gnl|my_center|LOCUS_00810 84684 83221 gene locus_tag LOCUS_00820 gene thiI 84684 83221 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488737.1 protein_id gnl|my_center|LOCUS_00820 85679 84759 gene locus_tag LOCUS_00830 85679 84759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 86680 85694 gene locus_tag LOCUS_00840 gene hemB 86680 85694 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852925.1 protein_id gnl|my_center|LOCUS_00840 86740 87315 gene locus_tag LOCUS_00850 gene ribA 86740 87315 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853056.1 protein_id gnl|my_center|LOCUS_00850 87312 87905 gene locus_tag LOCUS_00860 gene rsmG 87312 87905 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068828.1 protein_id gnl|my_center|LOCUS_00860 87906 88118 gene locus_tag LOCUS_00870 87906 88118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 88115 88498 gene locus_tag LOCUS_00880 88115 88498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 88485 88964 gene locus_tag LOCUS_00890 88485 88964 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121395.1 protein_id gnl|my_center|LOCUS_00890 89085 89333 gene locus_tag LOCUS_00900 89085 89333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 89651 89421 gene locus_tag LOCUS_00910 89651 89421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 89851 90702 gene locus_tag LOCUS_00920 89851 90702 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611641.1 protein_id gnl|my_center|LOCUS_00920 90712 91053 gene locus_tag LOCUS_00930 90712 91053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 91035 91379 gene locus_tag LOCUS_00940 91035 91379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 91399 91896 gene locus_tag LOCUS_00950 91399 91896 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858543.1 protein_id gnl|my_center|LOCUS_00950 91871 92569 gene locus_tag LOCUS_00960 91871 92569 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_00960 92785 92549 gene locus_tag LOCUS_00970 92785 92549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 92973 92782 gene locus_tag LOCUS_00980 92973 92782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 93525 93016 gene locus_tag LOCUS_00990 93525 93016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 93551 93694 gene locus_tag LOCUS_01000 93551 93694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 94145 95110 gene locus_tag LOCUS_01010 94145 95110 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858282.1 protein_id gnl|my_center|LOCUS_01010 95058 96341 gene locus_tag LOCUS_01020 95058 96341 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108527784.1 protein_id gnl|my_center|LOCUS_01020 96341 97504 gene locus_tag LOCUS_01030 gene trmB 96341 97504 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858203.1 protein_id gnl|my_center|LOCUS_01030 97501 98163 gene locus_tag LOCUS_01040 97501 98163 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853534.1 protein_id gnl|my_center|LOCUS_01040 98207 98956 gene locus_tag LOCUS_01050 98207 98956 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853622.1 protein_id gnl|my_center|LOCUS_01050 98953 100293 gene locus_tag LOCUS_01060 98953 100293 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853860.1 protein_id gnl|my_center|LOCUS_01060 100920 100294 gene locus_tag LOCUS_01070 gene recR 100920 100294 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853214.1 protein_id gnl|my_center|LOCUS_01070 100934 102058 gene locus_tag LOCUS_01080 gene dnaJ 100934 102058 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853203.1 protein_id gnl|my_center|LOCUS_01080 102061 102654 gene locus_tag LOCUS_01090 102061 102654 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852433.1 protein_id gnl|my_center|LOCUS_01090 102659 103621 gene locus_tag LOCUS_01100 102659 103621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 104733 103669 gene locus_tag LOCUS_01110 gene leuB 104733 103669 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057439.1 protein_id gnl|my_center|LOCUS_01110 105223 104726 gene locus_tag LOCUS_01120 gene leuD 105223 104726 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544917.1 protein_id gnl|my_center|LOCUS_01120 105359 107230 gene locus_tag LOCUS_01130 gene rpoD 105359 107230 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852997.1 protein_id gnl|my_center|LOCUS_01130 108223 107288 gene locus_tag LOCUS_01140 108223 107288 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_01140 109455 108286 gene locus_tag LOCUS_01150 109455 108286 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852601.1 protein_id gnl|my_center|LOCUS_01150 109673 111127 gene locus_tag LOCUS_01160 gene nadB 109673 111127 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583120.1 protein_id gnl|my_center|LOCUS_01160 111127 112506 gene locus_tag LOCUS_01170 gene nhaD 111127 112506 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147723.1 protein_id gnl|my_center|LOCUS_01170 112605 114143 gene locus_tag LOCUS_01180 gene guaA 112605 114143 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853189.1 protein_id gnl|my_center|LOCUS_01180 114148 114549 gene locus_tag LOCUS_01190 114148 114549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 114549 115073 gene locus_tag LOCUS_01200 114549 115073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 115120 115695 gene locus_tag LOCUS_01210 115120 115695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 115712 116281 gene locus_tag LOCUS_01220 gene gmhA 115712 116281 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566736.1 protein_id gnl|my_center|LOCUS_01220 116285 116836 gene locus_tag LOCUS_01230 gene apt 116285 116836 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853297.1 protein_id gnl|my_center|LOCUS_01230 116846 117523 gene locus_tag LOCUS_01240 116846 117523 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853249.1 protein_id gnl|my_center|LOCUS_01240 117535 118935 gene locus_tag LOCUS_01250 117535 118935 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912892.1 protein_id gnl|my_center|LOCUS_01250 119092 120552 gene locus_tag LOCUS_01260 gene pyk 119092 120552 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858708.1 protein_id gnl|my_center|LOCUS_01260 >Feature sequence002 195 524 gene locus_tag LOCUS_01270 195 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 538 1509 gene locus_tag LOCUS_01280 538 1509 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_01280 1506 2063 gene locus_tag LOCUS_01290 gene frr 1506 2063 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864198.1 protein_id gnl|my_center|LOCUS_01290 2066 2665 gene locus_tag LOCUS_01300 gene pyrE 2066 2665 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851820.1 protein_id gnl|my_center|LOCUS_01300 2928 2692 gene locus_tag LOCUS_01310 2928 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 4021 3062 gene locus_tag LOCUS_01320 4021 3062 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858639.1 protein_id gnl|my_center|LOCUS_01320 5014 4025 gene locus_tag LOCUS_01330 gene plsX 5014 4025 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858645.1 protein_id gnl|my_center|LOCUS_01330 5166 5014 gene locus_tag LOCUS_01340 gene rpmF 5166 5014 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858674.1 protein_id gnl|my_center|LOCUS_01340 5559 5176 gene locus_tag LOCUS_01350 5559 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 5983 5570 gene locus_tag LOCUS_01360 gene ndk 5983 5570 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858685.1 protein_id gnl|my_center|LOCUS_01360 6336 6055 gene locus_tag LOCUS_01370 6336 6055 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858671.1 protein_id gnl|my_center|LOCUS_01370 6544 7536 gene locus_tag LOCUS_01380 gene nadA 6544 7536 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141770.1 protein_id gnl|my_center|LOCUS_01380 7539 8363 gene locus_tag LOCUS_01390 gene nadC 7539 8363 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405980.1 protein_id gnl|my_center|LOCUS_01390 8885 8415 gene locus_tag LOCUS_01400 8885 8415 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851418.1 protein_id gnl|my_center|LOCUS_01400 9770 8886 gene locus_tag LOCUS_01410 9770 8886 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851295.1 protein_id gnl|my_center|LOCUS_01410 10897 9767 gene locus_tag LOCUS_01420 10897 9767 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851397.1 protein_id gnl|my_center|LOCUS_01420 11011 11895 gene locus_tag LOCUS_01430 11011 11895 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891825.1 protein_id gnl|my_center|LOCUS_01430 11912 12880 gene locus_tag LOCUS_01440 11912 12880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 12972 13214 gene locus_tag LOCUS_01450 12972 13214 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012997715.1 protein_id gnl|my_center|LOCUS_01450 13214 14035 gene locus_tag LOCUS_01460 gene rsmI 13214 14035 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851893.1 protein_id gnl|my_center|LOCUS_01460 14047 14625 gene locus_tag LOCUS_01470 14047 14625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 14630 15061 gene locus_tag LOCUS_01480 14630 15061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 15058 16827 gene locus_tag LOCUS_01490 gene mrdA 15058 16827 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852196.1 protein_id gnl|my_center|LOCUS_01490 16817 17770 gene locus_tag LOCUS_01500 16817 17770 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583572.1 protein_id gnl|my_center|LOCUS_01500 19175 17751 gene locus_tag LOCUS_01510 19175 17751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 19609 19178 gene locus_tag LOCUS_01520 19609 19178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 20414 19626 gene locus_tag LOCUS_01530 gene flgG 20414 19626 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946438.1 protein_id gnl|my_center|LOCUS_01530 20552 20920 gene locus_tag LOCUS_01540 20552 20920 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772151.1 protein_id gnl|my_center|LOCUS_01540 20924 21697 gene locus_tag LOCUS_01550 gene cheZ 20924 21697 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191026.1 protein_id gnl|my_center|LOCUS_01550 21710 22429 gene locus_tag LOCUS_01560 21710 22429 CDS product flagellar hook-basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858501.1 protein_id gnl|my_center|LOCUS_01560 22443 22847 gene locus_tag LOCUS_01570 gene flgB 22443 22847 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347783.1 protein_id gnl|my_center|LOCUS_01570 22863 24548 gene locus_tag LOCUS_01580 gene fliF 22863 24548 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364750.1 protein_id gnl|my_center|LOCUS_01580 24549 25559 gene locus_tag LOCUS_01590 gene fliG 24549 25559 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854670.1 protein_id gnl|my_center|LOCUS_01590 25564 26226 gene locus_tag LOCUS_01600 25564 26226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 26328 26621 gene locus_tag LOCUS_01610 26328 26621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 26631 27383 gene locus_tag LOCUS_01620 26631 27383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 27393 29018 gene locus_tag LOCUS_01630 27393 29018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 29106 31373 gene locus_tag LOCUS_01640 29106 31373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 31382 31711 gene locus_tag LOCUS_01650 31382 31711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 31715 33733 gene locus_tag LOCUS_01660 31715 33733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 33805 34113 gene locus_tag LOCUS_01670 33805 34113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 34128 34967 gene locus_tag LOCUS_01680 34128 34967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 34980 35735 gene locus_tag LOCUS_01690 34980 35735 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326458.1 protein_id gnl|my_center|LOCUS_01690 35750 36544 gene locus_tag LOCUS_01700 35750 36544 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937942.1 protein_id gnl|my_center|LOCUS_01700 36547 36852 gene locus_tag LOCUS_01710 36547 36852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 36849 37226 gene locus_tag LOCUS_01720 36849 37226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 37226 37627 gene locus_tag LOCUS_01730 37226 37627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 37628 38770 gene locus_tag LOCUS_01740 gene flhF 37628 38770 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612466.1 protein_id gnl|my_center|LOCUS_01740 38789 39604 gene locus_tag LOCUS_01750 gene flhG 38789 39604 CDS product flagella biosynthesis ATPase FlhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851985.1 protein_id gnl|my_center|LOCUS_01750 39611 39946 gene locus_tag LOCUS_01760 39611 39946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 39949 40272 gene locus_tag LOCUS_01770 39949 40272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 40293 40745 gene locus_tag LOCUS_01780 gene flgC 40293 40745 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858484.1 protein_id gnl|my_center|LOCUS_01780 40756 42753 gene locus_tag LOCUS_01790 40756 42753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 42764 43519 gene locus_tag LOCUS_01800 gene fliR 42764 43519 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852712.1 protein_id gnl|my_center|LOCUS_01800 43529 44575 gene locus_tag LOCUS_01810 gene flhB 43529 44575 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858726.1 protein_id gnl|my_center|LOCUS_01810 44591 46615 gene locus_tag LOCUS_01820 44591 46615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 46615 47922 gene locus_tag LOCUS_01830 gene fliI 46615 47922 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851735.1 protein_id gnl|my_center|LOCUS_01830 47915 49159 gene locus_tag LOCUS_01840 47915 49159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 49237 51294 gene locus_tag LOCUS_01850 gene flhA 49237 51294 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852599.1 protein_id gnl|my_center|LOCUS_01850 51342 51611 gene locus_tag LOCUS_01860 51342 51611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 51639 53210 gene locus_tag LOCUS_01870 gene secD 51639 53210 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857963.1 protein_id gnl|my_center|LOCUS_01870 53210 54181 gene locus_tag LOCUS_01880 gene secF 53210 54181 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858025.1 protein_id gnl|my_center|LOCUS_01880 54184 55521 gene locus_tag LOCUS_01890 gene glmM 54184 55521 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860288.1 protein_id gnl|my_center|LOCUS_01890 55515 55988 gene locus_tag LOCUS_01900 gene lspA 55515 55988 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921378.1 protein_id gnl|my_center|LOCUS_01900 56055 57008 gene locus_tag LOCUS_01910 56055 57008 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_01910 57595 57071 gene locus_tag LOCUS_01920 gene bcp 57595 57071 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932346.1 protein_id gnl|my_center|LOCUS_01920 58716 57634 gene locus_tag LOCUS_01930 58716 57634 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072975.1 protein_id gnl|my_center|LOCUS_01930 59210 58722 gene locus_tag LOCUS_01940 59210 58722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 59317 60522 gene locus_tag LOCUS_01950 gene ilvA 59317 60522 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858758.1 protein_id gnl|my_center|LOCUS_01950 60552 62330 gene locus_tag LOCUS_01960 gene asnB 60552 62330 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930749.1 protein_id gnl|my_center|LOCUS_01960 62534 62734 gene locus_tag LOCUS_01970 62534 62734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 62812 63777 gene locus_tag LOCUS_01980 62812 63777 CDS product SLAC1 anion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788774.1 protein_id gnl|my_center|LOCUS_01980 63779 64336 gene locus_tag LOCUS_01990 63779 64336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 64354 64743 gene locus_tag LOCUS_02000 64354 64743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927161.1 protein_id gnl|my_center|LOCUS_02000 64790 65671 gene locus_tag LOCUS_02010 64790 65671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 65815 66129 gene locus_tag LOCUS_02020 65815 66129 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853292.1 protein_id gnl|my_center|LOCUS_02020 66193 66612 gene locus_tag LOCUS_02030 66193 66612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 67525 66593 gene locus_tag LOCUS_02040 67525 66593 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346174.1 protein_id gnl|my_center|LOCUS_02040 68548 67529 gene locus_tag LOCUS_02050 68548 67529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851806.1 protein_id gnl|my_center|LOCUS_02050 68933 68577 gene locus_tag LOCUS_02060 gene dksA 68933 68577 CDS product molecular chaperone DnaK suppressor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851949.1 protein_id gnl|my_center|LOCUS_02060 69368 68985 gene locus_tag LOCUS_02070 gene rlmH 69368 68985 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203892.1 protein_id gnl|my_center|LOCUS_02070 69547 70323 gene locus_tag LOCUS_02080 69547 70323 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931634.1 protein_id gnl|my_center|LOCUS_02080 70320 72056 gene locus_tag LOCUS_02090 70320 72056 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858720.1 protein_id gnl|my_center|LOCUS_02090 72329 72111 gene locus_tag LOCUS_02100 72329 72111 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 protein_id gnl|my_center|LOCUS_02100 73254 72556 gene locus_tag LOCUS_02110 gene hisIE 73254 72556 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_02110 73669 73238 gene locus_tag LOCUS_02120 73669 73238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 74855 73770 gene locus_tag LOCUS_02130 74855 73770 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121076.1 protein_id gnl|my_center|LOCUS_02130 75848 74928 gene locus_tag LOCUS_02140 gene ilvE 75848 74928 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851928.1 protein_id gnl|my_center|LOCUS_02140 76092 77291 gene locus_tag LOCUS_02150 76092 77291 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_02150 77419 79218 gene locus_tag LOCUS_02160 77419 79218 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_02160 79218 79466 gene locus_tag LOCUS_02170 79218 79466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 79496 80380 gene locus_tag LOCUS_02180 gene ppk2 79496 80380 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852184.1 protein_id gnl|my_center|LOCUS_02180 80432 82003 gene locus_tag LOCUS_02190 gene recJ 80432 82003 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853146.1 protein_id gnl|my_center|LOCUS_02190 82653 82039 gene locus_tag LOCUS_02200 82653 82039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 83378 82641 gene locus_tag LOCUS_02210 83378 82641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 83648 85603 gene locus_tag LOCUS_02220 83648 85603 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072951.1 protein_id gnl|my_center|LOCUS_02220 >Feature sequence003 1596 265 gene locus_tag LOCUS_02230 gene purB 1596 265 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865088.1 protein_id gnl|my_center|LOCUS_02230 1773 2693 gene locus_tag LOCUS_02240 1773 2693 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099334852.1 protein_id gnl|my_center|LOCUS_02240 2693 4576 gene locus_tag LOCUS_02250 2693 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 5876 4578 gene locus_tag LOCUS_02260 gene murC 5876 4578 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894779.1 protein_id gnl|my_center|LOCUS_02260 6455 5877 gene locus_tag LOCUS_02270 6455 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 7615 6473 gene locus_tag LOCUS_02280 7615 6473 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142409.1 protein_id gnl|my_center|LOCUS_02280 8339 7662 gene locus_tag LOCUS_02290 8339 7662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 9504 8269 gene locus_tag LOCUS_02300 9504 8269 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462089.1 protein_id gnl|my_center|LOCUS_02300 11352 9505 gene locus_tag LOCUS_02310 11352 9505 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590871.1 protein_id gnl|my_center|LOCUS_02310 12587 11367 gene locus_tag LOCUS_02320 12587 11367 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858667.1 protein_id gnl|my_center|LOCUS_02320 13167 12595 gene locus_tag LOCUS_02330 13167 12595 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415847.1 protein_id gnl|my_center|LOCUS_02330 13543 13262 gene locus_tag LOCUS_02340 13543 13262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 13898 13533 gene locus_tag LOCUS_02350 13898 13533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 14008 14208 gene locus_tag LOCUS_02360 14008 14208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 14292 14906 gene locus_tag LOCUS_02370 14292 14906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858686.1 protein_id gnl|my_center|LOCUS_02370 15895 14948 gene locus_tag LOCUS_02380 15895 14948 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851196.1 protein_id gnl|my_center|LOCUS_02380 17110 16040 gene locus_tag LOCUS_02390 gene rlmN 17110 16040 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864795.1 protein_id gnl|my_center|LOCUS_02390 17670 17107 gene locus_tag LOCUS_02400 17670 17107 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853142.1 protein_id gnl|my_center|LOCUS_02400 18354 17680 gene locus_tag LOCUS_02410 18354 17680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 19117 18356 gene locus_tag LOCUS_02420 gene hisF 19117 18356 CDS product imidazoleglycerol phosphate synthase cyclase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880108.1 protein_id gnl|my_center|LOCUS_02420 19414 20238 gene locus_tag LOCUS_02430 gene rsmA 19414 20238 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853083.1 protein_id gnl|my_center|LOCUS_02430 20210 22120 gene locus_tag LOCUS_02440 20210 22120 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864793.1 protein_id gnl|my_center|LOCUS_02440 22258 23106 gene locus_tag LOCUS_02450 22258 23106 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853086.1 protein_id gnl|my_center|LOCUS_02450 23143 24159 gene locus_tag LOCUS_02460 23143 24159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 24159 24599 gene locus_tag LOCUS_02470 24159 24599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 24596 25777 gene locus_tag LOCUS_02480 24596 25777 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060246.1 protein_id gnl|my_center|LOCUS_02480 25807 26700 gene locus_tag LOCUS_02490 25807 26700 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852714.1 protein_id gnl|my_center|LOCUS_02490 26702 27643 gene locus_tag LOCUS_02500 26702 27643 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694271.1 protein_id gnl|my_center|LOCUS_02500 27653 28210 gene locus_tag LOCUS_02510 27653 28210 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107438.1 protein_id gnl|my_center|LOCUS_02510 29129 28296 gene locus_tag LOCUS_02520 gene rhuM 29129 28296 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201977.1 protein_id gnl|my_center|LOCUS_02520 30767 29340 gene locus_tag LOCUS_02530 30767 29340 CDS product COG3400 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717228.1 protein_id gnl|my_center|LOCUS_02530 30819 31145 gene locus_tag LOCUS_02540 30819 31145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 31159 32151 gene locus_tag LOCUS_02550 gene tal 31159 32151 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155041.1 protein_id gnl|my_center|LOCUS_02550 32162 33514 gene locus_tag LOCUS_02560 32162 33514 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766790.1 protein_id gnl|my_center|LOCUS_02560 35891 33561 gene locus_tag LOCUS_02570 gene gyrB 35891 33561 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858833.1 protein_id gnl|my_center|LOCUS_02570 36973 35903 gene locus_tag LOCUS_02580 gene dnaN 36973 35903 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858808.1 protein_id gnl|my_center|LOCUS_02580 38459 37140 gene locus_tag LOCUS_02590 gene dnaA 38459 37140 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858822.1 protein_id gnl|my_center|LOCUS_02590 38571 39062 gene locus_tag LOCUS_02600 gene ruvC 38571 39062 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891952.1 protein_id gnl|my_center|LOCUS_02600 40264 39077 gene locus_tag LOCUS_02610 40264 39077 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851177.1 protein_id gnl|my_center|LOCUS_02610 40889 40374 gene locus_tag LOCUS_02620 40889 40374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 41602 41006 gene locus_tag LOCUS_02630 41602 41006 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854219.1 protein_id gnl|my_center|LOCUS_02630 41853 42536 gene locus_tag LOCUS_02640 gene rlmB 41853 42536 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851944.1 protein_id gnl|my_center|LOCUS_02640 42538 43362 gene locus_tag LOCUS_02650 42538 43362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 43374 44600 gene locus_tag LOCUS_02660 43374 44600 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932911.1 protein_id gnl|my_center|LOCUS_02660 44621 44932 gene locus_tag LOCUS_02670 44621 44932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 45011 46273 gene locus_tag LOCUS_02680 45011 46273 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746824.1 protein_id gnl|my_center|LOCUS_02680 46375 46572 gene locus_tag LOCUS_02690 46375 46572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 46777 47649 gene locus_tag LOCUS_02700 46777 47649 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965501.1 protein_id gnl|my_center|LOCUS_02700 47890 49857 gene locus_tag LOCUS_02710 47890 49857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 50881 49940 gene locus_tag LOCUS_02720 50881 49940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 52154 50865 gene locus_tag LOCUS_02730 52154 50865 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_02730 53127 52147 gene locus_tag LOCUS_02740 53127 52147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 54404 53124 gene locus_tag LOCUS_02750 54404 53124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 55173 54421 gene locus_tag LOCUS_02760 55173 54421 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858306.1 protein_id gnl|my_center|LOCUS_02760 55798 55175 gene locus_tag LOCUS_02770 gene hisH 55798 55175 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856473.1 protein_id gnl|my_center|LOCUS_02770 56924 55788 gene locus_tag LOCUS_02780 gene pseA 56924 55788 CDS product pseudaminic acid biosynthesis protein PseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856493.1 protein_id gnl|my_center|LOCUS_02780 57892 56921 gene locus_tag LOCUS_02790 57892 56921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 58996 57962 gene locus_tag LOCUS_02800 gene pseI 58996 57962 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987011.1 protein_id gnl|my_center|LOCUS_02800 60254 58983 gene locus_tag LOCUS_02810 60254 58983 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065307.1 protein_id gnl|my_center|LOCUS_02810 60832 60305 gene locus_tag LOCUS_02820 gene pseH 60832 60305 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925126.1 protein_id gnl|my_center|LOCUS_02820 61698 60832 gene locus_tag LOCUS_02830 gene pseG 61698 60832 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002830499.1 protein_id gnl|my_center|LOCUS_02830 62480 61770 gene locus_tag LOCUS_02840 gene pseF 62480 61770 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_02840 63603 62473 gene locus_tag LOCUS_02850 gene pseC 63603 62473 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_02850 64605 63604 gene locus_tag LOCUS_02860 gene pseB 64605 63604 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858028.1 protein_id gnl|my_center|LOCUS_02860 65646 64666 gene locus_tag LOCUS_02870 65646 64666 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858656.1 protein_id gnl|my_center|LOCUS_02870 66225 65656 gene locus_tag LOCUS_02880 66225 65656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 68073 66256 gene locus_tag LOCUS_02890 gene typA 68073 66256 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859745.1 protein_id gnl|my_center|LOCUS_02890 68224 68613 gene locus_tag LOCUS_02900 68224 68613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 68925 68665 gene locus_tag LOCUS_02910 gene rpsR 68925 68665 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853032.1 protein_id gnl|my_center|LOCUS_02910 69498 68953 gene locus_tag LOCUS_02920 69498 68953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 69894 69526 gene locus_tag LOCUS_02930 69894 69526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 70980 70000 gene locus_tag LOCUS_02940 70980 70000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 72751 70982 gene locus_tag LOCUS_02950 72751 70982 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891871.1 protein_id gnl|my_center|LOCUS_02950 72901 73923 gene locus_tag LOCUS_02960 gene ilvC 72901 73923 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614924.1 protein_id gnl|my_center|LOCUS_02960 73990 75099 gene locus_tag LOCUS_02970 73990 75099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 75096 75872 gene locus_tag LOCUS_02980 gene dprA 75096 75872 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077645213.1 protein_id gnl|my_center|LOCUS_02980 77335 75890 gene locus_tag LOCUS_02990 77335 75890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484911.1 protein_id gnl|my_center|LOCUS_02990 78515 77346 gene locus_tag LOCUS_03000 78515 77346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 78895 78497 gene locus_tag LOCUS_03010 78895 78497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 79562 78960 gene locus_tag LOCUS_03020 79562 78960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 80699 79674 gene locus_tag LOCUS_03030 80699 79674 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256047.1 protein_id gnl|my_center|LOCUS_03030 81875 80706 gene locus_tag LOCUS_03040 81875 80706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 83052 81862 gene locus_tag LOCUS_03050 83052 81862 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879939.1 protein_id gnl|my_center|LOCUS_03050 >Feature sequence004 <1 649 gene locus_tag LOCUS_03060 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002864286.1:NAD-dependent deacetylase 945 2162 gene locus_tag LOCUS_03070 gene metK 945 2162 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852836.1 protein_id gnl|my_center|LOCUS_03070 2195 3076 gene locus_tag LOCUS_03080 gene accD 2195 3076 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851791.1 protein_id gnl|my_center|LOCUS_03080 3487 3098 gene locus_tag LOCUS_03090 3487 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 4061 3528 gene locus_tag LOCUS_03100 4061 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 4247 7225 gene locus_tag LOCUS_03110 4247 7225 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858240.1 protein_id gnl|my_center|LOCUS_03110 7226 8020 gene locus_tag LOCUS_03120 7226 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 8066 9097 gene locus_tag LOCUS_03130 8066 9097 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420964.1 protein_id gnl|my_center|LOCUS_03130 9153 10547 gene locus_tag LOCUS_03140 gene tlpD 9153 10547 CDS product chemotaxis chemoreceptor TlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467802.1 protein_id gnl|my_center|LOCUS_03140 10562 10942 gene locus_tag LOCUS_03150 10562 10942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 11114 12031 gene locus_tag LOCUS_03160 11114 12031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 12025 12861 gene locus_tag LOCUS_03170 12025 12861 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583165.1 protein_id gnl|my_center|LOCUS_03170 12936 13727 gene locus_tag LOCUS_03180 12936 13727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 13735 13986 gene locus_tag LOCUS_03190 13735 13986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 13996 14727 gene locus_tag LOCUS_03200 gene ubiE 13996 14727 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858648.1 protein_id gnl|my_center|LOCUS_03200 14727 15938 gene locus_tag LOCUS_03210 gene xseA 14727 15938 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382848.1 protein_id gnl|my_center|LOCUS_03210 15997 16473 gene locus_tag LOCUS_03220 15997 16473 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072185.1 protein_id gnl|my_center|LOCUS_03220 16587 18125 gene locus_tag LOCUS_03230 16587 18125 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681436.1 protein_id gnl|my_center|LOCUS_03230 18805 18245 gene locus_tag LOCUS_03240 gene efp 18805 18245 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855210.1 protein_id gnl|my_center|LOCUS_03240 20401 18815 gene locus_tag LOCUS_03250 gene serA 20401 18815 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852643.1 protein_id gnl|my_center|LOCUS_03250 22087 20432 gene locus_tag LOCUS_03260 22087 20432 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852520.1 protein_id gnl|my_center|LOCUS_03260 22976 22149 gene locus_tag LOCUS_03270 22976 22149 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852585.1 protein_id gnl|my_center|LOCUS_03270 24266 22980 gene locus_tag LOCUS_03280 gene aroA 24266 22980 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852577.1 protein_id gnl|my_center|LOCUS_03280 26590 24266 gene locus_tag LOCUS_03290 gene pheT 26590 24266 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002915726.1 protein_id gnl|my_center|LOCUS_03290 27597 26587 gene locus_tag LOCUS_03300 gene pheS 27597 26587 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852567.1 protein_id gnl|my_center|LOCUS_03300 28118 27687 gene locus_tag LOCUS_03310 28118 27687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 29203 28139 gene locus_tag LOCUS_03320 29203 28139 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858697.1 protein_id gnl|my_center|LOCUS_03320 29760 29200 gene locus_tag LOCUS_03330 gene pth 29760 29200 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858659.1 protein_id gnl|my_center|LOCUS_03330 30314 29778 gene locus_tag LOCUS_03340 30314 29778 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002791314.1 protein_id gnl|my_center|LOCUS_03340 31758 30382 gene locus_tag LOCUS_03350 31758 30382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 32834 31761 gene locus_tag LOCUS_03360 gene fabX 32834 31761 CDS product decanoate oxidase/trans-2-decenoyl-[acyl-carrier protein] isomerase FabX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255244.1 protein_id gnl|my_center|LOCUS_03360 34061 32853 gene locus_tag LOCUS_03370 gene tyrS 34061 32853 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858315.1 protein_id gnl|my_center|LOCUS_03370 36228 34069 gene locus_tag LOCUS_03380 36228 34069 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858057.1 protein_id gnl|my_center|LOCUS_03380 36424 36215 gene locus_tag LOCUS_03390 36424 36215 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712202.1 protein_id gnl|my_center|LOCUS_03390 37144 36437 gene locus_tag LOCUS_03400 gene pyrH 37144 36437 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858454.1 protein_id gnl|my_center|LOCUS_03400 38513 37215 gene locus_tag LOCUS_03410 38513 37215 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479127.1 protein_id gnl|my_center|LOCUS_03410 38634 40190 gene locus_tag LOCUS_03420 38634 40190 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_03420 40209 41786 gene locus_tag LOCUS_03430 40209 41786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 41773 42477 gene locus_tag LOCUS_03440 41773 42477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 42544 44523 gene locus_tag LOCUS_03450 42544 44523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 44608 47031 gene locus_tag LOCUS_03460 44608 47031 CDS product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028305.1 protein_id gnl|my_center|LOCUS_03460 47036 47578 gene locus_tag LOCUS_03470 47036 47578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 47614 48300 gene locus_tag LOCUS_03480 47614 48300 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_03480 48293 49951 gene locus_tag LOCUS_03490 48293 49951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 49944 51620 gene locus_tag LOCUS_03500 49944 51620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 52788 51835 gene locus_tag LOCUS_03510 52788 51835 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681111.1 protein_id gnl|my_center|LOCUS_03510 53044 53898 gene locus_tag LOCUS_03520 53044 53898 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209579.1 protein_id gnl|my_center|LOCUS_03520 55085 53964 gene locus_tag LOCUS_03530 55085 53964 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096393.1 protein_id gnl|my_center|LOCUS_03530 55825 55097 gene locus_tag LOCUS_03540 55825 55097 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024285.1 protein_id gnl|my_center|LOCUS_03540 56547 55918 gene locus_tag LOCUS_03550 56547 55918 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485245.1 protein_id gnl|my_center|LOCUS_03550 56719 57045 gene locus_tag LOCUS_03560 56719 57045 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100349.1 protein_id gnl|my_center|LOCUS_03560 57045 57788 gene locus_tag LOCUS_03570 57045 57788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 57788 58354 gene locus_tag LOCUS_03580 57788 58354 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080883.1 protein_id gnl|my_center|LOCUS_03580 58399 58908 gene locus_tag LOCUS_03590 58399 58908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 58909 59904 gene locus_tag LOCUS_03600 58909 59904 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_03600 59917 60789 gene locus_tag LOCUS_03610 59917 60789 CDS product N-carbamoylputrescine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853261.1 protein_id gnl|my_center|LOCUS_03610 60808 61551 gene locus_tag LOCUS_03620 gene fabG 60808 61551 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858551.1 protein_id gnl|my_center|LOCUS_03620 61645 61872 gene locus_tag LOCUS_03630 gene acpP 61645 61872 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125917.1 protein_id gnl|my_center|LOCUS_03630 61983 63236 gene locus_tag LOCUS_03640 61983 63236 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858574.1 protein_id gnl|my_center|LOCUS_03640 63246 64178 gene locus_tag LOCUS_03650 gene accA 63246 64178 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858530.1 protein_id gnl|my_center|LOCUS_03650 65088 64204 gene locus_tag LOCUS_03660 gene nfo 65088 64204 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479588.1 protein_id gnl|my_center|LOCUS_03660 65362 65099 gene locus_tag LOCUS_03670 65362 65099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 65538 66152 gene locus_tag LOCUS_03680 65538 66152 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852828.1 protein_id gnl|my_center|LOCUS_03680 66936 66142 gene locus_tag LOCUS_03690 gene mreC 66936 66142 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864583.1 protein_id gnl|my_center|LOCUS_03690 67960 66929 gene locus_tag LOCUS_03700 67960 66929 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891850.1 protein_id gnl|my_center|LOCUS_03700 69206 67971 gene locus_tag LOCUS_03710 gene clpX 69206 67971 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891849.1 protein_id gnl|my_center|LOCUS_03710 69990 69196 gene locus_tag LOCUS_03720 gene lpxA 69990 69196 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851756.1 protein_id gnl|my_center|LOCUS_03720 70440 69997 gene locus_tag LOCUS_03730 gene fabZ 70440 69997 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857452.1 protein_id gnl|my_center|LOCUS_03730 70392 70544 gene locus_tag LOCUS_03740 70392 70544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 70636 71364 gene locus_tag LOCUS_03750 70636 71364 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851668.1 protein_id gnl|my_center|LOCUS_03750 71440 71925 gene locus_tag LOCUS_03760 71440 71925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 71873 72724 gene locus_tag LOCUS_03770 71873 72724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 72736 73695 gene locus_tag LOCUS_03780 gene hemC 72736 73695 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208189.1 protein_id gnl|my_center|LOCUS_03780 74422 73700 gene locus_tag LOCUS_03790 gene truA 74422 73700 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852636.1 protein_id gnl|my_center|LOCUS_03790 75450 74431 gene locus_tag LOCUS_03800 75450 74431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 76199 75447 gene locus_tag LOCUS_03810 76199 75447 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881038.1 protein_id gnl|my_center|LOCUS_03810 76917 76231 gene locus_tag LOCUS_03820 76917 76231 CDS product di-trans,poly-cis-decaprenylcistransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370674.1 protein_id gnl|my_center|LOCUS_03820 78127 76910 gene locus_tag LOCUS_03830 gene coaBC 78127 76910 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009984.1 protein_id gnl|my_center|LOCUS_03830 78276 79976 gene locus_tag LOCUS_03840 78276 79976 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852245.1 protein_id gnl|my_center|LOCUS_03840 79978 80481 gene locus_tag LOCUS_03850 79978 80481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 80478 80864 gene locus_tag LOCUS_03860 80478 80864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 83047 80888 gene locus_tag LOCUS_03870 83047 80888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 >Feature sequence005 423 842 gene locus_tag LOCUS_03880 gene rplM 423 842 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167671.1 protein_id gnl|my_center|LOCUS_03880 846 1235 gene locus_tag LOCUS_03890 gene rpsI 846 1235 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227269.1 protein_id gnl|my_center|LOCUS_03890 1324 1989 gene locus_tag LOCUS_03900 1324 1989 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851542.1 protein_id gnl|my_center|LOCUS_03900 1992 2444 gene locus_tag LOCUS_03910 1992 2444 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817864.1 protein_id gnl|my_center|LOCUS_03910 2469 3557 gene locus_tag LOCUS_03920 2469 3557 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491853.1 protein_id gnl|my_center|LOCUS_03920 3737 3552 gene locus_tag LOCUS_03930 3737 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 4135 3851 gene locus_tag LOCUS_03940 4135 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 4377 4132 gene locus_tag LOCUS_03950 4377 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 4739 4512 gene locus_tag LOCUS_03960 4739 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 5975 4755 gene locus_tag LOCUS_03970 5975 4755 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856962.1 protein_id gnl|my_center|LOCUS_03970 6035 6439 gene locus_tag LOCUS_03980 6035 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 6447 7118 gene locus_tag LOCUS_03990 6447 7118 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213204.1 protein_id gnl|my_center|LOCUS_03990 7894 7181 gene locus_tag LOCUS_04000 7894 7181 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948617.1 protein_id gnl|my_center|LOCUS_04000 8304 7903 gene locus_tag LOCUS_04010 8304 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 9288 8416 gene locus_tag LOCUS_04020 9288 8416 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657605.1 protein_id gnl|my_center|LOCUS_04020 10538 9288 gene locus_tag LOCUS_04030 10538 9288 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852758.1 protein_id gnl|my_center|LOCUS_04030 11052 10549 gene locus_tag LOCUS_04040 gene petA 11052 10549 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852880.1 protein_id gnl|my_center|LOCUS_04040 11243 11737 gene locus_tag LOCUS_04050 gene purE 11243 11737 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852194.1 protein_id gnl|my_center|LOCUS_04050 11740 12633 gene locus_tag LOCUS_04060 gene glyQ 11740 12633 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150920.1 protein_id gnl|my_center|LOCUS_04060 12640 13374 gene locus_tag LOCUS_04070 12640 13374 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852315.1 protein_id gnl|my_center|LOCUS_04070 13385 14101 gene locus_tag LOCUS_04080 13385 14101 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852139.1 protein_id gnl|my_center|LOCUS_04080 14126 15271 gene locus_tag LOCUS_04090 gene waaA 14126 15271 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852277.1 protein_id gnl|my_center|LOCUS_04090 15274 16014 gene locus_tag LOCUS_04100 15274 16014 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852134.1 protein_id gnl|my_center|LOCUS_04100 17163 16051 gene locus_tag LOCUS_04110 17163 16051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 18349 17354 gene locus_tag LOCUS_04120 gene purM 18349 17354 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851320.1 protein_id gnl|my_center|LOCUS_04120 18555 18349 gene locus_tag LOCUS_04130 18555 18349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 18644 19264 gene locus_tag LOCUS_04140 gene coaE 18644 19264 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243282.1 protein_id gnl|my_center|LOCUS_04140 19509 19285 gene locus_tag LOCUS_04150 19509 19285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 21015 19516 gene locus_tag LOCUS_04160 21015 19516 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_04160 21672 21112 gene locus_tag LOCUS_04170 21672 21112 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867312.1 protein_id gnl|my_center|LOCUS_04170 22954 21674 gene locus_tag LOCUS_04180 gene leuC 22954 21674 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_04180 23141 23599 gene locus_tag LOCUS_04190 23141 23599 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947495.1 protein_id gnl|my_center|LOCUS_04190 23617 24150 gene locus_tag LOCUS_04200 23617 24150 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904001.1 protein_id gnl|my_center|LOCUS_04200 25350 24142 gene locus_tag LOCUS_04210 25350 24142 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858151.1 protein_id gnl|my_center|LOCUS_04210 25831 25385 gene locus_tag LOCUS_04220 25831 25385 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545911.1 protein_id gnl|my_center|LOCUS_04220 26196 27515 gene locus_tag LOCUS_04230 gene soxC 26196 27515 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_04230 27487 28686 gene locus_tag LOCUS_04240 27487 28686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 28697 29056 gene locus_tag LOCUS_04250 28697 29056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 29072 29533 gene locus_tag LOCUS_04260 gene soxY 29072 29533 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083833.1 protein_id gnl|my_center|LOCUS_04260 29604 29909 gene locus_tag LOCUS_04270 29604 29909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 29952 30872 gene locus_tag LOCUS_04280 gene soxA 29952 30872 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932698.1 protein_id gnl|my_center|LOCUS_04280 30884 31330 gene locus_tag LOCUS_04290 30884 31330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 31444 33249 gene locus_tag LOCUS_04300 gene soxB 31444 33249 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926971.1 protein_id gnl|my_center|LOCUS_04300 33328 34131 gene locus_tag LOCUS_04310 33328 34131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 34326 34946 gene locus_tag LOCUS_04320 34326 34946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 34955 37165 gene locus_tag LOCUS_04330 34955 37165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 37158 39248 gene locus_tag LOCUS_04340 37158 39248 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073464.1 protein_id gnl|my_center|LOCUS_04340 39304 40281 gene locus_tag LOCUS_04350 39304 40281 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851460.1 protein_id gnl|my_center|LOCUS_04350 40278 41069 gene locus_tag LOCUS_04360 40278 41069 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851136.1 protein_id gnl|my_center|LOCUS_04360 41081 41881 gene locus_tag LOCUS_04370 41081 41881 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626402.1 protein_id gnl|my_center|LOCUS_04370 45021 41926 gene locus_tag LOCUS_04380 45021 41926 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_04380 45602 45120 gene locus_tag LOCUS_04390 45602 45120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 46523 45603 gene locus_tag LOCUS_04400 46523 45603 CDS product quinoprotein relay system zinc metallohydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969580.1 protein_id gnl|my_center|LOCUS_04400 46976 46539 gene locus_tag LOCUS_04410 46976 46539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 47092 47661 gene locus_tag LOCUS_04420 47092 47661 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858481.1 protein_id gnl|my_center|LOCUS_04420 47662 48399 gene locus_tag LOCUS_04430 47662 48399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 49507 48446 gene locus_tag LOCUS_04440 49507 48446 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_04440 51537 49573 gene locus_tag LOCUS_04450 51537 49573 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858576.1 protein_id gnl|my_center|LOCUS_04450 53038 51557 gene locus_tag LOCUS_04460 gene gpmI 53038 51557 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057737.1 protein_id gnl|my_center|LOCUS_04460 53129 54190 gene locus_tag LOCUS_04470 gene mraY 53129 54190 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858494.1 protein_id gnl|my_center|LOCUS_04470 54207 55364 gene locus_tag LOCUS_04480 gene murD 54207 55364 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858617.1 protein_id gnl|my_center|LOCUS_04480 55644 56813 gene locus_tag LOCUS_04490 55644 56813 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_04490 >Feature sequence006 1039 2163 gene locus_tag LOCUS_04500 gene proV 1039 2163 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985501.1 protein_id gnl|my_center|LOCUS_04500 2156 3172 gene locus_tag LOCUS_04510 gene proW 2156 3172 CDS product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261482.1 protein_id gnl|my_center|LOCUS_04510 3173 4144 gene locus_tag LOCUS_04520 gene proX 3173 4144 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418240.1 protein_id gnl|my_center|LOCUS_04520 5130 4159 gene locus_tag LOCUS_04530 5130 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 5324 6796 gene locus_tag LOCUS_04540 gene prpD 5324 6796 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598114.1 protein_id gnl|my_center|LOCUS_04540 7053 7943 gene locus_tag LOCUS_04550 gene prpB 7053 7943 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052184.1 protein_id gnl|my_center|LOCUS_04550 7999 9108 gene locus_tag LOCUS_04560 gene prpC 7999 9108 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267427.1 protein_id gnl|my_center|LOCUS_04560 9254 11848 gene locus_tag LOCUS_04570 gene acnD 9254 11848 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224931.1 protein_id gnl|my_center|LOCUS_04570 11851 13026 gene locus_tag LOCUS_04580 gene prpF 11851 13026 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114192.1 protein_id gnl|my_center|LOCUS_04580 14300 13101 gene locus_tag LOCUS_04590 14300 13101 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_04590 16941 14440 gene locus_tag LOCUS_04600 16941 14440 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_04600 17533 16943 gene locus_tag LOCUS_04610 17533 16943 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852394.1 protein_id gnl|my_center|LOCUS_04610 18362 17535 gene locus_tag LOCUS_04620 18362 17535 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853724.1 protein_id gnl|my_center|LOCUS_04620 19022 18366 gene locus_tag LOCUS_04630 gene nth 19022 18366 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852225.1 protein_id gnl|my_center|LOCUS_04630 19141 19539 gene locus_tag LOCUS_04640 19141 19539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 19605 19832 gene locus_tag LOCUS_04650 19605 19832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 20757 19819 gene locus_tag LOCUS_04660 20757 19819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 21076 22377 gene locus_tag LOCUS_04670 gene gltX 21076 22377 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871824.1 protein_id gnl|my_center|LOCUS_04670 22374 22655 gene locus_tag LOCUS_04680 22374 22655 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852501.1 protein_id gnl|my_center|LOCUS_04680 24197 22707 gene locus_tag LOCUS_04690 gene thrC 24197 22707 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117321.1 protein_id gnl|my_center|LOCUS_04690 24337 24843 gene locus_tag LOCUS_04700 24337 24843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 24876 25655 gene locus_tag LOCUS_04710 24876 25655 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853163.1 protein_id gnl|my_center|LOCUS_04710 25655 26566 gene locus_tag LOCUS_04720 gene pdxA 25655 26566 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075036.1 protein_id gnl|my_center|LOCUS_04720 27495 26569 gene locus_tag LOCUS_04730 27495 26569 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_04730 28230 27520 gene locus_tag LOCUS_04740 28230 27520 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780603.1 protein_id gnl|my_center|LOCUS_04740 29283 28291 gene locus_tag LOCUS_04750 29283 28291 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_04750 30106 29450 gene locus_tag LOCUS_04760 30106 29450 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070966.1 protein_id gnl|my_center|LOCUS_04760 30462 30719 gene locus_tag LOCUS_04770 30462 30719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 30722 32545 gene locus_tag LOCUS_04780 30722 32545 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_04780 32576 33898 gene locus_tag LOCUS_04790 32576 33898 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 protein_id gnl|my_center|LOCUS_04790 33907 35493 gene locus_tag LOCUS_04800 gene pckA 33907 35493 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853265.1 protein_id gnl|my_center|LOCUS_04800 35588 36454 gene locus_tag LOCUS_04810 35588 36454 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986202.1 protein_id gnl|my_center|LOCUS_04810 36502 37005 gene locus_tag LOCUS_04820 gene mobB 36502 37005 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852644.1 protein_id gnl|my_center|LOCUS_04820 37018 37854 gene locus_tag LOCUS_04830 37018 37854 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864856.1 protein_id gnl|my_center|LOCUS_04830 37858 38061 gene locus_tag LOCUS_04840 37858 38061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611784.1 protein_id gnl|my_center|LOCUS_04840 38045 39175 gene locus_tag LOCUS_04850 gene nspC 38045 39175 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858431.1 protein_id gnl|my_center|LOCUS_04850 39256 40077 gene locus_tag LOCUS_04860 39256 40077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 40690 40106 gene locus_tag LOCUS_04870 40690 40106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 41797 40691 gene locus_tag LOCUS_04880 41797 40691 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002661162.1 protein_id gnl|my_center|LOCUS_04880 42630 41791 gene locus_tag LOCUS_04890 42630 41791 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864856.1 protein_id gnl|my_center|LOCUS_04890 42901 42987 gene locus_tag LOCUS_t00020 42901 42987 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 43455 43237 gene locus_tag LOCUS_04900 gene infA 43455 43237 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090248.1 protein_id gnl|my_center|LOCUS_04900 44234 43473 gene locus_tag LOCUS_04910 gene map 44234 43473 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858416.1 protein_id gnl|my_center|LOCUS_04910 45504 44242 gene locus_tag LOCUS_04920 gene secY 45504 44242 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864789.1 protein_id gnl|my_center|LOCUS_04920 45911 45510 gene locus_tag LOCUS_04930 gene rplO 45911 45510 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851292.1 protein_id gnl|my_center|LOCUS_04930 46356 45916 gene locus_tag LOCUS_04940 gene rpsE 46356 45916 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001860543.1 protein_id gnl|my_center|LOCUS_04940 46725 46366 gene locus_tag LOCUS_04950 gene rplR 46725 46366 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851411.1 protein_id gnl|my_center|LOCUS_04950 47272 46736 gene locus_tag LOCUS_04960 gene rplF 47272 46736 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851302.1 protein_id gnl|my_center|LOCUS_04960 47683 47282 gene locus_tag LOCUS_04970 gene rpsH 47683 47282 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851353.1 protein_id gnl|my_center|LOCUS_04970 47893 47708 gene locus_tag LOCUS_04980 47893 47708 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085694.1 protein_id gnl|my_center|LOCUS_04980 48441 47893 gene locus_tag LOCUS_04990 gene rplE 48441 47893 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851453.1 protein_id gnl|my_center|LOCUS_04990 48679 48443 gene locus_tag LOCUS_05000 48679 48443 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779437.1 protein_id gnl|my_center|LOCUS_05000 49047 48679 gene locus_tag LOCUS_05010 gene rplN 49047 48679 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779438.1 protein_id gnl|my_center|LOCUS_05010 49301 49044 gene locus_tag LOCUS_05020 gene rpsQ 49301 49044 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851549.1 protein_id gnl|my_center|LOCUS_05020 49498 49313 gene locus_tag LOCUS_05030 gene rpmC 49498 49313 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851566.1 protein_id gnl|my_center|LOCUS_05030 49910 49485 gene locus_tag LOCUS_05040 gene rplP 49910 49485 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928961.1 protein_id gnl|my_center|LOCUS_05040 50611 49913 gene locus_tag LOCUS_05050 gene rpsC 50611 49913 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851138.1 protein_id gnl|my_center|LOCUS_05050 >Feature sequence007 694 302 gene locus_tag LOCUS_05060 694 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 1207 788 gene locus_tag LOCUS_05070 1207 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 1496 2407 gene locus_tag LOCUS_05080 gene cmoB 1496 2407 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864121.1 protein_id gnl|my_center|LOCUS_05080 2410 3657 gene locus_tag LOCUS_05090 2410 3657 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_05090 5302 3704 gene locus_tag LOCUS_05100 5302 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 6039 5335 gene locus_tag LOCUS_05110 6039 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 6353 7999 gene locus_tag LOCUS_05120 6353 7999 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_05120 8023 9414 gene locus_tag LOCUS_05130 8023 9414 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_05130 10163 9483 gene locus_tag LOCUS_05140 10163 9483 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583518.1 protein_id gnl|my_center|LOCUS_05140 10237 11586 gene locus_tag LOCUS_05150 10237 11586 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930455.1 protein_id gnl|my_center|LOCUS_05150 11863 11612 gene locus_tag LOCUS_05160 11863 11612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 13147 11867 gene locus_tag LOCUS_05170 13147 11867 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851494.1 protein_id gnl|my_center|LOCUS_05170 13480 14358 gene locus_tag LOCUS_05180 13480 14358 CDS product DnaJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045822.1 protein_id gnl|my_center|LOCUS_05180 14360 14725 gene locus_tag LOCUS_05190 gene hspR 14360 14725 CDS product heat shock transcriptional regulator HspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853230.1 protein_id gnl|my_center|LOCUS_05190 15883 14738 gene locus_tag LOCUS_05200 gene ftsZ 15883 14738 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852071.1 protein_id gnl|my_center|LOCUS_05200 17250 15883 gene locus_tag LOCUS_05210 gene ftsA 17250 15883 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891881.1 protein_id gnl|my_center|LOCUS_05210 18599 17253 gene locus_tag LOCUS_05220 18599 17253 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852128.1 protein_id gnl|my_center|LOCUS_05220 20350 18857 gene locus_tag LOCUS_05230 20350 18857 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108558166.1 protein_id gnl|my_center|LOCUS_05230 20503 21120 gene locus_tag LOCUS_05240 gene recO 20503 21120 CDS product recombination protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851895.1 protein_id gnl|my_center|LOCUS_05240 21320 21862 gene locus_tag LOCUS_05250 21320 21862 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_05250 21869 22468 gene locus_tag LOCUS_05260 21869 22468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 22770 22558 gene locus_tag LOCUS_05270 22770 22558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 23896 22841 gene locus_tag LOCUS_05280 gene rseP 23896 22841 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002934663.1 protein_id gnl|my_center|LOCUS_05280 24472 23906 gene locus_tag LOCUS_05290 gene pgsA 24472 23906 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002812871.1 protein_id gnl|my_center|LOCUS_05290 25242 24472 gene locus_tag LOCUS_05300 25242 24472 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891889.1 protein_id gnl|my_center|LOCUS_05300 26969 25323 gene locus_tag LOCUS_05310 26969 25323 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864855.1 protein_id gnl|my_center|LOCUS_05310 27054 28346 gene locus_tag LOCUS_05320 27054 28346 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860275.1 protein_id gnl|my_center|LOCUS_05320 28442 29491 gene locus_tag LOCUS_05330 28442 29491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 29573 29725 gene locus_tag LOCUS_05340 29573 29725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 30011 29754 gene locus_tag LOCUS_05350 30011 29754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 30120 30857 gene locus_tag LOCUS_05360 30120 30857 CDS product DUF3944 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323695.1 protein_id gnl|my_center|LOCUS_05360 31587 31036 gene locus_tag LOCUS_05370 gene maf 31587 31036 CDS product septum formation inhibitor Maf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420308.1 protein_id gnl|my_center|LOCUS_05370 32591 31599 gene locus_tag LOCUS_05380 gene pta 32591 31599 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_05380 32968 32618 gene locus_tag LOCUS_05390 32968 32618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 33130 33825 gene locus_tag LOCUS_05400 33130 33825 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 protein_id gnl|my_center|LOCUS_05400 33840 34760 gene locus_tag LOCUS_05410 33840 34760 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462366.1 protein_id gnl|my_center|LOCUS_05410 35685 34828 gene locus_tag LOCUS_05420 35685 34828 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684417.1 protein_id gnl|my_center|LOCUS_05420 35830 37782 gene locus_tag LOCUS_05430 35830 37782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 37775 38362 gene locus_tag LOCUS_05440 37775 38362 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941339.1 protein_id gnl|my_center|LOCUS_05440 38954 38367 gene locus_tag LOCUS_05450 38954 38367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 39108 39467 gene locus_tag LOCUS_05460 39108 39467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 39544 40701 gene locus_tag LOCUS_05470 39544 40701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384854.1 protein_id gnl|my_center|LOCUS_05470 40716 41021 gene locus_tag LOCUS_05480 40716 41021 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643490.1 protein_id gnl|my_center|LOCUS_05480 41229 41825 gene locus_tag LOCUS_05490 41229 41825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552477.1 protein_id gnl|my_center|LOCUS_05490 41827 42180 gene locus_tag LOCUS_05500 41827 42180 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760150.1 protein_id gnl|my_center|LOCUS_05500 43192 42185 gene locus_tag LOCUS_05510 43192 42185 CDS product YhdH/YhfP family quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016968.1 protein_id gnl|my_center|LOCUS_05510 44562 43180 gene locus_tag LOCUS_05520 44562 43180 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963764.1 protein_id gnl|my_center|LOCUS_05520 44945 44808 gene locus_tag LOCUS_05530 44945 44808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 45111 45035 gene locus_tag LOCUS_t00030 45111 45035 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 45243 45169 gene locus_tag LOCUS_t00040 45243 45169 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 45348 45272 gene locus_tag LOCUS_t00050 45348 45272 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 45428 45354 gene locus_tag LOCUS_t00060 45428 45354 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 45554 46582 gene locus_tag LOCUS_05540 45554 46582 CDS product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601458.1 protein_id gnl|my_center|LOCUS_05540 46584 47540 gene locus_tag LOCUS_05550 46584 47540 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852619.1 protein_id gnl|my_center|LOCUS_05550 47540 48187 gene locus_tag LOCUS_05560 47540 48187 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964303.1 protein_id gnl|my_center|LOCUS_05560 48401 49192 gene locus_tag LOCUS_05570 48401 49192 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948751.1 protein_id gnl|my_center|LOCUS_05570 <50188 49236 gene locus_tag LOCUS_05580 <50188 49236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010874471.1:choline/carnitine O-acyltransferase >Feature sequence008 475 1026 gene locus_tag LOCUS_05590 475 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 1004 1528 gene locus_tag LOCUS_05600 1004 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 2722 1532 gene locus_tag LOCUS_05610 2722 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 3459 2869 gene locus_tag LOCUS_05620 3459 2869 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207872.1 protein_id gnl|my_center|LOCUS_05620 3535 4371 gene locus_tag LOCUS_05630 3535 4371 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151652833.1 protein_id gnl|my_center|LOCUS_05630 4422 6209 gene locus_tag LOCUS_05640 4422 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 7853 6279 gene locus_tag LOCUS_05650 7853 6279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 9338 7857 gene locus_tag LOCUS_05660 9338 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 10801 9374 gene locus_tag LOCUS_05670 gene lpdA 10801 9374 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479684.1 protein_id gnl|my_center|LOCUS_05670 12508 10811 gene locus_tag LOCUS_05680 gene aceF 12508 10811 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070783.1 protein_id gnl|my_center|LOCUS_05680 15185 12519 gene locus_tag LOCUS_05690 gene aceE 15185 12519 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070782.1 protein_id gnl|my_center|LOCUS_05690 15510 16187 gene locus_tag LOCUS_05700 15510 16187 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941047.1 protein_id gnl|my_center|LOCUS_05700 16171 17079 gene locus_tag LOCUS_05710 gene lipA 16171 17079 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941048.1 protein_id gnl|my_center|LOCUS_05710 17146 17919 gene locus_tag LOCUS_05720 gene dapB 17146 17919 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851754.1 protein_id gnl|my_center|LOCUS_05720 17921 19273 gene locus_tag LOCUS_05730 gene purF 17921 19273 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851896.1 protein_id gnl|my_center|LOCUS_05730 19333 20601 gene locus_tag LOCUS_05740 19333 20601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 20622 21269 gene locus_tag LOCUS_05750 20622 21269 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612425.1 protein_id gnl|my_center|LOCUS_05750 21304 22227 gene locus_tag LOCUS_05760 21304 22227 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251148.1 protein_id gnl|my_center|LOCUS_05760 23762 22224 gene locus_tag LOCUS_05770 23762 22224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 26338 23780 gene locus_tag LOCUS_05780 gene alaS 26338 23780 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858583.1 protein_id gnl|my_center|LOCUS_05780 26476 26793 gene locus_tag LOCUS_05790 gene trxA 26476 26793 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851800.1 protein_id gnl|my_center|LOCUS_05790 26889 27221 gene locus_tag LOCUS_05800 26889 27221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 27235 28614 gene locus_tag LOCUS_05810 27235 28614 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678947.1 protein_id gnl|my_center|LOCUS_05810 28757 28833 gene locus_tag LOCUS_t00070 28757 28833 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 28871 28947 gene locus_tag LOCUS_t00080 28871 28947 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 28966 29042 gene locus_tag LOCUS_t00090 28966 29042 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 29075 29159 gene locus_tag LOCUS_t00100 29075 29159 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 29242 29317 gene locus_tag LOCUS_t00110 29242 29317 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 29519 29331 gene locus_tag LOCUS_05820 29519 29331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 30530 29535 gene locus_tag LOCUS_05830 gene tsaD 30530 29535 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603684.1 protein_id gnl|my_center|LOCUS_05830 30697 31104 gene locus_tag LOCUS_05840 30697 31104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 31101 31622 gene locus_tag LOCUS_05850 31101 31622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 31673 32782 gene locus_tag LOCUS_05860 31673 32782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 33522 32935 gene locus_tag LOCUS_05870 33522 32935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 33715 34101 gene locus_tag LOCUS_05880 33715 34101 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853400.1 protein_id gnl|my_center|LOCUS_05880 34125 35156 gene locus_tag LOCUS_05890 gene aroB 34125 35156 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852978.1 protein_id gnl|my_center|LOCUS_05890 35156 36790 gene locus_tag LOCUS_05900 35156 36790 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852957.1 protein_id gnl|my_center|LOCUS_05900 36802 38070 gene locus_tag LOCUS_05910 gene mtaB 36802 38070 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858158.1 protein_id gnl|my_center|LOCUS_05910 38054 39541 gene locus_tag LOCUS_05920 38054 39541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 39531 40031 gene locus_tag LOCUS_05930 gene bioV 39531 40031 CDS product pimelyl-ACP methyl ester esterase BioV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210594.1 protein_id gnl|my_center|LOCUS_05930 40028 40567 gene locus_tag LOCUS_05940 gene mog 40028 40567 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070478.1 protein_id gnl|my_center|LOCUS_05940 40580 42778 gene locus_tag LOCUS_05950 40580 42778 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891903.1 protein_id gnl|my_center|LOCUS_05950 42775 43257 gene locus_tag LOCUS_05960 42775 43257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 >Feature sequence009 6017 8239 gene locus_tag LOCUS_05970 gene pfeA 6017 8239 CDS product siderophore enterobactin receptor PfeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113404.1 protein_id gnl|my_center|LOCUS_05970 8667 9173 gene locus_tag LOCUS_05980 8667 9173 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858699.1 protein_id gnl|my_center|LOCUS_05980 9387 10190 gene locus_tag LOCUS_05990 9387 10190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 10187 10810 gene locus_tag LOCUS_06000 gene grpE 10187 10810 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650844.1 protein_id gnl|my_center|LOCUS_06000 11013 12905 gene locus_tag LOCUS_06010 gene dnaK 11013 12905 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521014.1 protein_id gnl|my_center|LOCUS_06010 14885 13233 gene locus_tag LOCUS_06020 14885 13233 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202721.1 protein_id gnl|my_center|LOCUS_06020 15199 14885 gene locus_tag LOCUS_06030 15199 14885 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039127.1 protein_id gnl|my_center|LOCUS_06030 15711 17069 gene locus_tag LOCUS_06040 15711 17069 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249879.1 protein_id gnl|my_center|LOCUS_06040 17087 17416 gene locus_tag LOCUS_06050 17087 17416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 17488 18954 gene locus_tag LOCUS_06060 17488 18954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 18964 19443 gene locus_tag LOCUS_06070 18964 19443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 19928 19458 gene locus_tag LOCUS_06080 19928 19458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 20008 20394 gene locus_tag LOCUS_06090 20008 20394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 20480 21307 gene locus_tag LOCUS_06100 20480 21307 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_06100 21307 23133 gene locus_tag LOCUS_06110 21307 23133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 23111 24628 gene locus_tag LOCUS_06120 23111 24628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 24760 25188 gene locus_tag LOCUS_06130 24760 25188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 25188 25607 gene locus_tag LOCUS_06140 25188 25607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 25604 26356 gene locus_tag LOCUS_06150 25604 26356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 26353 27063 gene locus_tag LOCUS_06160 26353 27063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 27119 28249 gene locus_tag LOCUS_06170 27119 28249 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858477.1 protein_id gnl|my_center|LOCUS_06170 28298 28381 gene locus_tag LOCUS_t00120 28298 28381 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 31395 28438 gene locus_tag LOCUS_06180 gene mutS 31395 28438 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494923.1 protein_id gnl|my_center|LOCUS_06180 31739 31392 gene locus_tag LOCUS_06190 31739 31392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 32049 31732 gene locus_tag LOCUS_06200 32049 31732 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545356.1 protein_id gnl|my_center|LOCUS_06200 32220 32963 gene locus_tag LOCUS_06210 32220 32963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 33340 34776 gene locus_tag LOCUS_06220 gene sufB 33340 34776 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772922.1 protein_id gnl|my_center|LOCUS_06220 34786 35547 gene locus_tag LOCUS_06230 gene sufC 34786 35547 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037895.1 protein_id gnl|my_center|LOCUS_06230 35534 36304 gene locus_tag LOCUS_06240 35534 36304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 36301 37503 gene locus_tag LOCUS_06250 36301 37503 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958175.1 protein_id gnl|my_center|LOCUS_06250 37507 37917 gene locus_tag LOCUS_06260 37507 37917 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_06260 37910 38269 gene locus_tag LOCUS_06270 37910 38269 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_06270 39295 38276 gene locus_tag LOCUS_06280 gene murG 39295 38276 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856115.1 protein_id gnl|my_center|LOCUS_06280 41248 39296 gene locus_tag LOCUS_06290 41248 39296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 >Feature sequence010 931 1554 gene locus_tag LOCUS_06300 gene plsY 931 1554 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854681.1 protein_id gnl|my_center|LOCUS_06300 1547 1885 gene locus_tag LOCUS_06310 1547 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 2508 1882 gene locus_tag LOCUS_06320 2508 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 2900 2520 gene locus_tag LOCUS_06330 gene queF 2900 2520 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002834281.1 protein_id gnl|my_center|LOCUS_06330 2988 4628 gene locus_tag LOCUS_06340 2988 4628 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853239.1 protein_id gnl|my_center|LOCUS_06340 4615 4911 gene locus_tag LOCUS_06350 4615 4911 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852892.1 protein_id gnl|my_center|LOCUS_06350 4915 7158 gene locus_tag LOCUS_06360 gene clpA 4915 7158 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420182.1 protein_id gnl|my_center|LOCUS_06360 8852 7215 gene locus_tag LOCUS_06370 gene groL 8852 7215 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858047.1 protein_id gnl|my_center|LOCUS_06370 9127 8852 gene locus_tag LOCUS_06380 gene groES 9127 8852 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002825273.1 protein_id gnl|my_center|LOCUS_06380 10608 9259 gene locus_tag LOCUS_06390 gene radA 10608 9259 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858434.1 protein_id gnl|my_center|LOCUS_06390 10806 11348 gene locus_tag LOCUS_06400 gene raiA 10806 11348 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671185.1 protein_id gnl|my_center|LOCUS_06400 11541 13514 gene locus_tag LOCUS_06410 gene uvrB 11541 13514 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855027.1 protein_id gnl|my_center|LOCUS_06410 14783 13539 gene locus_tag LOCUS_06420 gene serS 14783 13539 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858681.1 protein_id gnl|my_center|LOCUS_06420 15385 14792 gene locus_tag LOCUS_06430 15385 14792 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358891.1 protein_id gnl|my_center|LOCUS_06430 15440 16405 gene locus_tag LOCUS_06440 gene trpS 15440 16405 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858719.1 protein_id gnl|my_center|LOCUS_06440 16688 16419 gene locus_tag LOCUS_06450 16688 16419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 17020 16664 gene locus_tag LOCUS_06460 gene fliS 17020 16664 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199081.1 protein_id gnl|my_center|LOCUS_06460 18422 17088 gene locus_tag LOCUS_06470 gene fliD 18422 17088 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816592.1 protein_id gnl|my_center|LOCUS_06470 20718 18448 gene locus_tag LOCUS_06480 20718 18448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 21477 20773 gene locus_tag LOCUS_06490 gene flgH 21477 20773 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864738.1 protein_id gnl|my_center|LOCUS_06490 21889 21467 gene locus_tag LOCUS_06500 21889 21467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 22451 21906 gene locus_tag LOCUS_06510 22451 21906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 22947 22453 gene locus_tag LOCUS_06520 22947 22453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 23362 22937 gene locus_tag LOCUS_06530 23362 22937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 23625 23359 gene locus_tag LOCUS_06540 gene fliQ 23625 23359 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851290.1 protein_id gnl|my_center|LOCUS_06540 23953 23627 gene locus_tag LOCUS_06550 23953 23627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 24387 23953 gene locus_tag LOCUS_06560 24387 23953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 24491 25549 gene locus_tag LOCUS_06570 24491 25549 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832067.1 protein_id gnl|my_center|LOCUS_06570 25551 26651 gene locus_tag LOCUS_06580 gene fliM 25551 26651 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851710.1 protein_id gnl|my_center|LOCUS_06580 26722 27819 gene locus_tag LOCUS_06590 26722 27819 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924085.1 protein_id gnl|my_center|LOCUS_06590 27822 28667 gene locus_tag LOCUS_06600 27822 28667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 28672 29925 gene locus_tag LOCUS_06610 28672 29925 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851458.1 protein_id gnl|my_center|LOCUS_06610 29938 30489 gene locus_tag LOCUS_06620 29938 30489 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237418.1 protein_id gnl|my_center|LOCUS_06620 30501 31622 gene locus_tag LOCUS_06630 gene carA 30501 31622 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851156.1 protein_id gnl|my_center|LOCUS_06630 32169 31666 gene locus_tag LOCUS_06640 32169 31666 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001873572.1 protein_id gnl|my_center|LOCUS_06640 33215 32184 gene locus_tag LOCUS_06650 33215 32184 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198982.1 protein_id gnl|my_center|LOCUS_06650 34424 33228 gene locus_tag LOCUS_06660 34424 33228 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891932.1 protein_id gnl|my_center|LOCUS_06660 37775 34551 gene locus_tag LOCUS_06670 37775 34551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 38221 39369 gene locus_tag LOCUS_06680 38221 39369 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220815.1 protein_id gnl|my_center|LOCUS_06680 >Feature sequence011 2414 2067 gene locus_tag LOCUS_06690 2414 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 2754 2404 gene locus_tag LOCUS_06700 2754 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 2965 2744 gene locus_tag LOCUS_06710 2965 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 3695 2967 gene locus_tag LOCUS_06720 3695 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 4013 3696 gene locus_tag LOCUS_06730 4013 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 6235 4073 gene locus_tag LOCUS_06740 gene ctpC 6235 4073 CDS product manganese-exporting P-type ATPase CtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899995.1 protein_id gnl|my_center|LOCUS_06740 6689 6237 gene locus_tag LOCUS_06750 6689 6237 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854230.1 protein_id gnl|my_center|LOCUS_06750 6917 7663 gene locus_tag LOCUS_06760 6917 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 7665 8981 gene locus_tag LOCUS_06770 7665 8981 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_06770 8983 9501 gene locus_tag LOCUS_06780 8983 9501 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263603.1 protein_id gnl|my_center|LOCUS_06780 9502 9906 gene locus_tag LOCUS_06790 9502 9906 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_06790 9908 10537 gene locus_tag LOCUS_06800 9908 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 10534 11703 gene locus_tag LOCUS_06810 10534 11703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 13008 11758 gene locus_tag LOCUS_06820 13008 11758 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973796.1 protein_id gnl|my_center|LOCUS_06820 13754 13008 gene locus_tag LOCUS_06830 13754 13008 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973817.1 protein_id gnl|my_center|LOCUS_06830 14524 13742 gene locus_tag LOCUS_06840 14524 13742 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973816.1 protein_id gnl|my_center|LOCUS_06840 15595 14621 gene locus_tag LOCUS_06850 15595 14621 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681111.1 protein_id gnl|my_center|LOCUS_06850 15927 15607 gene locus_tag LOCUS_06860 15927 15607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 16274 16080 gene locus_tag LOCUS_06870 16274 16080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 16784 16284 gene locus_tag LOCUS_06880 16784 16284 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933399.1 protein_id gnl|my_center|LOCUS_06880 17199 16756 gene locus_tag LOCUS_06890 17199 16756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 17481 18239 gene locus_tag LOCUS_06900 17481 18239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 18250 19863 gene locus_tag LOCUS_06910 18250 19863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 19968 20207 gene locus_tag LOCUS_06920 19968 20207 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023401.1 protein_id gnl|my_center|LOCUS_06920 20204 22681 gene locus_tag LOCUS_06930 20204 22681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 22730 23032 gene locus_tag LOCUS_06940 22730 23032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674683.1 protein_id gnl|my_center|LOCUS_06940 23103 23900 gene locus_tag LOCUS_06950 23103 23900 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679851.1 protein_id gnl|my_center|LOCUS_06950 25012 23990 gene locus_tag LOCUS_06960 25012 23990 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677174.1 protein_id gnl|my_center|LOCUS_06960 25497 25021 gene locus_tag LOCUS_06970 gene aroQ 25497 25021 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852001.1 protein_id gnl|my_center|LOCUS_06970 25562 26794 gene locus_tag LOCUS_06980 25562 26794 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851913.1 protein_id gnl|my_center|LOCUS_06980 26778 27647 gene locus_tag LOCUS_06990 gene sppA 26778 27647 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851869.1 protein_id gnl|my_center|LOCUS_06990 27666 28718 gene locus_tag LOCUS_07000 gene mqnE 27666 28718 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858079.1 protein_id gnl|my_center|LOCUS_07000 28896 29573 gene locus_tag LOCUS_07010 gene rnc 28896 29573 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851153.1 protein_id gnl|my_center|LOCUS_07010 29573 30646 gene locus_tag LOCUS_07020 gene aroC 29573 30646 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851463.1 protein_id gnl|my_center|LOCUS_07020 30731 32548 gene locus_tag LOCUS_07030 gene thrS 30731 32548 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858701.1 protein_id gnl|my_center|LOCUS_07030 32545 33087 gene locus_tag LOCUS_07040 gene infC 32545 33087 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851726.1 protein_id gnl|my_center|LOCUS_07040 33755 33123 gene locus_tag LOCUS_07050 33755 33123 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851887.1 protein_id gnl|my_center|LOCUS_07050 34004 35377 gene locus_tag LOCUS_07060 gene rho 34004 35377 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004715.1 protein_id gnl|my_center|LOCUS_07060 35381 35854 gene locus_tag LOCUS_07070 35381 35854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 35873 36619 gene locus_tag LOCUS_07080 gene murI 35873 36619 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851499.1 protein_id gnl|my_center|LOCUS_07080 36619 38319 gene locus_tag LOCUS_07090 36619 38319 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891914.1 protein_id gnl|my_center|LOCUS_07090 >Feature sequence012 173 775 gene locus_tag LOCUS_07100 173 775 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880222.1 protein_id gnl|my_center|LOCUS_07100 772 1569 gene locus_tag LOCUS_07110 gene surE 772 1569 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722451.1 protein_id gnl|my_center|LOCUS_07110 1562 1822 gene locus_tag LOCUS_07120 1562 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 1822 2958 gene locus_tag LOCUS_07130 1822 2958 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947710.1 protein_id gnl|my_center|LOCUS_07130 2965 3777 gene locus_tag LOCUS_07140 2965 3777 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852452.1 protein_id gnl|my_center|LOCUS_07140 3842 5431 gene locus_tag LOCUS_07150 3842 5431 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942070.1 protein_id gnl|my_center|LOCUS_07150 5433 5717 gene locus_tag LOCUS_07160 5433 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 5786 5974 gene locus_tag LOCUS_07170 gene rpmB 5786 5974 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854974.1 protein_id gnl|my_center|LOCUS_07170 5993 7150 gene locus_tag LOCUS_07180 5993 7150 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461981.1 protein_id gnl|my_center|LOCUS_07180 7143 8324 gene locus_tag LOCUS_07190 gene argJ 7143 8324 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989754.1 protein_id gnl|my_center|LOCUS_07190 8331 8726 gene locus_tag LOCUS_07200 8331 8726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 8713 11001 gene locus_tag LOCUS_07210 8713 11001 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434402.1 protein_id gnl|my_center|LOCUS_07210 11177 11617 gene locus_tag LOCUS_07220 11177 11617 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932687.1 protein_id gnl|my_center|LOCUS_07220 11693 11914 gene locus_tag LOCUS_07230 11693 11914 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857949.1 protein_id gnl|my_center|LOCUS_07230 11918 12370 gene locus_tag LOCUS_07240 11918 12370 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781229.1 protein_id gnl|my_center|LOCUS_07240 12381 13166 gene locus_tag LOCUS_07250 12381 13166 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_07250 13305 14663 gene locus_tag LOCUS_07260 gene ffh 13305 14663 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852163.1 protein_id gnl|my_center|LOCUS_07260 14762 14992 gene locus_tag LOCUS_07270 gene rpsP 14762 14992 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216125.1 protein_id gnl|my_center|LOCUS_07270 14998 15237 gene locus_tag LOCUS_07280 14998 15237 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852144.1 protein_id gnl|my_center|LOCUS_07280 15237 15761 gene locus_tag LOCUS_07290 gene rimM 15237 15761 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293716.1 protein_id gnl|my_center|LOCUS_07290 16033 16635 gene locus_tag LOCUS_07300 16033 16635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 16635 16862 gene locus_tag LOCUS_07310 16635 16862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 16866 17909 gene locus_tag LOCUS_07320 16866 17909 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073986.1 protein_id gnl|my_center|LOCUS_07320 17911 21015 gene locus_tag LOCUS_07330 17911 21015 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_07330 21012 22247 gene locus_tag LOCUS_07340 21012 22247 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933015.1 protein_id gnl|my_center|LOCUS_07340 22365 23378 gene locus_tag LOCUS_07350 gene pyrC 22365 23378 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852008.1 protein_id gnl|my_center|LOCUS_07350 25114 23426 gene locus_tag LOCUS_07360 gene ilvD 25114 23426 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853088.1 protein_id gnl|my_center|LOCUS_07360 25226 26539 gene locus_tag LOCUS_07370 gene murJ 25226 26539 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611242.1 protein_id gnl|my_center|LOCUS_07370 26611 26856 gene locus_tag LOCUS_07380 26611 26856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 26859 27161 gene locus_tag LOCUS_07390 26859 27161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 27162 29123 gene locus_tag LOCUS_07400 gene ligA 27162 29123 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852062.1 protein_id gnl|my_center|LOCUS_07400 29367 29443 gene locus_tag LOCUS_t00130 29367 29443 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 30633 29533 gene locus_tag LOCUS_07410 30633 29533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 30871 30623 gene locus_tag LOCUS_07420 30871 30623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 31115 30876 gene locus_tag LOCUS_07430 31115 30876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 31320 31105 gene locus_tag LOCUS_07440 31320 31105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 31562 31410 gene locus_tag LOCUS_07450 31562 31410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 32591 31608 gene locus_tag LOCUS_07460 32591 31608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 32782 33327 gene locus_tag LOCUS_07470 32782 33327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 33376 33642 gene locus_tag LOCUS_07480 33376 33642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 33639 33905 gene locus_tag LOCUS_07490 33639 33905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 33905 34528 gene locus_tag LOCUS_07500 33905 34528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 35076 34651 gene locus_tag LOCUS_07510 35076 34651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 35299 35069 gene locus_tag LOCUS_07520 35299 35069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 >Feature sequence013 124 396 gene locus_tag LOCUS_07530 124 396 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939104.1 protein_id gnl|my_center|LOCUS_07530 673 449 gene locus_tag LOCUS_07540 673 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 3063 673 gene locus_tag LOCUS_07550 3063 673 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891913.1 protein_id gnl|my_center|LOCUS_07550 3179 3051 gene locus_tag LOCUS_07560 3179 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 3244 4863 gene locus_tag LOCUS_07570 3244 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 5490 4867 gene locus_tag LOCUS_07580 gene gmk 5490 4867 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551230.1 protein_id gnl|my_center|LOCUS_07580 6277 5483 gene locus_tag LOCUS_07590 6277 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 6994 6314 gene locus_tag LOCUS_07600 6994 6314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891917.1 protein_id gnl|my_center|LOCUS_07600 8065 7016 gene locus_tag LOCUS_07610 gene tsf 8065 7016 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864836.1 protein_id gnl|my_center|LOCUS_07610 8874 8068 gene locus_tag LOCUS_07620 gene rpsB 8874 8068 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002892710.1 protein_id gnl|my_center|LOCUS_07620 9752 9039 gene locus_tag LOCUS_07630 gene hisA 9752 9039 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207860.1 protein_id gnl|my_center|LOCUS_07630 10101 10259 gene locus_tag LOCUS_07640 10101 10259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 10272 10514 gene locus_tag LOCUS_07650 10272 10514 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809228.1 protein_id gnl|my_center|LOCUS_07650 11854 10652 gene locus_tag LOCUS_07660 11854 10652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 12509 11901 gene locus_tag LOCUS_07670 gene hisH 12509 11901 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_07670 13230 12658 gene locus_tag LOCUS_07680 13230 12658 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852959.1 protein_id gnl|my_center|LOCUS_07680 14916 13240 gene locus_tag LOCUS_07690 14916 13240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07690 16459 14918 gene locus_tag LOCUS_07700 16459 14918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07700 17228 16464 gene locus_tag LOCUS_07710 17228 16464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 18583 17225 gene locus_tag LOCUS_07720 18583 17225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 19949 18630 gene locus_tag LOCUS_07730 gene rimO 19949 18630 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851299.1 protein_id gnl|my_center|LOCUS_07730 20070 20312 gene locus_tag LOCUS_07740 20070 20312 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780038.1 protein_id gnl|my_center|LOCUS_07740 20325 21677 gene locus_tag LOCUS_07750 gene miaB 20325 21677 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858634.1 protein_id gnl|my_center|LOCUS_07750 21664 22308 gene locus_tag LOCUS_07760 21664 22308 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867614.1 protein_id gnl|my_center|LOCUS_07760 22363 23997 gene locus_tag LOCUS_07770 22363 23997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 24958 23987 gene locus_tag LOCUS_07780 gene tilS 24958 23987 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851521.1 protein_id gnl|my_center|LOCUS_07780 25093 26472 gene locus_tag LOCUS_07790 gene ccoG 25093 26472 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858753.1 protein_id gnl|my_center|LOCUS_07790 26540 27055 gene locus_tag LOCUS_07800 gene luxS 26540 27055 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857890.1 protein_id gnl|my_center|LOCUS_07800 27163 27795 gene locus_tag LOCUS_07810 27163 27795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 29608 27797 gene locus_tag LOCUS_07820 29608 27797 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370329.1 protein_id gnl|my_center|LOCUS_07820 29648 30862 gene locus_tag LOCUS_07830 29648 30862 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611797.1 protein_id gnl|my_center|LOCUS_07830 31583 31086 gene locus_tag LOCUS_07840 31583 31086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 >Feature sequence014 <1 1235 gene locus_tag LOCUS_07850 <1 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529849.1:VCBS domain-containing protein 1195 1371 gene locus_tag LOCUS_07860 1195 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1346 11287 gene locus_tag LOCUS_07870 1346 11287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 11324 12118 gene locus_tag LOCUS_07880 11324 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 12201 12806 gene locus_tag LOCUS_07890 12201 12806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 13513 12803 gene locus_tag LOCUS_07900 13513 12803 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_07900 13603 14247 gene locus_tag LOCUS_07910 13603 14247 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263954.1 protein_id gnl|my_center|LOCUS_07910 14281 16479 gene locus_tag LOCUS_07920 14281 16479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 16554 18062 gene locus_tag LOCUS_07930 16554 18062 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460991.1 protein_id gnl|my_center|LOCUS_07930 18062 20200 gene locus_tag LOCUS_07940 18062 20200 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154355.1 protein_id gnl|my_center|LOCUS_07940 20205 21548 gene locus_tag LOCUS_07950 20205 21548 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_07950 21538 22662 gene locus_tag LOCUS_07960 21538 22662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 22683 23366 gene locus_tag LOCUS_07970 22683 23366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 24071 23397 gene locus_tag LOCUS_07980 24071 23397 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263211.1 protein_id gnl|my_center|LOCUS_07980 25407 24097 gene locus_tag LOCUS_07990 gene glmU 25407 24097 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862579.1 protein_id gnl|my_center|LOCUS_07990 27058 25463 gene locus_tag LOCUS_08000 27058 25463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 27104 28225 gene locus_tag LOCUS_08010 gene trmA 27104 28225 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206575.1 protein_id gnl|my_center|LOCUS_08010 29722 28538 gene locus_tag LOCUS_08020 29722 28538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 >Feature sequence015 328 1536 gene locus_tag LOCUS_08030 gene lysA 328 1536 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858733.1 protein_id gnl|my_center|LOCUS_08030 1548 2615 gene locus_tag LOCUS_08040 gene pheA 1548 2615 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858741.1 protein_id gnl|my_center|LOCUS_08040 2624 3730 gene locus_tag LOCUS_08050 gene hisC 2624 3730 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858650.1 protein_id gnl|my_center|LOCUS_08050 3731 5029 gene locus_tag LOCUS_08060 3731 5029 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505472.1 protein_id gnl|my_center|LOCUS_08060 5041 5496 gene locus_tag LOCUS_08070 5041 5496 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852389.1 protein_id gnl|my_center|LOCUS_08070 5498 7300 gene locus_tag LOCUS_08080 gene dxs 5498 7300 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180373797.1 protein_id gnl|my_center|LOCUS_08080 8238 7363 gene locus_tag LOCUS_08090 8238 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 9077 8304 gene locus_tag LOCUS_08100 gene mqnP 9077 8304 CDS product menaquinone biosynthesis prenyltransferase MqnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913938.1 protein_id gnl|my_center|LOCUS_08100 9315 10238 gene locus_tag LOCUS_08110 9315 10238 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483126.1 protein_id gnl|my_center|LOCUS_08110 10296 10664 gene locus_tag LOCUS_08120 10296 10664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 10780 11694 gene locus_tag LOCUS_08130 10780 11694 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483126.1 protein_id gnl|my_center|LOCUS_08130 11793 12293 gene locus_tag LOCUS_08140 11793 12293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 12417 14300 gene locus_tag LOCUS_08150 12417 14300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 14297 15205 gene locus_tag LOCUS_08160 14297 15205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 15206 16096 gene locus_tag LOCUS_08170 gene miaA 15206 16096 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851982.1 protein_id gnl|my_center|LOCUS_08170 16305 16102 gene locus_tag LOCUS_08180 16305 16102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 16245 16634 gene locus_tag LOCUS_08190 16245 16634 CDS product NAD(P)H-quinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183543.1 protein_id gnl|my_center|LOCUS_08190 16616 17125 gene locus_tag LOCUS_08200 16616 17125 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183511.1 protein_id gnl|my_center|LOCUS_08200 17126 17947 gene locus_tag LOCUS_08210 17126 17947 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864416.1 protein_id gnl|my_center|LOCUS_08210 17949 19175 gene locus_tag LOCUS_08220 gene nuoD 17949 19175 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068242.1 protein_id gnl|my_center|LOCUS_08220 19175 19444 gene locus_tag LOCUS_08230 19175 19444 CDS product NADH-ubiquinone oxidoreductase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819168.1 protein_id gnl|my_center|LOCUS_08230 19468 20286 gene locus_tag LOCUS_08240 19468 20286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 20286 22640 gene locus_tag LOCUS_08250 20286 22640 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891945.1 protein_id gnl|my_center|LOCUS_08250 22644 23603 gene locus_tag LOCUS_08260 gene nuoH 22644 23603 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277308.1 protein_id gnl|my_center|LOCUS_08260 23613 24236 gene locus_tag LOCUS_08270 gene nuoI 23613 24236 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851456.1 protein_id gnl|my_center|LOCUS_08270 24256 24861 gene locus_tag LOCUS_08280 24256 24861 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464208.1 protein_id gnl|my_center|LOCUS_08280 24858 25172 gene locus_tag LOCUS_08290 gene nuoK 24858 25172 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579761.1 protein_id gnl|my_center|LOCUS_08290 25175 27106 gene locus_tag LOCUS_08300 gene nuoL 25175 27106 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200192.1 protein_id gnl|my_center|LOCUS_08300 27117 28646 gene locus_tag LOCUS_08310 27117 28646 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159928.1 protein_id gnl|my_center|LOCUS_08310 28643 30127 gene locus_tag LOCUS_08320 gene nuoN 28643 30127 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904307.1 protein_id gnl|my_center|LOCUS_08320 >Feature sequence016 83 8 gene locus_tag LOCUS_t00140 83 8 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 630 130 gene locus_tag LOCUS_08330 gene pncC 630 130 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209445.1 protein_id gnl|my_center|LOCUS_08330 710 3460 gene locus_tag LOCUS_08340 gene ileS 710 3460 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907389.1 protein_id gnl|my_center|LOCUS_08340 3580 3861 gene locus_tag LOCUS_08350 3580 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 3854 4444 gene locus_tag LOCUS_08360 3854 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 4428 5714 gene locus_tag LOCUS_08370 4428 5714 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865460.1 protein_id gnl|my_center|LOCUS_08370 5872 6252 gene locus_tag LOCUS_08380 gene panD 5872 6252 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142250.1 protein_id gnl|my_center|LOCUS_08380 6252 6569 gene locus_tag LOCUS_08390 6252 6569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 6559 7431 gene locus_tag LOCUS_08400 6559 7431 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851379.1 protein_id gnl|my_center|LOCUS_08400 8040 7492 gene locus_tag LOCUS_08410 8040 7492 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821257.1 protein_id gnl|my_center|LOCUS_08410 8193 9122 gene locus_tag LOCUS_08420 8193 9122 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853293.1 protein_id gnl|my_center|LOCUS_08420 9343 11133 gene locus_tag LOCUS_08430 gene lepA 9343 11133 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002837927.1 protein_id gnl|my_center|LOCUS_08430 11222 11482 gene locus_tag LOCUS_08440 11222 11482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 11479 11721 gene locus_tag LOCUS_08450 gene relE3 11479 11721 CDS product type II toxin-antitoxin system toxin RelE3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870615.1 protein_id gnl|my_center|LOCUS_08450 12979 11759 gene locus_tag LOCUS_08460 gene bioA 12979 11759 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295303.1 protein_id gnl|my_center|LOCUS_08460 13028 13423 gene locus_tag LOCUS_tm00010 13028 13423 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 13567 13722 gene locus_tag LOCUS_08470 13567 13722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 13723 14253 gene locus_tag LOCUS_08480 13723 14253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 14577 14861 gene locus_tag LOCUS_08490 14577 14861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 14848 15129 gene locus_tag LOCUS_08500 14848 15129 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080272.1 protein_id gnl|my_center|LOCUS_08500 16305 15211 gene locus_tag LOCUS_08510 gene prfB 16305 15211 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371130.1 protein_id gnl|my_center|LOCUS_08510 17006 16314 gene locus_tag LOCUS_08520 17006 16314 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894935.1 protein_id gnl|my_center|LOCUS_08520 17140 17826 gene locus_tag LOCUS_08530 17140 17826 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858390.1 protein_id gnl|my_center|LOCUS_08530 18031 19938 gene locus_tag LOCUS_08540 18031 19938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 19935 21854 gene locus_tag LOCUS_08550 19935 21854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 22283 21861 gene locus_tag LOCUS_08560 22283 21861 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_08560 22616 22296 gene locus_tag LOCUS_08570 22616 22296 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244013.1 protein_id gnl|my_center|LOCUS_08570 23975 22623 gene locus_tag LOCUS_08580 gene mgtE 23975 22623 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389748.1 protein_id gnl|my_center|LOCUS_08580 25053 23986 gene locus_tag LOCUS_08590 gene csd1 25053 23986 CDS product peptidoglycan DD-metalloendopeptidase Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231086.1 protein_id gnl|my_center|LOCUS_08590 25213 26172 gene locus_tag LOCUS_08600 gene csd6 25213 26172 CDS product cell shape-determining L,D-carboxypeptidase Csd6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757130.1 protein_id gnl|my_center|LOCUS_08600 26731 26177 gene locus_tag LOCUS_08610 26731 26177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 27165 26731 gene locus_tag LOCUS_08620 27165 26731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 27445 27176 gene locus_tag LOCUS_08630 27445 27176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 28508 27438 gene locus_tag LOCUS_08640 gene dxr 28508 27438 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864243.1 protein_id gnl|my_center|LOCUS_08640 29263 28505 gene locus_tag LOCUS_08650 29263 28505 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656886.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence017 690 55 gene locus_tag LOCUS_08660 690 55 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263502.1 protein_id gnl|my_center|LOCUS_08660 5624 750 gene locus_tag LOCUS_08670 5624 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 6677 5715 gene locus_tag LOCUS_08680 gene mutY 6677 5715 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851465.1 protein_id gnl|my_center|LOCUS_08680 9419 6678 gene locus_tag LOCUS_08690 9419 6678 CDS product RecB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864468.1 protein_id gnl|my_center|LOCUS_08690 10192 9416 gene locus_tag LOCUS_08700 10192 9416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 12608 10203 gene locus_tag LOCUS_08710 12608 10203 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891938.1 protein_id gnl|my_center|LOCUS_08710 13140 12553 gene locus_tag LOCUS_08720 13140 12553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 13771 13130 gene locus_tag LOCUS_08730 13771 13130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851454.1 protein_id gnl|my_center|LOCUS_08730 14019 13825 gene locus_tag LOCUS_08740 14019 13825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 14110 13982 gene locus_tag LOCUS_08750 14110 13982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 15253 14120 gene locus_tag LOCUS_08760 gene cydB 15253 14120 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851984.1 protein_id gnl|my_center|LOCUS_08760 16781 15255 gene locus_tag LOCUS_08770 16781 15255 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858826.1 protein_id gnl|my_center|LOCUS_08770 16996 16781 gene locus_tag LOCUS_08780 16996 16781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 17224 17484 gene locus_tag LOCUS_08790 gene rpsT 17224 17484 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851317.1 protein_id gnl|my_center|LOCUS_08790 17573 18640 gene locus_tag LOCUS_08800 gene prfA 17573 18640 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851189.1 protein_id gnl|my_center|LOCUS_08800 18772 19980 gene locus_tag LOCUS_08810 gene nusA 18772 19980 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858478.1 protein_id gnl|my_center|LOCUS_08810 19989 21404 gene locus_tag LOCUS_08820 gene cysS 19989 21404 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471359.1 protein_id gnl|my_center|LOCUS_08820 23450 21573 gene locus_tag LOCUS_08830 23450 21573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 24023 23781 gene locus_tag LOCUS_08840 24023 23781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 24915 24025 gene locus_tag LOCUS_08850 24915 24025 CDS product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851306.1 protein_id gnl|my_center|LOCUS_08850 25163 24951 gene locus_tag LOCUS_08860 25163 24951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 25838 25173 gene locus_tag LOCUS_08870 gene ccoO 25838 25173 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851187.1 protein_id gnl|my_center|LOCUS_08870 27326 25854 gene locus_tag LOCUS_08880 gene ccoN 27326 25854 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851405.1 protein_id gnl|my_center|LOCUS_08880 27562 28170 gene locus_tag LOCUS_08890 27562 28170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 28972 28187 gene locus_tag LOCUS_08900 gene hemH 28972 28187 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364269.1 protein_id gnl|my_center|LOCUS_08900 >Feature sequence018 124 435 gene locus_tag LOCUS_08910 124 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 1506 595 gene locus_tag LOCUS_08920 1506 595 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850619.1 protein_id gnl|my_center|LOCUS_08920 1760 2389 gene locus_tag LOCUS_08930 1760 2389 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021856.1 protein_id gnl|my_center|LOCUS_08930 3509 2424 gene locus_tag LOCUS_08940 3509 2424 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107381.1 protein_id gnl|my_center|LOCUS_08940 4806 3625 gene locus_tag LOCUS_08950 4806 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 4964 5533 gene locus_tag LOCUS_08960 4964 5533 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_08960 6426 5539 gene locus_tag LOCUS_08970 6426 5539 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139790.1 protein_id gnl|my_center|LOCUS_08970 7239 6448 gene locus_tag LOCUS_08980 7239 6448 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246321.1 protein_id gnl|my_center|LOCUS_08980 9014 7302 gene locus_tag LOCUS_08990 9014 7302 CDS product protein adenylyltransferase SelO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125671.1 protein_id gnl|my_center|LOCUS_08990 9243 10160 gene locus_tag LOCUS_09000 9243 10160 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263293.1 protein_id gnl|my_center|LOCUS_09000 10160 11344 gene locus_tag LOCUS_09010 10160 11344 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851486.1 protein_id gnl|my_center|LOCUS_09010 11349 12596 gene locus_tag LOCUS_09020 11349 12596 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002873165.1 protein_id gnl|my_center|LOCUS_09020 12926 12582 gene locus_tag LOCUS_09030 12926 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 14335 12971 gene locus_tag LOCUS_09040 14335 12971 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461217.1 protein_id gnl|my_center|LOCUS_09040 18772 14339 gene locus_tag LOCUS_09050 gene gltB 18772 14339 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_09050 20364 18937 gene locus_tag LOCUS_09060 gene glnA 20364 18937 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858636.1 protein_id gnl|my_center|LOCUS_09060 20521 21192 gene locus_tag LOCUS_09070 20521 21192 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888213.1 protein_id gnl|my_center|LOCUS_09070 22428 21220 gene locus_tag LOCUS_09080 22428 21220 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853329.1 protein_id gnl|my_center|LOCUS_09080 25051 22430 gene locus_tag LOCUS_09090 gene secA 25051 22430 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858134.1 protein_id gnl|my_center|LOCUS_09090 26237 25161 gene locus_tag LOCUS_09100 26237 25161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 27611 26343 gene locus_tag LOCUS_09110 27611 26343 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387846.1 protein_id gnl|my_center|LOCUS_09110 27833 28360 gene locus_tag LOCUS_09120 27833 28360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence019 <1 526 gene locus_tag LOCUS_09130 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_187598931.1:non-ribosomal peptide synthetase 1219 536 gene locus_tag LOCUS_09140 gene mubP 1219 536 CDS product mutanobactin A biosynthesis phosphopantetheinyl transferase MubP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267537.1 protein_id gnl|my_center|LOCUS_09140 2200 1301 gene locus_tag LOCUS_09150 2200 1301 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880380.1 protein_id gnl|my_center|LOCUS_09150 2369 4405 gene locus_tag LOCUS_09160 2369 4405 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891908.1 protein_id gnl|my_center|LOCUS_09160 4417 5235 gene locus_tag LOCUS_09170 gene truB 4417 5235 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891909.1 protein_id gnl|my_center|LOCUS_09170 5238 6005 gene locus_tag LOCUS_09180 5238 6005 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859130.1 protein_id gnl|my_center|LOCUS_09180 6264 6659 gene locus_tag LOCUS_09190 6264 6659 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156735.1 protein_id gnl|my_center|LOCUS_09190 6656 8311 gene locus_tag LOCUS_09200 6656 8311 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202721.1 protein_id gnl|my_center|LOCUS_09200 8396 10231 gene locus_tag LOCUS_09210 8396 10231 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086890.1 protein_id gnl|my_center|LOCUS_09210 10239 10841 gene locus_tag LOCUS_09220 10239 10841 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086891.1 protein_id gnl|my_center|LOCUS_09220 11120 11917 gene locus_tag LOCUS_09230 11120 11917 CDS product fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854660.1 protein_id gnl|my_center|LOCUS_09230 11917 13902 gene locus_tag LOCUS_09240 11917 13902 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854193.1 protein_id gnl|my_center|LOCUS_09240 13902 14633 gene locus_tag LOCUS_09250 13902 14633 CDS product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854302.1 protein_id gnl|my_center|LOCUS_09250 17547 14713 gene locus_tag LOCUS_09260 17547 14713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 17870 20458 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttaatcccctaagtcgggtcattgattataaaat 20572 22098 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttaatcccctaagtcgggtcattgattataaaat >Feature sequence020 <1 1014 gene locus_tag LOCUS_09270 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209615.1:methyl-accepting chemotaxis protein 1080 2009 gene locus_tag LOCUS_09280 1080 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 2009 3190 gene locus_tag LOCUS_09290 gene pstA 2009 3190 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864528.1 protein_id gnl|my_center|LOCUS_09290 4910 3216 gene locus_tag LOCUS_09300 4910 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 5108 5872 gene locus_tag LOCUS_09310 gene pstB 5108 5872 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_09310 5883 6545 gene locus_tag LOCUS_09320 5883 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 6565 7245 gene locus_tag LOCUS_09330 6565 7245 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963772.1 protein_id gnl|my_center|LOCUS_09330 7239 8615 gene locus_tag LOCUS_09340 7239 8615 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852536.1 protein_id gnl|my_center|LOCUS_09340 9458 8622 gene locus_tag LOCUS_09350 9458 8622 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_09350 10846 9455 gene locus_tag LOCUS_09360 10846 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 10979 11203 gene locus_tag LOCUS_09370 10979 11203 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855201.1 protein_id gnl|my_center|LOCUS_09370 11352 13928 gene locus_tag LOCUS_09380 gene gyrA 11352 13928 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857904.1 protein_id gnl|my_center|LOCUS_09380 13936 14979 gene locus_tag LOCUS_09390 13936 14979 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852931.1 protein_id gnl|my_center|LOCUS_09390 14984 15502 gene locus_tag LOCUS_09400 14984 15502 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852919.1 protein_id gnl|my_center|LOCUS_09400 15502 16563 gene locus_tag LOCUS_09410 gene hemE 15502 16563 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853233.1 protein_id gnl|my_center|LOCUS_09410 16613 17473 gene locus_tag LOCUS_09420 16613 17473 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853222.1 protein_id gnl|my_center|LOCUS_09420 17563 17637 gene locus_tag LOCUS_t00150 17563 17637 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 17785 18552 gene locus_tag LOCUS_09430 17785 18552 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851318.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence021 318 1094 gene locus_tag LOCUS_09440 318 1094 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073715.1 protein_id gnl|my_center|LOCUS_09440 1195 2988 gene locus_tag LOCUS_09450 1195 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 3936 3007 gene locus_tag LOCUS_09460 3936 3007 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969466.1 protein_id gnl|my_center|LOCUS_09460 5086 4040 gene locus_tag LOCUS_09470 5086 4040 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_09470 6014 5088 gene locus_tag LOCUS_09480 gene rimK 6014 5088 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261388.1 protein_id gnl|my_center|LOCUS_09480 6614 6195 gene locus_tag LOCUS_09490 6614 6195 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459284.1 protein_id gnl|my_center|LOCUS_09490 7867 6662 gene locus_tag LOCUS_09500 7867 6662 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235507.1 protein_id gnl|my_center|LOCUS_09500 7967 9781 gene locus_tag LOCUS_09510 7967 9781 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865770.1 protein_id gnl|my_center|LOCUS_09510 9835 10482 gene locus_tag LOCUS_09520 gene ung 9835 10482 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262567.1 protein_id gnl|my_center|LOCUS_09520 10570 11448 gene locus_tag LOCUS_09530 10570 11448 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864239.1 protein_id gnl|my_center|LOCUS_09530 12057 11485 gene locus_tag LOCUS_09540 12057 11485 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388051.1 protein_id gnl|my_center|LOCUS_09540 12901 12068 gene locus_tag LOCUS_09550 12901 12068 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885323.1 protein_id gnl|my_center|LOCUS_09550 14033 12891 gene locus_tag LOCUS_09560 14033 12891 CDS product 2-oxoglutarate synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858560.1 protein_id gnl|my_center|LOCUS_09560 14362 14033 gene locus_tag LOCUS_09570 14362 14033 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096894.1 protein_id gnl|my_center|LOCUS_09570 14867 14373 gene locus_tag LOCUS_09580 14867 14373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 14951 15373 gene locus_tag LOCUS_09590 14951 15373 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023470.1 protein_id gnl|my_center|LOCUS_09590 16314 15379 gene locus_tag LOCUS_09600 16314 15379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 >Feature sequence022 1756 140 gene locus_tag LOCUS_09610 1756 140 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853102.1 protein_id gnl|my_center|LOCUS_09610 2056 3174 gene locus_tag LOCUS_09620 2056 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 3558 3286 gene locus_tag LOCUS_09630 3558 3286 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080272.1 protein_id gnl|my_center|LOCUS_09630 3835 3548 gene locus_tag LOCUS_09640 3835 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 4668 3928 gene locus_tag LOCUS_09650 4668 3928 CDS product YaaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853346.1 protein_id gnl|my_center|LOCUS_09650 4726 5247 gene locus_tag LOCUS_09660 gene hemJ 4726 5247 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506456.1 protein_id gnl|my_center|LOCUS_09660 5263 5871 gene locus_tag LOCUS_09670 5263 5871 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461913.1 protein_id gnl|my_center|LOCUS_09670 5917 6522 gene locus_tag LOCUS_09680 5917 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 6620 7012 gene locus_tag LOCUS_09690 6620 7012 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072183.1 protein_id gnl|my_center|LOCUS_09690 7030 8445 gene locus_tag LOCUS_09700 gene gltX 7030 8445 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858284.1 protein_id gnl|my_center|LOCUS_09700 8442 8786 gene locus_tag LOCUS_09710 gene arsC 8442 8786 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072786.1 protein_id gnl|my_center|LOCUS_09710 8790 9431 gene locus_tag LOCUS_09720 8790 9431 CDS product UPF0323 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854351.1 protein_id gnl|my_center|LOCUS_09720 9435 10613 gene locus_tag LOCUS_09730 9435 10613 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858689.1 protein_id gnl|my_center|LOCUS_09730 10624 11070 gene locus_tag LOCUS_09740 10624 11070 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_09740 11051 11620 gene locus_tag LOCUS_09750 11051 11620 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477331.1 protein_id gnl|my_center|LOCUS_09750 11642 12463 gene locus_tag LOCUS_09760 11642 12463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 12548 13972 gene locus_tag LOCUS_09770 gene gatB 12548 13972 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858123.1 protein_id gnl|my_center|LOCUS_09770 13980 14876 gene locus_tag LOCUS_09780 13980 14876 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859277.1 protein_id gnl|my_center|LOCUS_09780 14892 15578 gene locus_tag LOCUS_09790 gene fetB 14892 15578 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937792.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence023 2230 701 gene locus_tag LOCUS_09800 gene rny 2230 701 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858133.1 protein_id gnl|my_center|LOCUS_09800 2787 2242 gene locus_tag LOCUS_09810 2787 2242 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002875342.1 protein_id gnl|my_center|LOCUS_09810 2843 3439 gene locus_tag LOCUS_09820 2843 3439 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858112.1 protein_id gnl|my_center|LOCUS_09820 3439 4386 gene locus_tag LOCUS_09830 gene ftsY 3439 4386 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864556.1 protein_id gnl|my_center|LOCUS_09830 4941 4537 gene locus_tag LOCUS_09840 4941 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 6190 4997 gene locus_tag LOCUS_09850 6190 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 6304 6585 gene locus_tag LOCUS_09860 6304 6585 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859562.1 protein_id gnl|my_center|LOCUS_09860 6912 9344 gene locus_tag LOCUS_09870 gene topA 6912 9344 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765309.1 protein_id gnl|my_center|LOCUS_09870 9556 10689 gene locus_tag LOCUS_09880 9556 10689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 >Feature sequence024 308 757 gene locus_tag LOCUS_09890 308 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 985 2676 gene locus_tag LOCUS_09900 985 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 2696 2947 gene locus_tag LOCUS_09910 2696 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 3179 4420 gene locus_tag LOCUS_09920 3179 4420 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852200.1 protein_id gnl|my_center|LOCUS_09920 4513 6414 gene locus_tag LOCUS_09930 4513 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 7448 6411 gene locus_tag LOCUS_09940 gene queA 7448 6411 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852279.1 protein_id gnl|my_center|LOCUS_09940 8187 7435 gene locus_tag LOCUS_09950 gene tatC 8187 7435 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852171.1 protein_id gnl|my_center|LOCUS_09950 8582 8187 gene locus_tag LOCUS_09960 gene tatB 8582 8187 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467616.1 protein_id gnl|my_center|LOCUS_09960 8665 9420 gene locus_tag LOCUS_09970 8665 9420 CDS product DnaJ family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853334.1 protein_id gnl|my_center|LOCUS_09970 9420 9644 gene locus_tag LOCUS_09980 9420 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 9644 9856 gene locus_tag LOCUS_09990 9644 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 10387 9902 gene locus_tag LOCUS_10000 gene smpB 10387 9902 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852861.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence025 4088 4723 gene locus_tag LOCUS_10010 4088 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 4770 5528 gene locus_tag LOCUS_10020 4770 5528 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852555.1 protein_id gnl|my_center|LOCUS_10020 5546 6706 gene locus_tag LOCUS_10030 gene pseC 5546 6706 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_10030 6765 7661 gene locus_tag LOCUS_10040 6765 7661 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833936.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence026 2681 1419 gene locus_tag LOCUS_10050 2681 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 3030 3260 gene locus_tag LOCUS_10060 3030 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 3250 3636 gene locus_tag LOCUS_10070 3250 3636 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770889.1 protein_id gnl|my_center|LOCUS_10070 6340 3707 gene locus_tag LOCUS_10080 6340 3707 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864150.1 protein_id gnl|my_center|LOCUS_10080 6886 6467 gene locus_tag LOCUS_10090 6886 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence027 178 828 gene locus_tag LOCUS_10100 178 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 825 1916 gene locus_tag LOCUS_10110 825 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 2556 1930 gene locus_tag LOCUS_10120 gene serB 2556 1930 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851598.1 protein_id gnl|my_center|LOCUS_10120 3692 2604 gene locus_tag LOCUS_10130 3692 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 3969 4283 gene locus_tag LOCUS_10140 gene rpsJ 3969 4283 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779353.1 protein_id gnl|my_center|LOCUS_10140 4297 4869 gene locus_tag LOCUS_10150 gene rplC 4297 4869 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864792.1 protein_id gnl|my_center|LOCUS_10150 4869 5471 gene locus_tag LOCUS_10160 gene rplD 4869 5471 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851146.1 protein_id gnl|my_center|LOCUS_10160 5484 5765 gene locus_tag LOCUS_10170 5484 5765 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763613.1 protein_id gnl|my_center|LOCUS_10170 5777 6604 gene locus_tag LOCUS_10180 gene rplB 5777 6604 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002825501.1 protein_id gnl|my_center|LOCUS_10180 6614 6892 gene locus_tag LOCUS_10190 gene rpsS 6614 6892 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851509.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence028 2248 143 gene locus_tag LOCUS_10200 gene recQ 2248 143 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948677.1 protein_id gnl|my_center|LOCUS_10200 2485 2273 gene locus_tag LOCUS_10210 2485 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 3414 2986 gene locus_tag LOCUS_10220 3414 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10220 <4876 3407 gene locus_tag LOCUS_10230 <4876 3407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_149560769.1:TRAP transporter permease >Feature sequence029 2185 923 gene locus_tag LOCUS_10240 2185 923 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108527784.1 protein_id gnl|my_center|LOCUS_10240 2675 2133 gene locus_tag LOCUS_10250 2675 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10250 3039 2701 gene locus_tag LOCUS_10260 3039 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10260 >Feature sequence030 1565 621 gene locus_tag LOCUS_10270 1565 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10270 2187 1675 gene locus_tag LOCUS_10280 2187 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10280 <2763 2220 gene locus_tag LOCUS_10290 <2763 2220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002721316.1:sodium:proton antiporter NhaD >Feature sequence031 >Feature sequence032 <1 762 gene locus_tag LOCUS_10300 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001218141.1:mechanosensitive ion channel family protein 781 1383 gene locus_tag LOCUS_10310 781 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10310 1361 1990 gene locus_tag LOCUS_10320 1361 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10320 >Feature sequence033 8 1111 gene locus_tag LOCUS_10330 8 1111 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864601.1 protein_id gnl|my_center|LOCUS_10330 1112 1960 gene locus_tag LOCUS_10340 gene speB 1112 1960 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_10340 <2551 1961 gene locus_tag LOCUS_10350 <2551 1961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891852.1:coproporphyrinogen III oxidase family protein >Feature sequence034 1223 477 gene locus_tag LOCUS_10360 1223 477 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262110.1 protein_id gnl|my_center|LOCUS_10360 2318 1239 gene locus_tag LOCUS_10370 2318 1239 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764114.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence035 312 1103 gene locus_tag LOCUS_10380 312 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1357 2190 gene locus_tag LOCUS_10390 1357 2190 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851295.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence036 452 234 gene locus_tag LOCUS_10400 452 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 671 453 gene locus_tag LOCUS_10410 671 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1131 568 gene locus_tag LOCUS_10420 1131 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1724 1140 gene locus_tag LOCUS_10430 1724 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 <2513 1736 gene locus_tag LOCUS_10440 <2513 1736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107012.1:DUF932 domain-containing protein >Feature sequence037 2 301 gene locus_tag LOCUS_10450 2 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 312 2006 gene locus_tag LOCUS_10460 312 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence038 <1 1644 gene locus_tag LOCUS_10470 <1 1644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853182.1:polyribonucleotide nucleotidyltransferase >Feature sequence039 <1 799 gene locus_tag LOCUS_10480 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858618.1:AAA family ATPase note possible pseudo, internal stop codon 744 950 gene locus_tag LOCUS_10490 744 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10490 1174 2013 gene locus_tag LOCUS_10500 1174 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence040 <1 1342 gene locus_tag LOCUS_10510 <1 1342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858720.1:ATP-binding protein >Feature sequence041 79 897 gene locus_tag LOCUS_10520 gene panC 79 897 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264323.1 protein_id gnl|my_center|LOCUS_10520 941 1195 gene locus_tag LOCUS_10530 941 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence042 863 1486 gene locus_tag LOCUS_10540 863 1486 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853160.1 protein_id gnl|my_center|LOCUS_10540 2059 1610 gene locus_tag LOCUS_10550 2059 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 >Feature sequence043 1333 593 gene locus_tag LOCUS_10560 gene exoX 1333 593 CDS product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816172.1 protein_id gnl|my_center|LOCUS_10560 1948 1358 gene locus_tag LOCUS_10570 1948 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence044 1178 378 gene locus_tag LOCUS_10580 1178 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10580 1411 1244 gene locus_tag LOCUS_10590 1411 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1847 1404 gene locus_tag LOCUS_10600 1847 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence045 1012 212 gene locus_tag LOCUS_10610 gene kdsA 1012 212 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858652.1 protein_id gnl|my_center|LOCUS_10610 <2039 1009 gene locus_tag LOCUS_10620 <2039 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838131.1:potassium channel protein >Feature sequence046 416 183 gene locus_tag LOCUS_10630 416 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10630 1054 452 gene locus_tag LOCUS_10640 1054 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10640 <1958 1064 gene locus_tag LOCUS_10650 <1958 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852836.1:methionine adenosyltransferase >Feature sequence047 1222 959 gene locus_tag LOCUS_10660 1222 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1701 1222 gene locus_tag LOCUS_10670 gene moaC 1701 1222 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851725.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence048 29 1735 gene locus_tag LOCUS_10680 29 1735 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891863.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence049 472 1827 gene locus_tag LOCUS_10690 472 1827 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858001.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence050 246 791 gene locus_tag LOCUS_10700 246 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 <1900 896 gene locus_tag LOCUS_10710 <1900 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002857102.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence051 112 957 gene locus_tag LOCUS_10720 112 957 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857898.1 protein_id gnl|my_center|LOCUS_10720 1022 1687 gene locus_tag LOCUS_10730 1022 1687 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853724.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence052 1178 681 gene locus_tag LOCUS_10740 1178 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1333 1181 gene locus_tag LOCUS_10750 1333 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence053 <1 955 gene locus_tag LOCUS_10760 <1 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094115.1:cell division protein FtsA 955 1527 gene locus_tag LOCUS_10770 955 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10770 >Feature sequence054 381 1016 gene locus_tag LOCUS_10780 381 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1090 1473 gene locus_tag LOCUS_10790 1090 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10790 >Feature sequence055 1149 391 gene locus_tag LOCUS_10800 1149 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1320 1658 gene locus_tag LOCUS_10810 gene glnB 1320 1658 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073353.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence056 1212 37 gene locus_tag LOCUS_10820 gene tyrS 1212 37 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858315.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence057 <1 595 gene locus_tag LOCUS_10830 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002855462.1:glucose-6-phosphate isomerase >Feature sequence058 390 785 gene locus_tag LOCUS_10840 gene nusB 390 785 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002824771.1 protein_id gnl|my_center|LOCUS_10840 787 1473 gene locus_tag LOCUS_10850 gene pyrF 787 1473 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858700.1 protein_id gnl|my_center|LOCUS_10850 1578 1667 gene locus_tag LOCUS_t00160 1578 1667 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence059 <1 969 gene locus_tag LOCUS_10860 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001123234.1:TRAP transporter substrate-binding protein 990 1628 gene locus_tag LOCUS_10870 990 1628 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483276.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence060 114 1133 gene locus_tag LOCUS_10880 114 1133 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002185292.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence061 849 430 gene locus_tag LOCUS_10890 gene ybeY 849 430 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851664.1 protein_id gnl|my_center|LOCUS_10890 <1609 916 gene locus_tag LOCUS_10900 <1609 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858434.1:DNA repair protein RadA >Feature sequence062 14 310 gene locus_tag LOCUS_10910 14 310 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963096.1 protein_id gnl|my_center|LOCUS_10910 681 319 gene locus_tag LOCUS_10920 681 319 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_10920 978 685 gene locus_tag LOCUS_10930 978 685 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_10930 <1595 1022 gene locus_tag LOCUS_10940 <1595 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269243.1:tRNA 4-thiouridine(8) synthase ThiI >Feature sequence063 >Feature sequence064 <1 539 gene locus_tag LOCUS_10950 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389748.1:magnesium transporter >Feature sequence065 216 1304 gene locus_tag LOCUS_10960 216 1304 CDS product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851090.1 protein_id gnl|my_center|LOCUS_10960 >Feature sequence066 1423 743 gene locus_tag LOCUS_10970 gene truB 1423 743 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891909.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10970 >Feature sequence067 >Feature sequence068 <1 634 gene locus_tag LOCUS_10980 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003020490.1:AMP-binding protein note possible pseudo, frameshifted 618 1019 gene locus_tag LOCUS_10990 618 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10990 1187 1354 gene locus_tag LOCUS_11000 1187 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence069 888 595 gene locus_tag LOCUS_11010 888 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 >Feature sequence070 952 719 gene locus_tag LOCUS_11020 952 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence071 >Feature sequence072 1237 143 gene locus_tag LOCUS_11030 1237 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence073 <1 568 gene locus_tag LOCUS_11040 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000473297.1:MFS transporter 579 848 gene locus_tag LOCUS_11050 579 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11050 >Feature sequence074 <1423 268 gene locus_tag LOCUS_11060 <1423 268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986993.1:glycosyltransferase >Feature sequence075 1381 401 gene locus_tag LOCUS_11070 1381 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence076 988 677 gene locus_tag LOCUS_11080 988 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence077 >Feature sequence078 953 486 gene locus_tag LOCUS_11090 953 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence079 <1 1065 gene locus_tag LOCUS_11100 <1 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454664.1:efflux transporter SaoE >Feature sequence080 1 633 gene locus_tag LOCUS_11110 1 633 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106442.1 protein_id gnl|my_center|LOCUS_11110 1153 986 gene locus_tag LOCUS_11120 1153 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence081 >Feature sequence082 <1 592 gene locus_tag LOCUS_11130 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403685.1:CNNM domain-containing protein >Feature sequence083 699 64 gene locus_tag LOCUS_11140 699 64 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862414.1 protein_id gnl|my_center|LOCUS_11140 1294 689 gene locus_tag LOCUS_11150 1294 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence084 <1 665 gene locus_tag LOCUS_11160 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000133787.1:endopeptidase La >Feature sequence085 >Feature sequence086 <1 801 gene locus_tag LOCUS_11170 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888774.1:SPFH domain-containing protein 791 1216 gene locus_tag LOCUS_11180 791 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence087 <1 771 gene locus_tag LOCUS_11190 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891825.1:RluA family pseudouridine synthase >Feature sequence088 932 735 gene locus_tag LOCUS_11200 932 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11200 >Feature sequence089 >Feature sequence090 >Feature sequence091 >Feature sequence092 1050 247 gene locus_tag LOCUS_11210 1050 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence093 1 249 gene locus_tag LOCUS_11220 1 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence094 727 131 gene locus_tag LOCUS_11230 727 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11230 >Feature sequence095 129 599 gene locus_tag LOCUS_11240 129 599 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852450.1 protein_id gnl|my_center|LOCUS_11240 >Feature sequence096 158 559 gene locus_tag LOCUS_11250 158 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 569 781 gene locus_tag LOCUS_11260 569 781 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388926.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence097 472 68 gene locus_tag LOCUS_11270 gene perR 472 68 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858684.1 protein_id gnl|my_center|LOCUS_11270 <1193 609 gene locus_tag LOCUS_11280 <1193 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004597525.1:NADP-dependent malic enzyme >Feature sequence098 >Feature sequence099 >Feature sequence100 914 15 gene locus_tag LOCUS_11290 914 15 CDS product hexaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864642.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence101 112 612 gene locus_tag LOCUS_11300 112 612 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852091.1 protein_id gnl|my_center|LOCUS_11300 630 1037 gene locus_tag LOCUS_11310 630 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence102 253 747 gene locus_tag LOCUS_11320 253 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence103 >Feature sequence104 59 778 gene locus_tag LOCUS_11330 59 778 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989854.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence105 595 1053 gene locus_tag LOCUS_11340 595 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence106 >Feature sequence107 >Feature sequence108 >Feature sequence109 556 314 gene locus_tag LOCUS_11350 556 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 <1113 568 gene locus_tag LOCUS_11360 <1113 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880870.1:lipoyl synthase >Feature sequence110 >Feature sequence111 1099 809 gene locus_tag LOCUS_11370 1099 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence112 <1 522 gene locus_tag LOCUS_11380 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001156090.1:3-dehydroquinate synthase note possible pseudo, frameshifted 515 733 gene locus_tag LOCUS_11390 515 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11390 >Feature sequence113 >Feature sequence114 <1 749 gene locus_tag LOCUS_11400 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444593.1:AmmeMemoRadiSam system protein B 878 766 gene locus_tag LOCUS_r00010 878 766 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence115 2 901 gene locus_tag LOCUS_11410 gene fmt 2 901 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851657.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence116 <1 748 gene locus_tag LOCUS_11420 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337643.1:carbohydrate ABC transporter permease 758 1036 gene locus_tag LOCUS_11430 758 1036 CDS product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719814.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence117 594 818 gene locus_tag LOCUS_11440 594 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence118 >Feature sequence119 >Feature sequence120 933 427 gene locus_tag LOCUS_11450 933 427 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941961.1 protein_id gnl|my_center|LOCUS_11450 >Feature sequence121 <1 889 gene locus_tag LOCUS_11460 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000505472.1:NCS2 family permease >Feature sequence122 26 754 gene locus_tag LOCUS_11470 26 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence123 445 834 gene locus_tag LOCUS_11480 445 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11480 >Feature sequence124 332 247 gene locus_tag LOCUS_t00170 332 247 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 662 387 gene locus_tag LOCUS_11490 662 387 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859562.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence125 >Feature sequence126 >Feature sequence127 >Feature sequence128