>Feature sequence01 178 543 gene locus_tag LOCUS_00010 178 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00010 787 1785 gene locus_tag LOCUS_00020 787 1785 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817098.1 protein_id gnl|my_center|LOCUS_00020 1969 2457 gene locus_tag LOCUS_00030 1969 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3098 2694 gene locus_tag LOCUS_00040 3098 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3404 5797 gene locus_tag LOCUS_00050 3404 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7313 5832 gene locus_tag LOCUS_00060 7313 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7296 8639 gene locus_tag LOCUS_00070 gene mtaB 7296 8639 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388937.1 protein_id gnl|my_center|LOCUS_00070 8689 9141 gene locus_tag LOCUS_00080 8689 9141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9522 10454 gene locus_tag LOCUS_00090 9522 10454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00090 13578 10495 gene locus_tag LOCUS_00100 13578 10495 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144016.1 protein_id gnl|my_center|LOCUS_00100 14723 13575 gene locus_tag LOCUS_00110 14723 13575 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546440.1 protein_id gnl|my_center|LOCUS_00110 15385 17079 gene locus_tag LOCUS_00120 15385 17079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 17134 18495 gene locus_tag LOCUS_00130 17134 18495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 18492 19094 gene locus_tag LOCUS_00140 18492 19094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18997 19227 gene locus_tag LOCUS_00150 18997 19227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19434 19592 gene locus_tag LOCUS_00160 19434 19592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 20595 19690 gene locus_tag LOCUS_00170 20595 19690 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390313.1 protein_id gnl|my_center|LOCUS_00170 23150 20592 gene locus_tag LOCUS_00180 23150 20592 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008668559.1 protein_id gnl|my_center|LOCUS_00180 26467 23150 gene locus_tag LOCUS_00190 26467 23150 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390311.1 protein_id gnl|my_center|LOCUS_00190 26750 28267 gene locus_tag LOCUS_00200 26750 28267 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340179.1 protein_id gnl|my_center|LOCUS_00200 28269 29183 gene locus_tag LOCUS_00210 28269 29183 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_00210 29348 29629 gene locus_tag LOCUS_00220 29348 29629 CDS product endoribonuclease VapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271456.1 protein_id gnl|my_center|LOCUS_00220 30101 29754 gene locus_tag LOCUS_00230 30101 29754 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066878203.1 protein_id gnl|my_center|LOCUS_00230 32123 30120 gene locus_tag LOCUS_00240 32123 30120 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_00240 32245 35850 gene locus_tag LOCUS_00250 gene dnaE 32245 35850 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_00250 35869 36858 gene locus_tag LOCUS_00260 35869 36858 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772042.1 protein_id gnl|my_center|LOCUS_00260 37017 37541 gene locus_tag LOCUS_00270 37017 37541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 40411 37688 gene locus_tag LOCUS_00280 40411 37688 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932591.1 protein_id gnl|my_center|LOCUS_00280 41652 40648 gene locus_tag LOCUS_00290 gene rhuM 41652 40648 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019212714.1 protein_id gnl|my_center|LOCUS_00290 43549 41663 gene locus_tag LOCUS_00300 43549 41663 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932588.1 protein_id gnl|my_center|LOCUS_00300 44236 43871 gene locus_tag LOCUS_00310 44236 43871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 45293 44514 gene locus_tag LOCUS_00320 45293 44514 CDS product DUF4391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932587.1 protein_id gnl|my_center|LOCUS_00320 48511 45293 gene locus_tag LOCUS_00330 48511 45293 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932586.1 protein_id gnl|my_center|LOCUS_00330 50421 48742 gene locus_tag LOCUS_00340 gene ettA 50421 48742 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946440.1 protein_id gnl|my_center|LOCUS_00340 51361 50429 gene locus_tag LOCUS_00350 51361 50429 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_00350 51603 52058 gene locus_tag LOCUS_00360 51603 52058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 52071 52478 gene locus_tag LOCUS_00370 52071 52478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 52732 53943 gene locus_tag LOCUS_00380 52732 53943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 55411 53996 gene locus_tag LOCUS_00390 55411 53996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 56053 55670 gene locus_tag LOCUS_00400 56053 55670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 56854 56078 gene locus_tag LOCUS_00410 gene tpiA 56854 56078 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071430.1 protein_id gnl|my_center|LOCUS_00410 57168 57395 gene locus_tag LOCUS_00420 57168 57395 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355878.1 protein_id gnl|my_center|LOCUS_00420 57392 58306 gene locus_tag LOCUS_00430 57392 58306 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810943.1 protein_id gnl|my_center|LOCUS_00430 58319 60187 gene locus_tag LOCUS_00440 gene dxs 58319 60187 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_00440 60175 60930 gene locus_tag LOCUS_00450 60175 60930 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_00450 62829 60931 gene locus_tag LOCUS_00460 gene mutL 62829 60931 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106411.1 protein_id gnl|my_center|LOCUS_00460 63471 62836 gene locus_tag LOCUS_00470 63471 62836 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_00470 63564 64448 gene locus_tag LOCUS_00480 gene cysM 63564 64448 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_00480 65203 64460 gene locus_tag LOCUS_00490 65203 64460 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_00490 65402 65695 gene locus_tag LOCUS_00500 65402 65695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 65744 66496 gene locus_tag LOCUS_00510 gene truA 65744 66496 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391099.1 protein_id gnl|my_center|LOCUS_00510 66568 66643 gene locus_tag LOCUS_t00010 66568 66643 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 66727 67692 gene locus_tag LOCUS_00520 66727 67692 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_00520 67692 68345 gene locus_tag LOCUS_00530 67692 68345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929189.1 protein_id gnl|my_center|LOCUS_00530 68842 68534 gene locus_tag LOCUS_00540 68842 68534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 69501 70676 gene locus_tag LOCUS_00550 69501 70676 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388027.1 protein_id gnl|my_center|LOCUS_00550 71319 71639 gene locus_tag LOCUS_00560 71319 71639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 72690 71962 gene locus_tag LOCUS_00570 72690 71962 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268728.1 protein_id gnl|my_center|LOCUS_00570 73361 72687 gene locus_tag LOCUS_00580 gene gltK 73361 72687 CDS product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167916.1 protein_id gnl|my_center|LOCUS_00580 75067 73358 gene locus_tag LOCUS_00590 75067 73358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 75291 77357 gene locus_tag LOCUS_00600 75291 77357 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529393.1 protein_id gnl|my_center|LOCUS_00600 77741 77923 gene locus_tag LOCUS_00610 77741 77923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 78425 78946 gene locus_tag LOCUS_00620 78425 78946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 79787 78957 gene locus_tag LOCUS_00630 79787 78957 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946265.1 protein_id gnl|my_center|LOCUS_00630 80989 79784 gene locus_tag LOCUS_00640 80989 79784 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039061.1 protein_id gnl|my_center|LOCUS_00640 82565 81051 gene locus_tag LOCUS_00650 82565 81051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 83629 82565 gene locus_tag LOCUS_00660 83629 82565 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870053.1 protein_id gnl|my_center|LOCUS_00660 84060 83647 gene locus_tag LOCUS_00670 84060 83647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 84596 84057 gene locus_tag LOCUS_00680 84596 84057 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965515.1 protein_id gnl|my_center|LOCUS_00680 86489 84627 gene locus_tag LOCUS_00690 86489 84627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 88137 86653 gene locus_tag LOCUS_00700 88137 86653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 89390 88134 gene locus_tag LOCUS_00710 89390 88134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 91811 89418 gene locus_tag LOCUS_00720 91811 89418 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266949.1 protein_id gnl|my_center|LOCUS_00720 92028 92339 gene locus_tag LOCUS_00730 92028 92339 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015097.1 protein_id gnl|my_center|LOCUS_00730 92354 93733 gene locus_tag LOCUS_00740 92354 93733 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039554.1 protein_id gnl|my_center|LOCUS_00740 94098 95621 gene locus_tag LOCUS_00750 94098 95621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 95618 97048 gene locus_tag LOCUS_00760 95618 97048 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_00760 97334 97708 gene locus_tag LOCUS_00770 97334 97708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 98439 98702 gene locus_tag LOCUS_00780 98439 98702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 98723 100198 gene locus_tag LOCUS_00790 98723 100198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 100209 101855 gene locus_tag LOCUS_00800 gene almE 100209 101855 CDS product lipid A modification system glycine--protein ligase AlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146752.1 protein_id gnl|my_center|LOCUS_00800 102976 101870 gene locus_tag LOCUS_00810 gene mnmA 102976 101870 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_00810 104082 102991 gene locus_tag LOCUS_00820 gene thiO 104082 102991 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000335173.1 protein_id gnl|my_center|LOCUS_00820 105287 104085 gene locus_tag LOCUS_00830 105287 104085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 105606 105394 gene locus_tag LOCUS_00840 105606 105394 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812875.1 protein_id gnl|my_center|LOCUS_00840 106018 106251 gene locus_tag LOCUS_00850 106018 106251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 107156 106419 gene locus_tag LOCUS_00860 107156 106419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 108167 107193 gene locus_tag LOCUS_00870 108167 107193 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527983.1 protein_id gnl|my_center|LOCUS_00870 109551 108178 gene locus_tag LOCUS_00880 109551 108178 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518834.1 protein_id gnl|my_center|LOCUS_00880 110270 109554 gene locus_tag LOCUS_00890 110270 109554 CDS product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816647.1 protein_id gnl|my_center|LOCUS_00890 111500 110283 gene locus_tag LOCUS_00900 111500 110283 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387806.1 protein_id gnl|my_center|LOCUS_00900 111757 111497 gene locus_tag LOCUS_00910 111757 111497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 115779 111859 gene locus_tag LOCUS_00920 115779 111859 CDS product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189879.1 protein_id gnl|my_center|LOCUS_00920 116380 115829 gene locus_tag LOCUS_00930 116380 115829 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_00930 117405 116422 gene locus_tag LOCUS_00940 gene epmA 117405 116422 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209139.1 protein_id gnl|my_center|LOCUS_00940 118089 117529 gene locus_tag LOCUS_00950 gene efp 118089 117529 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444882.1 protein_id gnl|my_center|LOCUS_00950 118192 119154 gene locus_tag LOCUS_00960 gene epmB 118192 119154 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940510.1 protein_id gnl|my_center|LOCUS_00960 120233 119199 gene locus_tag LOCUS_00970 120233 119199 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528795.1 protein_id gnl|my_center|LOCUS_00970 121338 120256 gene locus_tag LOCUS_00980 gene leuB 121338 120256 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038427.1 protein_id gnl|my_center|LOCUS_00980 121992 121342 gene locus_tag LOCUS_00990 gene leuD 121992 121342 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357988.1 protein_id gnl|my_center|LOCUS_00990 123416 122010 gene locus_tag LOCUS_01000 gene leuC 123416 122010 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_01000 124332 123637 gene locus_tag LOCUS_01010 124332 123637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 126397 124634 gene locus_tag LOCUS_01020 126397 124634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 127118 126648 gene locus_tag LOCUS_01030 127118 126648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 128865 127408 gene locus_tag LOCUS_01040 128865 127408 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941905.1 protein_id gnl|my_center|LOCUS_01040 131050 128858 gene locus_tag LOCUS_01050 131050 128858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 132041 131292 gene locus_tag LOCUS_01060 132041 131292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 132748 132053 gene locus_tag LOCUS_01070 132748 132053 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_01070 133875 132841 gene locus_tag LOCUS_01080 133875 132841 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_01080 134518 135357 gene locus_tag LOCUS_01090 134518 135357 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103230.1 protein_id gnl|my_center|LOCUS_01090 137470 135428 gene locus_tag LOCUS_01100 137470 135428 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338328.1 protein_id gnl|my_center|LOCUS_01100 137408 137620 gene locus_tag LOCUS_01110 137408 137620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 137941 137561 gene locus_tag LOCUS_01120 137941 137561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 139422 137983 gene locus_tag LOCUS_01130 139422 137983 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388392.1 protein_id gnl|my_center|LOCUS_01130 141206 139419 gene locus_tag LOCUS_01140 141206 139419 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091546.1 protein_id gnl|my_center|LOCUS_01140 141526 141203 gene locus_tag LOCUS_01150 141526 141203 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388394.1 protein_id gnl|my_center|LOCUS_01150 143683 141746 gene locus_tag LOCUS_01160 gene acs 143683 141746 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113911.1 protein_id gnl|my_center|LOCUS_01160 143979 146105 gene locus_tag LOCUS_01170 143979 146105 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_01170 146102 147979 gene locus_tag LOCUS_01180 146102 147979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 149329 148052 gene locus_tag LOCUS_01190 149329 148052 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890489.1 protein_id gnl|my_center|LOCUS_01190 150576 149323 gene locus_tag LOCUS_01200 150576 149323 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479176.1 protein_id gnl|my_center|LOCUS_01200 151843 150614 gene locus_tag LOCUS_01210 151843 150614 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112811.1 protein_id gnl|my_center|LOCUS_01210 152575 151868 gene locus_tag LOCUS_01220 gene gloB 152575 151868 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337385.1 protein_id gnl|my_center|LOCUS_01220 152679 153455 gene locus_tag LOCUS_01230 152679 153455 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973187.1 protein_id gnl|my_center|LOCUS_01230 153452 154357 gene locus_tag LOCUS_01240 gene xerD 153452 154357 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209933.1 protein_id gnl|my_center|LOCUS_01240 154360 155400 gene locus_tag LOCUS_01250 154360 155400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 155671 156936 gene locus_tag LOCUS_01260 155671 156936 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_01260 157080 158165 gene locus_tag LOCUS_01270 157080 158165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 158274 159242 gene locus_tag LOCUS_01280 gene arsS 158274 159242 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_01280 159253 159933 gene locus_tag LOCUS_01290 159253 159933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 160067 162109 gene locus_tag LOCUS_01300 160067 162109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 162106 163140 gene locus_tag LOCUS_01310 162106 163140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 163140 165113 gene locus_tag LOCUS_01320 163140 165113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 165114 166670 gene locus_tag LOCUS_01330 165114 166670 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294598.1 protein_id gnl|my_center|LOCUS_01330 166803 167660 gene locus_tag LOCUS_01340 166803 167660 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980649.1 protein_id gnl|my_center|LOCUS_01340 167702 169054 gene locus_tag LOCUS_01350 gene ffh 167702 169054 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941303.1 protein_id gnl|my_center|LOCUS_01350 169228 170211 gene locus_tag LOCUS_01360 169228 170211 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048017.1 protein_id gnl|my_center|LOCUS_01360 170305 171498 gene locus_tag LOCUS_01370 170305 171498 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_01370 171882 171589 gene locus_tag LOCUS_01380 gene rpmB 171882 171589 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337158.1 protein_id gnl|my_center|LOCUS_01380 172068 172280 gene locus_tag LOCUS_01390 172068 172280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 172391 174271 gene locus_tag LOCUS_01400 172391 174271 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_01400 174396 175091 gene locus_tag LOCUS_01410 174396 175091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 175092 176006 gene locus_tag LOCUS_01420 gene ispE 175092 176006 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391620.1 protein_id gnl|my_center|LOCUS_01420 176013 176087 gene locus_tag LOCUS_t00020 176013 176087 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 176122 176502 gene locus_tag LOCUS_01430 176122 176502 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113117.1 protein_id gnl|my_center|LOCUS_01430 177789 176569 gene locus_tag LOCUS_01440 177789 176569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 178573 177980 gene locus_tag LOCUS_01450 178573 177980 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940393.1 protein_id gnl|my_center|LOCUS_01450 179062 178607 gene locus_tag LOCUS_01460 179062 178607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 179196 179642 gene locus_tag LOCUS_01470 gene tnpA 179196 179642 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_01470 180365 179667 gene locus_tag LOCUS_01480 180365 179667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01480 183382 181076 gene locus_tag LOCUS_01490 183382 181076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 190210 183584 gene locus_tag LOCUS_01500 190210 183584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 190362 190207 gene locus_tag LOCUS_01510 190362 190207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 193476 191536 gene locus_tag LOCUS_01520 193476 191536 CDS product DUF3732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036780.1 protein_id gnl|my_center|LOCUS_01520 193988 193473 gene locus_tag LOCUS_01530 193988 193473 CDS product DUF6521 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204896.1 protein_id gnl|my_center|LOCUS_01530 195192 193978 gene locus_tag LOCUS_01540 195192 193978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036781.1 protein_id gnl|my_center|LOCUS_01540 197120 196266 gene locus_tag LOCUS_01550 197120 196266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 197847 197506 gene locus_tag LOCUS_01560 197847 197506 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068360.1 protein_id gnl|my_center|LOCUS_01560 199343 198000 gene locus_tag LOCUS_01570 199343 198000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 200013 199336 gene locus_tag LOCUS_01580 200013 199336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 201283 200315 gene locus_tag LOCUS_01590 201283 200315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 202124 201267 gene locus_tag LOCUS_01600 202124 201267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 203098 202181 gene locus_tag LOCUS_01610 203098 202181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 205230 203158 gene locus_tag LOCUS_01620 205230 203158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 206214 205288 gene locus_tag LOCUS_01630 206214 205288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 206629 206222 gene locus_tag LOCUS_01640 206629 206222 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940036.1 protein_id gnl|my_center|LOCUS_01640 209643 206632 gene locus_tag LOCUS_01650 209643 206632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 210220 209630 gene locus_tag LOCUS_01660 210220 209630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 211113 210265 gene locus_tag LOCUS_01670 211113 210265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 211643 211131 gene locus_tag LOCUS_01680 211643 211131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 212244 211651 gene locus_tag LOCUS_01690 212244 211651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 213130 212246 gene locus_tag LOCUS_01700 213130 212246 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020666.1 protein_id gnl|my_center|LOCUS_01700 214434 213127 gene locus_tag LOCUS_01710 214434 213127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 215117 214431 gene locus_tag LOCUS_01720 215117 214431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 215993 215142 gene locus_tag LOCUS_01730 215993 215142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 217969 215990 gene locus_tag LOCUS_01740 217969 215990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 219302 217971 gene locus_tag LOCUS_01750 219302 217971 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_01750 220282 219302 gene locus_tag LOCUS_01760 220282 219302 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943251.1 protein_id gnl|my_center|LOCUS_01760 220547 220329 gene locus_tag LOCUS_01770 220547 220329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 221058 220753 gene locus_tag LOCUS_01780 221058 220753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 222151 221105 gene locus_tag LOCUS_01790 gene mreB 222151 221105 CDS product cell shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229650.1 protein_id gnl|my_center|LOCUS_01790 224271 222211 gene locus_tag LOCUS_01800 224271 222211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 226433 224430 gene locus_tag LOCUS_01810 226433 224430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 226667 226440 gene locus_tag LOCUS_01820 226667 226440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 228036 226693 gene locus_tag LOCUS_01830 gene blt 228036 226693 CDS product multidrug efflux MFS transporter Blt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229880.1 protein_id gnl|my_center|LOCUS_01830 228362 228039 gene locus_tag LOCUS_01840 228362 228039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 229209 228379 gene locus_tag LOCUS_01850 229209 228379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 230970 229702 gene locus_tag LOCUS_01860 230970 229702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 231896 230967 gene locus_tag LOCUS_01870 231896 230967 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106663661.1 protein_id gnl|my_center|LOCUS_01870 236741 231909 gene locus_tag LOCUS_01880 236741 231909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 237486 236788 gene locus_tag LOCUS_01890 237486 236788 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274356.1 protein_id gnl|my_center|LOCUS_01890 239493 237499 gene locus_tag LOCUS_01900 gene feoB 239493 237499 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045027.1 protein_id gnl|my_center|LOCUS_01900 240122 239793 gene locus_tag LOCUS_01910 240122 239793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 241271 240330 gene locus_tag LOCUS_01920 241271 240330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 241785 241600 gene locus_tag LOCUS_01930 241785 241600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 <243428 242097 gene locus_tag LOCUS_01940 <243428 242097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010951067.1:phage tail protein >Feature sequence02 281 96 gene locus_tag LOCUS_01950 281 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 747 301 gene locus_tag LOCUS_01960 747 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 1951 1202 gene locus_tag LOCUS_01970 1951 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 2642 4021 gene locus_tag LOCUS_01980 gene mgtE 2642 4021 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228410.1 protein_id gnl|my_center|LOCUS_01980 4025 5011 gene locus_tag LOCUS_01990 4025 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 5046 5495 gene locus_tag LOCUS_02000 5046 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 9487 5567 gene locus_tag LOCUS_02010 9487 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 10548 9655 gene locus_tag LOCUS_02020 10548 9655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 11701 10577 gene locus_tag LOCUS_02030 gene dnaN 11701 10577 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338892.1 protein_id gnl|my_center|LOCUS_02030 13107 11740 gene locus_tag LOCUS_02040 gene dnaA 13107 11740 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_02040 13384 13097 gene locus_tag LOCUS_02050 13384 13097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 13781 13476 gene locus_tag LOCUS_02060 13781 13476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926944.1 protein_id gnl|my_center|LOCUS_02060 16414 13778 gene locus_tag LOCUS_02070 gene alaS 16414 13778 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063947.1 protein_id gnl|my_center|LOCUS_02070 16895 16422 gene locus_tag LOCUS_02080 gene recX 16895 16422 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036900.1 protein_id gnl|my_center|LOCUS_02080 17671 16895 gene locus_tag LOCUS_02090 17671 16895 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108766.1 protein_id gnl|my_center|LOCUS_02090 17786 18313 gene locus_tag LOCUS_02100 gene hslV 17786 18313 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769770.1 protein_id gnl|my_center|LOCUS_02100 18314 19699 gene locus_tag LOCUS_02110 gene hslU 18314 19699 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208943.1 protein_id gnl|my_center|LOCUS_02110 19863 20693 gene locus_tag LOCUS_02120 gene ppk2 19863 20693 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121626.1 protein_id gnl|my_center|LOCUS_02120 20793 21224 gene locus_tag LOCUS_02130 20793 21224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 21285 21578 gene locus_tag LOCUS_02140 21285 21578 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408073.1 protein_id gnl|my_center|LOCUS_02140 21718 22596 gene locus_tag LOCUS_02150 21718 22596 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538556.1 protein_id gnl|my_center|LOCUS_02150 22686 23771 gene locus_tag LOCUS_02160 22686 23771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 23773 24678 gene locus_tag LOCUS_02170 gene pstC 23773 24678 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_02170 24681 25553 gene locus_tag LOCUS_02180 gene pstA 24681 25553 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962534.1 protein_id gnl|my_center|LOCUS_02180 25547 26296 gene locus_tag LOCUS_02190 gene pstB 25547 26296 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_02190 26296 27087 gene locus_tag LOCUS_02200 gene pstB 26296 27087 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_02200 27324 29036 gene locus_tag LOCUS_02210 27324 29036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 29113 31887 gene locus_tag LOCUS_02220 29113 31887 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704393.1 protein_id gnl|my_center|LOCUS_02220 32615 31896 gene locus_tag LOCUS_02230 32615 31896 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_02230 34467 32701 gene locus_tag LOCUS_02240 gene phoR 34467 32701 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_02240 36145 34508 gene locus_tag LOCUS_02250 gene ubiB 36145 34508 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391544.1 protein_id gnl|my_center|LOCUS_02250 36866 36153 gene locus_tag LOCUS_02260 36866 36153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 37618 36869 gene locus_tag LOCUS_02270 gene ubiE 37618 36869 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948588.1 protein_id gnl|my_center|LOCUS_02270 37989 39839 gene locus_tag LOCUS_02280 gene ubiD 37989 39839 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489172.1 protein_id gnl|my_center|LOCUS_02280 41963 39912 gene locus_tag LOCUS_02290 41963 39912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 42359 42132 gene locus_tag LOCUS_02300 42359 42132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 44065 42461 gene locus_tag LOCUS_02310 gene ctaD 44065 42461 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940894.1 protein_id gnl|my_center|LOCUS_02310 44888 44160 gene locus_tag LOCUS_02320 44888 44160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 45730 44900 gene locus_tag LOCUS_02330 45730 44900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 46519 45749 gene locus_tag LOCUS_02340 46519 45749 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881437.1 protein_id gnl|my_center|LOCUS_02340 47177 46713 gene locus_tag LOCUS_02350 47177 46713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974834.1 protein_id gnl|my_center|LOCUS_02350 47449 49713 gene locus_tag LOCUS_02360 47449 49713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 49826 50221 gene locus_tag LOCUS_02370 49826 50221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 50315 51238 gene locus_tag LOCUS_02380 gene galU 50315 51238 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389966.1 protein_id gnl|my_center|LOCUS_02380 51255 52574 gene locus_tag LOCUS_02390 51255 52574 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_02390 52567 53964 gene locus_tag LOCUS_02400 52567 53964 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 protein_id gnl|my_center|LOCUS_02400 53972 54907 gene locus_tag LOCUS_02410 53972 54907 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_02410 54976 55602 gene locus_tag LOCUS_02420 gene ppiA 54976 55602 CDS product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477215.1 protein_id gnl|my_center|LOCUS_02420 55686 56933 gene locus_tag LOCUS_02430 55686 56933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 58332 56998 gene locus_tag LOCUS_02440 gene fliI 58332 56998 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460756.1 protein_id gnl|my_center|LOCUS_02440 59575 58316 gene locus_tag LOCUS_02450 59575 58316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 60711 59635 gene locus_tag LOCUS_02460 gene fliG 60711 59635 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937619.1 protein_id gnl|my_center|LOCUS_02460 62572 60929 gene locus_tag LOCUS_02470 gene fliF 62572 60929 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_02470 63005 62688 gene locus_tag LOCUS_02480 gene fliE 63005 62688 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392291.1 protein_id gnl|my_center|LOCUS_02480 63446 63021 gene locus_tag LOCUS_02490 gene flgC 63446 63021 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_02490 63935 63522 gene locus_tag LOCUS_02500 gene flgB 63935 63522 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884694.1 protein_id gnl|my_center|LOCUS_02500 65160 64210 gene locus_tag LOCUS_02510 gene pyrF 65160 64210 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922551.1 protein_id gnl|my_center|LOCUS_02510 65900 65166 gene locus_tag LOCUS_02520 65900 65166 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401893.1 protein_id gnl|my_center|LOCUS_02520 66248 65904 gene locus_tag LOCUS_02530 66248 65904 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071016.1 protein_id gnl|my_center|LOCUS_02530 66822 66259 gene locus_tag LOCUS_02540 66822 66259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 66971 68278 gene locus_tag LOCUS_02550 66971 68278 CDS product PqiA/YebS family transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820402.1 protein_id gnl|my_center|LOCUS_02550 68275 70002 gene locus_tag LOCUS_02560 68275 70002 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940385.1 protein_id gnl|my_center|LOCUS_02560 70007 70609 gene locus_tag LOCUS_02570 70007 70609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 70806 70570 gene locus_tag LOCUS_02580 70806 70570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 71552 70803 gene locus_tag LOCUS_02590 71552 70803 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943419.1 protein_id gnl|my_center|LOCUS_02590 72477 71581 gene locus_tag LOCUS_02600 gene hpnD 72477 71581 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_02600 73406 72474 gene locus_tag LOCUS_02610 gene hpnC 73406 72474 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 protein_id gnl|my_center|LOCUS_02610 74391 73474 gene locus_tag LOCUS_02620 74391 73474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 74813 75760 gene locus_tag LOCUS_02630 74813 75760 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924797.1 protein_id gnl|my_center|LOCUS_02630 75761 78733 gene locus_tag LOCUS_02640 75761 78733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 78739 80223 gene locus_tag LOCUS_02650 78739 80223 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089740.1 protein_id gnl|my_center|LOCUS_02650 80253 80720 gene locus_tag LOCUS_02660 80253 80720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 82257 80794 gene locus_tag LOCUS_02670 82257 80794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 83253 82486 gene locus_tag LOCUS_02680 gene trmB 83253 82486 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391524.1 protein_id gnl|my_center|LOCUS_02680 83839 83402 gene locus_tag LOCUS_02690 83839 83402 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_02690 84056 84949 gene locus_tag LOCUS_02700 gene rpoH 84056 84949 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090072.1 protein_id gnl|my_center|LOCUS_02700 85189 85611 gene locus_tag LOCUS_02710 85189 85611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 86077 88077 gene locus_tag LOCUS_02720 86077 88077 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941695.1 protein_id gnl|my_center|LOCUS_02720 88153 88836 gene locus_tag LOCUS_02730 88153 88836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 89998 88865 gene locus_tag LOCUS_02740 89998 88865 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651665.1 protein_id gnl|my_center|LOCUS_02740 90791 90108 gene locus_tag LOCUS_02750 90791 90108 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086058.1 protein_id gnl|my_center|LOCUS_02750 91993 91241 gene locus_tag LOCUS_02760 91993 91241 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_02760 93622 92378 gene locus_tag LOCUS_02770 93622 92378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 94778 93777 gene locus_tag LOCUS_02780 94778 93777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 95504 95211 gene locus_tag LOCUS_02790 95504 95211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 96280 95609 gene locus_tag LOCUS_02800 96280 95609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 96737 96662 gene locus_tag LOCUS_t00030 96737 96662 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 98728 96743 gene locus_tag LOCUS_02810 gene rpoD 98728 96743 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976352.1 protein_id gnl|my_center|LOCUS_02810 100613 98793 gene locus_tag LOCUS_02820 gene dnaG 100613 98793 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918820.1 protein_id gnl|my_center|LOCUS_02820 100836 102173 gene locus_tag LOCUS_02830 100836 102173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 102204 102641 gene locus_tag LOCUS_02840 102204 102641 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392135.1 protein_id gnl|my_center|LOCUS_02840 103809 102772 gene locus_tag LOCUS_02850 103809 102772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 104457 103993 gene locus_tag LOCUS_02860 gene rlmH 104457 103993 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338553.1 protein_id gnl|my_center|LOCUS_02860 104975 104463 gene locus_tag LOCUS_02870 104975 104463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 105624 104968 gene locus_tag LOCUS_02880 gene nadD 105624 104968 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071402.1 protein_id gnl|my_center|LOCUS_02880 106892 105621 gene locus_tag LOCUS_02890 106892 105621 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268988.1 protein_id gnl|my_center|LOCUS_02890 108093 106927 gene locus_tag LOCUS_02900 gene proB 108093 106927 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_02900 109243 108065 gene locus_tag LOCUS_02910 gene obgE 109243 108065 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036350.1 protein_id gnl|my_center|LOCUS_02910 109579 109298 gene locus_tag LOCUS_02920 gene rpmA 109579 109298 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723383.1 protein_id gnl|my_center|LOCUS_02920 109923 109591 gene locus_tag LOCUS_02930 gene rplU 109923 109591 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869646.1 protein_id gnl|my_center|LOCUS_02930 110657 110061 gene locus_tag LOCUS_02940 gene yhdE 110657 110061 CDS product nucleoside triphosphate pyrophosphatase YhdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203099.1 protein_id gnl|my_center|LOCUS_02940 110838 111881 gene locus_tag LOCUS_02950 110838 111881 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 protein_id gnl|my_center|LOCUS_02950 111958 112034 gene locus_tag LOCUS_t00040 111958 112034 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 112593 113909 gene locus_tag LOCUS_02960 112593 113909 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023185.1 protein_id gnl|my_center|LOCUS_02960 113943 117011 gene locus_tag LOCUS_02970 113943 117011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 117807 117151 gene locus_tag LOCUS_02980 117807 117151 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986868.1 protein_id gnl|my_center|LOCUS_02980 119074 117815 gene locus_tag LOCUS_02990 119074 117815 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035889.1 protein_id gnl|my_center|LOCUS_02990 119995 119321 gene locus_tag LOCUS_03000 119995 119321 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_03000 121074 120169 gene locus_tag LOCUS_03010 gene ccoP 121074 120169 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338422.1 protein_id gnl|my_center|LOCUS_03010 121815 121096 gene locus_tag LOCUS_03020 gene ccoO 121815 121096 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967643.1 protein_id gnl|my_center|LOCUS_03020 123248 121830 gene locus_tag LOCUS_03030 gene ccoN 123248 121830 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_03030 123436 124857 gene locus_tag LOCUS_03040 gene ccoG 123436 124857 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395451.1 protein_id gnl|my_center|LOCUS_03040 124857 125384 gene locus_tag LOCUS_03050 124857 125384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 125386 125541 gene locus_tag LOCUS_03060 125386 125541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 125737 128085 gene locus_tag LOCUS_03070 125737 128085 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_03070 128087 128308 gene locus_tag LOCUS_03080 gene ccoS 128087 128308 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391070.1 protein_id gnl|my_center|LOCUS_03080 128610 129005 gene locus_tag LOCUS_03090 128610 129005 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930561.1 protein_id gnl|my_center|LOCUS_03090 129141 129920 gene locus_tag LOCUS_03100 129141 129920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 129924 130340 gene locus_tag LOCUS_03110 129924 130340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 130494 134081 gene locus_tag LOCUS_03120 130494 134081 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_03120 134083 134856 gene locus_tag LOCUS_03130 134083 134856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 134853 135473 gene locus_tag LOCUS_03140 134853 135473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 135675 136469 gene locus_tag LOCUS_03150 135675 136469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 136513 136926 gene locus_tag LOCUS_03160 136513 136926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 136998 137429 gene locus_tag LOCUS_03170 136998 137429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 137790 138461 gene locus_tag LOCUS_03180 137790 138461 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633911.1 protein_id gnl|my_center|LOCUS_03180 138480 139217 gene locus_tag LOCUS_03190 138480 139217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 139274 140629 gene locus_tag LOCUS_03200 139274 140629 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388441.1 protein_id gnl|my_center|LOCUS_03200 140917 140711 gene locus_tag LOCUS_03210 140917 140711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 141273 141818 gene locus_tag LOCUS_03220 141273 141818 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057644910.1 protein_id gnl|my_center|LOCUS_03220 141832 142683 gene locus_tag LOCUS_03230 141832 142683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 143058 142771 gene locus_tag LOCUS_03240 143058 142771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 143716 143321 gene locus_tag LOCUS_03250 gene hisI 143716 143321 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 protein_id gnl|my_center|LOCUS_03250 144555 143734 gene locus_tag LOCUS_03260 gene hisF 144555 143734 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106334.1 protein_id gnl|my_center|LOCUS_03260 144778 145416 gene locus_tag LOCUS_03270 144778 145416 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_03270 145460 146677 gene locus_tag LOCUS_03280 gene sat 145460 146677 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_03280 146763 147194 gene locus_tag LOCUS_03290 gene aprB 146763 147194 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932545.1 protein_id gnl|my_center|LOCUS_03290 147239 149155 gene locus_tag LOCUS_03300 gene aprA 147239 149155 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932546.1 protein_id gnl|my_center|LOCUS_03300 149231 150163 gene locus_tag LOCUS_03310 149231 150163 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_03310 151683 150574 gene locus_tag LOCUS_03320 151683 150574 CDS product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210980.1 protein_id gnl|my_center|LOCUS_03320 153091 151793 gene locus_tag LOCUS_03330 153091 151793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 153981 153088 gene locus_tag LOCUS_03340 153981 153088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 154942 154073 gene locus_tag LOCUS_03350 154942 154073 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_03350 155173 156180 gene locus_tag LOCUS_03360 155173 156180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 156342 157379 gene locus_tag LOCUS_03370 156342 157379 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_03370 157647 158453 gene locus_tag LOCUS_03380 157647 158453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 161137 158489 gene locus_tag LOCUS_03390 gene mutS 161137 158489 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113873.1 protein_id gnl|my_center|LOCUS_03390 163298 161211 gene locus_tag LOCUS_03400 163298 161211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 165676 163607 gene locus_tag LOCUS_03410 165676 163607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 166822 165869 gene locus_tag LOCUS_03420 166822 165869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 167365 168309 gene locus_tag LOCUS_03430 167365 168309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 168309 170381 gene locus_tag LOCUS_03440 168309 170381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 171503 170388 gene locus_tag LOCUS_03450 171503 170388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 174205 171548 gene locus_tag LOCUS_03460 174205 171548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 174815 175525 gene locus_tag LOCUS_03470 174815 175525 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325942.1 protein_id gnl|my_center|LOCUS_03470 175529 175840 gene locus_tag LOCUS_03480 175529 175840 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687491.1 protein_id gnl|my_center|LOCUS_03480 175945 176997 gene locus_tag LOCUS_03490 175945 176997 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_03490 177024 180401 gene locus_tag LOCUS_03500 177024 180401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 180773 180423 gene locus_tag LOCUS_03510 180773 180423 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085225.1 protein_id gnl|my_center|LOCUS_03510 181412 182899 gene locus_tag LOCUS_03520 181412 182899 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267829.1 protein_id gnl|my_center|LOCUS_03520 182899 183999 gene locus_tag LOCUS_03530 182899 183999 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267830.1 protein_id gnl|my_center|LOCUS_03530 183996 187076 gene locus_tag LOCUS_03540 183996 187076 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267831.1 protein_id gnl|my_center|LOCUS_03540 187377 187592 gene locus_tag LOCUS_03550 187377 187592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 187599 188063 gene locus_tag LOCUS_03560 187599 188063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 188755 188222 gene locus_tag LOCUS_03570 188755 188222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 190059 188752 gene locus_tag LOCUS_03580 190059 188752 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056064.1 protein_id gnl|my_center|LOCUS_03580 190534 190145 gene locus_tag LOCUS_03590 190534 190145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 190512 191387 gene locus_tag LOCUS_03600 gene flaB 190512 191387 CDS product flagellin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705589.1 protein_id gnl|my_center|LOCUS_03600 191471 192358 gene locus_tag LOCUS_03610 191471 192358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 194054 192303 gene locus_tag LOCUS_03620 194054 192303 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942194.1 protein_id gnl|my_center|LOCUS_03620 194245 194169 gene locus_tag LOCUS_t00050 194245 194169 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 194392 194727 gene locus_tag LOCUS_03630 gene trxA 194392 194727 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391180.1 protein_id gnl|my_center|LOCUS_03630 195135 194779 gene locus_tag LOCUS_03640 195135 194779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 195718 195128 gene locus_tag LOCUS_03650 195718 195128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 196576 195752 gene locus_tag LOCUS_03660 gene proC 196576 195752 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140706.1 protein_id gnl|my_center|LOCUS_03660 197707 196598 gene locus_tag LOCUS_03670 197707 196598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 198437 197733 gene locus_tag LOCUS_03680 198437 197733 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_03680 198689 200653 gene locus_tag LOCUS_03690 gene tkt 198689 200653 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301211.1 protein_id gnl|my_center|LOCUS_03690 200837 201694 gene locus_tag LOCUS_03700 200837 201694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 201699 203993 gene locus_tag LOCUS_03710 201699 203993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 205681 203990 gene locus_tag LOCUS_03720 gene terL 205681 203990 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003751157.1 protein_id gnl|my_center|LOCUS_03720 208319 205824 gene locus_tag LOCUS_03730 208319 205824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 208499 209503 gene locus_tag LOCUS_03740 208499 209503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 209681 211465 gene locus_tag LOCUS_03750 209681 211465 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766050.1 protein_id gnl|my_center|LOCUS_03750 211893 213872 gene locus_tag LOCUS_03760 211893 213872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 213869 214573 gene locus_tag LOCUS_03770 gene kdpE 213869 214573 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185947.1 protein_id gnl|my_center|LOCUS_03770 214884 214687 gene locus_tag LOCUS_03780 214884 214687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 215255 215052 gene locus_tag LOCUS_03790 215255 215052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 215600 216160 gene locus_tag LOCUS_03800 215600 216160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 216197 217762 gene locus_tag LOCUS_03810 216197 217762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 218673 217825 gene locus_tag LOCUS_03820 gene radC 218673 217825 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810520.1 protein_id gnl|my_center|LOCUS_03820 219785 219117 gene locus_tag LOCUS_03830 gene rpe 219785 219117 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_03830 220627 219785 gene locus_tag LOCUS_03840 gene htpX 220627 219785 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531758.1 protein_id gnl|my_center|LOCUS_03840 221363 220695 gene locus_tag LOCUS_03850 221363 220695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_03850 223553 221430 gene locus_tag LOCUS_03860 223553 221430 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 protein_id gnl|my_center|LOCUS_03860 223795 224199 gene locus_tag LOCUS_03870 223795 224199 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026896.1 protein_id gnl|my_center|LOCUS_03870 225222 224320 gene locus_tag LOCUS_03880 225222 224320 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_03880 227489 225237 gene locus_tag LOCUS_03890 227489 225237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 227698 227486 gene locus_tag LOCUS_03900 227698 227486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 228900 227785 gene locus_tag LOCUS_03910 228900 227785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 230027 228900 gene locus_tag LOCUS_03920 230027 228900 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389347.1 protein_id gnl|my_center|LOCUS_03920 231234 230104 gene locus_tag LOCUS_03930 231234 230104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 231821 231351 gene locus_tag LOCUS_03940 231821 231351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 232622 231861 gene locus_tag LOCUS_03950 232622 231861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 232786 234066 gene locus_tag LOCUS_03960 gene hemL 232786 234066 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243834.1 protein_id gnl|my_center|LOCUS_03960 235017 234115 gene locus_tag LOCUS_03970 235017 234115 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267627.1 protein_id gnl|my_center|LOCUS_03970 235173 235658 gene locus_tag LOCUS_03980 235173 235658 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083756.1 protein_id gnl|my_center|LOCUS_03980 >Feature sequence03 <1 2977 gene locus_tag LOCUS_03990 <1 2977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389998.1:ribonuclease E/G 2981 3190 gene locus_tag LOCUS_04000 2981 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 3380 3198 gene locus_tag LOCUS_04010 3380 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 5214 3670 gene locus_tag LOCUS_04020 5214 3670 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462181.1 protein_id gnl|my_center|LOCUS_04020 5332 6171 gene locus_tag LOCUS_04030 5332 6171 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170039298.1 protein_id gnl|my_center|LOCUS_04030 6227 7219 gene locus_tag LOCUS_04040 6227 7219 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_04040 7222 7596 gene locus_tag LOCUS_04050 7222 7596 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570784.1 protein_id gnl|my_center|LOCUS_04050 7687 8373 gene locus_tag LOCUS_04060 7687 8373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 8909 8457 gene locus_tag LOCUS_04070 gene dksA 8909 8457 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406657.1 protein_id gnl|my_center|LOCUS_04070 10460 9030 gene locus_tag LOCUS_04080 10460 9030 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_04080 11187 10417 gene locus_tag LOCUS_04090 11187 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 11597 11226 gene locus_tag LOCUS_04100 11597 11226 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392503.1 protein_id gnl|my_center|LOCUS_04100 12519 11590 gene locus_tag LOCUS_04110 gene rsmI 12519 11590 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057354.1 protein_id gnl|my_center|LOCUS_04110 12681 14438 gene locus_tag LOCUS_04120 12681 14438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 17205 14512 gene locus_tag LOCUS_04130 17205 14512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 18879 17377 gene locus_tag LOCUS_04140 gene gatB 18879 17377 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_04140 20405 18930 gene locus_tag LOCUS_04150 gene gatA 20405 18930 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772005.1 protein_id gnl|my_center|LOCUS_04150 20706 20419 gene locus_tag LOCUS_04160 gene gatC 20706 20419 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920296.1 protein_id gnl|my_center|LOCUS_04160 22250 21096 gene locus_tag LOCUS_04170 22250 21096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 22726 22247 gene locus_tag LOCUS_04180 22726 22247 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073310.1 protein_id gnl|my_center|LOCUS_04180 23566 22793 gene locus_tag LOCUS_04190 23566 22793 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389501.1 protein_id gnl|my_center|LOCUS_04190 24449 23580 gene locus_tag LOCUS_04200 24449 23580 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366477.1 protein_id gnl|my_center|LOCUS_04200 25732 24446 gene locus_tag LOCUS_04210 gene livM 25732 24446 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096032.1 protein_id gnl|my_center|LOCUS_04210 26658 25732 gene locus_tag LOCUS_04220 26658 25732 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096033.1 protein_id gnl|my_center|LOCUS_04220 27988 26792 gene locus_tag LOCUS_04230 27988 26792 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099985.1 protein_id gnl|my_center|LOCUS_04230 28108 28464 gene locus_tag LOCUS_04240 gene erpA 28108 28464 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194247.1 protein_id gnl|my_center|LOCUS_04240 28660 31347 gene locus_tag LOCUS_04250 gene lon 28660 31347 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101982.1 protein_id gnl|my_center|LOCUS_04250 31492 31968 gene locus_tag LOCUS_04260 31492 31968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 31968 32744 gene locus_tag LOCUS_04270 31968 32744 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887613.1 protein_id gnl|my_center|LOCUS_04270 32844 33512 gene locus_tag LOCUS_04280 32844 33512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 33505 33900 gene locus_tag LOCUS_04290 33505 33900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 35049 34120 gene locus_tag LOCUS_04300 35049 34120 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957516.1 protein_id gnl|my_center|LOCUS_04300 36576 35281 gene locus_tag LOCUS_04310 36576 35281 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268608.1 protein_id gnl|my_center|LOCUS_04310 37943 36573 gene locus_tag LOCUS_04320 37943 36573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 38155 38388 gene locus_tag LOCUS_04330 38155 38388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 40275 38965 gene locus_tag LOCUS_04340 40275 38965 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942336.1 protein_id gnl|my_center|LOCUS_04340 41531 40341 gene locus_tag LOCUS_04350 41531 40341 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390164.1 protein_id gnl|my_center|LOCUS_04350 43546 41627 gene locus_tag LOCUS_04360 43546 41627 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_04360 44447 43806 gene locus_tag LOCUS_04370 44447 43806 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561944.1 protein_id gnl|my_center|LOCUS_04370 44959 44633 gene locus_tag LOCUS_04380 44959 44633 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 protein_id gnl|my_center|LOCUS_04380 45444 46118 gene locus_tag LOCUS_04390 45444 46118 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267999.1 protein_id gnl|my_center|LOCUS_04390 46548 47576 gene locus_tag LOCUS_04400 46548 47576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 47599 48822 gene locus_tag LOCUS_04410 47599 48822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 48815 49309 gene locus_tag LOCUS_04420 gene moaC 48815 49309 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393624.1 protein_id gnl|my_center|LOCUS_04420 49303 50334 gene locus_tag LOCUS_04430 gene moaA 49303 50334 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059643243.1 protein_id gnl|my_center|LOCUS_04430 51090 50323 gene locus_tag LOCUS_04440 gene thiF 51090 50323 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880850.1 protein_id gnl|my_center|LOCUS_04440 51316 51750 gene locus_tag LOCUS_04450 gene fur 51316 51750 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010359353.1 protein_id gnl|my_center|LOCUS_04450 51793 52761 gene locus_tag LOCUS_04460 51793 52761 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948545.1 protein_id gnl|my_center|LOCUS_04460 52806 53765 gene locus_tag LOCUS_04470 52806 53765 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948544.1 protein_id gnl|my_center|LOCUS_04470 53758 54282 gene locus_tag LOCUS_04480 53758 54282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 54279 55052 gene locus_tag LOCUS_04490 54279 55052 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060390007.1 protein_id gnl|my_center|LOCUS_04490 55248 57926 gene locus_tag LOCUS_04500 gene ndvB 55248 57926 CDS product glycosyltransferase NdvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 protein_id gnl|my_center|LOCUS_04500 57985 59244 gene locus_tag LOCUS_04510 57985 59244 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205497.1 protein_id gnl|my_center|LOCUS_04510 59381 60643 gene locus_tag LOCUS_04520 59381 60643 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261163.1 protein_id gnl|my_center|LOCUS_04520 60645 61058 gene locus_tag LOCUS_04530 60645 61058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 61069 61482 gene locus_tag LOCUS_04540 61069 61482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 61479 61940 gene locus_tag LOCUS_04550 61479 61940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 61940 62383 gene locus_tag LOCUS_04560 61940 62383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 62425 62835 gene locus_tag LOCUS_04570 62425 62835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 65127 62830 gene locus_tag LOCUS_04580 gene clpA 65127 62830 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037131.1 protein_id gnl|my_center|LOCUS_04580 65460 65140 gene locus_tag LOCUS_04590 gene clpS 65460 65140 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064083.1 protein_id gnl|my_center|LOCUS_04590 66309 65572 gene locus_tag LOCUS_04600 66309 65572 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_04600 68701 66293 gene locus_tag LOCUS_04610 68701 66293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 68826 69470 gene locus_tag LOCUS_04620 gene cysC 68826 69470 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046849124.1 protein_id gnl|my_center|LOCUS_04620 69511 69597 gene locus_tag LOCUS_t00060 69511 69597 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 70496 69651 gene locus_tag LOCUS_04630 gene mutM 70496 69651 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102876.1 protein_id gnl|my_center|LOCUS_04630 70649 71140 gene locus_tag LOCUS_04640 70649 71140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 71521 71144 gene locus_tag LOCUS_04650 71521 71144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 71826 72269 gene locus_tag LOCUS_04660 71826 72269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 72418 73932 gene locus_tag LOCUS_04670 72418 73932 CDS product lysine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886371.1 protein_id gnl|my_center|LOCUS_04670 74048 73962 gene locus_tag LOCUS_t00070 74048 73962 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 74151 75353 gene locus_tag LOCUS_04680 74151 75353 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530350.1 protein_id gnl|my_center|LOCUS_04680 75350 77278 gene locus_tag LOCUS_04690 75350 77278 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086957.1 protein_id gnl|my_center|LOCUS_04690 80717 77334 gene locus_tag LOCUS_04700 80717 77334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 81070 81315 gene locus_tag LOCUS_04710 81070 81315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 81341 81880 gene locus_tag LOCUS_04720 gene rimM 81341 81880 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043335.1 protein_id gnl|my_center|LOCUS_04720 81916 82689 gene locus_tag LOCUS_04730 gene trmD 81916 82689 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071568.1 protein_id gnl|my_center|LOCUS_04730 82701 83048 gene locus_tag LOCUS_04740 82701 83048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 83060 83743 gene locus_tag LOCUS_04750 83060 83743 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390957.1 protein_id gnl|my_center|LOCUS_04750 83823 84200 gene locus_tag LOCUS_04760 83823 84200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 84197 84709 gene locus_tag LOCUS_04770 gene aroQ 84197 84709 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_04770 84735 85238 gene locus_tag LOCUS_04780 gene accB 84735 85238 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946212.1 protein_id gnl|my_center|LOCUS_04780 85239 86588 gene locus_tag LOCUS_04790 gene accC 85239 86588 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919750.1 protein_id gnl|my_center|LOCUS_04790 86585 87190 gene locus_tag LOCUS_04800 86585 87190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 87171 88388 gene locus_tag LOCUS_04810 87171 88388 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459669.1 protein_id gnl|my_center|LOCUS_04810 89574 88888 gene locus_tag LOCUS_04820 89574 88888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 90450 91190 gene locus_tag LOCUS_04830 90450 91190 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921244.1 protein_id gnl|my_center|LOCUS_04830 91254 92309 gene locus_tag LOCUS_04840 91254 92309 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294811.1 protein_id gnl|my_center|LOCUS_04840 92309 92728 gene locus_tag LOCUS_04850 92309 92728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 92725 93288 gene locus_tag LOCUS_04860 92725 93288 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902602.1 protein_id gnl|my_center|LOCUS_04860 93391 94272 gene locus_tag LOCUS_04870 93391 94272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 96151 96366 gene locus_tag LOCUS_04880 96151 96366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 96382 97131 gene locus_tag LOCUS_04890 gene elbB 96382 97131 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299134.1 protein_id gnl|my_center|LOCUS_04890 97122 98273 gene locus_tag LOCUS_04900 97122 98273 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902891.1 protein_id gnl|my_center|LOCUS_04900 102650 98376 gene locus_tag LOCUS_04910 102650 98376 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545209.1 protein_id gnl|my_center|LOCUS_04910 102795 103256 gene locus_tag LOCUS_04920 102795 103256 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370248.1 protein_id gnl|my_center|LOCUS_04920 103263 103694 gene locus_tag LOCUS_04930 103263 103694 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 protein_id gnl|my_center|LOCUS_04930 103739 104713 gene locus_tag LOCUS_04940 103739 104713 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651714.1 protein_id gnl|my_center|LOCUS_04940 105163 104762 gene locus_tag LOCUS_04950 105163 104762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 105303 105647 gene locus_tag LOCUS_04960 105303 105647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 105631 106254 gene locus_tag LOCUS_04970 105631 106254 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_04970 107204 106290 gene locus_tag LOCUS_04980 107204 106290 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965125.1 protein_id gnl|my_center|LOCUS_04980 107974 107201 gene locus_tag LOCUS_04990 107974 107201 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921580.1 protein_id gnl|my_center|LOCUS_04990 108798 107992 gene locus_tag LOCUS_05000 108798 107992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 108939 109979 gene locus_tag LOCUS_05010 108939 109979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 110047 111924 gene locus_tag LOCUS_05020 110047 111924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 112335 112135 gene locus_tag LOCUS_05030 112335 112135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 114470 112332 gene locus_tag LOCUS_05040 gene feoB 114470 112332 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931750.1 protein_id gnl|my_center|LOCUS_05040 114738 114475 gene locus_tag LOCUS_05050 114738 114475 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_05050 120470 114825 gene locus_tag LOCUS_05060 120470 114825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 122056 120464 gene locus_tag LOCUS_05070 122056 120464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 123207 122053 gene locus_tag LOCUS_05080 123207 122053 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_05080 123999 123259 gene locus_tag LOCUS_05090 123999 123259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 124206 124940 gene locus_tag LOCUS_05100 124206 124940 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095848.1 protein_id gnl|my_center|LOCUS_05100 124944 125504 gene locus_tag LOCUS_05110 124944 125504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 125657 126100 gene locus_tag LOCUS_05120 125657 126100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 126577 126155 gene locus_tag LOCUS_05130 126577 126155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 127011 126619 gene locus_tag LOCUS_05140 127011 126619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 127337 128167 gene locus_tag LOCUS_05150 127337 128167 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070966.1 protein_id gnl|my_center|LOCUS_05150 128892 128257 gene locus_tag LOCUS_05160 128892 128257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 129161 130243 gene locus_tag LOCUS_05170 129161 130243 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457764.1 protein_id gnl|my_center|LOCUS_05170 130236 131522 gene locus_tag LOCUS_05180 130236 131522 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186079.1 protein_id gnl|my_center|LOCUS_05180 131570 133195 gene locus_tag LOCUS_05190 gene purH 131570 133195 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_05190 133245 134426 gene locus_tag LOCUS_05200 133245 134426 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941144.1 protein_id gnl|my_center|LOCUS_05200 134704 135480 gene locus_tag LOCUS_05210 gene fabI 134704 135480 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383908.1 protein_id gnl|my_center|LOCUS_05210 135485 136567 gene locus_tag LOCUS_05220 gene aroC 135485 136567 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390373.1 protein_id gnl|my_center|LOCUS_05220 137180 137752 gene locus_tag LOCUS_05230 137180 137752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 138261 138653 gene locus_tag LOCUS_05240 138261 138653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 139807 138737 gene locus_tag LOCUS_05250 139807 138737 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546163.1 protein_id gnl|my_center|LOCUS_05250 140107 139874 gene locus_tag LOCUS_05260 140107 139874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545020.1 protein_id gnl|my_center|LOCUS_05260 142105 140279 gene locus_tag LOCUS_05270 142105 140279 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 protein_id gnl|my_center|LOCUS_05270 142344 143201 gene locus_tag LOCUS_05280 142344 143201 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545567.1 protein_id gnl|my_center|LOCUS_05280 145219 143411 gene locus_tag LOCUS_05290 145219 143411 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 protein_id gnl|my_center|LOCUS_05290 148632 145309 gene locus_tag LOCUS_05300 148632 145309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 149552 148656 gene locus_tag LOCUS_05310 149552 148656 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942175.1 protein_id gnl|my_center|LOCUS_05310 151143 149836 gene locus_tag LOCUS_05320 151143 149836 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437598.1 protein_id gnl|my_center|LOCUS_05320 151846 151127 gene locus_tag LOCUS_05330 151846 151127 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_05330 152109 151897 gene locus_tag LOCUS_05340 152109 151897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 152604 152398 gene locus_tag LOCUS_05350 152604 152398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 153191 152673 gene locus_tag LOCUS_05360 gene rnhA 153191 152673 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084134.1 protein_id gnl|my_center|LOCUS_05360 153983 153333 gene locus_tag LOCUS_05370 153983 153333 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814926.1 protein_id gnl|my_center|LOCUS_05370 155170 153977 gene locus_tag LOCUS_05380 155170 153977 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942570.1 protein_id gnl|my_center|LOCUS_05380 157432 155273 gene locus_tag LOCUS_05390 157432 155273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 158085 157435 gene locus_tag LOCUS_05400 158085 157435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 158987 158082 gene locus_tag LOCUS_05410 158987 158082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 160246 159278 gene locus_tag LOCUS_05420 160246 159278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 160680 162452 gene locus_tag LOCUS_05430 160680 162452 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943144.1 protein_id gnl|my_center|LOCUS_05430 162534 162977 gene locus_tag LOCUS_05440 162534 162977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 164392 163004 gene locus_tag LOCUS_05450 164392 163004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 167529 164578 gene locus_tag LOCUS_05460 gene uvrA 167529 164578 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_05460 167623 168276 gene locus_tag LOCUS_05470 167623 168276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 169452 168298 gene locus_tag LOCUS_05480 169452 168298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 169796 170947 gene locus_tag LOCUS_05490 169796 170947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 170944 171651 gene locus_tag LOCUS_05500 170944 171651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 174514 171674 gene locus_tag LOCUS_05510 174514 171674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 174481 174684 gene locus_tag LOCUS_05520 174481 174684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 174798 176132 gene locus_tag LOCUS_05530 174798 176132 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958618.1 protein_id gnl|my_center|LOCUS_05530 176139 177719 gene locus_tag LOCUS_05540 176139 177719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 177773 181711 gene locus_tag LOCUS_05550 177773 181711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 181744 183078 gene locus_tag LOCUS_05560 181744 183078 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938317.1 protein_id gnl|my_center|LOCUS_05560 183117 185177 gene locus_tag LOCUS_05570 183117 185177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 185180 187072 gene locus_tag LOCUS_05580 185180 187072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 >Feature sequence04 706 155 gene locus_tag LOCUS_05590 706 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 1601 1002 gene locus_tag LOCUS_05600 1601 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 3500 1713 gene locus_tag LOCUS_05610 gene mnmG 3500 1713 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195816.1 protein_id gnl|my_center|LOCUS_05610 4930 3641 gene locus_tag LOCUS_05620 gene mnmE 4930 3641 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207681.1 protein_id gnl|my_center|LOCUS_05620 5857 5210 gene locus_tag LOCUS_05630 5857 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 6075 6614 gene locus_tag LOCUS_05640 6075 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 6620 8212 gene locus_tag LOCUS_05650 gene atpA 6620 8212 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389785.1 protein_id gnl|my_center|LOCUS_05650 8258 9142 gene locus_tag LOCUS_05660 8258 9142 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388980.1 protein_id gnl|my_center|LOCUS_05660 9186 10607 gene locus_tag LOCUS_05670 gene atpD 9186 10607 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083272.1 protein_id gnl|my_center|LOCUS_05670 10640 11062 gene locus_tag LOCUS_05680 10640 11062 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083271.1 protein_id gnl|my_center|LOCUS_05680 11296 12534 gene locus_tag LOCUS_05690 11296 12534 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940944.1 protein_id gnl|my_center|LOCUS_05690 12562 14382 gene locus_tag LOCUS_05700 gene glmS 12562 14382 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087378.1 protein_id gnl|my_center|LOCUS_05700 14446 15360 gene locus_tag LOCUS_05710 14446 15360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 17133 15436 gene locus_tag LOCUS_05720 gene yidC 17133 15436 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013843865.1 protein_id gnl|my_center|LOCUS_05720 17385 17173 gene locus_tag LOCUS_05730 gene yidD 17385 17173 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106504.1 protein_id gnl|my_center|LOCUS_05730 17757 17425 gene locus_tag LOCUS_05740 gene rnpA 17757 17425 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726628.1 protein_id gnl|my_center|LOCUS_05740 18277 18465 gene locus_tag LOCUS_05750 18277 18465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 21775 18530 gene locus_tag LOCUS_05760 21775 18530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 23158 21974 gene locus_tag LOCUS_05770 23158 21974 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_05770 23164 24588 gene locus_tag LOCUS_05780 gene dnaB 23164 24588 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225362.1 protein_id gnl|my_center|LOCUS_05780 24594 25733 gene locus_tag LOCUS_05790 gene alr 24594 25733 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_05790 25747 27951 gene locus_tag LOCUS_05800 gene priA 25747 27951 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940804.1 protein_id gnl|my_center|LOCUS_05800 28417 27965 gene locus_tag LOCUS_05810 gene ccmE 28417 27965 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387797.1 protein_id gnl|my_center|LOCUS_05810 28551 28414 gene locus_tag LOCUS_05820 28551 28414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 29203 28544 gene locus_tag LOCUS_05830 29203 28544 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_05830 29973 29299 gene locus_tag LOCUS_05840 29973 29299 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228657.1 protein_id gnl|my_center|LOCUS_05840 30644 29970 gene locus_tag LOCUS_05850 30644 29970 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_05850 32155 30653 gene locus_tag LOCUS_05860 32155 30653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 32209 32763 gene locus_tag LOCUS_05870 32209 32763 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_05870 32808 33317 gene locus_tag LOCUS_05880 gene def 32808 33317 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944066.1 protein_id gnl|my_center|LOCUS_05880 33572 33390 gene locus_tag LOCUS_05890 33572 33390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 34098 33565 gene locus_tag LOCUS_05900 34098 33565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 35207 34095 gene locus_tag LOCUS_05910 gene prfA 35207 34095 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222130.1 protein_id gnl|my_center|LOCUS_05910 36483 35224 gene locus_tag LOCUS_05920 gene hemA 36483 35224 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_05920 36829 37350 gene locus_tag LOCUS_05930 36829 37350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 37483 37559 gene locus_tag LOCUS_t00080 37483 37559 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 37595 37671 gene locus_tag LOCUS_t00090 37595 37671 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 37769 37844 gene locus_tag LOCUS_t00100 37769 37844 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 37936 38020 gene locus_tag LOCUS_t00110 37936 38020 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 38488 38147 gene locus_tag LOCUS_05940 38488 38147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 41526 38569 gene locus_tag LOCUS_05950 41526 38569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 42009 41620 gene locus_tag LOCUS_05960 42009 41620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 42476 42264 gene locus_tag LOCUS_05970 42476 42264 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 protein_id gnl|my_center|LOCUS_05970 43953 42700 gene locus_tag LOCUS_05980 43953 42700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 47120 43953 gene locus_tag LOCUS_05990 47120 43953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 47855 47121 gene locus_tag LOCUS_06000 gene dnaQ 47855 47121 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_06000 49327 47852 gene locus_tag LOCUS_06010 gene hemG 49327 47852 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403969.1 protein_id gnl|my_center|LOCUS_06010 50830 49421 gene locus_tag LOCUS_06020 gene hemN 50830 49421 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704280.1 protein_id gnl|my_center|LOCUS_06020 51920 50832 gene locus_tag LOCUS_06030 gene hemE 51920 50832 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635049.1 protein_id gnl|my_center|LOCUS_06030 53380 52238 gene locus_tag LOCUS_06040 53380 52238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 53689 54549 gene locus_tag LOCUS_06050 gene folD 53689 54549 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941526.1 protein_id gnl|my_center|LOCUS_06050 54584 55477 gene locus_tag LOCUS_06060 54584 55477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 55519 57102 gene locus_tag LOCUS_06070 gene lysS 55519 57102 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066108.1 protein_id gnl|my_center|LOCUS_06070 57223 59898 gene locus_tag LOCUS_06080 57223 59898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 60369 60767 gene locus_tag LOCUS_06090 60369 60767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 60840 60915 gene locus_tag LOCUS_t00120 60840 60915 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 61125 61201 gene locus_tag LOCUS_t00130 61125 61201 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 61336 62610 gene locus_tag LOCUS_06100 61336 62610 CDS product succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880832.1 protein_id gnl|my_center|LOCUS_06100 62742 65513 gene locus_tag LOCUS_06110 62742 65513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 66426 65656 gene locus_tag LOCUS_06120 66426 65656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 67318 66632 gene locus_tag LOCUS_06130 67318 66632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 68592 67318 gene locus_tag LOCUS_06140 68592 67318 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_06140 69909 68602 gene locus_tag LOCUS_06150 69909 68602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 70160 70567 gene locus_tag LOCUS_06160 gene gcvH 70160 70567 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026899.1 protein_id gnl|my_center|LOCUS_06160 70564 70959 gene locus_tag LOCUS_06170 70564 70959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 70956 71282 gene locus_tag LOCUS_06180 70956 71282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 71325 72638 gene locus_tag LOCUS_06190 gene hflX 71325 72638 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389375.1 protein_id gnl|my_center|LOCUS_06190 72863 73159 gene locus_tag LOCUS_06200 gene groES 72863 73159 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_06200 73236 74885 gene locus_tag LOCUS_06210 gene groL 73236 74885 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975850.1 protein_id gnl|my_center|LOCUS_06210 75187 75618 gene locus_tag LOCUS_06220 75187 75618 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 protein_id gnl|my_center|LOCUS_06220 75624 76283 gene locus_tag LOCUS_06230 75624 76283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 76533 77915 gene locus_tag LOCUS_06240 76533 77915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 79529 77916 gene locus_tag LOCUS_06250 gene pckA 79529 77916 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_06250 80386 79613 gene locus_tag LOCUS_06260 80386 79613 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_06260 80775 80479 gene locus_tag LOCUS_06270 80775 80479 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_06270 83591 81033 gene locus_tag LOCUS_06280 83591 81033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 85934 83844 gene locus_tag LOCUS_06290 85934 83844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 86371 85931 gene locus_tag LOCUS_06300 86371 85931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 86622 87857 gene locus_tag LOCUS_06310 86622 87857 CDS product glyceraldehyde 3-phosphate dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546756.1 protein_id gnl|my_center|LOCUS_06310 87869 89224 gene locus_tag LOCUS_06320 gene tolB 87869 89224 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066846.1 protein_id gnl|my_center|LOCUS_06320 89266 89817 gene locus_tag LOCUS_06330 gene pal 89266 89817 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932322.1 protein_id gnl|my_center|LOCUS_06330 89867 90964 gene locus_tag LOCUS_06340 89867 90964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 90968 91654 gene locus_tag LOCUS_06350 gene queC 90968 91654 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111415.1 protein_id gnl|my_center|LOCUS_06350 91651 92655 gene locus_tag LOCUS_06360 91651 92655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 92790 94772 gene locus_tag LOCUS_06370 gene ftsH 92790 94772 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_06370 94769 95683 gene locus_tag LOCUS_06380 gene folP 94769 95683 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337038.1 protein_id gnl|my_center|LOCUS_06380 95695 97101 gene locus_tag LOCUS_06390 gene glmM 95695 97101 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_06390 97293 99203 gene locus_tag LOCUS_06400 gene thrS 97293 99203 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_06400 99321 99881 gene locus_tag LOCUS_06410 gene infC 99321 99881 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_06410 100064 100267 gene locus_tag LOCUS_06420 gene rpmI 100064 100267 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429729.1 protein_id gnl|my_center|LOCUS_06420 100298 100654 gene locus_tag LOCUS_06430 gene rplT 100298 100654 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597959.1 protein_id gnl|my_center|LOCUS_06430 100666 101706 gene locus_tag LOCUS_06440 gene pheS 100666 101706 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_06440 101826 102869 gene locus_tag LOCUS_06450 gene argC 101826 102869 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_06450 103081 103341 gene locus_tag LOCUS_06460 103081 103341 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215364.1 protein_id gnl|my_center|LOCUS_06460 103472 104371 gene locus_tag LOCUS_06470 103472 104371 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693694.1 protein_id gnl|my_center|LOCUS_06470 104419 105054 gene locus_tag LOCUS_06480 gene gmk 104419 105054 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388188.1 protein_id gnl|my_center|LOCUS_06480 105095 105517 gene locus_tag LOCUS_06490 105095 105517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 105591 107879 gene locus_tag LOCUS_06500 105591 107879 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_06500 107915 108385 gene locus_tag LOCUS_06510 107915 108385 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174212.1 protein_id gnl|my_center|LOCUS_06510 108823 108482 gene locus_tag LOCUS_06520 108823 108482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 109045 109704 gene locus_tag LOCUS_06530 109045 109704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444495.1 protein_id gnl|my_center|LOCUS_06530 109802 110056 gene locus_tag LOCUS_06540 109802 110056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 110078 111673 gene locus_tag LOCUS_06550 110078 111673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 112403 111651 gene locus_tag LOCUS_06560 gene thiD 112403 111651 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870432.1 protein_id gnl|my_center|LOCUS_06560 112630 114219 gene locus_tag LOCUS_06570 gene serA 112630 114219 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090136.1 protein_id gnl|my_center|LOCUS_06570 114353 117082 gene locus_tag LOCUS_06580 114353 117082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 118787 117093 gene locus_tag LOCUS_06590 118787 117093 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926968.1 protein_id gnl|my_center|LOCUS_06590 120223 118790 gene locus_tag LOCUS_06600 gene purF 120223 118790 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_06600 120782 120240 gene locus_tag LOCUS_06610 120782 120240 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694239.1 protein_id gnl|my_center|LOCUS_06610 122271 120907 gene locus_tag LOCUS_06620 gene radA 122271 120907 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_06620 122846 122292 gene locus_tag LOCUS_06630 122846 122292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 123722 122859 gene locus_tag LOCUS_06640 123722 122859 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933356.1 protein_id gnl|my_center|LOCUS_06640 124547 123732 gene locus_tag LOCUS_06650 124547 123732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 124723 127578 gene locus_tag LOCUS_06660 124723 127578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 127607 128716 gene locus_tag LOCUS_06670 127607 128716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 128776 129966 gene locus_tag LOCUS_06680 128776 129966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 131559 130009 gene locus_tag LOCUS_06690 131559 130009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 131871 133256 gene locus_tag LOCUS_06700 131871 133256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 >Feature sequence05 686 2008 gene locus_tag LOCUS_06710 686 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 2334 2020 gene locus_tag LOCUS_06720 2334 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 2409 2843 gene locus_tag LOCUS_06730 2409 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 3170 2856 gene locus_tag LOCUS_06740 3170 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 5758 3206 gene locus_tag LOCUS_06750 5758 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 6234 5782 gene locus_tag LOCUS_06760 6234 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 10427 6252 gene locus_tag LOCUS_06770 10427 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 11067 10432 gene locus_tag LOCUS_06780 11067 10432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 12083 11073 gene locus_tag LOCUS_06790 12083 11073 CDS product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037627.1 protein_id gnl|my_center|LOCUS_06790 12628 12152 gene locus_tag LOCUS_06800 12628 12152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 13182 12625 gene locus_tag LOCUS_06810 13182 12625 CDS product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957587.1 protein_id gnl|my_center|LOCUS_06810 13406 14905 gene locus_tag LOCUS_06820 13406 14905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 15094 16968 gene locus_tag LOCUS_06830 15094 16968 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941958.1 protein_id gnl|my_center|LOCUS_06830 17558 16989 gene locus_tag LOCUS_06840 17558 16989 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388643.1 protein_id gnl|my_center|LOCUS_06840 17794 18867 gene locus_tag LOCUS_06850 17794 18867 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968871.1 protein_id gnl|my_center|LOCUS_06850 18873 21047 gene locus_tag LOCUS_06860 18873 21047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 21078 22220 gene locus_tag LOCUS_06870 21078 22220 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_06870 22228 25668 gene locus_tag LOCUS_06880 22228 25668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 25691 26788 gene locus_tag LOCUS_06890 25691 26788 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_06890 26809 27801 gene locus_tag LOCUS_06900 26809 27801 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099334852.1 protein_id gnl|my_center|LOCUS_06900 27798 31763 gene locus_tag LOCUS_06910 27798 31763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 32703 31807 gene locus_tag LOCUS_06920 32703 31807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 36188 32700 gene locus_tag LOCUS_06930 36188 32700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 36807 36328 gene locus_tag LOCUS_06940 36807 36328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 37286 37005 gene locus_tag LOCUS_06950 37286 37005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 37993 37448 gene locus_tag LOCUS_06960 gene msrA 37993 37448 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939270.1 protein_id gnl|my_center|LOCUS_06960 37987 38250 gene locus_tag LOCUS_06970 37987 38250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 38429 38935 gene locus_tag LOCUS_06980 38429 38935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 38945 40147 gene locus_tag LOCUS_06990 38945 40147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 40156 40728 gene locus_tag LOCUS_07000 40156 40728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 41540 41136 gene locus_tag LOCUS_07010 41540 41136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 41546 42442 gene locus_tag LOCUS_07020 41546 42442 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972192.1 protein_id gnl|my_center|LOCUS_07020 42743 43144 gene locus_tag LOCUS_07030 42743 43144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 43676 45691 gene locus_tag LOCUS_07040 43676 45691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 45726 46160 gene locus_tag LOCUS_07050 gene trxC 45726 46160 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_07050 46180 46947 gene locus_tag LOCUS_07060 gene yaaA 46180 46947 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209240.1 protein_id gnl|my_center|LOCUS_07060 48227 47133 gene locus_tag LOCUS_07070 48227 47133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 50304 48295 gene locus_tag LOCUS_07080 50304 48295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 50631 54233 gene locus_tag LOCUS_07090 50631 54233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 54500 54575 gene locus_tag LOCUS_t00140 54500 54575 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 55707 56639 gene locus_tag LOCUS_07100 55707 56639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 57078 57236 gene locus_tag LOCUS_07110 57078 57236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 57946 57479 gene locus_tag LOCUS_07120 57946 57479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 58192 60771 gene locus_tag LOCUS_07130 58192 60771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 61705 60749 gene locus_tag LOCUS_07140 61705 60749 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_07140 62577 61711 gene locus_tag LOCUS_07150 62577 61711 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388840.1 protein_id gnl|my_center|LOCUS_07150 62623 62874 gene locus_tag LOCUS_07160 gene moaD 62623 62874 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971414.1 protein_id gnl|my_center|LOCUS_07160 62871 63395 gene locus_tag LOCUS_07170 62871 63395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 63705 63388 gene locus_tag LOCUS_07180 63705 63388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 63548 63557 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 63736 64707 gene locus_tag LOCUS_07190 63736 64707 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488462.1 protein_id gnl|my_center|LOCUS_07190 64856 64701 gene locus_tag LOCUS_07200 64856 64701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 66351 65071 gene locus_tag LOCUS_07210 66351 65071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 66452 67429 gene locus_tag LOCUS_07220 gene trxB 66452 67429 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390648.1 protein_id gnl|my_center|LOCUS_07220 67521 68675 gene locus_tag LOCUS_07230 67521 68675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 69360 68686 gene locus_tag LOCUS_07240 gene modB 69360 68686 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_07240 70134 69364 gene locus_tag LOCUS_07250 gene modA 70134 69364 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039007.1 protein_id gnl|my_center|LOCUS_07250 71037 70153 gene locus_tag LOCUS_07260 71037 70153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 71662 71021 gene locus_tag LOCUS_07270 71662 71021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 72088 71714 gene locus_tag LOCUS_07280 72088 71714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 72508 72113 gene locus_tag LOCUS_07290 72508 72113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 72649 73317 gene locus_tag LOCUS_07300 72649 73317 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_07300 83478 73399 gene locus_tag LOCUS_07310 83478 73399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 85535 83496 gene locus_tag LOCUS_07320 85535 83496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 86317 85532 gene locus_tag LOCUS_07330 86317 85532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 88311 86314 gene locus_tag LOCUS_07340 88311 86314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 90461 88308 gene locus_tag LOCUS_07350 90461 88308 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_07350 92312 90465 gene locus_tag LOCUS_07360 92312 90465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 113995 92339 gene locus_tag LOCUS_07370 113995 92339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 117109 114356 gene locus_tag LOCUS_07380 117109 114356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 117952 118212 gene locus_tag LOCUS_07390 117952 118212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 119184 118522 gene locus_tag LOCUS_07400 119184 118522 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092844068.1 protein_id gnl|my_center|LOCUS_07400 119319 120224 gene locus_tag LOCUS_07410 119319 120224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103250.1 protein_id gnl|my_center|LOCUS_07410 120821 120234 gene locus_tag LOCUS_07420 120821 120234 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143015.1 protein_id gnl|my_center|LOCUS_07420 121145 121627 gene locus_tag LOCUS_07430 121145 121627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 123223 121715 gene locus_tag LOCUS_07440 123223 121715 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 protein_id gnl|my_center|LOCUS_07440 124866 123334 gene locus_tag LOCUS_07450 124866 123334 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265659.1 protein_id gnl|my_center|LOCUS_07450 126629 124878 gene locus_tag LOCUS_07460 126629 124878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 128316 126838 gene locus_tag LOCUS_07470 128316 126838 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence06 4559 3363 gene locus_tag LOCUS_07480 gene queG 4559 3363 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388032.1 protein_id gnl|my_center|LOCUS_07480 4771 6456 gene locus_tag LOCUS_07490 4771 6456 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933697.1 protein_id gnl|my_center|LOCUS_07490 6496 7473 gene locus_tag LOCUS_07500 6496 7473 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933696.1 protein_id gnl|my_center|LOCUS_07500 7498 8385 gene locus_tag LOCUS_07510 7498 8385 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142939.1 protein_id gnl|my_center|LOCUS_07510 8438 10270 gene locus_tag LOCUS_07520 gene pabB 8438 10270 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404430.1 protein_id gnl|my_center|LOCUS_07520 10776 10483 gene locus_tag LOCUS_07530 10776 10483 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_07530 10988 10773 gene locus_tag LOCUS_07540 10988 10773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 12781 11237 gene locus_tag LOCUS_07550 12781 11237 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_07550 13411 12950 gene locus_tag LOCUS_07560 13411 12950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 14121 13456 gene locus_tag LOCUS_07570 14121 13456 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_07570 15661 14159 gene locus_tag LOCUS_07580 15661 14159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 16107 15658 gene locus_tag LOCUS_07590 16107 15658 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813311.1 protein_id gnl|my_center|LOCUS_07590 17208 16111 gene locus_tag LOCUS_07600 gene nadA 17208 16111 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_07600 17336 19987 gene locus_tag LOCUS_07610 gene leuS 17336 19987 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105190.1 protein_id gnl|my_center|LOCUS_07610 19995 20534 gene locus_tag LOCUS_07620 19995 20534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 20566 21621 gene locus_tag LOCUS_07630 gene holA 20566 21621 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244058.1 protein_id gnl|my_center|LOCUS_07630 22817 21618 gene locus_tag LOCUS_07640 22817 21618 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 protein_id gnl|my_center|LOCUS_07640 23124 22906 gene locus_tag LOCUS_07650 23124 22906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 23343 23705 gene locus_tag LOCUS_07660 23343 23705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 23702 24412 gene locus_tag LOCUS_07670 23702 24412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 24418 26274 gene locus_tag LOCUS_07680 24418 26274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 26334 26690 gene locus_tag LOCUS_07690 26334 26690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 26690 26989 gene locus_tag LOCUS_07700 26690 26989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 26986 27585 gene locus_tag LOCUS_07710 26986 27585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 27582 29342 gene locus_tag LOCUS_07720 27582 29342 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_07720 29405 30805 gene locus_tag LOCUS_07730 29405 30805 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869268.1 protein_id gnl|my_center|LOCUS_07730 30805 31398 gene locus_tag LOCUS_07740 30805 31398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 31810 33120 gene locus_tag LOCUS_07750 31810 33120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 33287 34342 gene locus_tag LOCUS_07760 gene purM 33287 34342 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194386.1 protein_id gnl|my_center|LOCUS_07760 34379 35047 gene locus_tag LOCUS_07770 gene purN 34379 35047 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112584.1 protein_id gnl|my_center|LOCUS_07770 35082 35915 gene locus_tag LOCUS_07780 35082 35915 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705953.1 protein_id gnl|my_center|LOCUS_07780 35944 37473 gene locus_tag LOCUS_07790 gene rfaE1 35944 37473 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_07790 37477 38430 gene locus_tag LOCUS_07800 gene rfaD 37477 38430 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821513.1 protein_id gnl|my_center|LOCUS_07800 38446 39468 gene locus_tag LOCUS_07810 gene waaF 38446 39468 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958358.1 protein_id gnl|my_center|LOCUS_07810 39453 40460 gene locus_tag LOCUS_07820 39453 40460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 40460 41470 gene locus_tag LOCUS_07830 gene waaC 40460 41470 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266460.1 protein_id gnl|my_center|LOCUS_07830 41467 42216 gene locus_tag LOCUS_07840 41467 42216 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 protein_id gnl|my_center|LOCUS_07840 42976 42221 gene locus_tag LOCUS_07850 gene hda 42976 42221 CDS product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072789.1 protein_id gnl|my_center|LOCUS_07850 43473 42973 gene locus_tag LOCUS_07860 43473 42973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 44693 43518 gene locus_tag LOCUS_07870 44693 43518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 45312 44722 gene locus_tag LOCUS_07880 gene gmhA2 45312 44722 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857991.1 protein_id gnl|my_center|LOCUS_07880 45818 45309 gene locus_tag LOCUS_07890 45818 45309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 45963 47000 gene locus_tag LOCUS_07900 45963 47000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 50548 47063 gene locus_tag LOCUS_07910 50548 47063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 50573 52495 gene locus_tag LOCUS_07920 50573 52495 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_07920 52519 53520 gene locus_tag LOCUS_07930 52519 53520 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113256.1 protein_id gnl|my_center|LOCUS_07930 53650 55863 gene locus_tag LOCUS_07940 53650 55863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 57493 55880 gene locus_tag LOCUS_07950 57493 55880 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537535.1 protein_id gnl|my_center|LOCUS_07950 58528 57494 gene locus_tag LOCUS_07960 58528 57494 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524778.1 protein_id gnl|my_center|LOCUS_07960 59843 58569 gene locus_tag LOCUS_07970 59843 58569 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094900.1 protein_id gnl|my_center|LOCUS_07970 59829 60977 gene locus_tag LOCUS_07980 59829 60977 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925698.1 protein_id gnl|my_center|LOCUS_07980 60974 62152 gene locus_tag LOCUS_07990 60974 62152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 62149 63144 gene locus_tag LOCUS_08000 62149 63144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 63433 64566 gene locus_tag LOCUS_08010 63433 64566 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259281.1 protein_id gnl|my_center|LOCUS_08010 64579 66468 gene locus_tag LOCUS_08020 gene asnB 64579 66468 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_08020 67623 66469 gene locus_tag LOCUS_08030 67623 66469 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545405.1 protein_id gnl|my_center|LOCUS_08030 69446 67620 gene locus_tag LOCUS_08040 69446 67620 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938960.1 protein_id gnl|my_center|LOCUS_08040 70983 69448 gene locus_tag LOCUS_08050 70983 69448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 71836 70997 gene locus_tag LOCUS_08060 71836 70997 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088717.1 protein_id gnl|my_center|LOCUS_08060 72885 71836 gene locus_tag LOCUS_08070 72885 71836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 73676 72882 gene locus_tag LOCUS_08080 73676 72882 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_08080 74239 73727 gene locus_tag LOCUS_08090 74239 73727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 75395 74262 gene locus_tag LOCUS_08100 75395 74262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 76364 75489 gene locus_tag LOCUS_08110 76364 75489 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926938.1 protein_id gnl|my_center|LOCUS_08110 76735 76550 gene locus_tag LOCUS_08120 76735 76550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 77580 77152 gene locus_tag LOCUS_08130 77580 77152 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687922.1 protein_id gnl|my_center|LOCUS_08130 78125 77748 gene locus_tag LOCUS_08140 78125 77748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 79614 78934 gene locus_tag LOCUS_08150 79614 78934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 82345 79628 gene locus_tag LOCUS_08160 82345 79628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 83854 82367 gene locus_tag LOCUS_08170 83854 82367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 84341 84078 gene locus_tag LOCUS_08180 84341 84078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 84544 85755 gene locus_tag LOCUS_08190 84544 85755 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951153.1 protein_id gnl|my_center|LOCUS_08190 85742 86389 gene locus_tag LOCUS_08200 gene metW 85742 86389 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_08200 86386 86910 gene locus_tag LOCUS_08210 gene hpt 86386 86910 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226700.1 protein_id gnl|my_center|LOCUS_08210 86918 87610 gene locus_tag LOCUS_08220 gene gph 86918 87610 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532061.1 protein_id gnl|my_center|LOCUS_08220 87637 88518 gene locus_tag LOCUS_08230 gene hisG 87637 88518 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937425.1 protein_id gnl|my_center|LOCUS_08230 88621 88854 gene locus_tag LOCUS_08240 88621 88854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 88921 90741 gene locus_tag LOCUS_08250 gene oadA 88921 90741 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711626.1 protein_id gnl|my_center|LOCUS_08250 90758 91924 gene locus_tag LOCUS_08260 90758 91924 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 protein_id gnl|my_center|LOCUS_08260 92172 92480 gene locus_tag LOCUS_08270 92172 92480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 93787 92540 gene locus_tag LOCUS_08280 93787 92540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 94320 93784 gene locus_tag LOCUS_08290 94320 93784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 94739 94317 gene locus_tag LOCUS_08300 94739 94317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 95196 94741 gene locus_tag LOCUS_08310 95196 94741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 96244 95165 gene locus_tag LOCUS_08320 96244 95165 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_08320 99749 96234 gene locus_tag LOCUS_08330 99749 96234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 100152 100433 gene locus_tag LOCUS_08340 100152 100433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 100666 101058 gene locus_tag LOCUS_08350 100666 101058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 101085 101852 gene locus_tag LOCUS_08360 101085 101852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 101845 102264 gene locus_tag LOCUS_08370 101845 102264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 102261 104300 gene locus_tag LOCUS_08380 gene mshL 102261 104300 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227124.1 protein_id gnl|my_center|LOCUS_08380 105341 104385 gene locus_tag LOCUS_08390 105341 104385 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902359.1 protein_id gnl|my_center|LOCUS_08390 105979 105371 gene locus_tag LOCUS_08400 105979 105371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 106306 107634 gene locus_tag LOCUS_08410 106306 107634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 107721 108698 gene locus_tag LOCUS_08420 107721 108698 CDS product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967169.1 protein_id gnl|my_center|LOCUS_08420 108708 111041 gene locus_tag LOCUS_08430 108708 111041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 111155 111388 gene locus_tag LOCUS_08440 111155 111388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 111385 111663 gene locus_tag LOCUS_08450 111385 111663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 >Feature sequence07 <1 999 gene locus_tag LOCUS_08460 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388703.1:UDP-N-acetylmuramate dehydrogenase 1026 2006 gene locus_tag LOCUS_08470 1026 2006 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_08470 1988 2677 gene locus_tag LOCUS_08480 1988 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 2816 4054 gene locus_tag LOCUS_08490 gene ftsA 2816 4054 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_08490 4152 5462 gene locus_tag LOCUS_08500 gene ftsZ 4152 5462 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497096.1 protein_id gnl|my_center|LOCUS_08500 5968 6918 gene locus_tag LOCUS_08510 gene lpxC 5968 6918 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_08510 7137 7697 gene locus_tag LOCUS_08520 7137 7697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 7694 9937 gene locus_tag LOCUS_08530 7694 9937 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 protein_id gnl|my_center|LOCUS_08530 9999 11372 gene locus_tag LOCUS_08540 9999 11372 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940194.1 protein_id gnl|my_center|LOCUS_08540 12110 11412 gene locus_tag LOCUS_08550 gene dnr 12110 11412 CDS product transcriptional regulator Dnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_08550 12262 12978 gene locus_tag LOCUS_08560 gene rsmD 12262 12978 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704347.1 protein_id gnl|my_center|LOCUS_08560 13013 13504 gene locus_tag LOCUS_08570 gene coaD 13013 13504 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011214781.1 protein_id gnl|my_center|LOCUS_08570 13511 14857 gene locus_tag LOCUS_08580 gene miaB 13511 14857 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037471.1 protein_id gnl|my_center|LOCUS_08580 14880 15917 gene locus_tag LOCUS_08590 14880 15917 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707017.1 protein_id gnl|my_center|LOCUS_08590 15944 18394 gene locus_tag LOCUS_08600 15944 18394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 18345 18824 gene locus_tag LOCUS_08610 18345 18824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 18821 20365 gene locus_tag LOCUS_08620 gene lnt 18821 20365 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483491.1 protein_id gnl|my_center|LOCUS_08620 20827 20459 gene locus_tag LOCUS_08630 20827 20459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 22990 20936 gene locus_tag LOCUS_08640 gene ligA 22990 20936 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443689.1 protein_id gnl|my_center|LOCUS_08640 24046 23012 gene locus_tag LOCUS_08650 24046 23012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 24618 24076 gene locus_tag LOCUS_08660 24618 24076 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_08660 26797 24611 gene locus_tag LOCUS_08670 26797 24611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 43058 26931 gene locus_tag LOCUS_08680 43058 26931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 46172 43065 gene locus_tag LOCUS_08690 46172 43065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08690 46998 47882 gene locus_tag LOCUS_08700 gene rfbA 46998 47882 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097851.1 protein_id gnl|my_center|LOCUS_08700 47891 48445 gene locus_tag LOCUS_08710 gene rfbC 47891 48445 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 protein_id gnl|my_center|LOCUS_08710 48442 49311 gene locus_tag LOCUS_08720 gene rfbD 48442 49311 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_08720 49304 50377 gene locus_tag LOCUS_08730 gene rfbB 49304 50377 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143225.1 protein_id gnl|my_center|LOCUS_08730 50592 50395 gene locus_tag LOCUS_08740 50592 50395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 50485 57807 gene locus_tag LOCUS_08750 50485 57807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 57951 58991 gene locus_tag LOCUS_08760 57951 58991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 58964 60922 gene locus_tag LOCUS_08770 58964 60922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 61014 61673 gene locus_tag LOCUS_08780 61014 61673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 62651 64942 gene locus_tag LOCUS_08790 gene maeB 62651 64942 CDS product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172316.1 protein_id gnl|my_center|LOCUS_08790 65115 65026 gene locus_tag LOCUS_t00150 65115 65026 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 65517 67094 gene locus_tag LOCUS_08800 gene gpmI 65517 67094 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 protein_id gnl|my_center|LOCUS_08800 67091 67939 gene locus_tag LOCUS_08810 67091 67939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 68010 69527 gene locus_tag LOCUS_08820 68010 69527 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_08820 69582 69803 gene locus_tag LOCUS_08830 69582 69803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 70039 70857 gene locus_tag LOCUS_08840 70039 70857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 70859 72253 gene locus_tag LOCUS_08850 70859 72253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 72265 73617 gene locus_tag LOCUS_08860 72265 73617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 73754 75013 gene locus_tag LOCUS_08870 gene coaBC 73754 75013 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338345.1 protein_id gnl|my_center|LOCUS_08870 75081 75542 gene locus_tag LOCUS_08880 75081 75542 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 protein_id gnl|my_center|LOCUS_08880 75593 76264 gene locus_tag LOCUS_08890 gene moeB 75593 76264 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942003.1 protein_id gnl|my_center|LOCUS_08890 76270 77211 gene locus_tag LOCUS_08900 gene cysK 76270 77211 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_08900 77208 77978 gene locus_tag LOCUS_08910 77208 77978 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704415.1 protein_id gnl|my_center|LOCUS_08910 77959 78183 gene locus_tag LOCUS_08920 77959 78183 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391512.1 protein_id gnl|my_center|LOCUS_08920 78462 78887 gene locus_tag LOCUS_08930 78462 78887 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_08930 79014 79475 gene locus_tag LOCUS_08940 gene mucR 79014 79475 CDS product exopolysaccharide biosynthesis transcriptional regulator MucR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707336.1 protein_id gnl|my_center|LOCUS_08940 79904 80938 gene locus_tag LOCUS_08950 79904 80938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 81394 81008 gene locus_tag LOCUS_08960 81394 81008 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036943.1 protein_id gnl|my_center|LOCUS_08960 82274 81432 gene locus_tag LOCUS_08970 gene panC 82274 81432 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_08970 83174 82335 gene locus_tag LOCUS_08980 gene panB 83174 82335 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942349.1 protein_id gnl|my_center|LOCUS_08980 83846 83355 gene locus_tag LOCUS_08990 83846 83355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 84798 83866 gene locus_tag LOCUS_09000 84798 83866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 85040 86608 gene locus_tag LOCUS_09010 85040 86608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 86605 87855 gene locus_tag LOCUS_09020 gene dapC 86605 87855 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 protein_id gnl|my_center|LOCUS_09020 87867 88715 gene locus_tag LOCUS_09030 gene dapD 87867 88715 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391226.1 protein_id gnl|my_center|LOCUS_09030 88720 89184 gene locus_tag LOCUS_09040 gene creA 88720 89184 CDS product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209232.1 protein_id gnl|my_center|LOCUS_09040 89204 90358 gene locus_tag LOCUS_09050 gene dapE 89204 90358 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277791.1 protein_id gnl|my_center|LOCUS_09050 90366 91124 gene locus_tag LOCUS_09060 90366 91124 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377592.1 protein_id gnl|my_center|LOCUS_09060 91279 93651 gene locus_tag LOCUS_09070 91279 93651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 94618 93731 gene locus_tag LOCUS_09080 94618 93731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 96782 94653 gene locus_tag LOCUS_09090 96782 94653 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836187.1 protein_id gnl|my_center|LOCUS_09090 97001 97885 gene locus_tag LOCUS_09100 97001 97885 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391360.1 protein_id gnl|my_center|LOCUS_09100 97903 98676 gene locus_tag LOCUS_09110 97903 98676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 98818 99591 gene locus_tag LOCUS_09120 gene map 98818 99591 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_09120 99857 101893 gene locus_tag LOCUS_09130 gene flhA 99857 101893 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_09130 101942 103339 gene locus_tag LOCUS_09140 gene flhF 101942 103339 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943680.1 protein_id gnl|my_center|LOCUS_09140 103475 104443 gene locus_tag LOCUS_09150 103475 104443 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943679.1 protein_id gnl|my_center|LOCUS_09150 104505 105269 gene locus_tag LOCUS_09160 gene whiG 104505 105269 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_09160 105274 105810 gene locus_tag LOCUS_09170 105274 105810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 105841 106941 gene locus_tag LOCUS_09180 105841 106941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 106944 107234 gene locus_tag LOCUS_09190 106944 107234 CDS product FlhB-like flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852641.1 protein_id gnl|my_center|LOCUS_09190 109667 107238 gene locus_tag LOCUS_09200 109667 107238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 110333 109719 gene locus_tag LOCUS_09210 110333 109719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence08 469 116 gene locus_tag LOCUS_09220 469 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 700 473 gene locus_tag LOCUS_09230 700 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1493 3040 gene locus_tag LOCUS_09240 1493 3040 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103418.1 protein_id gnl|my_center|LOCUS_09240 3040 3474 gene locus_tag LOCUS_09250 3040 3474 CDS product HI0074 family nucleotidyltransferase substrate-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118912.1 protein_id gnl|my_center|LOCUS_09250 3462 3860 gene locus_tag LOCUS_09260 3462 3860 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957957.1 protein_id gnl|my_center|LOCUS_09260 3850 5457 gene locus_tag LOCUS_09270 3850 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 5537 6637 gene locus_tag LOCUS_09280 5537 6637 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104341.1 protein_id gnl|my_center|LOCUS_09280 6634 9735 gene locus_tag LOCUS_09290 6634 9735 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_09290 10335 10012 gene locus_tag LOCUS_09300 10335 10012 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969960.1 protein_id gnl|my_center|LOCUS_09300 10702 10349 gene locus_tag LOCUS_09310 10702 10349 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969959.1 protein_id gnl|my_center|LOCUS_09310 12320 10821 gene locus_tag LOCUS_09320 12320 10821 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968967.1 protein_id gnl|my_center|LOCUS_09320 12727 12326 gene locus_tag LOCUS_09330 12727 12326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 12885 14372 gene locus_tag LOCUS_09340 12885 14372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 15379 14369 gene locus_tag LOCUS_09350 gene prfB 15379 14369 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148265477.1 protein_id gnl|my_center|LOCUS_09350 15619 16074 gene locus_tag LOCUS_09360 15619 16074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 16116 16412 gene locus_tag LOCUS_09370 16116 16412 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767703.1 protein_id gnl|my_center|LOCUS_09370 17191 16442 gene locus_tag LOCUS_09380 17191 16442 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903097.1 protein_id gnl|my_center|LOCUS_09380 19293 17188 gene locus_tag LOCUS_09390 19293 17188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 19384 21552 gene locus_tag LOCUS_09400 19384 21552 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104028.1 protein_id gnl|my_center|LOCUS_09400 22062 21553 gene locus_tag LOCUS_09410 22062 21553 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083151.1 protein_id gnl|my_center|LOCUS_09410 22886 22059 gene locus_tag LOCUS_09420 22886 22059 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695633.1 protein_id gnl|my_center|LOCUS_09420 23806 22883 gene locus_tag LOCUS_09430 23806 22883 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083149.1 protein_id gnl|my_center|LOCUS_09430 25107 23806 gene locus_tag LOCUS_09440 25107 23806 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935040.1 protein_id gnl|my_center|LOCUS_09440 27027 25108 gene locus_tag LOCUS_09450 gene nosZ 27027 25108 CDS product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967622.1 protein_id gnl|my_center|LOCUS_09450 29668 27569 gene locus_tag LOCUS_09460 29668 27569 CDS product NosR/NirI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083146.1 protein_id gnl|my_center|LOCUS_09460 29889 31037 gene locus_tag LOCUS_09470 29889 31037 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143816.1 protein_id gnl|my_center|LOCUS_09470 31264 31461 gene locus_tag LOCUS_09480 31264 31461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 31861 31553 gene locus_tag LOCUS_09490 31861 31553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 33569 31854 gene locus_tag LOCUS_09500 33569 31854 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_09500 34419 33583 gene locus_tag LOCUS_09510 gene folE2 34419 33583 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_09510 34569 35474 gene locus_tag LOCUS_09520 34569 35474 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_09520 35518 35925 gene locus_tag LOCUS_09530 35518 35925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 35979 37157 gene locus_tag LOCUS_09540 35979 37157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 37157 38266 gene locus_tag LOCUS_09550 37157 38266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 40259 38274 gene locus_tag LOCUS_09560 40259 38274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 40642 40283 gene locus_tag LOCUS_09570 40642 40283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 41086 40655 gene locus_tag LOCUS_09580 41086 40655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09580 43725 41083 gene locus_tag LOCUS_09590 43725 41083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 44655 43876 gene locus_tag LOCUS_09600 44655 43876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 44930 44766 gene locus_tag LOCUS_09610 44930 44766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 45158 45979 gene locus_tag LOCUS_09620 45158 45979 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_09620 46005 47075 gene locus_tag LOCUS_09630 gene hflK 46005 47075 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409358.1 protein_id gnl|my_center|LOCUS_09630 47072 47986 gene locus_tag LOCUS_09640 47072 47986 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937986.1 protein_id gnl|my_center|LOCUS_09640 47940 48164 gene locus_tag LOCUS_09650 47940 48164 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940433.1 protein_id gnl|my_center|LOCUS_09650 48168 48770 gene locus_tag LOCUS_09660 48168 48770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 48787 48966 gene locus_tag LOCUS_09670 gene rpmF 48787 48966 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638547.1 protein_id gnl|my_center|LOCUS_09670 48988 50073 gene locus_tag LOCUS_09680 gene plsX 48988 50073 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 protein_id gnl|my_center|LOCUS_09680 50070 51059 gene locus_tag LOCUS_09690 50070 51059 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_09690 52995 51133 gene locus_tag LOCUS_09700 52995 51133 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533539.1 protein_id gnl|my_center|LOCUS_09700 53548 53033 gene locus_tag LOCUS_09710 53548 53033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 53812 53612 gene locus_tag LOCUS_09720 53812 53612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 53945 55426 gene locus_tag LOCUS_09730 53945 55426 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038176.1 protein_id gnl|my_center|LOCUS_09730 55776 55372 gene locus_tag LOCUS_09740 55776 55372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 56202 55798 gene locus_tag LOCUS_09750 56202 55798 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_09750 58797 56227 gene locus_tag LOCUS_09760 58797 56227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 60872 58806 gene locus_tag LOCUS_09770 60872 58806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 61332 60949 gene locus_tag LOCUS_09780 61332 60949 CDS product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_09780 61919 61359 gene locus_tag LOCUS_09790 61919 61359 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_09790 62106 62291 gene locus_tag LOCUS_09800 62106 62291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 65554 62243 gene locus_tag LOCUS_09810 65554 62243 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244431.1 protein_id gnl|my_center|LOCUS_09810 67114 65639 gene locus_tag LOCUS_09820 67114 65639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 68468 67173 gene locus_tag LOCUS_09830 gene gltA 68468 67173 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389475.1 protein_id gnl|my_center|LOCUS_09830 69693 68560 gene locus_tag LOCUS_09840 gene zapE 69693 68560 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550551.1 protein_id gnl|my_center|LOCUS_09840 71554 70013 gene locus_tag LOCUS_09850 71554 70013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 72568 71621 gene locus_tag LOCUS_09860 72568 71621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 73398 72958 gene locus_tag LOCUS_09870 gene cadR 73398 72958 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 protein_id gnl|my_center|LOCUS_09870 73503 75464 gene locus_tag LOCUS_09880 73503 75464 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027223829.1 protein_id gnl|my_center|LOCUS_09880 77753 75711 gene locus_tag LOCUS_09890 77753 75711 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941958.1 protein_id gnl|my_center|LOCUS_09890 78292 77789 gene locus_tag LOCUS_09900 78292 77789 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_09900 78750 78319 gene locus_tag LOCUS_09910 78750 78319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 81156 78958 gene locus_tag LOCUS_09920 81156 78958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 82923 81202 gene locus_tag LOCUS_09930 82923 81202 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943144.1 protein_id gnl|my_center|LOCUS_09930 83029 82886 gene locus_tag LOCUS_09940 83029 82886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 83110 83379 gene locus_tag LOCUS_09950 83110 83379 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970463.1 protein_id gnl|my_center|LOCUS_09950 83488 84753 gene locus_tag LOCUS_09960 83488 84753 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_09960 84750 86102 gene locus_tag LOCUS_09970 84750 86102 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087697.1 protein_id gnl|my_center|LOCUS_09970 88315 86273 gene locus_tag LOCUS_09980 88315 86273 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335531.1 protein_id gnl|my_center|LOCUS_09980 88900 91746 gene locus_tag LOCUS_09990 88900 91746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 92092 92388 gene locus_tag LOCUS_10000 92092 92388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 94372 92681 gene locus_tag LOCUS_10010 94372 92681 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_10010 94775 94509 gene locus_tag LOCUS_10020 94775 94509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 94893 94806 gene locus_tag LOCUS_t00160 94893 94806 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 95614 94913 gene locus_tag LOCUS_10030 95614 94913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10030 96202 95624 gene locus_tag LOCUS_10040 96202 95624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10040 98982 96208 gene locus_tag LOCUS_10050 98982 96208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 99533 99105 gene locus_tag LOCUS_10060 99533 99105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 99727 99981 gene locus_tag LOCUS_10070 99727 99981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 99988 100533 gene locus_tag LOCUS_10080 99988 100533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 100763 100566 gene locus_tag LOCUS_10090 100763 100566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 103342 100790 gene locus_tag LOCUS_10100 103342 100790 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391400.1 protein_id gnl|my_center|LOCUS_10100 104004 103339 gene locus_tag LOCUS_10110 104004 103339 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083291.1 protein_id gnl|my_center|LOCUS_10110 104003 104674 gene locus_tag LOCUS_10120 104003 104674 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010440639.1 protein_id gnl|my_center|LOCUS_10120 104671 104976 gene locus_tag LOCUS_10130 104671 104976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 105059 105886 gene locus_tag LOCUS_10140 105059 105886 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939715.1 protein_id gnl|my_center|LOCUS_10140 106690 106109 gene locus_tag LOCUS_10150 106690 106109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 106956 107225 gene locus_tag LOCUS_10160 gene fliQ 106956 107225 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937354.1 protein_id gnl|my_center|LOCUS_10160 107245 108036 gene locus_tag LOCUS_10170 gene fliR 107245 108036 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039843.1 protein_id gnl|my_center|LOCUS_10170 108047 109129 gene locus_tag LOCUS_10180 gene flhB 108047 109129 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858726.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence09 1070 213 gene locus_tag LOCUS_10190 1070 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 5272 1157 gene locus_tag LOCUS_10200 5272 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 5575 7797 gene locus_tag LOCUS_10210 5575 7797 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048283.1 protein_id gnl|my_center|LOCUS_10210 8692 7859 gene locus_tag LOCUS_10220 gene cobA 8692 7859 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975884.1 protein_id gnl|my_center|LOCUS_10220 9783 8689 gene locus_tag LOCUS_10230 9783 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 10801 9827 gene locus_tag LOCUS_10240 10801 9827 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582557.1 protein_id gnl|my_center|LOCUS_10240 11647 10838 gene locus_tag LOCUS_10250 gene rquA 11647 10838 CDS product rhodoquinone biosynthesis methyltransferase RquA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390975.1 protein_id gnl|my_center|LOCUS_10250 12040 12306 gene locus_tag LOCUS_10260 12040 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 12594 12388 gene locus_tag LOCUS_10270 12594 12388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 14430 12766 gene locus_tag LOCUS_10280 14430 12766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 17222 14427 gene locus_tag LOCUS_10290 17222 14427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 18018 17419 gene locus_tag LOCUS_10300 18018 17419 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137608.1 protein_id gnl|my_center|LOCUS_10300 18655 18026 gene locus_tag LOCUS_10310 18655 18026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 19247 18648 gene locus_tag LOCUS_10320 gene dcd 19247 18648 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390604.1 protein_id gnl|my_center|LOCUS_10320 19888 19244 gene locus_tag LOCUS_10330 19888 19244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 20590 19895 gene locus_tag LOCUS_10340 20590 19895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 22087 20597 gene locus_tag LOCUS_10350 22087 20597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 23153 22080 gene locus_tag LOCUS_10360 23153 22080 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141839.1 protein_id gnl|my_center|LOCUS_10360 23280 24038 gene locus_tag LOCUS_10370 23280 24038 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036616.1 protein_id gnl|my_center|LOCUS_10370 24066 24800 gene locus_tag LOCUS_10380 24066 24800 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202003.1 protein_id gnl|my_center|LOCUS_10380 25603 24818 gene locus_tag LOCUS_10390 25603 24818 CDS product FNR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477663.1 protein_id gnl|my_center|LOCUS_10390 26010 27419 gene locus_tag LOCUS_10400 26010 27419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 27431 28051 gene locus_tag LOCUS_10410 27431 28051 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943605.1 protein_id gnl|my_center|LOCUS_10410 28208 29029 gene locus_tag LOCUS_10420 28208 29029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 29323 30072 gene locus_tag LOCUS_10430 29323 30072 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870067.1 protein_id gnl|my_center|LOCUS_10430 30210 30896 gene locus_tag LOCUS_10440 gene pomA 30210 30896 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071707.1 protein_id gnl|my_center|LOCUS_10440 32186 31437 gene locus_tag LOCUS_10450 32186 31437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 32528 32265 gene locus_tag LOCUS_10460 32528 32265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 32448 35147 gene locus_tag LOCUS_10470 gene secA 32448 35147 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533499.1 protein_id gnl|my_center|LOCUS_10470 35258 37558 gene locus_tag LOCUS_10480 35258 37558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 38298 37645 gene locus_tag LOCUS_10490 38298 37645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 38560 39375 gene locus_tag LOCUS_10500 38560 39375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 39368 40069 gene locus_tag LOCUS_10510 39368 40069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 40104 41168 gene locus_tag LOCUS_10520 40104 41168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 41186 42058 gene locus_tag LOCUS_10530 41186 42058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 43277 42216 gene locus_tag LOCUS_10540 gene tsaD 43277 42216 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071502.1 protein_id gnl|my_center|LOCUS_10540 43742 43314 gene locus_tag LOCUS_10550 43742 43314 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_10550 44494 43739 gene locus_tag LOCUS_10560 44494 43739 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_10560 44823 44512 gene locus_tag LOCUS_10570 44823 44512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 45177 45824 gene locus_tag LOCUS_10580 gene lolA 45177 45824 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090414.1 protein_id gnl|my_center|LOCUS_10580 45872 46360 gene locus_tag LOCUS_10590 45872 46360 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_10590 46364 47773 gene locus_tag LOCUS_10600 gene rimO 46364 47773 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_10600 47770 48462 gene locus_tag LOCUS_10610 gene lolD 47770 48462 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263326.1 protein_id gnl|my_center|LOCUS_10610 48449 49144 gene locus_tag LOCUS_10620 48449 49144 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_10620 49242 50258 gene locus_tag LOCUS_10630 gene trpS 49242 50258 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706960.1 protein_id gnl|my_center|LOCUS_10630 50309 52249 gene locus_tag LOCUS_10640 50309 52249 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563875.1 protein_id gnl|my_center|LOCUS_10640 52227 54914 gene locus_tag LOCUS_10650 gene pepN 52227 54914 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_10650 54968 55726 gene locus_tag LOCUS_10660 54968 55726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 55811 56020 gene locus_tag LOCUS_10670 55811 56020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 56029 56292 gene locus_tag LOCUS_10680 56029 56292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 56424 56642 gene locus_tag LOCUS_10690 gene infA 56424 56642 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689399.1 protein_id gnl|my_center|LOCUS_10690 56602 58563 gene locus_tag LOCUS_10700 gene parE 56602 58563 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919840.1 protein_id gnl|my_center|LOCUS_10700 58566 59867 gene locus_tag LOCUS_10710 58566 59867 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626249.1 protein_id gnl|my_center|LOCUS_10710 59963 60199 gene locus_tag LOCUS_10720 59963 60199 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_10720 60206 60799 gene locus_tag LOCUS_10730 gene ampD 60206 60799 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707565.1 protein_id gnl|my_center|LOCUS_10730 60854 62257 gene locus_tag LOCUS_10740 gene mpl 60854 62257 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707291.1 protein_id gnl|my_center|LOCUS_10740 62254 62838 gene locus_tag LOCUS_10750 62254 62838 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461717.1 protein_id gnl|my_center|LOCUS_10750 62870 64165 gene locus_tag LOCUS_10760 gene rlmD 62870 64165 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704765.1 protein_id gnl|my_center|LOCUS_10760 64274 65119 gene locus_tag LOCUS_10770 64274 65119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 65189 67657 gene locus_tag LOCUS_10780 65189 67657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 67794 69113 gene locus_tag LOCUS_10790 67794 69113 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_10790 69159 70181 gene locus_tag LOCUS_10800 69159 70181 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_10800 73247 70371 gene locus_tag LOCUS_10810 73247 70371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 73761 73441 gene locus_tag LOCUS_10820 73761 73441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 74166 73864 gene locus_tag LOCUS_10830 74166 73864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 74865 74518 gene locus_tag LOCUS_10840 74865 74518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 75334 77112 gene locus_tag LOCUS_10850 75334 77112 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943144.1 protein_id gnl|my_center|LOCUS_10850 80928 77185 gene locus_tag LOCUS_10860 80928 77185 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111930220.1 protein_id gnl|my_center|LOCUS_10860 83312 81696 gene locus_tag LOCUS_10870 83312 81696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 83688 84251 gene locus_tag LOCUS_10880 83688 84251 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532447.1 protein_id gnl|my_center|LOCUS_10880 84251 85612 gene locus_tag LOCUS_10890 84251 85612 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258857.1 protein_id gnl|my_center|LOCUS_10890 86941 85622 gene locus_tag LOCUS_10900 86941 85622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 88408 87011 gene locus_tag LOCUS_10910 88408 87011 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_10910 89489 88401 gene locus_tag LOCUS_10920 gene serC 89489 88401 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931650.1 protein_id gnl|my_center|LOCUS_10920 89902 89597 gene locus_tag LOCUS_10930 89902 89597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 90305 90820 gene locus_tag LOCUS_10940 90305 90820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939815.1 protein_id gnl|my_center|LOCUS_10940 90802 92316 gene locus_tag LOCUS_10950 90802 92316 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_10950 92431 93483 gene locus_tag LOCUS_10960 92431 93483 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681769.1 protein_id gnl|my_center|LOCUS_10960 93931 94845 gene locus_tag LOCUS_10970 93931 94845 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946804.1 protein_id gnl|my_center|LOCUS_10970 94842 98126 gene locus_tag LOCUS_10980 94842 98126 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_10980 98127 98858 gene locus_tag LOCUS_10990 98127 98858 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939808.1 protein_id gnl|my_center|LOCUS_10990 99945 98881 gene locus_tag LOCUS_11000 99945 98881 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_11000 101073 100006 gene locus_tag LOCUS_11010 101073 100006 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546142.1 protein_id gnl|my_center|LOCUS_11010 104132 101070 gene locus_tag LOCUS_11020 104132 101070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 104483 104253 gene locus_tag LOCUS_11030 104483 104253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 104515 106725 gene locus_tag LOCUS_11040 104515 106725 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942301.1 protein_id gnl|my_center|LOCUS_11040 >Feature sequence10 371 1138 gene locus_tag LOCUS_11050 371 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1801 1187 gene locus_tag LOCUS_11060 1801 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 2838 1879 gene locus_tag LOCUS_11070 2838 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 3026 2835 gene locus_tag LOCUS_11080 3026 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 3724 3023 gene locus_tag LOCUS_11090 3724 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 4677 3721 gene locus_tag LOCUS_11100 4677 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 5931 4708 gene locus_tag LOCUS_11110 gene mshG 5931 4708 CDS product MSHA fimbrial biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704369.1 protein_id gnl|my_center|LOCUS_11110 8003 6018 gene locus_tag LOCUS_11120 8003 6018 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073811.1 protein_id gnl|my_center|LOCUS_11120 9174 8029 gene locus_tag LOCUS_11130 9174 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 10100 9171 gene locus_tag LOCUS_11140 gene mshM 10100 9171 CDS product MSHA fimbrial biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704366.1 protein_id gnl|my_center|LOCUS_11140 11799 10156 gene locus_tag LOCUS_11150 11799 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 13052 11985 gene locus_tag LOCUS_11160 13052 11985 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256737.1 protein_id gnl|my_center|LOCUS_11160 15775 13049 gene locus_tag LOCUS_11170 15775 13049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 17260 15788 gene locus_tag LOCUS_11180 17260 15788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 19109 17271 gene locus_tag LOCUS_11190 19109 17271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 20231 19134 gene locus_tag LOCUS_11200 20231 19134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 20525 20908 gene locus_tag LOCUS_11210 20525 20908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 22951 21410 gene locus_tag LOCUS_11220 22951 21410 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660540.1 protein_id gnl|my_center|LOCUS_11220 23370 22957 gene locus_tag LOCUS_11230 23370 22957 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_11230 24164 23400 gene locus_tag LOCUS_11240 24164 23400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 26789 24216 gene locus_tag LOCUS_11250 26789 24216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 27219 26797 gene locus_tag LOCUS_11260 27219 26797 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_11260 29178 27244 gene locus_tag LOCUS_11270 29178 27244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 31983 29359 gene locus_tag LOCUS_11280 31983 29359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 33154 32015 gene locus_tag LOCUS_11290 gene carA 33154 32015 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_11290 34320 33175 gene locus_tag LOCUS_11300 34320 33175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 34989 34369 gene locus_tag LOCUS_11310 gene aat 34989 34369 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113368.1 protein_id gnl|my_center|LOCUS_11310 35295 37547 gene locus_tag LOCUS_11320 35295 37547 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706513.1 protein_id gnl|my_center|LOCUS_11320 37544 38863 gene locus_tag LOCUS_11330 37544 38863 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_11330 38952 40208 gene locus_tag LOCUS_11340 gene trpB 38952 40208 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687637.1 protein_id gnl|my_center|LOCUS_11340 40205 41032 gene locus_tag LOCUS_11350 gene trpA 40205 41032 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392849.1 protein_id gnl|my_center|LOCUS_11350 41075 43258 gene locus_tag LOCUS_11360 41075 43258 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461597.1 protein_id gnl|my_center|LOCUS_11360 43329 43970 gene locus_tag LOCUS_11370 43329 43970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 46407 44038 gene locus_tag LOCUS_11380 46407 44038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 47509 46409 gene locus_tag LOCUS_11390 47509 46409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 48481 47525 gene locus_tag LOCUS_11400 48481 47525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 49509 48478 gene locus_tag LOCUS_11410 49509 48478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 49901 49536 gene locus_tag LOCUS_11420 49901 49536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 50373 49936 gene locus_tag LOCUS_11430 50373 49936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 50882 50370 gene locus_tag LOCUS_11440 50882 50370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 51908 50982 gene locus_tag LOCUS_11450 51908 50982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286905.1 protein_id gnl|my_center|LOCUS_11450 52367 51948 gene locus_tag LOCUS_11460 52367 51948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 53459 52395 gene locus_tag LOCUS_11470 53459 52395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273072.1 protein_id gnl|my_center|LOCUS_11470 54444 53731 gene locus_tag LOCUS_11480 54444 53731 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070966.1 protein_id gnl|my_center|LOCUS_11480 54772 54981 gene locus_tag LOCUS_11490 54772 54981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 55415 55077 gene locus_tag LOCUS_11500 gene soxZ 55415 55077 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881177.1 protein_id gnl|my_center|LOCUS_11500 55961 55476 gene locus_tag LOCUS_11510 gene soxY 55961 55476 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086296.1 protein_id gnl|my_center|LOCUS_11510 56627 56019 gene locus_tag LOCUS_11520 gene napC 56627 56019 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528376.1 protein_id gnl|my_center|LOCUS_11520 58223 56916 gene locus_tag LOCUS_11530 58223 56916 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_11530 58872 58246 gene locus_tag LOCUS_11540 58872 58246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 59564 58983 gene locus_tag LOCUS_11550 59564 58983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 60549 59848 gene locus_tag LOCUS_11560 gene yrfG 60549 59848 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942337.1 protein_id gnl|my_center|LOCUS_11560 61772 60549 gene locus_tag LOCUS_11570 gene argJ 61772 60549 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110156.1 protein_id gnl|my_center|LOCUS_11570 61912 62361 gene locus_tag LOCUS_11580 61912 62361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 63286 62351 gene locus_tag LOCUS_11590 gene bioC 63286 62351 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035637.1 protein_id gnl|my_center|LOCUS_11590 63466 63939 gene locus_tag LOCUS_11600 gene greA 63466 63939 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722610.1 protein_id gnl|my_center|LOCUS_11600 63952 64620 gene locus_tag LOCUS_11610 gene rlmE 63952 64620 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443939.1 protein_id gnl|my_center|LOCUS_11610 64648 66108 gene locus_tag LOCUS_11620 gene guaB 64648 66108 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947450.1 protein_id gnl|my_center|LOCUS_11620 66125 67723 gene locus_tag LOCUS_11630 gene guaA 66125 67723 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942834.1 protein_id gnl|my_center|LOCUS_11630 67962 68606 gene locus_tag LOCUS_11640 67962 68606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 68635 69063 gene locus_tag LOCUS_11650 68635 69063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 69738 69136 gene locus_tag LOCUS_11660 gene ybjG 69738 69136 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295291.1 protein_id gnl|my_center|LOCUS_11660 70729 70007 gene locus_tag LOCUS_11670 70729 70007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 70932 72275 gene locus_tag LOCUS_11680 gene tig 70932 72275 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245213.1 protein_id gnl|my_center|LOCUS_11680 72400 73014 gene locus_tag LOCUS_11690 gene clpP 72400 73014 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552734.1 protein_id gnl|my_center|LOCUS_11690 73032 74297 gene locus_tag LOCUS_11700 gene clpX 73032 74297 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301524.1 protein_id gnl|my_center|LOCUS_11700 74324 76780 gene locus_tag LOCUS_11710 gene lon 74324 76780 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389427.1 protein_id gnl|my_center|LOCUS_11710 76890 78401 gene locus_tag LOCUS_11720 76890 78401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 80710 78428 gene locus_tag LOCUS_11730 80710 78428 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388200.1 protein_id gnl|my_center|LOCUS_11730 81783 80785 gene locus_tag LOCUS_11740 81783 80785 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268102.1 protein_id gnl|my_center|LOCUS_11740 98215 82049 gene locus_tag LOCUS_11750 98215 82049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 >Feature sequence11 2064 826 gene locus_tag LOCUS_11760 2064 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 4214 2061 gene locus_tag LOCUS_11770 gene aas 4214 2061 CDS product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209843.1 protein_id gnl|my_center|LOCUS_11770 4984 4211 gene locus_tag LOCUS_11780 4984 4211 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112491.1 protein_id gnl|my_center|LOCUS_11780 11153 4989 gene locus_tag LOCUS_11790 11153 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008617987.1 protein_id gnl|my_center|LOCUS_11790 11378 11779 gene locus_tag LOCUS_11800 11378 11779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 11937 12287 gene locus_tag LOCUS_11810 11937 12287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 12506 14296 gene locus_tag LOCUS_11820 12506 14296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 14458 14868 gene locus_tag LOCUS_11830 14458 14868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 14856 18896 gene locus_tag LOCUS_11840 14856 18896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 18929 21769 gene locus_tag LOCUS_11850 18929 21769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 22126 21962 gene locus_tag LOCUS_11860 22126 21962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 22691 22966 gene locus_tag LOCUS_11870 22691 22966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 23195 24382 gene locus_tag LOCUS_11880 23195 24382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 24474 26447 gene locus_tag LOCUS_11890 24474 26447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 26512 28038 gene locus_tag LOCUS_11900 26512 28038 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088170.1 protein_id gnl|my_center|LOCUS_11900 28084 28725 gene locus_tag LOCUS_11910 28084 28725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11910 28712 29704 gene locus_tag LOCUS_11920 28712 29704 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967057.1 protein_id gnl|my_center|LOCUS_11920 29701 30525 gene locus_tag LOCUS_11930 29701 30525 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088174.1 protein_id gnl|my_center|LOCUS_11930 30529 31452 gene locus_tag LOCUS_11940 30529 31452 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088175.1 protein_id gnl|my_center|LOCUS_11940 31525 32142 gene locus_tag LOCUS_11950 gene gmhA 31525 32142 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942729.1 protein_id gnl|my_center|LOCUS_11950 32139 33158 gene locus_tag LOCUS_11960 32139 33158 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957731.1 protein_id gnl|my_center|LOCUS_11960 34030 33182 gene locus_tag LOCUS_11970 34030 33182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 34757 34092 gene locus_tag LOCUS_11980 34757 34092 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517243.1 protein_id gnl|my_center|LOCUS_11980 34722 34952 gene locus_tag LOCUS_11990 34722 34952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 35903 34839 gene locus_tag LOCUS_12000 35903 34839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 36266 38308 gene locus_tag LOCUS_12010 36266 38308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 38305 39330 gene locus_tag LOCUS_12020 38305 39330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 39330 42827 gene locus_tag LOCUS_12030 39330 42827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 42843 43661 gene locus_tag LOCUS_12040 42843 43661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 44462 43776 gene locus_tag LOCUS_12050 44462 43776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 45101 44478 gene locus_tag LOCUS_12060 45101 44478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 45959 45186 gene locus_tag LOCUS_12070 45959 45186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 46321 45956 gene locus_tag LOCUS_12080 46321 45956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 47334 46327 gene locus_tag LOCUS_12090 47334 46327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 47859 47350 gene locus_tag LOCUS_12100 47859 47350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 49206 47887 gene locus_tag LOCUS_12110 49206 47887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 50345 49179 gene locus_tag LOCUS_12120 50345 49179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 51209 50388 gene locus_tag LOCUS_12130 51209 50388 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003105.1 protein_id gnl|my_center|LOCUS_12130 51395 51673 gene locus_tag LOCUS_12140 51395 51673 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009941095.1 protein_id gnl|my_center|LOCUS_12140 51712 52722 gene locus_tag LOCUS_12150 gene aitP 51712 52722 CDS product CDF family iron/cobalt efflux transporter AitP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112362.1 protein_id gnl|my_center|LOCUS_12150 53849 52725 gene locus_tag LOCUS_12160 53849 52725 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_12160 56700 53839 gene locus_tag LOCUS_12170 56700 53839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 57536 56697 gene locus_tag LOCUS_12180 57536 56697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 58090 57644 gene locus_tag LOCUS_12190 58090 57644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 58308 58832 gene locus_tag LOCUS_12200 58308 58832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 59148 60530 gene locus_tag LOCUS_12210 59148 60530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 60724 62295 gene locus_tag LOCUS_12220 60724 62295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 62320 63075 gene locus_tag LOCUS_12230 gene fabG 62320 63075 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888576.1 protein_id gnl|my_center|LOCUS_12230 63191 64096 gene locus_tag LOCUS_12240 63191 64096 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392272.1 protein_id gnl|my_center|LOCUS_12240 64202 64762 gene locus_tag LOCUS_12250 gene rfbC 64202 64762 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356893.1 protein_id gnl|my_center|LOCUS_12250 64784 65725 gene locus_tag LOCUS_12260 64784 65725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 65722 66654 gene locus_tag LOCUS_12270 65722 66654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 66720 67751 gene locus_tag LOCUS_12280 66720 67751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 67802 69028 gene locus_tag LOCUS_12290 67802 69028 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739314.1 protein_id gnl|my_center|LOCUS_12290 69181 70167 gene locus_tag LOCUS_12300 69181 70167 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 protein_id gnl|my_center|LOCUS_12300 70207 70656 gene locus_tag LOCUS_12310 70207 70656 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937385.1 protein_id gnl|my_center|LOCUS_12310 70649 71665 gene locus_tag LOCUS_12320 70649 71665 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_12320 71662 72636 gene locus_tag LOCUS_12330 71662 72636 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887356.1 protein_id gnl|my_center|LOCUS_12330 72717 73952 gene locus_tag LOCUS_12340 72717 73952 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975517.1 protein_id gnl|my_center|LOCUS_12340 74292 77063 gene locus_tag LOCUS_12350 74292 77063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 77266 79284 gene locus_tag LOCUS_12360 77266 79284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 79921 79304 gene locus_tag LOCUS_12370 79921 79304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 80325 79936 gene locus_tag LOCUS_12380 80325 79936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 80619 82490 gene locus_tag LOCUS_12390 gene recQ 80619 82490 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_12390 82514 83056 gene locus_tag LOCUS_12400 82514 83056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 83596 84114 gene locus_tag LOCUS_12410 83596 84114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 84124 85194 gene locus_tag LOCUS_12420 84124 85194 CDS product YydG family radical SAM peptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242609.1 protein_id gnl|my_center|LOCUS_12420 85191 86084 gene locus_tag LOCUS_12430 85191 86084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 87256 86093 gene locus_tag LOCUS_12440 87256 86093 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290820.1 protein_id gnl|my_center|LOCUS_12440 87649 87909 gene locus_tag LOCUS_12450 87649 87909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 88283 90301 gene locus_tag LOCUS_12460 88283 90301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 90304 91326 gene locus_tag LOCUS_12470 90304 91326 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706832.1 protein_id gnl|my_center|LOCUS_12470 91323 94784 gene locus_tag LOCUS_12480 91323 94784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 94856 95677 gene locus_tag LOCUS_12490 94856 95677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 95867 96031 gene locus_tag LOCUS_12500 95867 96031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 96043 97194 gene locus_tag LOCUS_12510 96043 97194 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926879.1 protein_id gnl|my_center|LOCUS_12510 97198 97941 gene locus_tag LOCUS_12520 97198 97941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057678.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence12 333 1367 gene locus_tag LOCUS_12530 333 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1553 2530 gene locus_tag LOCUS_12540 1553 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 2567 4786 gene locus_tag LOCUS_12550 2567 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 4990 8241 gene locus_tag LOCUS_12560 4990 8241 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388279.1 protein_id gnl|my_center|LOCUS_12560 8281 8799 gene locus_tag LOCUS_12570 8281 8799 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037040.1 protein_id gnl|my_center|LOCUS_12570 8879 10156 gene locus_tag LOCUS_12580 8879 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 10171 11013 gene locus_tag LOCUS_12590 gene cheR 10171 11013 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091728.1 protein_id gnl|my_center|LOCUS_12590 11163 11537 gene locus_tag LOCUS_12600 11163 11537 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_12600 11577 12746 gene locus_tag LOCUS_12610 11577 12746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 13688 12831 gene locus_tag LOCUS_12620 13688 12831 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_12620 13938 14861 gene locus_tag LOCUS_12630 13938 14861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 14864 15337 gene locus_tag LOCUS_12640 14864 15337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 16630 15428 gene locus_tag LOCUS_12650 16630 15428 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941806.1 protein_id gnl|my_center|LOCUS_12650 18739 16640 gene locus_tag LOCUS_12660 18739 16640 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941945.1 protein_id gnl|my_center|LOCUS_12660 19270 18905 gene locus_tag LOCUS_12670 19270 18905 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941944.1 protein_id gnl|my_center|LOCUS_12670 19629 19270 gene locus_tag LOCUS_12680 19629 19270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 19906 21966 gene locus_tag LOCUS_12690 19906 21966 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941958.1 protein_id gnl|my_center|LOCUS_12690 22038 22547 gene locus_tag LOCUS_12700 22038 22547 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941344.1 protein_id gnl|my_center|LOCUS_12700 22608 23573 gene locus_tag LOCUS_12710 22608 23573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 23605 24609 gene locus_tag LOCUS_12720 23605 24609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 25677 24712 gene locus_tag LOCUS_12730 25677 24712 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420408.1 protein_id gnl|my_center|LOCUS_12730 26026 28536 gene locus_tag LOCUS_12740 26026 28536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 28752 31052 gene locus_tag LOCUS_12750 28752 31052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 34085 31137 gene locus_tag LOCUS_12760 34085 31137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 34334 36046 gene locus_tag LOCUS_12770 34334 36046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 36265 36687 gene locus_tag LOCUS_12780 36265 36687 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_12780 36750 37091 gene locus_tag LOCUS_12790 36750 37091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 39542 37188 gene locus_tag LOCUS_12800 39542 37188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 39807 43712 gene locus_tag LOCUS_12810 39807 43712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 43877 45940 gene locus_tag LOCUS_12820 43877 45940 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400568.1 protein_id gnl|my_center|LOCUS_12820 45954 46490 gene locus_tag LOCUS_12830 gene cobU 45954 46490 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082599.1 protein_id gnl|my_center|LOCUS_12830 46492 47550 gene locus_tag LOCUS_12840 gene cobT 46492 47550 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038174.1 protein_id gnl|my_center|LOCUS_12840 47543 48238 gene locus_tag LOCUS_12850 47543 48238 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086787.1 protein_id gnl|my_center|LOCUS_12850 48358 49779 gene locus_tag LOCUS_12860 48358 49779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 49776 50570 gene locus_tag LOCUS_12870 49776 50570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 52259 50520 gene locus_tag LOCUS_12880 gene recN 52259 50520 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706784.1 protein_id gnl|my_center|LOCUS_12880 52386 52460 gene locus_tag LOCUS_t00170 52386 52460 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 54896 52689 gene locus_tag LOCUS_12890 54896 52689 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126413.1 protein_id gnl|my_center|LOCUS_12890 55049 54900 gene locus_tag LOCUS_12900 55049 54900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 56051 55056 gene locus_tag LOCUS_12910 56051 55056 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 protein_id gnl|my_center|LOCUS_12910 57617 56379 gene locus_tag LOCUS_12920 57617 56379 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_12920 57743 58207 gene locus_tag LOCUS_12930 gene bcp 57743 58207 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292536.1 protein_id gnl|my_center|LOCUS_12930 58715 58269 gene locus_tag LOCUS_12940 58715 58269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 58954 60189 gene locus_tag LOCUS_12950 gene dsrA 58954 60189 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_12950 60244 61317 gene locus_tag LOCUS_12960 gene dsrB 60244 61317 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_12960 61334 63064 gene locus_tag LOCUS_12970 61334 63064 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933900.1 protein_id gnl|my_center|LOCUS_12970 63079 63444 gene locus_tag LOCUS_12980 63079 63444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933899.1 protein_id gnl|my_center|LOCUS_12980 63738 63508 gene locus_tag LOCUS_12990 63738 63508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 63798 64628 gene locus_tag LOCUS_13000 63798 64628 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_13000 64618 66729 gene locus_tag LOCUS_13010 64618 66729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 66787 67620 gene locus_tag LOCUS_13020 66787 67620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 67705 68319 gene locus_tag LOCUS_13030 67705 68319 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100063.1 protein_id gnl|my_center|LOCUS_13030 69689 68325 gene locus_tag LOCUS_13040 gene amrB 69689 68325 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_13040 71151 69760 gene locus_tag LOCUS_13050 71151 69760 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140787.1 protein_id gnl|my_center|LOCUS_13050 72323 71643 gene locus_tag LOCUS_13060 72323 71643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 76220 72459 gene locus_tag LOCUS_13070 76220 72459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 78223 76226 gene locus_tag LOCUS_13080 78223 76226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 78666 78226 gene locus_tag LOCUS_13090 78666 78226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 80763 78670 gene locus_tag LOCUS_13100 80763 78670 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532918.1 protein_id gnl|my_center|LOCUS_13100 81673 80795 gene locus_tag LOCUS_13110 gene lsrF 81673 80795 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933433.1 protein_id gnl|my_center|LOCUS_13110 81869 82675 gene locus_tag LOCUS_13120 81869 82675 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975594.1 protein_id gnl|my_center|LOCUS_13120 82672 83049 gene locus_tag LOCUS_13130 82672 83049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 83631 83374 gene locus_tag LOCUS_13140 83631 83374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390515.1 protein_id gnl|my_center|LOCUS_13140 85670 83826 gene locus_tag LOCUS_13150 85670 83826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 86557 85667 gene locus_tag LOCUS_13160 86557 85667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 87585 86713 gene locus_tag LOCUS_13170 87585 86713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 87845 88093 gene locus_tag LOCUS_13180 87845 88093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 88173 88406 gene locus_tag LOCUS_13190 88173 88406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 89463 88477 gene locus_tag LOCUS_13200 89463 88477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 90887 89937 gene locus_tag LOCUS_13210 90887 89937 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098747.1 protein_id gnl|my_center|LOCUS_13210 91411 90920 gene locus_tag LOCUS_13220 91411 90920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 92872 91514 gene locus_tag LOCUS_13230 92872 91514 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_13230 93172 93393 gene locus_tag LOCUS_13240 93172 93393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 93500 94681 gene locus_tag LOCUS_13250 gene acrE 93500 94681 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160363.1 protein_id gnl|my_center|LOCUS_13250 94692 95216 gene locus_tag LOCUS_13260 94692 95216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13260 >Feature sequence13 1155 670 gene locus_tag LOCUS_13270 1155 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1288 2337 gene locus_tag LOCUS_13280 1288 2337 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_13280 2392 3168 gene locus_tag LOCUS_13290 2392 3168 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020696.1 protein_id gnl|my_center|LOCUS_13290 7477 3638 gene locus_tag LOCUS_13300 7477 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 8322 7507 gene locus_tag LOCUS_13310 gene larE 8322 7507 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_13310 9095 8322 gene locus_tag LOCUS_13320 gene larB 9095 8322 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_13320 10383 9175 gene locus_tag LOCUS_13330 gene larC 10383 9175 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_13330 11927 10380 gene locus_tag LOCUS_13340 11927 10380 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_13340 12973 11927 gene locus_tag LOCUS_13350 12973 11927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 13877 12966 gene locus_tag LOCUS_13360 13877 12966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 15186 13963 gene locus_tag LOCUS_13370 15186 13963 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_13370 15866 15234 gene locus_tag LOCUS_13380 15866 15234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 16165 16542 gene locus_tag LOCUS_13390 16165 16542 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_13390 18407 16707 gene locus_tag LOCUS_13400 18407 16707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 20103 18391 gene locus_tag LOCUS_13410 20103 18391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 24242 20100 gene locus_tag LOCUS_13420 24242 20100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 25169 24261 gene locus_tag LOCUS_13430 25169 24261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 25501 26181 gene locus_tag LOCUS_13440 25501 26181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 26268 28076 gene locus_tag LOCUS_13450 26268 28076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 28467 28219 gene locus_tag LOCUS_13460 28467 28219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 29092 28457 gene locus_tag LOCUS_13470 29092 28457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 29985 29107 gene locus_tag LOCUS_13480 29985 29107 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256841.1 protein_id gnl|my_center|LOCUS_13480 31697 29985 gene locus_tag LOCUS_13490 31697 29985 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256840.1 protein_id gnl|my_center|LOCUS_13490 32588 31830 gene locus_tag LOCUS_13500 gene sucD 32588 31830 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388967.1 protein_id gnl|my_center|LOCUS_13500 33875 32715 gene locus_tag LOCUS_13510 gene sucC 33875 32715 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 protein_id gnl|my_center|LOCUS_13510 35751 34030 gene locus_tag LOCUS_13520 35751 34030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 36547 35807 gene locus_tag LOCUS_13530 36547 35807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 38946 36703 gene locus_tag LOCUS_13540 38946 36703 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142855.1 protein_id gnl|my_center|LOCUS_13540 39925 39110 gene locus_tag LOCUS_13550 39925 39110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 41281 39950 gene locus_tag LOCUS_13560 41281 39950 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550333.1 protein_id gnl|my_center|LOCUS_13560 43082 41442 gene locus_tag LOCUS_13570 43082 41442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 45146 43107 gene locus_tag LOCUS_13580 45146 43107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 46057 45410 gene locus_tag LOCUS_13590 gene recR 46057 45410 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_13590 46377 46057 gene locus_tag LOCUS_13600 46377 46057 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420010.1 protein_id gnl|my_center|LOCUS_13600 48157 46421 gene locus_tag LOCUS_13610 48157 46421 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338432.1 protein_id gnl|my_center|LOCUS_13610 48472 48382 gene locus_tag LOCUS_t00180 48472 48382 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 49000 48521 gene locus_tag LOCUS_13620 gene tadA 49000 48521 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810985.1 protein_id gnl|my_center|LOCUS_13620 49596 48997 gene locus_tag LOCUS_13630 49596 48997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 49864 49774 gene locus_tag LOCUS_t00190 49864 49774 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 50404 51240 gene locus_tag LOCUS_13640 50404 51240 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_13640 51747 51322 gene locus_tag LOCUS_13650 51747 51322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 51890 53278 gene locus_tag LOCUS_13660 51890 53278 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_13660 53265 53915 gene locus_tag LOCUS_13670 53265 53915 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_13670 54889 53894 gene locus_tag LOCUS_13680 54889 53894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 55614 54988 gene locus_tag LOCUS_13690 55614 54988 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006699921.1 protein_id gnl|my_center|LOCUS_13690 57268 55583 gene locus_tag LOCUS_13700 57268 55583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 58422 57313 gene locus_tag LOCUS_13710 58422 57313 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480283.1 protein_id gnl|my_center|LOCUS_13710 59867 58443 gene locus_tag LOCUS_13720 59867 58443 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_13720 60396 62864 gene locus_tag LOCUS_13730 gene nirB 60396 62864 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530942.1 protein_id gnl|my_center|LOCUS_13730 62861 63187 gene locus_tag LOCUS_13740 gene nirD 62861 63187 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530461.1 protein_id gnl|my_center|LOCUS_13740 63180 65837 gene locus_tag LOCUS_13750 63180 65837 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973413.1 protein_id gnl|my_center|LOCUS_13750 66352 65834 gene locus_tag LOCUS_13760 66352 65834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 67929 66358 gene locus_tag LOCUS_13770 67929 66358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 69153 68107 gene locus_tag LOCUS_13780 69153 68107 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_13780 72983 69210 gene locus_tag LOCUS_13790 72983 69210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 76365 73129 gene locus_tag LOCUS_13800 gene fdhF 76365 73129 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726709.1 protein_id gnl|my_center|LOCUS_13800 77917 76412 gene locus_tag LOCUS_13810 77917 76412 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205011.1 protein_id gnl|my_center|LOCUS_13810 87956 78153 gene locus_tag LOCUS_13820 87956 78153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence14 670 1623 gene locus_tag LOCUS_13830 gene rluC 670 1623 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201356046.1 protein_id gnl|my_center|LOCUS_13830 1790 3010 gene locus_tag LOCUS_13840 1790 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 3101 4825 gene locus_tag LOCUS_13850 3101 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 6802 4955 gene locus_tag LOCUS_13860 6802 4955 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444166.1 protein_id gnl|my_center|LOCUS_13860 6796 6960 gene locus_tag LOCUS_13870 6796 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 7034 7957 gene locus_tag LOCUS_13880 7034 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 8004 9971 gene locus_tag LOCUS_13890 8004 9971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 10291 10674 gene locus_tag LOCUS_13900 10291 10674 CDS product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331338.1 protein_id gnl|my_center|LOCUS_13900 10845 16772 gene locus_tag LOCUS_13910 10845 16772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 16846 17313 gene locus_tag LOCUS_13920 16846 17313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 19525 17573 gene locus_tag LOCUS_13930 19525 17573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 21122 19608 gene locus_tag LOCUS_13940 21122 19608 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_13940 21982 21092 gene locus_tag LOCUS_13950 21982 21092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 22866 21979 gene locus_tag LOCUS_13960 22866 21979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 23809 22883 gene locus_tag LOCUS_13970 23809 22883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 24005 26593 gene locus_tag LOCUS_13980 24005 26593 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073156.1 protein_id gnl|my_center|LOCUS_13980 26593 27741 gene locus_tag LOCUS_13990 26593 27741 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088731.1 protein_id gnl|my_center|LOCUS_13990 27763 28395 gene locus_tag LOCUS_14000 27763 28395 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403382.1 protein_id gnl|my_center|LOCUS_14000 28398 29462 gene locus_tag LOCUS_14010 28398 29462 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_14010 29493 30821 gene locus_tag LOCUS_14020 29493 30821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 33425 30816 gene locus_tag LOCUS_14030 gene clpB 33425 30816 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_14030 33684 36224 gene locus_tag LOCUS_14040 gene acnB 33684 36224 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797887.1 protein_id gnl|my_center|LOCUS_14040 37911 36280 gene locus_tag LOCUS_14050 gene nadB 37911 36280 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 protein_id gnl|my_center|LOCUS_14050 38112 38708 gene locus_tag LOCUS_14060 gene rpoE 38112 38708 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_14060 38728 39126 gene locus_tag LOCUS_14070 38728 39126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 39138 39611 gene locus_tag LOCUS_14080 39138 39611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 39713 41146 gene locus_tag LOCUS_14090 39713 41146 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_14090 41242 41496 gene locus_tag LOCUS_14100 gene rpsU 41242 41496 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014762084.1 protein_id gnl|my_center|LOCUS_14100 41651 43492 gene locus_tag LOCUS_14110 41651 43492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 44472 43522 gene locus_tag LOCUS_14120 gene hemC 44472 43522 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939176.1 protein_id gnl|my_center|LOCUS_14120 44659 46308 gene locus_tag LOCUS_14130 44659 46308 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087573.1 protein_id gnl|my_center|LOCUS_14130 46341 47177 gene locus_tag LOCUS_14140 gene kdsA 46341 47177 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946916.1 protein_id gnl|my_center|LOCUS_14140 47174 48271 gene locus_tag LOCUS_14150 gene gcvT 47174 48271 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958390.1 protein_id gnl|my_center|LOCUS_14150 48664 52485 gene locus_tag LOCUS_14160 48664 52485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 52482 53321 gene locus_tag LOCUS_14170 52482 53321 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079012.1 protein_id gnl|my_center|LOCUS_14170 53318 53905 gene locus_tag LOCUS_14180 53318 53905 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036380.1 protein_id gnl|my_center|LOCUS_14180 53898 56078 gene locus_tag LOCUS_14190 53898 56078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 56368 57381 gene locus_tag LOCUS_14200 56368 57381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 58435 57575 gene locus_tag LOCUS_14210 58435 57575 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217633758.1 protein_id gnl|my_center|LOCUS_14210 59570 58587 gene locus_tag LOCUS_14220 gene sppA 59570 58587 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267147.1 protein_id gnl|my_center|LOCUS_14220 60078 59587 gene locus_tag LOCUS_14230 60078 59587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 61448 60150 gene locus_tag LOCUS_14240 gene eno 61448 60150 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 protein_id gnl|my_center|LOCUS_14240 63013 61529 gene locus_tag LOCUS_14250 gene gcvPB 63013 61529 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958389.1 protein_id gnl|my_center|LOCUS_14250 64377 63016 gene locus_tag LOCUS_14260 gene gcvPA 64377 63016 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770511.1 protein_id gnl|my_center|LOCUS_14260 67332 64483 gene locus_tag LOCUS_14270 67332 64483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 67956 67666 gene locus_tag LOCUS_14280 67956 67666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 68063 68314 gene locus_tag LOCUS_14290 68063 68314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 68382 69326 gene locus_tag LOCUS_14300 68382 69326 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060991800.1 protein_id gnl|my_center|LOCUS_14300 69424 70017 gene locus_tag LOCUS_14310 69424 70017 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391493.1 protein_id gnl|my_center|LOCUS_14310 70084 70701 gene locus_tag LOCUS_14320 gene pth 70084 70701 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941324.1 protein_id gnl|my_center|LOCUS_14320 70843 71952 gene locus_tag LOCUS_14330 gene ychF 70843 71952 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_14330 71967 72602 gene locus_tag LOCUS_14340 71967 72602 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063917.1 protein_id gnl|my_center|LOCUS_14340 73696 72599 gene locus_tag LOCUS_14350 73696 72599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 74086 75090 gene locus_tag LOCUS_14360 74086 75090 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305130.1 protein_id gnl|my_center|LOCUS_14360 75199 76104 gene locus_tag LOCUS_14370 75199 76104 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205164.1 protein_id gnl|my_center|LOCUS_14370 76140 76409 gene locus_tag LOCUS_14380 76140 76409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 76422 77852 gene locus_tag LOCUS_14390 76422 77852 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525043.1 protein_id gnl|my_center|LOCUS_14390 77951 79480 gene locus_tag LOCUS_14400 77951 79480 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_14400 80152 79595 gene locus_tag LOCUS_14410 80152 79595 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971134.1 protein_id gnl|my_center|LOCUS_14410 80930 80349 gene locus_tag LOCUS_14420 gene sodB 80930 80349 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380941.1 protein_id gnl|my_center|LOCUS_14420 81614 80961 gene locus_tag LOCUS_14430 81614 80961 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943859.1 protein_id gnl|my_center|LOCUS_14430 81747 82310 gene locus_tag LOCUS_14440 81747 82310 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122724.1 protein_id gnl|my_center|LOCUS_14440 82381 82465 gene locus_tag LOCUS_t00200 82381 82465 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 82552 82625 gene locus_tag LOCUS_t00210 82552 82625 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 82644 82719 gene locus_tag LOCUS_t00220 82644 82719 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 82815 84005 gene locus_tag LOCUS_14450 gene tuf 82815 84005 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088152.1 protein_id gnl|my_center|LOCUS_14450 84046 84201 gene locus_tag LOCUS_14460 gene rpmG 84046 84201 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_14460 84231 84306 gene locus_tag LOCUS_t00230 84231 84306 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 84450 84641 gene locus_tag LOCUS_14470 84450 84641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 84725 85255 gene locus_tag LOCUS_14480 gene nusG 84725 85255 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390510.1 protein_id gnl|my_center|LOCUS_14480 85303 85734 gene locus_tag LOCUS_14490 gene rplK 85303 85734 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390509.1 protein_id gnl|my_center|LOCUS_14490 85746 86435 gene locus_tag LOCUS_14500 gene rplA 85746 86435 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390508.1 protein_id gnl|my_center|LOCUS_14500 86530 87057 gene locus_tag LOCUS_14510 gene rplJ 86530 87057 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 protein_id gnl|my_center|LOCUS_14510 87111 87497 gene locus_tag LOCUS_14520 gene rplL 87111 87497 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003028681.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence15 <1 3104 gene locus_tag LOCUS_14530 <1 3104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011817311.1:methionine synthase 3956 3597 gene locus_tag LOCUS_14540 3956 3597 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_14540 4239 3949 gene locus_tag LOCUS_14550 4239 3949 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_14550 4835 6061 gene locus_tag LOCUS_14560 4835 6061 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255992.1 protein_id gnl|my_center|LOCUS_14560 6820 6122 gene locus_tag LOCUS_14570 6820 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 7952 6903 gene locus_tag LOCUS_14580 7952 6903 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390645.1 protein_id gnl|my_center|LOCUS_14580 8153 7956 gene locus_tag LOCUS_14590 8153 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 8839 8288 gene locus_tag LOCUS_14600 8839 8288 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941805.1 protein_id gnl|my_center|LOCUS_14600 9512 8847 gene locus_tag LOCUS_14610 9512 8847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 10621 9509 gene locus_tag LOCUS_14620 10621 9509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 13346 10614 gene locus_tag LOCUS_14630 13346 10614 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704393.1 protein_id gnl|my_center|LOCUS_14630 14094 13366 gene locus_tag LOCUS_14640 14094 13366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 14444 14094 gene locus_tag LOCUS_14650 14444 14094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 16160 14460 gene locus_tag LOCUS_14660 16160 14460 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037070.1 protein_id gnl|my_center|LOCUS_14660 16356 19037 gene locus_tag LOCUS_14670 16356 19037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 19633 19055 gene locus_tag LOCUS_14680 19633 19055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 20577 19630 gene locus_tag LOCUS_14690 20577 19630 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_14690 20919 23138 gene locus_tag LOCUS_14700 20919 23138 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925780.1 protein_id gnl|my_center|LOCUS_14700 23383 23595 gene locus_tag LOCUS_14710 23383 23595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 24000 23668 gene locus_tag LOCUS_14720 24000 23668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 25226 24342 gene locus_tag LOCUS_14730 25226 24342 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978476.1 protein_id gnl|my_center|LOCUS_14730 25813 25223 gene locus_tag LOCUS_14740 25813 25223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 28039 25817 gene locus_tag LOCUS_14750 28039 25817 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932548.1 protein_id gnl|my_center|LOCUS_14750 29309 28041 gene locus_tag LOCUS_14760 29309 28041 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 protein_id gnl|my_center|LOCUS_14760 29621 32530 gene locus_tag LOCUS_14770 29621 32530 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_14770 32911 33642 gene locus_tag LOCUS_14780 32911 33642 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_14780 33639 34607 gene locus_tag LOCUS_14790 33639 34607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 35950 35168 gene locus_tag LOCUS_14800 gene fliP 35950 35168 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_14800 36555 35947 gene locus_tag LOCUS_14810 36555 35947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 36848 36555 gene locus_tag LOCUS_14820 gene fliN 36848 36555 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037084.1 protein_id gnl|my_center|LOCUS_14820 37954 36968 gene locus_tag LOCUS_14830 gene fliM 37954 36968 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938209.1 protein_id gnl|my_center|LOCUS_14830 38494 37979 gene locus_tag LOCUS_14840 gene fliL 38494 37979 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780442.1 protein_id gnl|my_center|LOCUS_14840 40266 38815 gene locus_tag LOCUS_14850 gene flgE 40266 38815 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680830.1 protein_id gnl|my_center|LOCUS_14850 41023 40349 gene locus_tag LOCUS_14860 41023 40349 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388305.1 protein_id gnl|my_center|LOCUS_14860 42643 41315 gene locus_tag LOCUS_14870 42643 41315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 42776 42630 gene locus_tag LOCUS_14880 42776 42630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 43932 42937 gene locus_tag LOCUS_14890 43932 42937 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388502.1 protein_id gnl|my_center|LOCUS_14890 44452 44066 gene locus_tag LOCUS_14900 44452 44066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 45064 45378 gene locus_tag LOCUS_14910 gene hsbA 45064 45378 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_14910 45554 47371 gene locus_tag LOCUS_14920 45554 47371 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268439.1 protein_id gnl|my_center|LOCUS_14920 47454 48578 gene locus_tag LOCUS_14930 47454 48578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 50381 48924 gene locus_tag LOCUS_14940 gene der 50381 48924 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_14940 51579 50371 gene locus_tag LOCUS_14950 gene bamB 51579 50371 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460257.1 protein_id gnl|my_center|LOCUS_14950 52220 51576 gene locus_tag LOCUS_14960 52220 51576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 53492 52239 gene locus_tag LOCUS_14970 gene hisS 53492 52239 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417932.1 protein_id gnl|my_center|LOCUS_14970 54595 53489 gene locus_tag LOCUS_14980 gene ispG 54595 53489 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_14980 56337 54592 gene locus_tag LOCUS_14990 56337 54592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 57164 56337 gene locus_tag LOCUS_15000 57164 56337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 58900 57173 gene locus_tag LOCUS_15010 58900 57173 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926542.1 protein_id gnl|my_center|LOCUS_15010 59015 60043 gene locus_tag LOCUS_15020 gene hisC 59015 60043 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943720.1 protein_id gnl|my_center|LOCUS_15020 60095 61168 gene locus_tag LOCUS_15030 gene dapF 60095 61168 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876947.1 protein_id gnl|my_center|LOCUS_15030 61594 61145 gene locus_tag LOCUS_15040 61594 61145 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966071.1 protein_id gnl|my_center|LOCUS_15040 61872 61591 gene locus_tag LOCUS_15050 61872 61591 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087375.1 protein_id gnl|my_center|LOCUS_15050 62356 61958 gene locus_tag LOCUS_15060 62356 61958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 62995 62630 gene locus_tag LOCUS_15070 62995 62630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15070 63634 62999 gene locus_tag LOCUS_15080 63634 62999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15080 65673 63655 gene locus_tag LOCUS_15090 65673 63655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 64873 64882 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 66771 65701 gene locus_tag LOCUS_15100 66771 65701 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974676.1 protein_id gnl|my_center|LOCUS_15100 67680 66880 gene locus_tag LOCUS_15110 67680 66880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 68359 67763 gene locus_tag LOCUS_15120 68359 67763 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_15120 68753 68343 gene locus_tag LOCUS_15130 gene siaC 68753 68343 CDS product biofilm formation regulator SiaD modulator protein SiaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083913.1 protein_id gnl|my_center|LOCUS_15130 68902 70170 gene locus_tag LOCUS_15140 68902 70170 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_15140 70286 70987 gene locus_tag LOCUS_15150 gene fkpA 70286 70987 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704938.1 protein_id gnl|my_center|LOCUS_15150 71058 71639 gene locus_tag LOCUS_15160 71058 71639 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768434.1 protein_id gnl|my_center|LOCUS_15160 71699 73231 gene locus_tag LOCUS_15170 71699 73231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 73239 76364 gene locus_tag LOCUS_15180 73239 76364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 77114 76404 gene locus_tag LOCUS_15190 77114 76404 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943655.1 protein_id gnl|my_center|LOCUS_15190 77854 77111 gene locus_tag LOCUS_15200 gene pomA 77854 77111 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482965.1 protein_id gnl|my_center|LOCUS_15200 78616 78026 gene locus_tag LOCUS_15210 78616 78026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 79851 78802 gene locus_tag LOCUS_15220 gene mtnA 79851 78802 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_15220 80092 79943 gene locus_tag LOCUS_15230 80092 79943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 80122 80460 gene locus_tag LOCUS_15240 80122 80460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 80974 80591 gene locus_tag LOCUS_15250 80974 80591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 81045 81701 gene locus_tag LOCUS_15260 81045 81701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 81701 83638 gene locus_tag LOCUS_15270 81701 83638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 83642 84151 gene locus_tag LOCUS_15280 83642 84151 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 protein_id gnl|my_center|LOCUS_15280 84148 85068 gene locus_tag LOCUS_15290 gene rimK 84148 85068 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096254.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence16 463 669 gene locus_tag LOCUS_15300 463 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 653 925 gene locus_tag LOCUS_15310 653 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 989 1237 gene locus_tag LOCUS_15320 989 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1224 2042 gene locus_tag LOCUS_15330 1224 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 2564 2154 gene locus_tag LOCUS_15340 2564 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 2781 2650 gene locus_tag LOCUS_15350 2781 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 4480 2795 gene locus_tag LOCUS_15360 4480 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 4776 5120 gene locus_tag LOCUS_15370 4776 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 5643 5236 gene locus_tag LOCUS_15380 5643 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 9601 5741 gene locus_tag LOCUS_15390 9601 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 10408 9797 gene locus_tag LOCUS_15400 10408 9797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 10839 11093 gene locus_tag LOCUS_15410 10839 11093 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626074.1 protein_id gnl|my_center|LOCUS_15410 11284 11487 gene locus_tag LOCUS_15420 11284 11487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 11484 11696 gene locus_tag LOCUS_15430 11484 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 12016 11939 gene locus_tag LOCUS_t00240 12016 11939 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13119 12088 gene locus_tag LOCUS_15440 gene rsgA 13119 12088 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366295.1 protein_id gnl|my_center|LOCUS_15440 13220 15337 gene locus_tag LOCUS_15450 gene rlmKL 13220 15337 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_15450 15548 16990 gene locus_tag LOCUS_15460 15548 16990 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941905.1 protein_id gnl|my_center|LOCUS_15460 18916 17630 gene locus_tag LOCUS_15470 18916 17630 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391423.1 protein_id gnl|my_center|LOCUS_15470 19503 18913 gene locus_tag LOCUS_15480 19503 18913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 20579 19566 gene locus_tag LOCUS_15490 20579 19566 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721134.1 protein_id gnl|my_center|LOCUS_15490 21361 20699 gene locus_tag LOCUS_15500 gene nth 21361 20699 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185942.1 protein_id gnl|my_center|LOCUS_15500 21693 21358 gene locus_tag LOCUS_15510 21693 21358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 21825 22928 gene locus_tag LOCUS_15520 gene nagZ 21825 22928 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640386.1 protein_id gnl|my_center|LOCUS_15520 22949 23344 gene locus_tag LOCUS_15530 22949 23344 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_15530 23447 23522 gene locus_tag LOCUS_t00250 23447 23522 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 24553 24125 gene locus_tag LOCUS_15540 gene hicB 24553 24125 CDS product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209405.1 protein_id gnl|my_center|LOCUS_15540 24739 24969 gene locus_tag LOCUS_15550 24739 24969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 25302 26882 gene locus_tag LOCUS_15560 25302 26882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 27004 27459 gene locus_tag LOCUS_15570 27004 27459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 28615 27452 gene locus_tag LOCUS_15580 28615 27452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 28920 29717 gene locus_tag LOCUS_15590 28920 29717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 30672 29785 gene locus_tag LOCUS_15600 30672 29785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 31566 30733 gene locus_tag LOCUS_15610 31566 30733 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525286.1 protein_id gnl|my_center|LOCUS_15610 31774 32790 gene locus_tag LOCUS_15620 gene hemB 31774 32790 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144341.1 protein_id gnl|my_center|LOCUS_15620 32820 33869 gene locus_tag LOCUS_15630 32820 33869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_15630 33869 34123 gene locus_tag LOCUS_15640 33869 34123 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229888.1 protein_id gnl|my_center|LOCUS_15640 34127 35233 gene locus_tag LOCUS_15650 34127 35233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057110.1 protein_id gnl|my_center|LOCUS_15650 35352 38594 gene locus_tag LOCUS_15660 gene carB 35352 38594 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_15660 38663 39022 gene locus_tag LOCUS_15670 38663 39022 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222856.1 protein_id gnl|my_center|LOCUS_15670 39637 39440 gene locus_tag LOCUS_15680 39637 39440 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_15680 42608 39777 gene locus_tag LOCUS_15690 42608 39777 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391286.1 protein_id gnl|my_center|LOCUS_15690 42833 43867 gene locus_tag LOCUS_15700 42833 43867 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_15700 43938 44927 gene locus_tag LOCUS_15710 gene mreC 43938 44927 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388230.1 protein_id gnl|my_center|LOCUS_15710 45009 45503 gene locus_tag LOCUS_15720 45009 45503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 45542 47524 gene locus_tag LOCUS_15730 gene mrdA 45542 47524 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_15730 47540 48784 gene locus_tag LOCUS_15740 gene mrdB 47540 48784 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781440.1 protein_id gnl|my_center|LOCUS_15740 48799 49776 gene locus_tag LOCUS_15750 gene lpxD 48799 49776 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393447.1 protein_id gnl|my_center|LOCUS_15750 49785 50387 gene locus_tag LOCUS_15760 49785 50387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 52145 50466 gene locus_tag LOCUS_15770 52145 50466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 53119 52289 gene locus_tag LOCUS_15780 53119 52289 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_15780 53373 53116 gene locus_tag LOCUS_15790 gene grxC 53373 53116 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948013.1 protein_id gnl|my_center|LOCUS_15790 54068 53373 gene locus_tag LOCUS_15800 54068 53373 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529448.1 protein_id gnl|my_center|LOCUS_15800 54318 54857 gene locus_tag LOCUS_15810 54318 54857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 54854 55276 gene locus_tag LOCUS_15820 54854 55276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 55577 55254 gene locus_tag LOCUS_15830 55577 55254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 56461 55616 gene locus_tag LOCUS_15840 56461 55616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 56846 58243 gene locus_tag LOCUS_15850 gene mgtE 56846 58243 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125941.1 protein_id gnl|my_center|LOCUS_15850 58285 59679 gene locus_tag LOCUS_15860 gene mgtE 58285 59679 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228410.1 protein_id gnl|my_center|LOCUS_15860 62001 59725 gene locus_tag LOCUS_15870 62001 59725 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257539.1 protein_id gnl|my_center|LOCUS_15870 63931 62003 gene locus_tag LOCUS_15880 63931 62003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 65494 63950 gene locus_tag LOCUS_15890 65494 63950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 67791 65494 gene locus_tag LOCUS_15900 67791 65494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 68033 69085 gene locus_tag LOCUS_15910 68033 69085 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256737.1 protein_id gnl|my_center|LOCUS_15910 69261 69671 gene locus_tag LOCUS_15920 69261 69671 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_15920 69826 71148 gene locus_tag LOCUS_15930 69826 71148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 71192 72319 gene locus_tag LOCUS_15940 71192 72319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 73012 72560 gene locus_tag LOCUS_15950 73012 72560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 72908 73597 gene locus_tag LOCUS_15960 72908 73597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 73821 74813 gene locus_tag LOCUS_15970 73821 74813 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247176.1 protein_id gnl|my_center|LOCUS_15970 74839 76422 gene locus_tag LOCUS_15980 74839 76422 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103094.1 protein_id gnl|my_center|LOCUS_15980 76638 77918 gene locus_tag LOCUS_15990 76638 77918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 77983 78717 gene locus_tag LOCUS_16000 77983 78717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 78755 81730 gene locus_tag LOCUS_16010 78755 81730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 81863 82471 gene locus_tag LOCUS_16020 81863 82471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 82727 82651 gene locus_tag LOCUS_t00260 82727 82651 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 82870 82762 gene locus_tag LOCUS_r00010 82870 82762 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence17 741 142 gene locus_tag LOCUS_16030 741 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 2015 738 gene locus_tag LOCUS_16040 2015 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536312.1 protein_id gnl|my_center|LOCUS_16040 2311 10206 gene locus_tag LOCUS_16050 2311 10206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918990.1 protein_id gnl|my_center|LOCUS_16050 11674 10301 gene locus_tag LOCUS_16060 gene bioA 11674 10301 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057770.1 protein_id gnl|my_center|LOCUS_16060 12859 11750 gene locus_tag LOCUS_16070 12859 11750 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_16070 15797 12849 gene locus_tag LOCUS_16080 15797 12849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 16196 15837 gene locus_tag LOCUS_16090 16196 15837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 16686 16222 gene locus_tag LOCUS_16100 16686 16222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 18244 16865 gene locus_tag LOCUS_16110 18244 16865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 22422 18244 gene locus_tag LOCUS_16120 22422 18244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 23106 22549 gene locus_tag LOCUS_16130 23106 22549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 23465 23103 gene locus_tag LOCUS_16140 23465 23103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 24111 23608 gene locus_tag LOCUS_16150 24111 23608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 24331 24747 gene locus_tag LOCUS_16160 24331 24747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 24985 25134 gene locus_tag LOCUS_16170 24985 25134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 25165 25701 gene locus_tag LOCUS_16180 25165 25701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 25721 27457 gene locus_tag LOCUS_16190 25721 27457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 27658 28485 gene locus_tag LOCUS_16200 27658 28485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 30050 28491 gene locus_tag LOCUS_16210 30050 28491 CDS product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497115.1 protein_id gnl|my_center|LOCUS_16210 31220 30066 gene locus_tag LOCUS_16220 gene nirJ 31220 30066 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 protein_id gnl|my_center|LOCUS_16220 32313 31318 gene locus_tag LOCUS_16230 32313 31318 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903298.1 protein_id gnl|my_center|LOCUS_16230 32852 32310 gene locus_tag LOCUS_16240 32852 32310 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111534.1 protein_id gnl|my_center|LOCUS_16240 33326 32874 gene locus_tag LOCUS_16250 33326 32874 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084864.1 protein_id gnl|my_center|LOCUS_16250 34516 33323 gene locus_tag LOCUS_16260 gene nirF 34516 33323 CDS product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 protein_id gnl|my_center|LOCUS_16260 34767 34513 gene locus_tag LOCUS_16270 34767 34513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 35477 36346 gene locus_tag LOCUS_16280 35477 36346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 36362 37270 gene locus_tag LOCUS_16290 gene nrfD 36362 37270 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462220.1 protein_id gnl|my_center|LOCUS_16290 37288 39636 gene locus_tag LOCUS_16300 37288 39636 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_16300 39674 40339 gene locus_tag LOCUS_16310 39674 40339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 40473 42083 gene locus_tag LOCUS_16320 gene nirS 40473 42083 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_16320 42156 42587 gene locus_tag LOCUS_16330 42156 42587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 42673 43521 gene locus_tag LOCUS_16340 42673 43521 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990818.1 protein_id gnl|my_center|LOCUS_16340 43555 43800 gene locus_tag LOCUS_16350 43555 43800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 43912 45558 gene locus_tag LOCUS_16360 gene nirS 43912 45558 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_16360 45599 45850 gene locus_tag LOCUS_16370 45599 45850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 46468 45968 gene locus_tag LOCUS_16380 46468 45968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 48001 46487 gene locus_tag LOCUS_16390 48001 46487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 49075 48284 gene locus_tag LOCUS_16400 gene rlmB 49075 48284 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293282.1 protein_id gnl|my_center|LOCUS_16400 50553 49075 gene locus_tag LOCUS_16410 gene cysS 50553 49075 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_16410 50699 51856 gene locus_tag LOCUS_16420 50699 51856 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919408.1 protein_id gnl|my_center|LOCUS_16420 51856 52149 gene locus_tag LOCUS_16430 51856 52149 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_16430 52222 53853 gene locus_tag LOCUS_16440 52222 53853 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142798.1 protein_id gnl|my_center|LOCUS_16440 53968 55230 gene locus_tag LOCUS_16450 gene murA 53968 55230 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771755.1 protein_id gnl|my_center|LOCUS_16450 55376 56692 gene locus_tag LOCUS_16460 gene hisD 55376 56692 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537892.1 protein_id gnl|my_center|LOCUS_16460 56689 57288 gene locus_tag LOCUS_16470 gene hisB 56689 57288 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391344.1 protein_id gnl|my_center|LOCUS_16470 57310 57945 gene locus_tag LOCUS_16480 gene hisH 57310 57945 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_16480 57949 58692 gene locus_tag LOCUS_16490 gene hisA 57949 58692 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_16490 58804 60750 gene locus_tag LOCUS_16500 58804 60750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 60852 61862 gene locus_tag LOCUS_16510 gene queA 60852 61862 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143576.1 protein_id gnl|my_center|LOCUS_16510 61859 62986 gene locus_tag LOCUS_16520 gene tgt 61859 62986 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_16520 63132 63518 gene locus_tag LOCUS_16530 63132 63518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 63524 65104 gene locus_tag LOCUS_16540 gene secD 63524 65104 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_16540 65177 66127 gene locus_tag LOCUS_16550 gene secF 65177 66127 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087502.1 protein_id gnl|my_center|LOCUS_16550 66124 66540 gene locus_tag LOCUS_16560 66124 66540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 66602 66967 gene locus_tag LOCUS_16570 66602 66967 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_16570 67003 68709 gene locus_tag LOCUS_16580 gene ilvB 67003 68709 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942556.1 protein_id gnl|my_center|LOCUS_16580 68719 69216 gene locus_tag LOCUS_16590 gene ilvN 68719 69216 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_16590 69265 70281 gene locus_tag LOCUS_16600 gene ilvC 69265 70281 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942554.1 protein_id gnl|my_center|LOCUS_16600 70371 71018 gene locus_tag LOCUS_16610 70371 71018 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940238.1 protein_id gnl|my_center|LOCUS_16610 71015 71812 gene locus_tag LOCUS_16620 gene pssA 71015 71812 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_16620 72710 71934 gene locus_tag LOCUS_16630 72710 71934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 73380 72751 gene locus_tag LOCUS_16640 gene lpoB 73380 72751 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172966546.1 protein_id gnl|my_center|LOCUS_16640 73925 73461 gene locus_tag LOCUS_16650 73925 73461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 >Feature sequence18 <1 1515 gene locus_tag LOCUS_16660 <1 1515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705481.1:nitrate reductase catalytic subunit NapA 1660 2487 gene locus_tag LOCUS_16670 gene napG 1660 2487 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705482.1 protein_id gnl|my_center|LOCUS_16670 2491 3357 gene locus_tag LOCUS_16680 gene napH 2491 3357 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705483.1 protein_id gnl|my_center|LOCUS_16680 3354 3812 gene locus_tag LOCUS_16690 3354 3812 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262390.1 protein_id gnl|my_center|LOCUS_16690 3866 4447 gene locus_tag LOCUS_16700 3866 4447 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705485.1 protein_id gnl|my_center|LOCUS_16700 5696 5466 gene locus_tag LOCUS_16710 5696 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 6185 5826 gene locus_tag LOCUS_16720 6185 5826 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_16720 6663 6454 gene locus_tag LOCUS_16730 6663 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 6937 7227 gene locus_tag LOCUS_16740 6937 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 7653 9524 gene locus_tag LOCUS_16750 7653 9524 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869775.1 protein_id gnl|my_center|LOCUS_16750 9521 10360 gene locus_tag LOCUS_16760 9521 10360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 10347 11171 gene locus_tag LOCUS_16770 10347 11171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 11391 16574 gene locus_tag LOCUS_16780 11391 16574 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_16780 16571 17200 gene locus_tag LOCUS_16790 16571 17200 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341145.1 protein_id gnl|my_center|LOCUS_16790 17326 17162 gene locus_tag LOCUS_16800 17326 17162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 17568 17344 gene locus_tag LOCUS_16810 17568 17344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 19393 17600 gene locus_tag LOCUS_16820 19393 17600 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965497.1 protein_id gnl|my_center|LOCUS_16820 20592 19402 gene locus_tag LOCUS_16830 20592 19402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 21339 20662 gene locus_tag LOCUS_16840 21339 20662 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267999.1 protein_id gnl|my_center|LOCUS_16840 22031 22318 gene locus_tag LOCUS_16850 22031 22318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 22315 23316 gene locus_tag LOCUS_16860 22315 23316 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_16860 23380 23889 gene locus_tag LOCUS_16870 23380 23889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 24394 25368 gene locus_tag LOCUS_16880 24394 25368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 25455 25763 gene locus_tag LOCUS_16890 25455 25763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 25760 26131 gene locus_tag LOCUS_16900 25760 26131 CDS product DUF4810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815875.1 protein_id gnl|my_center|LOCUS_16900 26148 26873 gene locus_tag LOCUS_16910 26148 26873 CDS product DUF799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103486.1 protein_id gnl|my_center|LOCUS_16910 27406 27618 gene locus_tag LOCUS_16920 27406 27618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 27631 28086 gene locus_tag LOCUS_16930 27631 28086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 28648 29856 gene locus_tag LOCUS_16940 28648 29856 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_16940 29860 30102 gene locus_tag LOCUS_16950 29860 30102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 30099 30356 gene locus_tag LOCUS_16960 30099 30356 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_16960 30488 31558 gene locus_tag LOCUS_16970 30488 31558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 31694 31924 gene locus_tag LOCUS_16980 31694 31924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 31935 34172 gene locus_tag LOCUS_16990 31935 34172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 34337 34816 gene locus_tag LOCUS_17000 34337 34816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 34813 35313 gene locus_tag LOCUS_17010 34813 35313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 35562 35487 gene locus_tag LOCUS_t00270 35562 35487 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 35734 36195 gene locus_tag LOCUS_17020 35734 36195 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082024.1 protein_id gnl|my_center|LOCUS_17020 37044 36202 gene locus_tag LOCUS_17030 gene nlpI 37044 36202 CDS product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705628.1 protein_id gnl|my_center|LOCUS_17030 37365 37144 gene locus_tag LOCUS_17040 37365 37144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 38720 37539 gene locus_tag LOCUS_17050 gene lpxB 38720 37539 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_17050 39720 38713 gene locus_tag LOCUS_17060 39720 38713 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_17060 40660 39788 gene locus_tag LOCUS_17070 gene lpxI 40660 39788 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_17070 41421 40651 gene locus_tag LOCUS_17080 gene lpxA 41421 40651 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_17080 41909 41418 gene locus_tag LOCUS_17090 gene fabZ 41909 41418 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942905.1 protein_id gnl|my_center|LOCUS_17090 42688 42137 gene locus_tag LOCUS_17100 42688 42137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 45057 42760 gene locus_tag LOCUS_17110 gene bamA 45057 42760 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440405.1 protein_id gnl|my_center|LOCUS_17110 46299 45208 gene locus_tag LOCUS_17120 gene rseP 46299 45208 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545838.1 protein_id gnl|my_center|LOCUS_17120 47471 46281 gene locus_tag LOCUS_17130 47471 46281 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389467.1 protein_id gnl|my_center|LOCUS_17130 48336 47461 gene locus_tag LOCUS_17140 48336 47461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 49070 48345 gene locus_tag LOCUS_17150 49070 48345 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_17150 49650 49093 gene locus_tag LOCUS_17160 gene frr 49650 49093 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_17160 50363 49650 gene locus_tag LOCUS_17170 gene pyrH 50363 49650 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_17170 51303 50392 gene locus_tag LOCUS_17180 gene tsf 51303 50392 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389462.1 protein_id gnl|my_center|LOCUS_17180 52162 51386 gene locus_tag LOCUS_17190 gene rpsB 52162 51386 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262347.1 protein_id gnl|my_center|LOCUS_17190 53239 52412 gene locus_tag LOCUS_17200 53239 52412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811766.1 protein_id gnl|my_center|LOCUS_17200 53371 53446 gene locus_tag LOCUS_t00280 53371 53446 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 53611 54822 gene locus_tag LOCUS_17210 53611 54822 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 protein_id gnl|my_center|LOCUS_17210 55487 54819 gene locus_tag LOCUS_17220 55487 54819 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225569.1 protein_id gnl|my_center|LOCUS_17220 55623 55811 gene locus_tag LOCUS_17230 55623 55811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 55981 56160 gene locus_tag LOCUS_17240 55981 56160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 56613 57026 gene locus_tag LOCUS_17250 56613 57026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 57201 57542 gene locus_tag LOCUS_17260 57201 57542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 57834 57907 gene locus_tag LOCUS_t00290 57834 57907 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 57934 58164 gene locus_tag LOCUS_17270 57934 58164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 58155 58230 gene locus_tag LOCUS_t00300 58155 58230 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 58432 58728 gene locus_tag LOCUS_17280 58432 58728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 58709 58960 gene locus_tag LOCUS_17290 58709 58960 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529099.1 protein_id gnl|my_center|LOCUS_17290 58976 59455 gene locus_tag LOCUS_17300 58976 59455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 59455 60315 gene locus_tag LOCUS_17310 59455 60315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 60330 61190 gene locus_tag LOCUS_17320 60330 61190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 61210 62892 gene locus_tag LOCUS_17330 61210 62892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 63123 63335 gene locus_tag LOCUS_17340 63123 63335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 63332 64021 gene locus_tag LOCUS_17350 63332 64021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 64018 64368 gene locus_tag LOCUS_17360 64018 64368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 64365 65009 gene locus_tag LOCUS_17370 64365 65009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011011060.1 protein_id gnl|my_center|LOCUS_17370 65006 65722 gene locus_tag LOCUS_17380 65006 65722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 66193 65903 gene locus_tag LOCUS_17390 66193 65903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 66263 66451 gene locus_tag LOCUS_17400 66263 66451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 66497 67129 gene locus_tag LOCUS_17410 66497 67129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 67133 67999 gene locus_tag LOCUS_17420 67133 67999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 67996 68334 gene locus_tag LOCUS_17430 67996 68334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 68667 68891 gene locus_tag LOCUS_17440 68667 68891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence19 1414 449 gene locus_tag LOCUS_17450 1414 449 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_17450 1767 3065 gene locus_tag LOCUS_17460 1767 3065 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344468.1 protein_id gnl|my_center|LOCUS_17460 3114 4535 gene locus_tag LOCUS_17470 gene glnA 3114 4535 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389839.1 protein_id gnl|my_center|LOCUS_17470 5026 6684 gene locus_tag LOCUS_17480 5026 6684 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 protein_id gnl|my_center|LOCUS_17480 6799 8394 gene locus_tag LOCUS_17490 6799 8394 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094825.1 protein_id gnl|my_center|LOCUS_17490 8443 9201 gene locus_tag LOCUS_17500 8443 9201 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819116.1 protein_id gnl|my_center|LOCUS_17500 10417 9191 gene locus_tag LOCUS_17510 10417 9191 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869075.1 protein_id gnl|my_center|LOCUS_17510 10860 10429 gene locus_tag LOCUS_17520 10860 10429 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201060.1 protein_id gnl|my_center|LOCUS_17520 12294 10951 gene locus_tag LOCUS_17530 gene chrA 12294 10951 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206681.1 protein_id gnl|my_center|LOCUS_17530 13399 12407 gene locus_tag LOCUS_17540 13399 12407 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194565.1 protein_id gnl|my_center|LOCUS_17540 14325 13402 gene locus_tag LOCUS_17550 14325 13402 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_17550 14467 16104 gene locus_tag LOCUS_17560 14467 16104 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964096.1 protein_id gnl|my_center|LOCUS_17560 16284 16120 gene locus_tag LOCUS_17570 16284 16120 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392157.1 protein_id gnl|my_center|LOCUS_17570 17311 16304 gene locus_tag LOCUS_17580 17311 16304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 18560 17376 gene locus_tag LOCUS_17590 18560 17376 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058101.1 protein_id gnl|my_center|LOCUS_17590 19182 18634 gene locus_tag LOCUS_17600 19182 18634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 19318 19851 gene locus_tag LOCUS_17610 19318 19851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 19859 20575 gene locus_tag LOCUS_17620 gene mtnP 19859 20575 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879284.1 protein_id gnl|my_center|LOCUS_17620 20572 21843 gene locus_tag LOCUS_17630 20572 21843 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_17630 21840 23582 gene locus_tag LOCUS_17640 21840 23582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 23579 24790 gene locus_tag LOCUS_17650 23579 24790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 24768 26717 gene locus_tag LOCUS_17660 24768 26717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 26813 28027 gene locus_tag LOCUS_17670 26813 28027 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391154.1 protein_id gnl|my_center|LOCUS_17670 28040 29803 gene locus_tag LOCUS_17680 28040 29803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 31347 29896 gene locus_tag LOCUS_17690 31347 29896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 32974 31652 gene locus_tag LOCUS_17700 gene amt 32974 31652 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109815.1 protein_id gnl|my_center|LOCUS_17700 33350 33012 gene locus_tag LOCUS_17710 gene glnK 33350 33012 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767166.1 protein_id gnl|my_center|LOCUS_17710 33875 34057 gene locus_tag LOCUS_17720 33875 34057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 34140 37349 gene locus_tag LOCUS_17730 34140 37349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 37467 38306 gene locus_tag LOCUS_17740 37467 38306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 39572 38310 gene locus_tag LOCUS_17750 39572 38310 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_17750 40907 39594 gene locus_tag LOCUS_17760 40907 39594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 41781 40948 gene locus_tag LOCUS_17770 41781 40948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 41819 42199 gene locus_tag LOCUS_17780 41819 42199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 43475 42177 gene locus_tag LOCUS_17790 43475 42177 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942269.1 protein_id gnl|my_center|LOCUS_17790 44838 43570 gene locus_tag LOCUS_17800 44838 43570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 45268 44843 gene locus_tag LOCUS_17810 45268 44843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 45981 45265 gene locus_tag LOCUS_17820 gene tolQ 45981 45265 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529145.1 protein_id gnl|my_center|LOCUS_17820 46463 46050 gene locus_tag LOCUS_17830 gene ybgC 46463 46050 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038138.1 protein_id gnl|my_center|LOCUS_17830 47539 46502 gene locus_tag LOCUS_17840 gene ruvB 47539 46502 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568508.1 protein_id gnl|my_center|LOCUS_17840 48183 47536 gene locus_tag LOCUS_17850 gene ruvA 48183 47536 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689924.1 protein_id gnl|my_center|LOCUS_17850 48689 48180 gene locus_tag LOCUS_17860 gene ruvC 48689 48180 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_17860 49444 48704 gene locus_tag LOCUS_17870 49444 48704 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_17870 50449 49541 gene locus_tag LOCUS_17880 50449 49541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 50688 51110 gene locus_tag LOCUS_17890 gene ndk 50688 51110 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958107.1 protein_id gnl|my_center|LOCUS_17890 51172 52233 gene locus_tag LOCUS_17900 gene rlmN 51172 52233 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391076.1 protein_id gnl|my_center|LOCUS_17900 52230 53423 gene locus_tag LOCUS_17910 52230 53423 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256710.1 protein_id gnl|my_center|LOCUS_17910 53435 54037 gene locus_tag LOCUS_17920 53435 54037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 54037 54681 gene locus_tag LOCUS_17930 54037 54681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 55177 54650 gene locus_tag LOCUS_17940 55177 54650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 55279 56322 gene locus_tag LOCUS_17950 55279 56322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 56324 57190 gene locus_tag LOCUS_17960 gene rsmA 56324 57190 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036027.1 protein_id gnl|my_center|LOCUS_17960 57867 57124 gene locus_tag LOCUS_17970 57867 57124 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 protein_id gnl|my_center|LOCUS_17970 58092 57889 gene locus_tag LOCUS_17980 58092 57889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 58865 58185 gene locus_tag LOCUS_17990 58865 58185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 59790 58891 gene locus_tag LOCUS_18000 gene fabD 59790 58891 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388174.1 protein_id gnl|my_center|LOCUS_18000 60396 59863 gene locus_tag LOCUS_18010 60396 59863 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 protein_id gnl|my_center|LOCUS_18010 60672 60598 gene locus_tag LOCUS_t00310 60672 60598 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 60777 60700 gene locus_tag LOCUS_t00320 60777 60700 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 60865 60791 gene locus_tag LOCUS_t00330 60865 60791 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 61533 60985 gene locus_tag LOCUS_18020 gene pgsA 61533 60985 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_18020 63460 61541 gene locus_tag LOCUS_18030 gene uvrC 63460 61541 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389875.1 protein_id gnl|my_center|LOCUS_18030 64233 63457 gene locus_tag LOCUS_18040 gene lgt 64233 63457 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135560.1 protein_id gnl|my_center|LOCUS_18040 65073 64240 gene locus_tag LOCUS_18050 65073 64240 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920770.1 protein_id gnl|my_center|LOCUS_18050 65199 65996 gene locus_tag LOCUS_18060 65199 65996 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113853.1 protein_id gnl|my_center|LOCUS_18060 66166 67194 gene locus_tag LOCUS_18070 66166 67194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444437.1 protein_id gnl|my_center|LOCUS_18070 67387 67737 gene locus_tag LOCUS_18080 67387 67737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 68290 68871 gene locus_tag LOCUS_18090 68290 68871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence20 1224 43 gene locus_tag LOCUS_18100 1224 43 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930035.1 protein_id gnl|my_center|LOCUS_18100 1785 1237 gene locus_tag LOCUS_18110 1785 1237 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919820.1 protein_id gnl|my_center|LOCUS_18110 2324 1788 gene locus_tag LOCUS_18120 2324 1788 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389431.1 protein_id gnl|my_center|LOCUS_18120 2671 2315 gene locus_tag LOCUS_18130 2671 2315 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224824.1 protein_id gnl|my_center|LOCUS_18130 3373 2900 gene locus_tag LOCUS_18140 gene trmL 3373 2900 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_18140 3639 4160 gene locus_tag LOCUS_18150 gene petA 3639 4160 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388117.1 protein_id gnl|my_center|LOCUS_18150 4229 5440 gene locus_tag LOCUS_18160 4229 5440 CDS product cytochrome b/b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388116.1 protein_id gnl|my_center|LOCUS_18160 5455 6342 gene locus_tag LOCUS_18170 5455 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18170 6950 6429 gene locus_tag LOCUS_18180 gene purE 6950 6429 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858249.1 protein_id gnl|my_center|LOCUS_18180 8227 6947 gene locus_tag LOCUS_18190 gene purD 8227 6947 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_18190 8532 8224 gene locus_tag LOCUS_18200 8532 8224 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_18200 8910 9245 gene locus_tag LOCUS_18210 8910 9245 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_18210 9386 10099 gene locus_tag LOCUS_18220 gene dsrM 9386 10099 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393108.1 protein_id gnl|my_center|LOCUS_18220 10111 11610 gene locus_tag LOCUS_18230 10111 11610 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_18230 11737 12468 gene locus_tag LOCUS_18240 gene rph 11737 12468 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 protein_id gnl|my_center|LOCUS_18240 12474 13814 gene locus_tag LOCUS_18250 gene trmFO 12474 13814 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_18250 13987 15894 gene locus_tag LOCUS_18260 13987 15894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 15926 16801 gene locus_tag LOCUS_18270 gene prmC 15926 16801 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640077.1 protein_id gnl|my_center|LOCUS_18270 17156 16806 gene locus_tag LOCUS_18280 17156 16806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 17590 17153 gene locus_tag LOCUS_18290 17590 17153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 17987 17604 gene locus_tag LOCUS_18300 gene fliS 17987 17604 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050477.1 protein_id gnl|my_center|LOCUS_18300 19545 18025 gene locus_tag LOCUS_18310 gene fliD 19545 18025 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943664.1 protein_id gnl|my_center|LOCUS_18310 19957 19562 gene locus_tag LOCUS_18320 19957 19562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 21131 20163 gene locus_tag LOCUS_18330 gene flaB 21131 20163 CDS product flagellin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705589.1 protein_id gnl|my_center|LOCUS_18330 21655 21164 gene locus_tag LOCUS_18340 21655 21164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 23709 21706 gene locus_tag LOCUS_18350 23709 21706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 24314 23781 gene locus_tag LOCUS_18360 24314 23781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 25972 24437 gene locus_tag LOCUS_18370 gene flgL 25972 24437 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937826.1 protein_id gnl|my_center|LOCUS_18370 27817 25997 gene locus_tag LOCUS_18380 gene flgK 27817 25997 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656068.1 protein_id gnl|my_center|LOCUS_18380 28252 29097 gene locus_tag LOCUS_18390 28252 29097 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_18390 32600 29112 gene locus_tag LOCUS_18400 32600 29112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 32809 35310 gene locus_tag LOCUS_18410 32809 35310 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992271.1 protein_id gnl|my_center|LOCUS_18410 35303 36214 gene locus_tag LOCUS_18420 35303 36214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 36234 36575 gene locus_tag LOCUS_18430 36234 36575 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_18430 38635 36611 gene locus_tag LOCUS_18440 38635 36611 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083751.1 protein_id gnl|my_center|LOCUS_18440 39826 38696 gene locus_tag LOCUS_18450 39826 38696 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925054.1 protein_id gnl|my_center|LOCUS_18450 40933 39872 gene locus_tag LOCUS_18460 40933 39872 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390690.1 protein_id gnl|my_center|LOCUS_18460 41062 42465 gene locus_tag LOCUS_18470 gene thiC 41062 42465 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921089.1 protein_id gnl|my_center|LOCUS_18470 43281 42526 gene locus_tag LOCUS_18480 43281 42526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 43998 43303 gene locus_tag LOCUS_18490 43998 43303 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930771.1 protein_id gnl|my_center|LOCUS_18490 44882 43995 gene locus_tag LOCUS_18500 gene argB 44882 43995 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940826.1 protein_id gnl|my_center|LOCUS_18500 45063 45701 gene locus_tag LOCUS_18510 45063 45701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 45739 46086 gene locus_tag LOCUS_18520 45739 46086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 46140 47153 gene locus_tag LOCUS_18530 gene dusB 46140 47153 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035999.1 protein_id gnl|my_center|LOCUS_18530 47153 48214 gene locus_tag LOCUS_18540 47153 48214 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389367.1 protein_id gnl|my_center|LOCUS_18540 48217 49713 gene locus_tag LOCUS_18550 gene ntrC 48217 49713 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004441656.1 protein_id gnl|my_center|LOCUS_18550 49772 50044 gene locus_tag LOCUS_18560 49772 50044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 50086 50880 gene locus_tag LOCUS_18570 50086 50880 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532843.1 protein_id gnl|my_center|LOCUS_18570 50953 51180 gene locus_tag LOCUS_18580 50953 51180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 51186 51752 gene locus_tag LOCUS_18590 gene atpF 51186 51752 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142624.1 protein_id gnl|my_center|LOCUS_18590 53405 51972 gene locus_tag LOCUS_18600 53405 51972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 54222 54896 gene locus_tag LOCUS_18610 54222 54896 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856967.1 protein_id gnl|my_center|LOCUS_18610 55630 55052 gene locus_tag LOCUS_18620 55630 55052 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 protein_id gnl|my_center|LOCUS_18620 58730 56448 gene locus_tag LOCUS_18630 58730 56448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 59172 58723 gene locus_tag LOCUS_18640 59172 58723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 60482 59175 gene locus_tag LOCUS_18650 60482 59175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712483.1 protein_id gnl|my_center|LOCUS_18650 61005 61081 gene locus_tag LOCUS_t00340 61005 61081 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 62205 61750 gene locus_tag LOCUS_18660 62205 61750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 64649 62394 gene locus_tag LOCUS_18670 64649 62394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 64938 64660 gene locus_tag LOCUS_18680 64938 64660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 66151 65120 gene locus_tag LOCUS_18690 66151 65120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 >Feature sequence21 253 561 gene locus_tag LOCUS_18700 gene rpsJ 253 561 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_18700 649 1293 gene locus_tag LOCUS_18710 gene rplC 649 1293 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869928.1 protein_id gnl|my_center|LOCUS_18710 1309 1932 gene locus_tag LOCUS_18720 gene rplD 1309 1932 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_18720 1929 2228 gene locus_tag LOCUS_18730 gene rplW 1929 2228 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307955.1 protein_id gnl|my_center|LOCUS_18730 2299 3123 gene locus_tag LOCUS_18740 gene rplB 2299 3123 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_18740 3145 3420 gene locus_tag LOCUS_18750 gene rpsS 3145 3420 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390434.1 protein_id gnl|my_center|LOCUS_18750 3436 3774 gene locus_tag LOCUS_18760 gene rplV 3436 3774 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387269.1 protein_id gnl|my_center|LOCUS_18760 3832 4479 gene locus_tag LOCUS_18770 gene rpsC 3832 4479 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390432.1 protein_id gnl|my_center|LOCUS_18770 4520 4939 gene locus_tag LOCUS_18780 gene rplP 4520 4939 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008549252.1 protein_id gnl|my_center|LOCUS_18780 4950 5153 gene locus_tag LOCUS_18790 gene rpmC 4950 5153 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_18790 5156 5395 gene locus_tag LOCUS_18800 gene rpsQ 5156 5395 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240643.1 protein_id gnl|my_center|LOCUS_18800 5392 5760 gene locus_tag LOCUS_18810 gene rplN 5392 5760 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938608.1 protein_id gnl|my_center|LOCUS_18810 5770 6099 gene locus_tag LOCUS_18820 gene rplX 5770 6099 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390427.1 protein_id gnl|my_center|LOCUS_18820 6146 6685 gene locus_tag LOCUS_18830 gene rplE 6146 6685 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_18830 6997 7395 gene locus_tag LOCUS_18840 gene rpsH 6997 7395 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583359.1 protein_id gnl|my_center|LOCUS_18840 7464 7946 gene locus_tag LOCUS_18850 gene rplF 7464 7946 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_18850 7969 8334 gene locus_tag LOCUS_18860 gene rplR 7969 8334 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055951.1 protein_id gnl|my_center|LOCUS_18860 8387 8926 gene locus_tag LOCUS_18870 gene rpsE 8387 8926 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495208.1 protein_id gnl|my_center|LOCUS_18870 8932 9111 gene locus_tag LOCUS_18880 gene rpmD 8932 9111 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722524.1 protein_id gnl|my_center|LOCUS_18880 9342 9632 gene locus_tag LOCUS_18890 9342 9632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 9644 10975 gene locus_tag LOCUS_18900 gene secY 9644 10975 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_18900 11191 11556 gene locus_tag LOCUS_18910 gene rpsM 11191 11556 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390416.1 protein_id gnl|my_center|LOCUS_18910 11613 12008 gene locus_tag LOCUS_18920 gene rpsK 11613 12008 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_18920 12046 12672 gene locus_tag LOCUS_18930 gene rpsD 12046 12672 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_18930 12699 13721 gene locus_tag LOCUS_18940 12699 13721 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626433.1 protein_id gnl|my_center|LOCUS_18940 13733 14098 gene locus_tag LOCUS_18950 13733 14098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 14451 15551 gene locus_tag LOCUS_18960 14451 15551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 16217 15963 gene locus_tag LOCUS_18970 16217 15963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 17012 16485 gene locus_tag LOCUS_18980 17012 16485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 18004 17009 gene locus_tag LOCUS_18990 gene thiS 18004 17009 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390185.1 protein_id gnl|my_center|LOCUS_18990 18235 19362 gene locus_tag LOCUS_19000 18235 19362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 19355 19909 gene locus_tag LOCUS_19010 19355 19909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 19924 20877 gene locus_tag LOCUS_19020 19924 20877 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919030.1 protein_id gnl|my_center|LOCUS_19020 20979 22916 gene locus_tag LOCUS_19030 gene htpG 20979 22916 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185742.1 protein_id gnl|my_center|LOCUS_19030 23018 23281 gene locus_tag LOCUS_19040 23018 23281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 23289 24767 gene locus_tag LOCUS_19050 23289 24767 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396789.1 protein_id gnl|my_center|LOCUS_19050 24764 28030 gene locus_tag LOCUS_19060 24764 28030 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122713.1 protein_id gnl|my_center|LOCUS_19060 28023 29549 gene locus_tag LOCUS_19070 28023 29549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 29556 31094 gene locus_tag LOCUS_19080 29556 31094 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_19080 31094 32611 gene locus_tag LOCUS_19090 31094 32611 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967804.1 protein_id gnl|my_center|LOCUS_19090 33234 32617 gene locus_tag LOCUS_19100 33234 32617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 34073 33231 gene locus_tag LOCUS_19110 34073 33231 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036732.1 protein_id gnl|my_center|LOCUS_19110 34212 34697 gene locus_tag LOCUS_19120 34212 34697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 35061 35567 gene locus_tag LOCUS_19130 35061 35567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 36064 35594 gene locus_tag LOCUS_19140 36064 35594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 36210 36881 gene locus_tag LOCUS_19150 36210 36881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 36878 38929 gene locus_tag LOCUS_19160 36878 38929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 38967 40127 gene locus_tag LOCUS_19170 38967 40127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 40127 41881 gene locus_tag LOCUS_19180 gene recJ 40127 41881 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 protein_id gnl|my_center|LOCUS_19180 41928 42359 gene locus_tag LOCUS_19190 41928 42359 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719543.1 protein_id gnl|my_center|LOCUS_19190 42356 43720 gene locus_tag LOCUS_19200 gene murL 42356 43720 CDS product UDP-N-acetyl-alpha-D-muramoyl-L-alanyl-L-glutamate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 protein_id gnl|my_center|LOCUS_19200 43698 45065 gene locus_tag LOCUS_19210 gene murD 43698 45065 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037868.1 protein_id gnl|my_center|LOCUS_19210 45052 45222 gene locus_tag LOCUS_19220 45052 45222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 45219 45962 gene locus_tag LOCUS_19230 gene aztA 45219 45962 CDS product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104120.1 protein_id gnl|my_center|LOCUS_19230 45941 46834 gene locus_tag LOCUS_19240 45941 46834 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410031.1 protein_id gnl|my_center|LOCUS_19240 47117 47701 gene locus_tag LOCUS_19250 47117 47701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 49035 47680 gene locus_tag LOCUS_19260 gene carS 49035 47680 CDS product two-component system sensor histidine kinase CarS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090493.1 protein_id gnl|my_center|LOCUS_19260 49697 49032 gene locus_tag LOCUS_19270 49697 49032 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074115.1 protein_id gnl|my_center|LOCUS_19270 49844 50473 gene locus_tag LOCUS_19280 49844 50473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 50492 50899 gene locus_tag LOCUS_19290 50492 50899 CDS product DUF1924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337164.1 protein_id gnl|my_center|LOCUS_19290 50914 51447 gene locus_tag LOCUS_19300 50914 51447 CDS product diheme cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074113.1 protein_id gnl|my_center|LOCUS_19300 51483 51842 gene locus_tag LOCUS_19310 51483 51842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 51902 53182 gene locus_tag LOCUS_19320 51902 53182 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444330.1 protein_id gnl|my_center|LOCUS_19320 53688 53203 gene locus_tag LOCUS_19330 53688 53203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 53996 53691 gene locus_tag LOCUS_19340 53996 53691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 54599 54000 gene locus_tag LOCUS_19350 54599 54000 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180325543.1 protein_id gnl|my_center|LOCUS_19350 55043 54645 gene locus_tag LOCUS_19360 55043 54645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 55193 55387 gene locus_tag LOCUS_19370 55193 55387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 55293 56258 gene locus_tag LOCUS_19380 55293 56258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 56633 56319 gene locus_tag LOCUS_19390 56633 56319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 56844 57842 gene locus_tag LOCUS_19400 56844 57842 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002353252.1 protein_id gnl|my_center|LOCUS_19400 59076 58123 gene locus_tag LOCUS_19410 59076 58123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 59519 59073 gene locus_tag LOCUS_19420 59519 59073 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_19420 60758 59556 gene locus_tag LOCUS_19430 60758 59556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 62116 60932 gene locus_tag LOCUS_19440 62116 60932 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337766.1 protein_id gnl|my_center|LOCUS_19440 63589 62129 gene locus_tag LOCUS_19450 63589 62129 CDS product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545153.1 protein_id gnl|my_center|LOCUS_19450 64947 63586 gene locus_tag LOCUS_19460 64947 63586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 65971 64982 gene locus_tag LOCUS_19470 gene holB 65971 64982 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_19470 66206 65949 gene locus_tag LOCUS_19480 66206 65949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 >Feature sequence22 347 1195 gene locus_tag LOCUS_19490 347 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 1729 1268 gene locus_tag LOCUS_19500 1729 1268 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_19500 2932 1787 gene locus_tag LOCUS_19510 2932 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 3090 4082 gene locus_tag LOCUS_19520 3090 4082 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_19520 4079 4651 gene locus_tag LOCUS_19530 4079 4651 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_19530 4648 5319 gene locus_tag LOCUS_19540 4648 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 5297 5959 gene locus_tag LOCUS_19550 5297 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 5965 6747 gene locus_tag LOCUS_19560 gene lptB 5965 6747 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689540.1 protein_id gnl|my_center|LOCUS_19560 6775 8259 gene locus_tag LOCUS_19570 gene rpoN 6775 8259 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809045.1 protein_id gnl|my_center|LOCUS_19570 8317 8778 gene locus_tag LOCUS_19580 8317 8778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 8775 9731 gene locus_tag LOCUS_19590 gene rapZ 8775 9731 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391802.1 protein_id gnl|my_center|LOCUS_19590 9758 10864 gene locus_tag LOCUS_19600 9758 10864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 10861 11379 gene locus_tag LOCUS_19610 10861 11379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 11403 12629 gene locus_tag LOCUS_19620 11403 12629 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038876.1 protein_id gnl|my_center|LOCUS_19620 12830 15304 gene locus_tag LOCUS_19630 12830 15304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 15320 18463 gene locus_tag LOCUS_19640 gene sbcC 15320 18463 CDS product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698903.1 protein_id gnl|my_center|LOCUS_19640 18793 20142 gene locus_tag LOCUS_19650 gene trkA 18793 20142 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_19650 20139 21575 gene locus_tag LOCUS_19660 20139 21575 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_19660 21616 21951 gene locus_tag LOCUS_19670 21616 21951 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_19670 22514 22128 gene locus_tag LOCUS_19680 22514 22128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 22675 22601 gene locus_tag LOCUS_t00350 22675 22601 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 23659 22763 gene locus_tag LOCUS_19690 23659 22763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 23822 23667 gene locus_tag LOCUS_19700 23822 23667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 25049 23868 gene locus_tag LOCUS_19710 25049 23868 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162600451.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19710 25547 25107 gene locus_tag LOCUS_19720 25547 25107 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880938.1 protein_id gnl|my_center|LOCUS_19720 26248 25520 gene locus_tag LOCUS_19730 gene lipB 26248 25520 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144397.1 protein_id gnl|my_center|LOCUS_19730 27157 26435 gene locus_tag LOCUS_19740 27157 26435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 28237 27260 gene locus_tag LOCUS_19750 gene ppk2 28237 27260 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121626.1 protein_id gnl|my_center|LOCUS_19750 30391 28313 gene locus_tag LOCUS_19760 30391 28313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 30879 30388 gene locus_tag LOCUS_19770 30879 30388 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762515.1 protein_id gnl|my_center|LOCUS_19770 31149 32639 gene locus_tag LOCUS_19780 31149 32639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 32752 33711 gene locus_tag LOCUS_19790 32752 33711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 33790 34911 gene locus_tag LOCUS_19800 33790 34911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 35108 35878 gene locus_tag LOCUS_19810 35108 35878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 35919 37553 gene locus_tag LOCUS_19820 35919 37553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 37943 37566 gene locus_tag LOCUS_19830 37943 37566 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165710.1 protein_id gnl|my_center|LOCUS_19830 39528 37948 gene locus_tag LOCUS_19840 39528 37948 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390250.1 protein_id gnl|my_center|LOCUS_19840 39724 39560 gene locus_tag LOCUS_19850 39724 39560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 39873 39718 gene locus_tag LOCUS_19860 39873 39718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 40987 39992 gene locus_tag LOCUS_19870 40987 39992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 41535 40984 gene locus_tag LOCUS_19880 41535 40984 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217433129.1 protein_id gnl|my_center|LOCUS_19880 43118 41676 gene locus_tag LOCUS_19890 43118 41676 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090469.1 protein_id gnl|my_center|LOCUS_19890 47675 43146 gene locus_tag LOCUS_19900 47675 43146 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196742.1 protein_id gnl|my_center|LOCUS_19900 48847 47822 gene locus_tag LOCUS_19910 48847 47822 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918341.1 protein_id gnl|my_center|LOCUS_19910 49553 48840 gene locus_tag LOCUS_19920 49553 48840 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532296.1 protein_id gnl|my_center|LOCUS_19920 49769 50941 gene locus_tag LOCUS_19930 gene amiB 49769 50941 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_19930 51964 50942 gene locus_tag LOCUS_19940 51964 50942 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255924.1 protein_id gnl|my_center|LOCUS_19940 52157 53146 gene locus_tag LOCUS_19950 52157 53146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 54164 53232 gene locus_tag LOCUS_19960 54164 53232 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073034.1 protein_id gnl|my_center|LOCUS_19960 54964 54167 gene locus_tag LOCUS_19970 54964 54167 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973172.1 protein_id gnl|my_center|LOCUS_19970 55596 54961 gene locus_tag LOCUS_19980 gene dsbA 55596 54961 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 protein_id gnl|my_center|LOCUS_19980 56025 55600 gene locus_tag LOCUS_19990 56025 55600 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531833.1 protein_id gnl|my_center|LOCUS_19990 56191 57300 gene locus_tag LOCUS_20000 56191 57300 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140822.1 protein_id gnl|my_center|LOCUS_20000 57300 58166 gene locus_tag LOCUS_20010 gene lipA 57300 58166 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086498.1 protein_id gnl|my_center|LOCUS_20010 58259 58335 gene locus_tag LOCUS_t00360 58259 58335 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 58872 60554 gene locus_tag LOCUS_20020 58872 60554 CDS product anti-phage dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164996137.1 protein_id gnl|my_center|LOCUS_20020 61113 60763 gene locus_tag LOCUS_20030 61113 60763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 61453 61097 gene locus_tag LOCUS_20040 61453 61097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence23 1919 621 gene locus_tag LOCUS_20050 1919 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 2260 3339 gene locus_tag LOCUS_20060 2260 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 3344 4828 gene locus_tag LOCUS_20070 3344 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 7313 4779 gene locus_tag LOCUS_20080 7313 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 7463 8425 gene locus_tag LOCUS_20090 7463 8425 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390856.1 protein_id gnl|my_center|LOCUS_20090 9773 8478 gene locus_tag LOCUS_20100 gene tviB 9773 8478 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931326.1 protein_id gnl|my_center|LOCUS_20100 11152 9848 gene locus_tag LOCUS_20110 11152 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 12206 11142 gene locus_tag LOCUS_20120 12206 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 13465 12203 gene locus_tag LOCUS_20130 13465 12203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 14499 13462 gene locus_tag LOCUS_20140 14499 13462 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094902.1 protein_id gnl|my_center|LOCUS_20140 15532 14504 gene locus_tag LOCUS_20150 15532 14504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 15618 17213 gene locus_tag LOCUS_20160 gene almE 15618 17213 CDS product lipid A modification system glycine--protein ligase AlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146752.1 protein_id gnl|my_center|LOCUS_20160 17213 17476 gene locus_tag LOCUS_20170 17213 17476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 18206 17466 gene locus_tag LOCUS_20180 18206 17466 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061495.1 protein_id gnl|my_center|LOCUS_20180 18437 19225 gene locus_tag LOCUS_20190 18437 19225 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389465.1 protein_id gnl|my_center|LOCUS_20190 19350 19222 gene locus_tag LOCUS_20200 19350 19222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 19669 19337 gene locus_tag LOCUS_20210 19669 19337 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403362.1 protein_id gnl|my_center|LOCUS_20210 20075 19872 gene locus_tag LOCUS_20220 20075 19872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 20670 20278 gene locus_tag LOCUS_20230 20670 20278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 21979 20816 gene locus_tag LOCUS_20240 21979 20816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 22794 21976 gene locus_tag LOCUS_20250 22794 21976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 24057 22813 gene locus_tag LOCUS_20260 24057 22813 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974189.1 protein_id gnl|my_center|LOCUS_20260 24200 25708 gene locus_tag LOCUS_20270 24200 25708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 25705 26739 gene locus_tag LOCUS_20280 25705 26739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 26784 29849 gene locus_tag LOCUS_20290 26784 29849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 30804 29827 gene locus_tag LOCUS_20300 30804 29827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 31687 30797 gene locus_tag LOCUS_20310 31687 30797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 31756 32748 gene locus_tag LOCUS_20320 31756 32748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 32745 33959 gene locus_tag LOCUS_20330 32745 33959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 33956 35023 gene locus_tag LOCUS_20340 33956 35023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 35194 35946 gene locus_tag LOCUS_20350 35194 35946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 35943 36638 gene locus_tag LOCUS_20360 35943 36638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 36652 37794 gene locus_tag LOCUS_20370 36652 37794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 37791 38957 gene locus_tag LOCUS_20380 37791 38957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 38972 40012 gene locus_tag LOCUS_20390 38972 40012 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957641.1 protein_id gnl|my_center|LOCUS_20390 40239 41378 gene locus_tag LOCUS_20400 40239 41378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 41855 42781 gene locus_tag LOCUS_20410 41855 42781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 42786 45254 gene locus_tag LOCUS_20420 42786 45254 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006742214.1 protein_id gnl|my_center|LOCUS_20420 45217 45936 gene locus_tag LOCUS_20430 45217 45936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 45897 47330 gene locus_tag LOCUS_20440 45897 47330 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947937.1 protein_id gnl|my_center|LOCUS_20440 47340 48494 gene locus_tag LOCUS_20450 47340 48494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 50163 48727 gene locus_tag LOCUS_20460 50163 48727 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_20460 51538 50168 gene locus_tag LOCUS_20470 gene trkA 51538 50168 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535437.1 protein_id gnl|my_center|LOCUS_20470 52544 51933 gene locus_tag LOCUS_20480 52544 51933 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 protein_id gnl|my_center|LOCUS_20480 53158 52541 gene locus_tag LOCUS_20490 gene rsxG 53158 52541 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706453.1 protein_id gnl|my_center|LOCUS_20490 54261 53197 gene locus_tag LOCUS_20500 gene rsxD 54261 53197 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231916.1 protein_id gnl|my_center|LOCUS_20500 55984 54326 gene locus_tag LOCUS_20510 gene rsxC 55984 54326 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339117.1 protein_id gnl|my_center|LOCUS_20510 56626 56072 gene locus_tag LOCUS_20520 gene rsxB 56626 56072 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706450.1 protein_id gnl|my_center|LOCUS_20520 57239 56661 gene locus_tag LOCUS_20530 gene rsxA 57239 56661 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141550.1 protein_id gnl|my_center|LOCUS_20530 57520 58605 gene locus_tag LOCUS_20540 57520 58605 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_20540 58688 59818 gene locus_tag LOCUS_20550 58688 59818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 >Feature sequence24 <1 13534 gene locus_tag LOCUS_20560 <1 13534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928870.1:integrin alpha 13626 14603 gene locus_tag LOCUS_20570 13626 14603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958627.1 protein_id gnl|my_center|LOCUS_20570 15140 16057 gene locus_tag LOCUS_20580 15140 16057 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_20580 16955 19633 gene locus_tag LOCUS_20590 16955 19633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 19639 20856 gene locus_tag LOCUS_20600 19639 20856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 21312 22487 gene locus_tag LOCUS_20610 21312 22487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 22661 23764 gene locus_tag LOCUS_20620 22661 23764 CDS product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941807.1 protein_id gnl|my_center|LOCUS_20620 23771 25684 gene locus_tag LOCUS_20630 23771 25684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 25700 26152 gene locus_tag LOCUS_20640 25700 26152 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087061.1 protein_id gnl|my_center|LOCUS_20640 26149 28650 gene locus_tag LOCUS_20650 26149 28650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 28890 32828 gene locus_tag LOCUS_20660 28890 32828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 34005 32830 gene locus_tag LOCUS_20670 gene rlmM 34005 32830 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036052.1 protein_id gnl|my_center|LOCUS_20670 34193 36244 gene locus_tag LOCUS_20680 34193 36244 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404730.1 protein_id gnl|my_center|LOCUS_20680 36303 37430 gene locus_tag LOCUS_20690 36303 37430 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065538056.1 protein_id gnl|my_center|LOCUS_20690 40198 37436 gene locus_tag LOCUS_20700 40198 37436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 40936 40310 gene locus_tag LOCUS_20710 gene thiE 40936 40310 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_20710 41586 40936 gene locus_tag LOCUS_20720 gene queE 41586 40936 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301211.1 protein_id gnl|my_center|LOCUS_20720 42058 41606 gene locus_tag LOCUS_20730 gene queD 42058 41606 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368412.1 protein_id gnl|my_center|LOCUS_20730 43047 42073 gene locus_tag LOCUS_20740 43047 42073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 44736 43048 gene locus_tag LOCUS_20750 44736 43048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 45800 44733 gene locus_tag LOCUS_20760 gene fba 45800 44733 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064288.1 protein_id gnl|my_center|LOCUS_20760 46034 46618 gene locus_tag LOCUS_20770 46034 46618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 48434 46662 gene locus_tag LOCUS_20780 48434 46662 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810170.1 protein_id gnl|my_center|LOCUS_20780 49174 48479 gene locus_tag LOCUS_20790 49174 48479 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_20790 50037 49246 gene locus_tag LOCUS_20800 gene pstB 50037 49246 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_20800 50850 50077 gene locus_tag LOCUS_20810 gene pstB 50850 50077 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965015.1 protein_id gnl|my_center|LOCUS_20810 51820 50918 gene locus_tag LOCUS_20820 gene pstA 51820 50918 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538554.1 protein_id gnl|my_center|LOCUS_20820 52761 51829 gene locus_tag LOCUS_20830 52761 51829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 53863 52763 gene locus_tag LOCUS_20840 53863 52763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 54802 53933 gene locus_tag LOCUS_20850 54802 53933 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538556.1 protein_id gnl|my_center|LOCUS_20850 56320 55232 gene locus_tag LOCUS_20860 gene arsB 56320 55232 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440386.1 protein_id gnl|my_center|LOCUS_20860 56851 56342 gene locus_tag LOCUS_20870 56851 56342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 57089 58102 gene locus_tag LOCUS_20880 57089 58102 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070877.1 protein_id gnl|my_center|LOCUS_20880 58171 59394 gene locus_tag LOCUS_20890 gene arsJ 58171 59394 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798948.1 protein_id gnl|my_center|LOCUS_20890 59618 59881 gene locus_tag LOCUS_20900 59618 59881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 >Feature sequence25 610 1422 gene locus_tag LOCUS_20910 610 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 1419 2312 gene locus_tag LOCUS_20920 1419 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 2322 3983 gene locus_tag LOCUS_20930 2322 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 5072 3999 gene locus_tag LOCUS_20940 5072 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 5285 8911 gene locus_tag LOCUS_20950 5285 8911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 8932 10026 gene locus_tag LOCUS_20960 8932 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 10043 11254 gene locus_tag LOCUS_20970 10043 11254 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063044.1 protein_id gnl|my_center|LOCUS_20970 13130 11727 gene locus_tag LOCUS_20980 13130 11727 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836186.1 protein_id gnl|my_center|LOCUS_20980 14078 13224 gene locus_tag LOCUS_20990 14078 13224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 14220 15155 gene locus_tag LOCUS_21000 14220 15155 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390251.1 protein_id gnl|my_center|LOCUS_21000 15152 15937 gene locus_tag LOCUS_21010 15152 15937 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390252.1 protein_id gnl|my_center|LOCUS_21010 16846 15959 gene locus_tag LOCUS_21020 16846 15959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 18871 16991 gene locus_tag LOCUS_21030 18871 16991 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933900.1 protein_id gnl|my_center|LOCUS_21030 20002 18929 gene locus_tag LOCUS_21040 gene dsrB 20002 18929 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_21040 21489 20206 gene locus_tag LOCUS_21050 gene dsrA 21489 20206 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_21050 22733 21885 gene locus_tag LOCUS_21060 22733 21885 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965466.1 protein_id gnl|my_center|LOCUS_21060 23212 23658 gene locus_tag LOCUS_21070 23212 23658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 23778 24197 gene locus_tag LOCUS_21080 23778 24197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 24363 24279 gene locus_tag LOCUS_t00370 24363 24279 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 24562 25425 gene locus_tag LOCUS_21090 gene trxA 24562 25425 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522640.1 protein_id gnl|my_center|LOCUS_21090 25743 25516 gene locus_tag LOCUS_21100 25743 25516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 26222 25770 gene locus_tag LOCUS_21110 gene rplI 26222 25770 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338021.1 protein_id gnl|my_center|LOCUS_21110 26974 26228 gene locus_tag LOCUS_21120 26974 26228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 26868 27215 gene locus_tag LOCUS_21130 26868 27215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 27651 27337 gene locus_tag LOCUS_21140 27651 27337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 28095 27703 gene locus_tag LOCUS_21150 28095 27703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 28508 28095 gene locus_tag LOCUS_21160 gene rpsF 28508 28095 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941326.1 protein_id gnl|my_center|LOCUS_21160 29145 28597 gene locus_tag LOCUS_21170 29145 28597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 29544 29332 gene locus_tag LOCUS_21180 29544 29332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 29507 30274 gene locus_tag LOCUS_21190 29507 30274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 30338 30667 gene locus_tag LOCUS_21200 30338 30667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 31541 31152 gene locus_tag LOCUS_21210 31541 31152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 31709 32179 gene locus_tag LOCUS_21220 31709 32179 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105385.1 protein_id gnl|my_center|LOCUS_21220 33578 32382 gene locus_tag LOCUS_21230 gene nrfD 33578 32382 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272584.1 protein_id gnl|my_center|LOCUS_21230 34124 33594 gene locus_tag LOCUS_21240 34124 33594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 34914 34546 gene locus_tag LOCUS_21250 gene dsrJ 34914 34546 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393111.1 protein_id gnl|my_center|LOCUS_21250 35257 34964 gene locus_tag LOCUS_21260 gene tusB 35257 34964 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_21260 35679 35278 gene locus_tag LOCUS_21270 gene tusC 35679 35278 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932537.1 protein_id gnl|my_center|LOCUS_21270 36052 35696 gene locus_tag LOCUS_21280 gene tusD 36052 35696 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932536.1 protein_id gnl|my_center|LOCUS_21280 37599 36232 gene locus_tag LOCUS_21290 gene cobB 37599 36232 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_21290 37598 38599 gene locus_tag LOCUS_21300 gene hemH 37598 38599 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925680.1 protein_id gnl|my_center|LOCUS_21300 38858 38682 gene locus_tag LOCUS_21310 38858 38682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 40510 38906 gene locus_tag LOCUS_21320 40510 38906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 41892 40726 gene locus_tag LOCUS_21330 41892 40726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 42542 42096 gene locus_tag LOCUS_21340 42542 42096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 42966 42595 gene locus_tag LOCUS_21350 42966 42595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 43552 43055 gene locus_tag LOCUS_21360 43552 43055 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919563.1 protein_id gnl|my_center|LOCUS_21360 45109 43556 gene locus_tag LOCUS_21370 45109 43556 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092867.1 protein_id gnl|my_center|LOCUS_21370 46074 45172 gene locus_tag LOCUS_21380 46074 45172 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539670.1 protein_id gnl|my_center|LOCUS_21380 47148 46078 gene locus_tag LOCUS_21390 47148 46078 CDS product bifunctional UDP-4-keto-pentose/UDP-xylose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193921.1 protein_id gnl|my_center|LOCUS_21390 48116 47145 gene locus_tag LOCUS_21400 48116 47145 CDS product formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192441.1 protein_id gnl|my_center|LOCUS_21400 49090 48113 gene locus_tag LOCUS_21410 49090 48113 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191549.1 protein_id gnl|my_center|LOCUS_21410 50271 49135 gene locus_tag LOCUS_21420 50271 49135 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_21420 50469 51635 gene locus_tag LOCUS_21430 gene lptF 50469 51635 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_21430 51639 52742 gene locus_tag LOCUS_21440 gene lptG 51639 52742 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720056.1 protein_id gnl|my_center|LOCUS_21440 52899 54107 gene locus_tag LOCUS_21450 52899 54107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 54130 54891 gene locus_tag LOCUS_21460 gene cysZ 54130 54891 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115194.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence26 901 3738 gene locus_tag LOCUS_21470 901 3738 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946456.1 protein_id gnl|my_center|LOCUS_21470 3735 4577 gene locus_tag LOCUS_21480 gene nadC 3735 4577 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_21480 4574 5401 gene locus_tag LOCUS_21490 4574 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 5398 6231 gene locus_tag LOCUS_21500 5398 6231 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_21500 6241 6975 gene locus_tag LOCUS_21510 6241 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 7046 7122 gene locus_tag LOCUS_t00380 7046 7122 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7721 7338 gene locus_tag LOCUS_21520 7721 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 7752 8051 gene locus_tag LOCUS_21530 7752 8051 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_21530 8055 8351 gene locus_tag LOCUS_21540 8055 8351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 9792 8914 gene locus_tag LOCUS_21550 9792 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 12247 9812 gene locus_tag LOCUS_21560 12247 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 12457 13461 gene locus_tag LOCUS_21570 12457 13461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 13770 14453 gene locus_tag LOCUS_21580 13770 14453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 16137 14467 gene locus_tag LOCUS_21590 16137 14467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 19088 16320 gene locus_tag LOCUS_21600 19088 16320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 20110 19148 gene locus_tag LOCUS_21610 20110 19148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 20854 20462 gene locus_tag LOCUS_21620 20854 20462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 21210 20908 gene locus_tag LOCUS_21630 21210 20908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 21548 21255 gene locus_tag LOCUS_21640 21548 21255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 23137 23430 gene locus_tag LOCUS_21650 23137 23430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 24314 24015 gene locus_tag LOCUS_21660 24314 24015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 25830 24619 gene locus_tag LOCUS_21670 25830 24619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 26417 26112 gene locus_tag LOCUS_21680 26417 26112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 27980 26769 gene locus_tag LOCUS_21690 27980 26769 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 protein_id gnl|my_center|LOCUS_21690 28276 28201 gene locus_tag LOCUS_t00390 28276 28201 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 28534 28752 gene locus_tag LOCUS_21700 28534 28752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 31612 28919 gene locus_tag LOCUS_21710 gene ppdK 31612 28919 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_21710 31867 31953 gene locus_tag LOCUS_t00400 31867 31953 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 32393 33394 gene locus_tag LOCUS_21720 32393 33394 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939306.1 protein_id gnl|my_center|LOCUS_21720 33391 33924 gene locus_tag LOCUS_21730 33391 33924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038870.1 protein_id gnl|my_center|LOCUS_21730 34679 33927 gene locus_tag LOCUS_21740 34679 33927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 37734 34699 gene locus_tag LOCUS_21750 37734 34699 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873412.1 protein_id gnl|my_center|LOCUS_21750 37819 39090 gene locus_tag LOCUS_21760 37819 39090 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_21760 39087 40247 gene locus_tag LOCUS_21770 gene lpxK 39087 40247 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927066.1 protein_id gnl|my_center|LOCUS_21770 40380 40210 gene locus_tag LOCUS_21780 40380 40210 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196455.1 protein_id gnl|my_center|LOCUS_21780 40550 42265 gene locus_tag LOCUS_21790 gene argS 40550 42265 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140224.1 protein_id gnl|my_center|LOCUS_21790 42262 43497 gene locus_tag LOCUS_21800 42262 43497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 43637 47032 gene locus_tag LOCUS_21810 43637 47032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 47029 47430 gene locus_tag LOCUS_21820 47029 47430 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_21820 47502 48308 gene locus_tag LOCUS_21830 47502 48308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 49010 48582 gene locus_tag LOCUS_21840 49010 48582 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566317.1 protein_id gnl|my_center|LOCUS_21840 49216 49007 gene locus_tag LOCUS_21850 49216 49007 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893919.1 protein_id gnl|my_center|LOCUS_21850 49685 49419 gene locus_tag LOCUS_21860 49685 49419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 52357 49700 gene locus_tag LOCUS_21870 52357 49700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 53407 52490 gene locus_tag LOCUS_21880 gene prmA 53407 52490 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903455.1 protein_id gnl|my_center|LOCUS_21880 53775 53404 gene locus_tag LOCUS_21890 53775 53404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 53865 54314 gene locus_tag LOCUS_21900 53865 54314 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198843.1 protein_id gnl|my_center|LOCUS_21900 54318 54821 gene locus_tag LOCUS_21910 gene tsaE 54318 54821 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704860.1 protein_id gnl|my_center|LOCUS_21910 >Feature sequence27 193 528 gene locus_tag LOCUS_21920 193 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 783 2306 gene locus_tag LOCUS_21930 783 2306 CDS product PAS-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390226.1 protein_id gnl|my_center|LOCUS_21930 2307 2567 gene locus_tag LOCUS_21940 2307 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 2621 3169 gene locus_tag LOCUS_21950 2621 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 3178 3528 gene locus_tag LOCUS_21960 3178 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 3545 4900 gene locus_tag LOCUS_21970 3545 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 4897 5277 gene locus_tag LOCUS_21980 4897 5277 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933716.1 protein_id gnl|my_center|LOCUS_21980 5277 8372 gene locus_tag LOCUS_21990 5277 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 8369 9091 gene locus_tag LOCUS_22000 8369 9091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 9093 9554 gene locus_tag LOCUS_22010 gene rimI 9093 9554 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191864.1 protein_id gnl|my_center|LOCUS_22010 9596 10054 gene locus_tag LOCUS_22020 9596 10054 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870436.1 protein_id gnl|my_center|LOCUS_22020 10142 10885 gene locus_tag LOCUS_22030 10142 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 10915 11394 gene locus_tag LOCUS_22040 10915 11394 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_22040 11442 12326 gene locus_tag LOCUS_22050 gene apaH 11442 12326 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815544.1 protein_id gnl|my_center|LOCUS_22050 12342 13985 gene locus_tag LOCUS_22060 12342 13985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 14036 15442 gene locus_tag LOCUS_22070 14036 15442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 15469 16173 gene locus_tag LOCUS_22080 15469 16173 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529766.1 protein_id gnl|my_center|LOCUS_22080 18121 16181 gene locus_tag LOCUS_22090 18121 16181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 18412 23037 gene locus_tag LOCUS_22100 18412 23037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 23076 24692 gene locus_tag LOCUS_22110 23076 24692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 24689 25366 gene locus_tag LOCUS_22120 24689 25366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 25286 25296 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25445 26773 gene locus_tag LOCUS_22130 25445 26773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 26774 28873 gene locus_tag LOCUS_22140 26774 28873 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_22140 29818 28907 gene locus_tag LOCUS_22150 29818 28907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 30987 29842 gene locus_tag LOCUS_22160 30987 29842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 32494 30992 gene locus_tag LOCUS_22170 32494 30992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 34537 32504 gene locus_tag LOCUS_22180 34537 32504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 34864 34541 gene locus_tag LOCUS_22190 34864 34541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 35736 34939 gene locus_tag LOCUS_22200 35736 34939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22200 36628 35966 gene locus_tag LOCUS_22210 36628 35966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 37236 36769 gene locus_tag LOCUS_22220 37236 36769 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689877.1 protein_id gnl|my_center|LOCUS_22220 37763 37308 gene locus_tag LOCUS_22230 37763 37308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 39006 37927 gene locus_tag LOCUS_22240 39006 37927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 39188 39961 gene locus_tag LOCUS_22250 39188 39961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 40966 39968 gene locus_tag LOCUS_22260 40966 39968 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941474.1 protein_id gnl|my_center|LOCUS_22260 42181 41042 gene locus_tag LOCUS_22270 42181 41042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 46581 42178 gene locus_tag LOCUS_22280 46581 42178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 47376 46813 gene locus_tag LOCUS_22290 47376 46813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 47485 48009 gene locus_tag LOCUS_22300 47485 48009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 48384 48061 gene locus_tag LOCUS_22310 gene hsbA 48384 48061 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_22310 48549 48908 gene locus_tag LOCUS_22320 gene arsC 48549 48908 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072786.1 protein_id gnl|my_center|LOCUS_22320 49016 49816 gene locus_tag LOCUS_22330 49016 49816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 50113 50529 gene locus_tag LOCUS_22340 50113 50529 CDS product type II toxin-antitoxin system antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073052.1 protein_id gnl|my_center|LOCUS_22340 50519 50944 gene locus_tag LOCUS_22350 50519 50944 CDS product type II toxin-antitoxin system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 protein_id gnl|my_center|LOCUS_22350 <52819 51058 gene locus_tag LOCUS_22360 <52819 51058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941343.1:MCP four helix bundle domain-containing protein >Feature sequence28 341 733 gene locus_tag LOCUS_22370 341 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 904 1863 gene locus_tag LOCUS_22380 gene ispH 904 1863 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112824.1 protein_id gnl|my_center|LOCUS_22380 2107 3042 gene locus_tag LOCUS_22390 2107 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 4015 3053 gene locus_tag LOCUS_22400 4015 3053 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972446.1 protein_id gnl|my_center|LOCUS_22400 4159 5145 gene locus_tag LOCUS_22410 4159 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 5963 5253 gene locus_tag LOCUS_22420 5963 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 6144 6458 gene locus_tag LOCUS_22430 6144 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 6483 6899 gene locus_tag LOCUS_22440 6483 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 6943 7581 gene locus_tag LOCUS_22450 6943 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 7604 8998 gene locus_tag LOCUS_22460 gene thrC 7604 8998 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_22460 9053 9766 gene locus_tag LOCUS_22470 9053 9766 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_22470 9793 10386 gene locus_tag LOCUS_22480 9793 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 10497 11069 gene locus_tag LOCUS_22490 10497 11069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 11236 15264 gene locus_tag LOCUS_22500 11236 15264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 15852 18623 gene locus_tag LOCUS_22510 15852 18623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 21191 18624 gene locus_tag LOCUS_22520 21191 18624 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918008.1 protein_id gnl|my_center|LOCUS_22520 21832 21191 gene locus_tag LOCUS_22530 21832 21191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 22302 21853 gene locus_tag LOCUS_22540 gene mlaD 22302 21853 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941481.1 protein_id gnl|my_center|LOCUS_22540 23349 22327 gene locus_tag LOCUS_22550 23349 22327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 24133 23363 gene locus_tag LOCUS_22560 24133 23363 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_22560 24293 25039 gene locus_tag LOCUS_22570 24293 25039 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938538.1 protein_id gnl|my_center|LOCUS_22570 25155 26297 gene locus_tag LOCUS_22580 25155 26297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 26420 26872 gene locus_tag LOCUS_22590 26420 26872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 26872 27264 gene locus_tag LOCUS_22600 26872 27264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 27331 27990 gene locus_tag LOCUS_22610 27331 27990 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140293.1 protein_id gnl|my_center|LOCUS_22610 29654 28038 gene locus_tag LOCUS_22620 29654 28038 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224438.1 protein_id gnl|my_center|LOCUS_22620 30698 29748 gene locus_tag LOCUS_22630 30698 29748 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389548.1 protein_id gnl|my_center|LOCUS_22630 30884 31813 gene locus_tag LOCUS_22640 30884 31813 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_22640 33127 31880 gene locus_tag LOCUS_22650 33127 31880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 33271 33906 gene locus_tag LOCUS_22660 33271 33906 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083544.1 protein_id gnl|my_center|LOCUS_22660 33919 34650 gene locus_tag LOCUS_22670 33919 34650 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379796.1 protein_id gnl|my_center|LOCUS_22670 34666 35061 gene locus_tag LOCUS_22680 34666 35061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22680 35177 35632 gene locus_tag LOCUS_22690 35177 35632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 35788 36669 gene locus_tag LOCUS_22700 gene dapA 35788 36669 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939154.1 protein_id gnl|my_center|LOCUS_22700 36780 37088 gene locus_tag LOCUS_22710 36780 37088 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707788.1 protein_id gnl|my_center|LOCUS_22710 37134 37655 gene locus_tag LOCUS_22720 gene smpB 37134 37655 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919079.1 protein_id gnl|my_center|LOCUS_22720 39218 37770 gene locus_tag LOCUS_22730 gene nuoN 39218 37770 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389443.1 protein_id gnl|my_center|LOCUS_22730 40774 39290 gene locus_tag LOCUS_22740 40774 39290 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389442.1 protein_id gnl|my_center|LOCUS_22740 42783 40870 gene locus_tag LOCUS_22750 gene nuoL 42783 40870 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971513.1 protein_id gnl|my_center|LOCUS_22750 43112 42810 gene locus_tag LOCUS_22760 gene nuoK 43112 42810 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813920.1 protein_id gnl|my_center|LOCUS_22760 43703 43116 gene locus_tag LOCUS_22770 43703 43116 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919807.1 protein_id gnl|my_center|LOCUS_22770 44285 43791 gene locus_tag LOCUS_22780 gene nuoI 44285 43791 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389438.1 protein_id gnl|my_center|LOCUS_22780 45406 44363 gene locus_tag LOCUS_22790 gene nuoH 45406 44363 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389437.1 protein_id gnl|my_center|LOCUS_22790 47916 45514 gene locus_tag LOCUS_22800 gene nuoG 47916 45514 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389436.1 protein_id gnl|my_center|LOCUS_22800 49222 47960 gene locus_tag LOCUS_22810 gene nuoF 49222 47960 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389435.1 protein_id gnl|my_center|LOCUS_22810 49694 49239 gene locus_tag LOCUS_22820 gene nuoE 49694 49239 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597486.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence29 17958 17785 gene locus_tag LOCUS_22830 17958 17785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 18240 18851 gene locus_tag LOCUS_22840 18240 18851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 18866 19813 gene locus_tag LOCUS_22850 gene msrP 18866 19813 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920589.1 protein_id gnl|my_center|LOCUS_22850 19827 20426 gene locus_tag LOCUS_22860 19827 20426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 20426 21325 gene locus_tag LOCUS_22870 20426 21325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 21349 21981 gene locus_tag LOCUS_22880 21349 21981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 21978 22514 gene locus_tag LOCUS_22890 21978 22514 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073239.1 protein_id gnl|my_center|LOCUS_22890 22547 23125 gene locus_tag LOCUS_22900 22547 23125 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084626.1 protein_id gnl|my_center|LOCUS_22900 23532 24860 gene locus_tag LOCUS_22910 gene leuA 23532 24860 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098430.1 protein_id gnl|my_center|LOCUS_22910 24802 25305 gene locus_tag LOCUS_22920 24802 25305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 25759 26766 gene locus_tag LOCUS_22930 25759 26766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 26753 29869 gene locus_tag LOCUS_22940 26753 29869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 30024 38429 gene locus_tag LOCUS_22950 30024 38429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 38429 38854 gene locus_tag LOCUS_22960 38429 38854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 40813 38933 gene locus_tag LOCUS_22970 40813 38933 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813753.1 protein_id gnl|my_center|LOCUS_22970 41096 43267 gene locus_tag LOCUS_22980 gene scpA 41096 43267 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887727.1 protein_id gnl|my_center|LOCUS_22980 43264 44250 gene locus_tag LOCUS_22990 gene meaB 43264 44250 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005102543.1 protein_id gnl|my_center|LOCUS_22990 44254 45798 gene locus_tag LOCUS_23000 44254 45798 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_23000 45809 47767 gene locus_tag LOCUS_23010 45809 47767 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973161.1 protein_id gnl|my_center|LOCUS_23010 47930 48331 gene locus_tag LOCUS_23020 gene mce 47930 48331 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720998.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence30 223 459 gene locus_tag LOCUS_23030 223 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 449 706 gene locus_tag LOCUS_23040 449 706 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_23040 837 1790 gene locus_tag LOCUS_23050 837 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 1948 2178 gene locus_tag LOCUS_23060 1948 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 2188 4536 gene locus_tag LOCUS_23070 2188 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 4538 5191 gene locus_tag LOCUS_23080 4538 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 5334 5618 gene locus_tag LOCUS_23090 5334 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 5615 6133 gene locus_tag LOCUS_23100 5615 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 6130 6306 gene locus_tag LOCUS_23110 6130 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 6539 6464 gene locus_tag LOCUS_t00410 6539 6464 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6852 6658 gene locus_tag LOCUS_23120 gene iscX 6852 6658 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812452.1 protein_id gnl|my_center|LOCUS_23120 7187 6849 gene locus_tag LOCUS_23130 7187 6849 CDS product ferredoxin family 2Fe-2S iron-sulfur cluster binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389779.1 protein_id gnl|my_center|LOCUS_23130 9123 7225 gene locus_tag LOCUS_23140 gene hscA 9123 7225 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072280.1 protein_id gnl|my_center|LOCUS_23140 9693 9133 gene locus_tag LOCUS_23150 gene hscB 9693 9133 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105747.1 protein_id gnl|my_center|LOCUS_23150 10087 9761 gene locus_tag LOCUS_23160 gene iscA 10087 9761 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_23160 10536 10141 gene locus_tag LOCUS_23170 gene iscU 10536 10141 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213175.1 protein_id gnl|my_center|LOCUS_23170 11810 10596 gene locus_tag LOCUS_23180 11810 10596 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812462.1 protein_id gnl|my_center|LOCUS_23180 12953 11820 gene locus_tag LOCUS_23190 12953 11820 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943206.1 protein_id gnl|my_center|LOCUS_23190 13405 12950 gene locus_tag LOCUS_23200 gene iscR 13405 12950 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222202.1 protein_id gnl|my_center|LOCUS_23200 14127 13396 gene locus_tag LOCUS_23210 gene cysE 14127 13396 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_23210 14704 14243 gene locus_tag LOCUS_23220 14704 14243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 15729 14713 gene locus_tag LOCUS_23230 gene pdxA 15729 14713 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532510.1 protein_id gnl|my_center|LOCUS_23230 17082 15760 gene locus_tag LOCUS_23240 gene surA 17082 15760 CDS product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167006.1 protein_id gnl|my_center|LOCUS_23240 19376 17079 gene locus_tag LOCUS_23250 gene lptD 19376 17079 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073439.1 protein_id gnl|my_center|LOCUS_23250 20877 19561 gene locus_tag LOCUS_23260 20877 19561 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921370.1 protein_id gnl|my_center|LOCUS_23260 21871 20927 gene locus_tag LOCUS_23270 gene accD 21871 20927 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706493.1 protein_id gnl|my_center|LOCUS_23270 22555 21881 gene locus_tag LOCUS_23280 22555 21881 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_23280 23414 22563 gene locus_tag LOCUS_23290 gene trpC 23414 22563 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815394.1 protein_id gnl|my_center|LOCUS_23290 24430 23411 gene locus_tag LOCUS_23300 gene trpD 24430 23411 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943017.1 protein_id gnl|my_center|LOCUS_23300 25014 24427 gene locus_tag LOCUS_23310 25014 24427 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415847.1 protein_id gnl|my_center|LOCUS_23310 26547 25021 gene locus_tag LOCUS_23320 gene trpE 26547 25021 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_23320 26682 26757 gene locus_tag LOCUS_t00420 26682 26757 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 27531 29105 gene locus_tag LOCUS_23330 27531 29105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 29105 29881 gene locus_tag LOCUS_23340 gene istB 29105 29881 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391832.1 protein_id gnl|my_center|LOCUS_23340 30136 30621 gene locus_tag LOCUS_23350 30136 30621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 30851 31876 gene locus_tag LOCUS_23360 30851 31876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 32051 31863 gene locus_tag LOCUS_23370 32051 31863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 32544 32131 gene locus_tag LOCUS_23380 32544 32131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 33910 32567 gene locus_tag LOCUS_23390 33910 32567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 34338 33907 gene locus_tag LOCUS_23400 34338 33907 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_23400 34541 34335 gene locus_tag LOCUS_23410 34541 34335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 34824 35504 gene locus_tag LOCUS_23420 gene lexA 34824 35504 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_23420 35501 36676 gene locus_tag LOCUS_23430 35501 36676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 36679 37620 gene locus_tag LOCUS_23440 36679 37620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 38006 38209 gene locus_tag LOCUS_23450 38006 38209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 38307 39074 gene locus_tag LOCUS_23460 38307 39074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 39085 39810 gene locus_tag LOCUS_23470 39085 39810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 39900 40292 gene locus_tag LOCUS_23480 39900 40292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 40292 41230 gene locus_tag LOCUS_23490 40292 41230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 41224 42819 gene locus_tag LOCUS_23500 41224 42819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 42812 43018 gene locus_tag LOCUS_23510 42812 43018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 43030 45339 gene locus_tag LOCUS_23520 43030 45339 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975506.1 protein_id gnl|my_center|LOCUS_23520 44926 44951 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45768 46295 gene locus_tag LOCUS_23530 45768 46295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063611.1 protein_id gnl|my_center|LOCUS_23530 46292 46498 gene locus_tag LOCUS_23540 46292 46498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 46504 47157 gene locus_tag LOCUS_23550 46504 47157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 47493 47963 gene locus_tag LOCUS_23560 47493 47963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence31 <1 573 gene locus_tag LOCUS_23570 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941921.1:translation elongation factor 4 626 1546 gene locus_tag LOCUS_23580 626 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 1543 1980 gene locus_tag LOCUS_23590 1543 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 1984 2886 gene locus_tag LOCUS_23600 1984 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 2886 3884 gene locus_tag LOCUS_23610 gene era 2886 3884 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_23610 3868 4719 gene locus_tag LOCUS_23620 3868 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 4750 5916 gene locus_tag LOCUS_23630 4750 5916 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_23630 5950 7059 gene locus_tag LOCUS_23640 5950 7059 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202566.1 protein_id gnl|my_center|LOCUS_23640 7075 8019 gene locus_tag LOCUS_23650 7075 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 8254 8856 gene locus_tag LOCUS_23660 8254 8856 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966858.1 protein_id gnl|my_center|LOCUS_23660 8918 10375 gene locus_tag LOCUS_23670 8918 10375 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040261.1 protein_id gnl|my_center|LOCUS_23670 10372 11484 gene locus_tag LOCUS_23680 10372 11484 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532914.1 protein_id gnl|my_center|LOCUS_23680 11481 14552 gene locus_tag LOCUS_23690 11481 14552 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085210.1 protein_id gnl|my_center|LOCUS_23690 14613 15227 gene locus_tag LOCUS_23700 14613 15227 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404266.1 protein_id gnl|my_center|LOCUS_23700 15861 15232 gene locus_tag LOCUS_23710 15861 15232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 16171 15872 gene locus_tag LOCUS_23720 16171 15872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 17031 16318 gene locus_tag LOCUS_23730 17031 16318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 18134 17478 gene locus_tag LOCUS_23740 18134 17478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 18286 18507 gene locus_tag LOCUS_23750 18286 18507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 18645 20177 gene locus_tag LOCUS_23760 18645 20177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 20294 21028 gene locus_tag LOCUS_23770 20294 21028 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_23770 21033 21890 gene locus_tag LOCUS_23780 21033 21890 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_23780 21887 22237 gene locus_tag LOCUS_23790 21887 22237 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_23790 22661 24496 gene locus_tag LOCUS_23800 22661 24496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 24493 24852 gene locus_tag LOCUS_23810 24493 24852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 24862 25251 gene locus_tag LOCUS_23820 24862 25251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 25375 25674 gene locus_tag LOCUS_23830 25375 25674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 25763 27739 gene locus_tag LOCUS_23840 25763 27739 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259283.1 protein_id gnl|my_center|LOCUS_23840 27736 28296 gene locus_tag LOCUS_23850 27736 28296 CDS product DUF3124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139455833.1 protein_id gnl|my_center|LOCUS_23850 28999 28340 gene locus_tag LOCUS_23860 28999 28340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 31028 28965 gene locus_tag LOCUS_23870 31028 28965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23870 34036 31040 gene locus_tag LOCUS_23880 34036 31040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 37558 34490 gene locus_tag LOCUS_23890 gene mdtC 37558 34490 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815800.1 protein_id gnl|my_center|LOCUS_23890 40653 37555 gene locus_tag LOCUS_23900 40653 37555 CDS product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815034.1 protein_id gnl|my_center|LOCUS_23900 42036 40657 gene locus_tag LOCUS_23910 42036 40657 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815035.1 protein_id gnl|my_center|LOCUS_23910 42252 43055 gene locus_tag LOCUS_23920 42252 43055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 43632 43069 gene locus_tag LOCUS_23930 43632 43069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 45404 43659 gene locus_tag LOCUS_23940 45404 43659 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904125.1 protein_id gnl|my_center|LOCUS_23940 45644 46402 gene locus_tag LOCUS_23950 gene cpdA 45644 46402 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102066.1 protein_id gnl|my_center|LOCUS_23950 >Feature sequence32 15 2738 gene locus_tag LOCUS_23960 15 2738 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941696.1 protein_id gnl|my_center|LOCUS_23960 3603 2728 gene locus_tag LOCUS_23970 gene nfo 3603 2728 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932008.1 protein_id gnl|my_center|LOCUS_23970 4003 3614 gene locus_tag LOCUS_23980 4003 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 4394 4020 gene locus_tag LOCUS_23990 4394 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 5081 4431 gene locus_tag LOCUS_24000 gene mobA 5081 4431 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531703.1 protein_id gnl|my_center|LOCUS_24000 5381 5548 gene locus_tag LOCUS_24010 5381 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 5684 6055 gene locus_tag LOCUS_24020 5684 6055 CDS product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337920.1 protein_id gnl|my_center|LOCUS_24020 6401 7294 gene locus_tag LOCUS_24030 6401 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 8897 7734 gene locus_tag LOCUS_24040 8897 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 9098 10069 gene locus_tag LOCUS_24050 9098 10069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 10082 12091 gene locus_tag LOCUS_24060 gene uvrB 10082 12091 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_24060 12248 13543 gene locus_tag LOCUS_24070 12248 13543 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_24070 13583 14653 gene locus_tag LOCUS_24080 13583 14653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 14653 15264 gene locus_tag LOCUS_24090 14653 15264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 15264 15821 gene locus_tag LOCUS_24100 15264 15821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 16231 15872 gene locus_tag LOCUS_24110 16231 15872 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810732.1 protein_id gnl|my_center|LOCUS_24110 16566 16228 gene locus_tag LOCUS_24120 16566 16228 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_24120 16891 16706 gene locus_tag LOCUS_24130 16891 16706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 17103 17495 gene locus_tag LOCUS_24140 17103 17495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 21290 17544 gene locus_tag LOCUS_24150 21290 17544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 25241 21492 gene locus_tag LOCUS_24160 25241 21492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 25706 27718 gene locus_tag LOCUS_24170 25706 27718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 27762 29672 gene locus_tag LOCUS_24180 27762 29672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 29779 31491 gene locus_tag LOCUS_24190 gene mshE 29779 31491 CDS product MSHA fimbrial ATPase MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_24190 31494 34145 gene locus_tag LOCUS_24200 31494 34145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 35399 34905 gene locus_tag LOCUS_24210 35399 34905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 35644 35396 gene locus_tag LOCUS_24220 35644 35396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 36166 35882 gene locus_tag LOCUS_24230 36166 35882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 37371 36580 gene locus_tag LOCUS_24240 37371 36580 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140366.1 protein_id gnl|my_center|LOCUS_24240 38059 37658 gene locus_tag LOCUS_24250 38059 37658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 38461 38093 gene locus_tag LOCUS_24260 38461 38093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 39916 38513 gene locus_tag LOCUS_24270 39916 38513 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104442.1 protein_id gnl|my_center|LOCUS_24270 40534 40175 gene locus_tag LOCUS_24280 gene tnpB 40534 40175 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005747908.1 protein_id gnl|my_center|LOCUS_24280 40872 40531 gene locus_tag LOCUS_24290 40872 40531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 41969 41094 gene locus_tag LOCUS_24300 41969 41094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 42338 42045 gene locus_tag LOCUS_24310 42338 42045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 43342 42335 gene locus_tag LOCUS_24320 gene yejK 43342 42335 CDS product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113787.1 protein_id gnl|my_center|LOCUS_24320 44074 43694 gene locus_tag LOCUS_24330 44074 43694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 44565 44227 gene locus_tag LOCUS_24340 44565 44227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 44925 44653 gene locus_tag LOCUS_24350 44925 44653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 45289 45579 gene locus_tag LOCUS_24360 45289 45579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 45579 46091 gene locus_tag LOCUS_24370 45579 46091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24370 >Feature sequence33 1132 374 gene locus_tag LOCUS_24380 1132 374 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731052.1 protein_id gnl|my_center|LOCUS_24380 1366 2061 gene locus_tag LOCUS_24390 1366 2061 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010204183.1 protein_id gnl|my_center|LOCUS_24390 2172 3902 gene locus_tag LOCUS_24400 2172 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 3857 4681 gene locus_tag LOCUS_24410 3857 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 4693 6342 gene locus_tag LOCUS_24420 4693 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 9989 6432 gene locus_tag LOCUS_24430 9989 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 11676 9994 gene locus_tag LOCUS_24440 11676 9994 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_24440 12431 11673 gene locus_tag LOCUS_24450 gene tatC 12431 11673 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389524.1 protein_id gnl|my_center|LOCUS_24450 12867 12445 gene locus_tag LOCUS_24460 12867 12445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 13117 12902 gene locus_tag LOCUS_24470 13117 12902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 14102 13236 gene locus_tag LOCUS_24480 14102 13236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 15293 14256 gene locus_tag LOCUS_24490 15293 14256 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_24490 15487 23799 gene locus_tag LOCUS_24500 15487 23799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 23805 25298 gene locus_tag LOCUS_24510 23805 25298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 25300 27684 gene locus_tag LOCUS_24520 25300 27684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 27691 28386 gene locus_tag LOCUS_24530 27691 28386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 28373 29287 gene locus_tag LOCUS_24540 28373 29287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 29482 29697 gene locus_tag LOCUS_24550 29482 29697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 29697 30275 gene locus_tag LOCUS_24560 29697 30275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 30636 31637 gene locus_tag LOCUS_24570 gene pseB 30636 31637 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_24570 33137 31644 gene locus_tag LOCUS_24580 33137 31644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 33846 34490 gene locus_tag LOCUS_24590 33846 34490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 34600 35475 gene locus_tag LOCUS_24600 34600 35475 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_24600 35462 36550 gene locus_tag LOCUS_24610 35462 36550 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015754.1 protein_id gnl|my_center|LOCUS_24610 36523 37203 gene locus_tag LOCUS_24620 36523 37203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 37200 37898 gene locus_tag LOCUS_24630 gene pseF 37200 37898 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_24630 40013 37911 gene locus_tag LOCUS_24640 40013 37911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 41272 40070 gene locus_tag LOCUS_24650 41272 40070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 42090 41356 gene locus_tag LOCUS_24660 42090 41356 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088717.1 protein_id gnl|my_center|LOCUS_24660 44253 42178 gene locus_tag LOCUS_24670 gene pnp 44253 42178 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095181.1 protein_id gnl|my_center|LOCUS_24670 44693 44424 gene locus_tag LOCUS_24680 gene rpsO 44693 44424 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391531.1 protein_id gnl|my_center|LOCUS_24680 45395 44727 gene locus_tag LOCUS_24690 45395 44727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 45955 45494 gene locus_tag LOCUS_24700 gene rbfA 45955 45494 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475824.1 protein_id gnl|my_center|LOCUS_24700 >Feature sequence34 146 859 gene locus_tag LOCUS_24710 146 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 2519 918 gene locus_tag LOCUS_24720 2519 918 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880567.1 protein_id gnl|my_center|LOCUS_24720 2740 3906 gene locus_tag LOCUS_24730 gene metK 2740 3906 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_24730 3963 5261 gene locus_tag LOCUS_24740 gene ahcY 3963 5261 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 protein_id gnl|my_center|LOCUS_24740 5258 9244 gene locus_tag LOCUS_24750 gene hrpA 5258 9244 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268680.1 protein_id gnl|my_center|LOCUS_24750 10730 9354 gene locus_tag LOCUS_24760 10730 9354 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268280.1 protein_id gnl|my_center|LOCUS_24760 11398 10727 gene locus_tag LOCUS_24770 11398 10727 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070952.1 protein_id gnl|my_center|LOCUS_24770 11537 12934 gene locus_tag LOCUS_24780 11537 12934 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140787.1 protein_id gnl|my_center|LOCUS_24780 12946 13521 gene locus_tag LOCUS_24790 12946 13521 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388649.1 protein_id gnl|my_center|LOCUS_24790 13546 14130 gene locus_tag LOCUS_24800 13546 14130 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388648.1 protein_id gnl|my_center|LOCUS_24800 14151 14603 gene locus_tag LOCUS_24810 14151 14603 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371299.1 protein_id gnl|my_center|LOCUS_24810 14736 15767 gene locus_tag LOCUS_24820 14736 15767 CDS product TerC/Alx family metal homeostasis membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388645.1 protein_id gnl|my_center|LOCUS_24820 15812 17836 gene locus_tag LOCUS_24830 15812 17836 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898994.1 protein_id gnl|my_center|LOCUS_24830 19613 17847 gene locus_tag LOCUS_24840 19613 17847 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_24840 21343 19607 gene locus_tag LOCUS_24850 21343 19607 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267198.1 protein_id gnl|my_center|LOCUS_24850 22371 21334 gene locus_tag LOCUS_24860 22371 21334 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_24860 22668 23945 gene locus_tag LOCUS_24870 22668 23945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 23959 24375 gene locus_tag LOCUS_24880 23959 24375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 24497 25798 gene locus_tag LOCUS_24890 24497 25798 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226185.1 protein_id gnl|my_center|LOCUS_24890 26444 26626 gene locus_tag LOCUS_24900 26444 26626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 26623 29772 gene locus_tag LOCUS_24910 26623 29772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 30561 29791 gene locus_tag LOCUS_24920 30561 29791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 31082 30651 gene locus_tag LOCUS_24930 31082 30651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 31502 31083 gene locus_tag LOCUS_24940 31502 31083 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948605.1 protein_id gnl|my_center|LOCUS_24940 32161 33813 gene locus_tag LOCUS_24950 32161 33813 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792640.1 protein_id gnl|my_center|LOCUS_24950 33818 34483 gene locus_tag LOCUS_24960 33818 34483 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_24960 34480 35511 gene locus_tag LOCUS_24970 34480 35511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 35508 36119 gene locus_tag LOCUS_24980 35508 36119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 36123 37898 gene locus_tag LOCUS_24990 36123 37898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 38321 38094 gene locus_tag LOCUS_25000 38321 38094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 38551 39282 gene locus_tag LOCUS_25010 gene cas5c 38551 39282 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 protein_id gnl|my_center|LOCUS_25010 39279 41030 gene locus_tag LOCUS_25020 gene cas8c 39279 41030 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176708.1 protein_id gnl|my_center|LOCUS_25020 41054 41992 gene locus_tag LOCUS_25030 gene cas7c 41054 41992 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_25030 42498 42151 gene locus_tag LOCUS_25040 42498 42151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 42875 43060 gene locus_tag LOCUS_25050 42875 43060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 43238 43402 gene locus_tag LOCUS_25060 43238 43402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 43395 45269 gene locus_tag LOCUS_25070 43395 45269 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091102695.1 protein_id gnl|my_center|LOCUS_25070 >Feature sequence35 550 771 gene locus_tag LOCUS_25080 550 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 917 1219 gene locus_tag LOCUS_25090 917 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 1266 1550 gene locus_tag LOCUS_25100 1266 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 1745 2365 gene locus_tag LOCUS_25110 1745 2365 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946330.1 protein_id gnl|my_center|LOCUS_25110 2405 3964 gene locus_tag LOCUS_25120 gene rny 2405 3964 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_25120 3978 4739 gene locus_tag LOCUS_25130 3978 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 4920 6632 gene locus_tag LOCUS_25140 4920 6632 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941952.1 protein_id gnl|my_center|LOCUS_25140 6692 7555 gene locus_tag LOCUS_25150 6692 7555 CDS product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173287.1 protein_id gnl|my_center|LOCUS_25150 7558 8886 gene locus_tag LOCUS_25160 7558 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 8981 10078 gene locus_tag LOCUS_25170 8981 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 10159 10779 gene locus_tag LOCUS_25180 10159 10779 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_25180 10819 14505 gene locus_tag LOCUS_25190 gene mfd 10819 14505 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481852.1 protein_id gnl|my_center|LOCUS_25190 14549 14624 gene locus_tag LOCUS_t00430 14549 14624 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15351 15085 gene locus_tag LOCUS_25200 15351 15085 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 protein_id gnl|my_center|LOCUS_25200 15677 15348 gene locus_tag LOCUS_25210 15677 15348 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 protein_id gnl|my_center|LOCUS_25210 16616 15702 gene locus_tag LOCUS_25220 16616 15702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 17703 16618 gene locus_tag LOCUS_25230 17703 16618 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_25230 18016 17735 gene locus_tag LOCUS_25240 18016 17735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 18464 18231 gene locus_tag LOCUS_25250 18464 18231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 18493 18759 gene locus_tag LOCUS_25260 18493 18759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 18809 19117 gene locus_tag LOCUS_25270 18809 19117 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616835.1 protein_id gnl|my_center|LOCUS_25270 19122 19550 gene locus_tag LOCUS_25280 19122 19550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 20623 19604 gene locus_tag LOCUS_25290 20623 19604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 22685 20634 gene locus_tag LOCUS_25300 22685 20634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 22892 23278 gene locus_tag LOCUS_25310 22892 23278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 24177 23440 gene locus_tag LOCUS_25320 24177 23440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 25272 24406 gene locus_tag LOCUS_25330 25272 24406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 26413 25286 gene locus_tag LOCUS_25340 26413 25286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 29914 26441 gene locus_tag LOCUS_25350 29914 26441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 30435 31148 gene locus_tag LOCUS_25360 30435 31148 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_25360 31145 32905 gene locus_tag LOCUS_25370 gene phoR 31145 32905 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_25370 33051 35186 gene locus_tag LOCUS_25380 33051 35186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 35749 36804 gene locus_tag LOCUS_25390 35749 36804 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392751.1 protein_id gnl|my_center|LOCUS_25390 36882 37577 gene locus_tag LOCUS_25400 36882 37577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 37656 38381 gene locus_tag LOCUS_25410 37656 38381 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_25410 39162 38407 gene locus_tag LOCUS_25420 39162 38407 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_25420 39821 39315 gene locus_tag LOCUS_25430 39821 39315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 40314 40012 gene locus_tag LOCUS_25440 40314 40012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 41496 40438 gene locus_tag LOCUS_25450 41496 40438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 41673 42422 gene locus_tag LOCUS_25460 41673 42422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 42368 42514 gene locus_tag LOCUS_25470 42368 42514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 42567 43301 gene locus_tag LOCUS_25480 42567 43301 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020696.1 protein_id gnl|my_center|LOCUS_25480 43302 43745 gene locus_tag LOCUS_25490 43302 43745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 44278 43886 gene locus_tag LOCUS_25500 44278 43886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence36 <1 8027 gene locus_tag LOCUS_25510 <1 8027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928870.1:integrin alpha 8305 8670 gene locus_tag LOCUS_25520 8305 8670 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941944.1 protein_id gnl|my_center|LOCUS_25520 8758 9633 gene locus_tag LOCUS_25530 8758 9633 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_25530 11403 9652 gene locus_tag LOCUS_25540 11403 9652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 12054 11542 gene locus_tag LOCUS_25550 12054 11542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 12535 14340 gene locus_tag LOCUS_25560 12535 14340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 14345 15409 gene locus_tag LOCUS_25570 14345 15409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 15462 17240 gene locus_tag LOCUS_25580 15462 17240 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256840.1 protein_id gnl|my_center|LOCUS_25580 17279 18151 gene locus_tag LOCUS_25590 17279 18151 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256841.1 protein_id gnl|my_center|LOCUS_25590 18524 18219 gene locus_tag LOCUS_25600 18524 18219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 19109 22234 gene locus_tag LOCUS_25610 19109 22234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 22950 23216 gene locus_tag LOCUS_25620 22950 23216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 23449 23640 gene locus_tag LOCUS_25630 23449 23640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 24573 23683 gene locus_tag LOCUS_25640 24573 23683 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966458.1 protein_id gnl|my_center|LOCUS_25640 24790 24972 gene locus_tag LOCUS_25650 24790 24972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 24999 25607 gene locus_tag LOCUS_25660 24999 25607 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100063.1 protein_id gnl|my_center|LOCUS_25660 26464 25661 gene locus_tag LOCUS_25670 26464 25661 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_25670 27547 26477 gene locus_tag LOCUS_25680 27547 26477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 28346 27822 gene locus_tag LOCUS_25690 28346 27822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 28766 28461 gene locus_tag LOCUS_25700 28766 28461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 28785 29909 gene locus_tag LOCUS_25710 28785 29909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 29909 32473 gene locus_tag LOCUS_25720 gene cas10 29909 32473 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545463.1 protein_id gnl|my_center|LOCUS_25720 32470 32955 gene locus_tag LOCUS_25730 gene csm2 32470 32955 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546668.1 protein_id gnl|my_center|LOCUS_25730 32978 33682 gene locus_tag LOCUS_25740 gene csm3 32978 33682 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545508.1 protein_id gnl|my_center|LOCUS_25740 33700 34659 gene locus_tag LOCUS_25750 33700 34659 CDS product CRISPR-associated protein, Csm4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546365.1 protein_id gnl|my_center|LOCUS_25750 34652 36256 gene locus_tag LOCUS_25760 34652 36256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 36253 37203 gene locus_tag LOCUS_25770 36253 37203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 37209 37520 gene locus_tag LOCUS_25780 37209 37520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 37517 38704 gene locus_tag LOCUS_25790 37517 38704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 38710 39759 gene locus_tag LOCUS_25800 gene cas1 38710 39759 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388909.1 protein_id gnl|my_center|LOCUS_25800 39765 40055 gene locus_tag LOCUS_25810 gene cas2 39765 40055 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388908.1 protein_id gnl|my_center|LOCUS_25810 40321 41727 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq catcgatcacatgccccgccattaaggggattgaaac >Feature sequence37 2153 921 gene locus_tag LOCUS_25820 2153 921 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444497.1 protein_id gnl|my_center|LOCUS_25820 2883 2296 gene locus_tag LOCUS_25830 2883 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 3774 2887 gene locus_tag LOCUS_25840 gene mltB 3774 2887 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216677.1 protein_id gnl|my_center|LOCUS_25840 3736 3885 gene locus_tag LOCUS_25850 3736 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 4155 5942 gene locus_tag LOCUS_25860 4155 5942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_25860 5939 7756 gene locus_tag LOCUS_25870 5939 7756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_25870 8276 8563 gene locus_tag LOCUS_25880 8276 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 8770 9276 gene locus_tag LOCUS_25890 8770 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 10634 9273 gene locus_tag LOCUS_25900 10634 9273 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_25900 12118 10631 gene locus_tag LOCUS_25910 12118 10631 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546582.1 protein_id gnl|my_center|LOCUS_25910 12357 13292 gene locus_tag LOCUS_25920 12357 13292 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940556.1 protein_id gnl|my_center|LOCUS_25920 13655 15769 gene locus_tag LOCUS_25930 13655 15769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 19225 15905 gene locus_tag LOCUS_25940 19225 15905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 20139 19906 gene locus_tag LOCUS_25950 20139 19906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 20768 20238 gene locus_tag LOCUS_25960 20768 20238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 21103 20792 gene locus_tag LOCUS_25970 21103 20792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 21641 21210 gene locus_tag LOCUS_25980 21641 21210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 22738 21638 gene locus_tag LOCUS_25990 22738 21638 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_25990 23460 22759 gene locus_tag LOCUS_26000 23460 22759 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447174.1 protein_id gnl|my_center|LOCUS_26000 24212 23502 gene locus_tag LOCUS_26010 24212 23502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 25020 24220 gene locus_tag LOCUS_26020 gene flgG 25020 24220 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852142.1 protein_id gnl|my_center|LOCUS_26020 25899 25099 gene locus_tag LOCUS_26030 gene flgF 25899 25099 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_26030 26284 27147 gene locus_tag LOCUS_26040 gene mazG 26284 27147 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112589.1 protein_id gnl|my_center|LOCUS_26040 27144 28961 gene locus_tag LOCUS_26050 gene typA 27144 28961 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948509.1 protein_id gnl|my_center|LOCUS_26050 29069 29473 gene locus_tag LOCUS_26060 29069 29473 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_26060 29691 31862 gene locus_tag LOCUS_26070 29691 31862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 31962 32378 gene locus_tag LOCUS_26080 31962 32378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 32430 34169 gene locus_tag LOCUS_26090 32430 34169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 34843 34223 gene locus_tag LOCUS_26100 34843 34223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 36481 34925 gene locus_tag LOCUS_26110 36481 34925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 36832 36491 gene locus_tag LOCUS_26120 36832 36491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 37204 38040 gene locus_tag LOCUS_26130 37204 38040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 38131 39429 gene locus_tag LOCUS_26140 38131 39429 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247215.1 protein_id gnl|my_center|LOCUS_26140 39429 39986 gene locus_tag LOCUS_26150 39429 39986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 >Feature sequence38 <1 2428 gene locus_tag LOCUS_26160 <1 2428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703631.1:efflux RND transporter permease subunit 2421 3830 gene locus_tag LOCUS_26170 2421 3830 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188537.1 protein_id gnl|my_center|LOCUS_26170 4450 4490 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4536 4688 gene locus_tag LOCUS_26180 4536 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 5974 4892 gene locus_tag LOCUS_26190 5974 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 6761 5979 gene locus_tag LOCUS_26200 6761 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 7972 6767 gene locus_tag LOCUS_26210 7972 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 10315 8009 gene locus_tag LOCUS_26220 gene parC 10315 8009 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389601.1 protein_id gnl|my_center|LOCUS_26220 11457 10312 gene locus_tag LOCUS_26230 gene recA 11457 10312 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537720.1 protein_id gnl|my_center|LOCUS_26230 11696 12733 gene locus_tag LOCUS_26240 11696 12733 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003489919.1 protein_id gnl|my_center|LOCUS_26240 12762 13433 gene locus_tag LOCUS_26250 12762 13433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 13430 14017 gene locus_tag LOCUS_26260 13430 14017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 14709 14116 gene locus_tag LOCUS_26270 14709 14116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 14931 15776 gene locus_tag LOCUS_26280 14931 15776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 15789 16511 gene locus_tag LOCUS_26290 15789 16511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 16521 18152 gene locus_tag LOCUS_26300 16521 18152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 18453 18070 gene locus_tag LOCUS_26310 18453 18070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 20824 18947 gene locus_tag LOCUS_26320 20824 18947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 21155 20883 gene locus_tag LOCUS_26330 21155 20883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 21427 24108 gene locus_tag LOCUS_26340 21427 24108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 24692 24111 gene locus_tag LOCUS_26350 24692 24111 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940338.1 protein_id gnl|my_center|LOCUS_26350 25104 26384 gene locus_tag LOCUS_26360 25104 26384 CDS product bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114564.1 protein_id gnl|my_center|LOCUS_26360 26561 27136 gene locus_tag LOCUS_26370 26561 27136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 28092 27175 gene locus_tag LOCUS_26380 28092 27175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 28893 28132 gene locus_tag LOCUS_26390 28893 28132 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965197.1 protein_id gnl|my_center|LOCUS_26390 29265 29495 gene locus_tag LOCUS_26400 29265 29495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 29988 31034 gene locus_tag LOCUS_26410 29988 31034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 31367 31645 gene locus_tag LOCUS_26420 31367 31645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 31752 32561 gene locus_tag LOCUS_26430 31752 32561 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144308590.1 protein_id gnl|my_center|LOCUS_26430 33750 32839 gene locus_tag LOCUS_26440 33750 32839 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113064.1 protein_id gnl|my_center|LOCUS_26440 34968 34105 gene locus_tag LOCUS_26450 34968 34105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 35177 34998 gene locus_tag LOCUS_26460 35177 34998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 37019 35346 gene locus_tag LOCUS_26470 37019 35346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 37737 37378 gene locus_tag LOCUS_26480 gene tnpB 37737 37378 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005747908.1 protein_id gnl|my_center|LOCUS_26480 38175 37777 gene locus_tag LOCUS_26490 38175 37777 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227979.1 protein_id gnl|my_center|LOCUS_26490 38479 38159 gene locus_tag LOCUS_26500 38479 38159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 39857 38934 gene locus_tag LOCUS_26510 39857 38934 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence39 3 5354 gene locus_tag LOCUS_26520 3 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26520 5691 6254 gene locus_tag LOCUS_26530 5691 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 6329 7285 gene locus_tag LOCUS_26540 6329 7285 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_26540 7287 8588 gene locus_tag LOCUS_26550 7287 8588 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_26550 8609 9466 gene locus_tag LOCUS_26560 8609 9466 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_26560 9542 11626 gene locus_tag LOCUS_26570 gene fusA 9542 11626 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_26570 11727 11927 gene locus_tag LOCUS_26580 11727 11927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 12083 14530 gene locus_tag LOCUS_26590 gene gyrB 12083 14530 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704050.1 protein_id gnl|my_center|LOCUS_26590 15031 14549 gene locus_tag LOCUS_26600 15031 14549 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974838.1 protein_id gnl|my_center|LOCUS_26600 15585 15028 gene locus_tag LOCUS_26610 15585 15028 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039916.1 protein_id gnl|my_center|LOCUS_26610 17562 15598 gene locus_tag LOCUS_26620 17562 15598 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926646.1 protein_id gnl|my_center|LOCUS_26620 17848 18852 gene locus_tag LOCUS_26630 gene bioB 17848 18852 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002111813.1 protein_id gnl|my_center|LOCUS_26630 18944 19771 gene locus_tag LOCUS_26640 18944 19771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 19807 21546 gene locus_tag LOCUS_26650 19807 21546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 22391 21543 gene locus_tag LOCUS_26660 22391 21543 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_26660 24500 22458 gene locus_tag LOCUS_26670 24500 22458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 24412 24618 gene locus_tag LOCUS_26680 24412 24618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 26165 24771 gene locus_tag LOCUS_26690 gene argH 26165 24771 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121138.1 protein_id gnl|my_center|LOCUS_26690 27379 26162 gene locus_tag LOCUS_26700 27379 26162 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_26700 28406 27459 gene locus_tag LOCUS_26710 gene argF 28406 27459 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190177.1 protein_id gnl|my_center|LOCUS_26710 29688 28432 gene locus_tag LOCUS_26720 29688 28432 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940827.1 protein_id gnl|my_center|LOCUS_26720 30333 29863 gene locus_tag LOCUS_26730 30333 29863 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_26730 30570 30346 gene locus_tag LOCUS_26740 gene tusA 30570 30346 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_26740 30781 31317 gene locus_tag LOCUS_26750 30781 31317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 32076 31531 gene locus_tag LOCUS_26760 32076 31531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 <34213 32179 gene locus_tag LOCUS_26770 <34213 32179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943185.1:type I DNA topoisomerase >Feature sequence40 879 340 gene locus_tag LOCUS_26780 879 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 2431 872 gene locus_tag LOCUS_26790 2431 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 3387 2428 gene locus_tag LOCUS_26800 3387 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 3770 3387 gene locus_tag LOCUS_26810 3770 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 4532 3861 gene locus_tag LOCUS_26820 4532 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 5306 4545 gene locus_tag LOCUS_26830 5306 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 5791 5306 gene locus_tag LOCUS_26840 5791 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 5916 6149 gene locus_tag LOCUS_26850 5916 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 7216 6590 gene locus_tag LOCUS_26860 7216 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 7666 7220 gene locus_tag LOCUS_26870 7666 7220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 9264 8131 gene locus_tag LOCUS_26880 9264 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 11162 9267 gene locus_tag LOCUS_26890 11162 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 11434 12408 gene locus_tag LOCUS_26900 11434 12408 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150678942.1 protein_id gnl|my_center|LOCUS_26900 12449 13201 gene locus_tag LOCUS_26910 gene yaaA 12449 13201 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906204.1 protein_id gnl|my_center|LOCUS_26910 13636 13283 gene locus_tag LOCUS_26920 13636 13283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 13900 13646 gene locus_tag LOCUS_26930 13900 13646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 14736 13900 gene locus_tag LOCUS_26940 14736 13900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 16177 15083 gene locus_tag LOCUS_26950 16177 15083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 16482 16667 gene locus_tag LOCUS_26960 16482 16667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 16664 17107 gene locus_tag LOCUS_26970 16664 17107 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_26970 17104 18414 gene locus_tag LOCUS_26980 17104 18414 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_26980 18411 18821 gene locus_tag LOCUS_26990 18411 18821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 18839 19177 gene locus_tag LOCUS_27000 18839 19177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 19240 19458 gene locus_tag LOCUS_27010 19240 19458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 23334 19537 gene locus_tag LOCUS_27020 23334 19537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 24493 24419 gene locus_tag LOCUS_t00440 24493 24419 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 27255 24571 gene locus_tag LOCUS_27030 27255 24571 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_27030 27343 28425 gene locus_tag LOCUS_27040 gene pilM 27343 28425 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_27040 28422 29015 gene locus_tag LOCUS_27050 28422 29015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 29019 29636 gene locus_tag LOCUS_27060 29019 29636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 29633 30100 gene locus_tag LOCUS_27070 29633 30100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 30097 31209 gene locus_tag LOCUS_27080 gene aroB 30097 31209 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765495.1 protein_id gnl|my_center|LOCUS_27080 31214 32899 gene locus_tag LOCUS_27090 31214 32899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence41 <1 20981 gene locus_tag LOCUS_27100 <1 20981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036966.1:filamentous hemagglutinin N-terminal domain-containing protein 20965 22191 gene locus_tag LOCUS_27110 20965 22191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 22240 23958 gene locus_tag LOCUS_27120 22240 23958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 23962 24789 gene locus_tag LOCUS_27130 23962 24789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 24786 26669 gene locus_tag LOCUS_27140 24786 26669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 26666 28828 gene locus_tag LOCUS_27150 26666 28828 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_27150 29033 30148 gene locus_tag LOCUS_27160 29033 30148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27160 30122 30142 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30153 30851 gene locus_tag LOCUS_27170 30153 30851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27170 30912 31613 gene locus_tag LOCUS_27180 30912 31613 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944588.1 protein_id gnl|my_center|LOCUS_27180 31953 32174 gene locus_tag LOCUS_27190 31953 32174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 32187 32396 gene locus_tag LOCUS_27200 32187 32396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 >Feature sequence42 2230 527 gene locus_tag LOCUS_27210 gene glnS 2230 527 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210354.1 protein_id gnl|my_center|LOCUS_27210 2726 2274 gene locus_tag LOCUS_27220 2726 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 3033 3647 gene locus_tag LOCUS_27230 3033 3647 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275303.1 protein_id gnl|my_center|LOCUS_27230 4152 3649 gene locus_tag LOCUS_27240 4152 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 4803 4177 gene locus_tag LOCUS_27250 4803 4177 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351379.1 protein_id gnl|my_center|LOCUS_27250 4918 6768 gene locus_tag LOCUS_27260 gene ilvD 4918 6768 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244135.1 protein_id gnl|my_center|LOCUS_27260 8193 6778 gene locus_tag LOCUS_27270 gene lpdA 8193 6778 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064876.1 protein_id gnl|my_center|LOCUS_27270 8471 10210 gene locus_tag LOCUS_27280 8471 10210 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204925.1 protein_id gnl|my_center|LOCUS_27280 10424 10735 gene locus_tag LOCUS_27290 10424 10735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 10732 12084 gene locus_tag LOCUS_27300 10732 12084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 12081 14015 gene locus_tag LOCUS_27310 12081 14015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 14012 15115 gene locus_tag LOCUS_27320 14012 15115 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 protein_id gnl|my_center|LOCUS_27320 15235 18411 gene locus_tag LOCUS_27330 15235 18411 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554541.1 protein_id gnl|my_center|LOCUS_27330 18465 19340 gene locus_tag LOCUS_27340 gene rpoH 18465 19340 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388865.1 protein_id gnl|my_center|LOCUS_27340 20049 19348 gene locus_tag LOCUS_27350 20049 19348 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_27350 24197 20052 gene locus_tag LOCUS_27360 24197 20052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 24199 24555 gene locus_tag LOCUS_27370 24199 24555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 25807 26646 gene locus_tag LOCUS_27380 25807 26646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 26710 27150 gene locus_tag LOCUS_27390 26710 27150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 27747 28010 gene locus_tag LOCUS_27400 27747 28010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 28135 28377 gene locus_tag LOCUS_27410 28135 28377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 28729 29025 gene locus_tag LOCUS_27420 28729 29025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 29131 29625 gene locus_tag LOCUS_27430 29131 29625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 >Feature sequence43 999 3707 gene locus_tag LOCUS_27440 999 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 6797 3738 gene locus_tag LOCUS_27450 6797 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 7038 9839 gene locus_tag LOCUS_27460 7038 9839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27460 9844 10212 gene locus_tag LOCUS_27470 9844 10212 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969399.1 protein_id gnl|my_center|LOCUS_27470 10226 12853 gene locus_tag LOCUS_27480 10226 12853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 13308 12907 gene locus_tag LOCUS_27490 13308 12907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 14079 13492 gene locus_tag LOCUS_27500 14079 13492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 14577 14092 gene locus_tag LOCUS_27510 14577 14092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 14891 14697 gene locus_tag LOCUS_27520 14891 14697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 14916 16508 gene locus_tag LOCUS_27530 14916 16508 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530132.1 protein_id gnl|my_center|LOCUS_27530 16525 17835 gene locus_tag LOCUS_27540 16525 17835 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265542.1 protein_id gnl|my_center|LOCUS_27540 17927 18739 gene locus_tag LOCUS_27550 17927 18739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 18702 19133 gene locus_tag LOCUS_27560 18702 19133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 19039 20904 gene locus_tag LOCUS_27570 19039 20904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 20981 22684 gene locus_tag LOCUS_27580 20981 22684 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073843.1 protein_id gnl|my_center|LOCUS_27580 22687 24918 gene locus_tag LOCUS_27590 22687 24918 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073977.1 protein_id gnl|my_center|LOCUS_27590 24915 26315 gene locus_tag LOCUS_27600 24915 26315 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938317.1 protein_id gnl|my_center|LOCUS_27600 >Feature sequence44 353 751 gene locus_tag LOCUS_27610 353 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 911 1957 gene locus_tag LOCUS_27620 911 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 3376 1967 gene locus_tag LOCUS_27630 3376 1967 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_27630 3390 3929 gene locus_tag LOCUS_27640 3390 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 4214 4008 gene locus_tag LOCUS_27650 gene rpmE 4214 4008 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_27650 5493 4237 gene locus_tag LOCUS_27660 gene rho 5493 4237 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_27660 5509 5688 gene locus_tag LOCUS_27670 5509 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 6578 5847 gene locus_tag LOCUS_27680 gene coaE 6578 5847 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257771.1 protein_id gnl|my_center|LOCUS_27680 7336 6563 gene locus_tag LOCUS_27690 7336 6563 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_27690 9045 7360 gene locus_tag LOCUS_27700 9045 7360 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535987.1 protein_id gnl|my_center|LOCUS_27700 9259 9038 gene locus_tag LOCUS_27710 9259 9038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 10347 9256 gene locus_tag LOCUS_27720 10347 9256 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947153.1 protein_id gnl|my_center|LOCUS_27720 11656 10382 gene locus_tag LOCUS_27730 gene lysA 11656 10382 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384387.1 protein_id gnl|my_center|LOCUS_27730 12561 11890 gene locus_tag LOCUS_27740 12561 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 13334 12726 gene locus_tag LOCUS_27750 13334 12726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 13930 13349 gene locus_tag LOCUS_27760 13930 13349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 17239 13934 gene locus_tag LOCUS_27770 17239 13934 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072999.1 protein_id gnl|my_center|LOCUS_27770 17592 17239 gene locus_tag LOCUS_27780 17592 17239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 18354 17611 gene locus_tag LOCUS_27790 18354 17611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27790 19751 18351 gene locus_tag LOCUS_27800 gene tolC 19751 18351 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944694.1 protein_id gnl|my_center|LOCUS_27800 20370 20795 gene locus_tag LOCUS_27810 20370 20795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 20792 21223 gene locus_tag LOCUS_27820 20792 21223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 21220 21705 gene locus_tag LOCUS_27830 21220 21705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 24131 21753 gene locus_tag LOCUS_27840 gene pheT 24131 21753 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_27840 24355 24813 gene locus_tag LOCUS_27850 24355 24813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 25351 24833 gene locus_tag LOCUS_27860 25351 24833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 26060 25458 gene locus_tag LOCUS_27870 26060 25458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 26619 26224 gene locus_tag LOCUS_27880 gene rpsI 26619 26224 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384467.1 protein_id gnl|my_center|LOCUS_27880 27131 26691 gene locus_tag LOCUS_27890 gene rplM 27131 26691 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094164.1 protein_id gnl|my_center|LOCUS_27890 >Feature sequence45 2865 148 gene locus_tag LOCUS_27900 gene polA 2865 148 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_27900 5003 2877 gene locus_tag LOCUS_27910 5003 2877 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_27910 6045 4990 gene locus_tag LOCUS_27920 6045 4990 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532214.1 protein_id gnl|my_center|LOCUS_27920 6214 7572 gene locus_tag LOCUS_27930 6214 7572 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597555.1 protein_id gnl|my_center|LOCUS_27930 7603 9657 gene locus_tag LOCUS_27940 7603 9657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 9785 11068 gene locus_tag LOCUS_27950 9785 11068 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_27950 12287 11085 gene locus_tag LOCUS_27960 12287 11085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 12470 12856 gene locus_tag LOCUS_27970 12470 12856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 13228 15492 gene locus_tag LOCUS_27980 13228 15492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 15521 16669 gene locus_tag LOCUS_27990 15521 16669 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_27990 16666 18738 gene locus_tag LOCUS_28000 16666 18738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 19143 18820 gene locus_tag LOCUS_28010 19143 18820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 19289 20221 gene locus_tag LOCUS_28020 19289 20221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 20262 20951 gene locus_tag LOCUS_28030 20262 20951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 21480 20935 gene locus_tag LOCUS_28040 21480 20935 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739193.1 protein_id gnl|my_center|LOCUS_28040 21734 21477 gene locus_tag LOCUS_28050 21734 21477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 21885 22901 gene locus_tag LOCUS_28060 21885 22901 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 protein_id gnl|my_center|LOCUS_28060 23155 23400 gene locus_tag LOCUS_28070 23155 23400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 23534 23932 gene locus_tag LOCUS_28080 23534 23932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 >Feature sequence46 312 237 gene locus_tag LOCUS_t00450 312 237 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1268 384 gene locus_tag LOCUS_28090 1268 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 1397 1939 gene locus_tag LOCUS_28100 1397 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28100 2027 2371 gene locus_tag LOCUS_28110 2027 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28110 2495 3823 gene locus_tag LOCUS_28120 2495 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 3827 7711 gene locus_tag LOCUS_28130 gene purL 3827 7711 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830389.1 protein_id gnl|my_center|LOCUS_28130 7985 8329 gene locus_tag LOCUS_28140 7985 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 10655 8544 gene locus_tag LOCUS_28150 10655 8544 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_28150 10820 11107 gene locus_tag LOCUS_28160 10820 11107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 11224 13359 gene locus_tag LOCUS_28170 11224 13359 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207682836.1 protein_id gnl|my_center|LOCUS_28170 13393 14949 gene locus_tag LOCUS_28180 13393 14949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 15149 15772 gene locus_tag LOCUS_28190 15149 15772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 17253 15811 gene locus_tag LOCUS_28200 17253 15811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 18053 17250 gene locus_tag LOCUS_28210 18053 17250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 20898 18067 gene locus_tag LOCUS_28220 20898 18067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 >Feature sequence47 2138 1014 gene locus_tag LOCUS_28230 2138 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 2726 3682 gene locus_tag LOCUS_28240 2726 3682 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194383.1 protein_id gnl|my_center|LOCUS_28240 3894 6068 gene locus_tag LOCUS_28250 gene katG 3894 6068 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400805.1 protein_id gnl|my_center|LOCUS_28250 7505 6111 gene locus_tag LOCUS_28260 gene purB 7505 6111 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113371.1 protein_id gnl|my_center|LOCUS_28260 10371 7711 gene locus_tag LOCUS_28270 10371 7711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 10471 11151 gene locus_tag LOCUS_28280 10471 11151 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256873.1 protein_id gnl|my_center|LOCUS_28280 11312 12889 gene locus_tag LOCUS_28290 gene pntA 11312 12889 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096869.1 protein_id gnl|my_center|LOCUS_28290 12896 14302 gene locus_tag LOCUS_28300 gene pntB 12896 14302 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461042.1 protein_id gnl|my_center|LOCUS_28300 14314 14943 gene locus_tag LOCUS_28310 14314 14943 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113134.1 protein_id gnl|my_center|LOCUS_28310 15925 14924 gene locus_tag LOCUS_28320 15925 14924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 17027 16194 gene locus_tag LOCUS_28330 17027 16194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 17995 17108 gene locus_tag LOCUS_28340 17995 17108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 19668 17998 gene locus_tag LOCUS_28350 19668 17998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 >Feature sequence48 355 1467 gene locus_tag LOCUS_28360 gene recF 355 1467 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940680.1 protein_id gnl|my_center|LOCUS_28360 1489 1959 gene locus_tag LOCUS_28370 1489 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 2043 3899 gene locus_tag LOCUS_28380 2043 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 4282 3932 gene locus_tag LOCUS_28390 4282 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 4433 6187 gene locus_tag LOCUS_28400 4433 6187 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942999.1 protein_id gnl|my_center|LOCUS_28400 6215 8179 gene locus_tag LOCUS_28410 6215 8179 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389289.1 protein_id gnl|my_center|LOCUS_28410 8183 8791 gene locus_tag LOCUS_28420 8183 8791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 9329 8811 gene locus_tag LOCUS_28430 9329 8811 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529725.1 protein_id gnl|my_center|LOCUS_28430 10727 9420 gene locus_tag LOCUS_28440 10727 9420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 11179 13539 gene locus_tag LOCUS_28450 11179 13539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 13622 15220 gene locus_tag LOCUS_28460 13622 15220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 16196 15237 gene locus_tag LOCUS_28470 16196 15237 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_28470 16718 18097 gene locus_tag LOCUS_28480 16718 18097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 18330 18689 gene locus_tag LOCUS_28490 18330 18689 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958264.1 protein_id gnl|my_center|LOCUS_28490 18653 18976 gene locus_tag LOCUS_28500 18653 18976 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390816.1 protein_id gnl|my_center|LOCUS_28500 19100 19297 gene locus_tag LOCUS_28510 19100 19297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 19399 19226 gene locus_tag LOCUS_28520 19399 19226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence49 2386 3120 gene locus_tag LOCUS_28530 gene pdxJ 2386 3120 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101974.1 protein_id gnl|my_center|LOCUS_28530 3122 5404 gene locus_tag LOCUS_28540 3122 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 7150 5447 gene locus_tag LOCUS_28550 7150 5447 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_28550 7559 9610 gene locus_tag LOCUS_28560 gene metG 7559 9610 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072568.1 protein_id gnl|my_center|LOCUS_28560 9640 11430 gene locus_tag LOCUS_28570 9640 11430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 11447 12298 gene locus_tag LOCUS_28580 11447 12298 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167389.1 protein_id gnl|my_center|LOCUS_28580 15551 12291 gene locus_tag LOCUS_28590 15551 12291 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044884.1 protein_id gnl|my_center|LOCUS_28590 16605 15553 gene locus_tag LOCUS_28600 16605 15553 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256737.1 protein_id gnl|my_center|LOCUS_28600 18854 16602 gene locus_tag LOCUS_28610 18854 16602 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015337756.1 protein_id gnl|my_center|LOCUS_28610 20489 18873 gene locus_tag LOCUS_28620 20489 18873 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941702.1 protein_id gnl|my_center|LOCUS_28620 21029 20520 gene locus_tag LOCUS_28630 21029 20520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 <21849 21022 gene locus_tag LOCUS_28640 <21849 21022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012660540.1:protein-glutamate O-methyltransferase CheR >Feature sequence50 668 444 gene locus_tag LOCUS_28650 668 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 2668 848 gene locus_tag LOCUS_28660 2668 848 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626303.1 protein_id gnl|my_center|LOCUS_28660 2990 4645 gene locus_tag LOCUS_28670 2990 4645 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947007.1 protein_id gnl|my_center|LOCUS_28670 4666 5928 gene locus_tag LOCUS_28680 4666 5928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 6639 5938 gene locus_tag LOCUS_28690 gene yihA 6639 5938 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816879.1 protein_id gnl|my_center|LOCUS_28690 7252 6641 gene locus_tag LOCUS_28700 7252 6641 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941521.1 protein_id gnl|my_center|LOCUS_28700 8038 7784 gene locus_tag LOCUS_28710 8038 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 8786 8217 gene locus_tag LOCUS_28720 8786 8217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 10682 9033 gene locus_tag LOCUS_28730 gene pgi 10682 9033 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932668.1 protein_id gnl|my_center|LOCUS_28730 11651 10725 gene locus_tag LOCUS_28740 gene miaA 11651 10725 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704169.1 protein_id gnl|my_center|LOCUS_28740 12808 11744 gene locus_tag LOCUS_28750 12808 11744 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_28750 13999 12812 gene locus_tag LOCUS_28760 13999 12812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 14529 14173 gene locus_tag LOCUS_28770 14529 14173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 15122 14682 gene locus_tag LOCUS_28780 15122 14682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 15904 15158 gene locus_tag LOCUS_28790 15904 15158 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193701.1 protein_id gnl|my_center|LOCUS_28790 16643 18562 gene locus_tag LOCUS_28800 16643 18562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 18559 20763 gene locus_tag LOCUS_28810 18559 20763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 21332 20868 gene locus_tag LOCUS_28820 21332 20868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 >Feature sequence51 2617 83 gene locus_tag LOCUS_28830 2617 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 2823 4643 gene locus_tag LOCUS_28840 2823 4643 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390041.1 protein_id gnl|my_center|LOCUS_28840 4789 5145 gene locus_tag LOCUS_28850 4789 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 6035 5220 gene locus_tag LOCUS_28860 6035 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 7470 6049 gene locus_tag LOCUS_28870 7470 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 8255 7467 gene locus_tag LOCUS_28880 8255 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 9883 8252 gene locus_tag LOCUS_28890 9883 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 12106 10007 gene locus_tag LOCUS_28900 12106 10007 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122239.1 protein_id gnl|my_center|LOCUS_28900 <20325 12103 gene locus_tag LOCUS_28910 <20325 12103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086345.1:VCBS domain-containing protein >Feature sequence52 200 30 gene locus_tag LOCUS_28920 200 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 1795 425 gene locus_tag LOCUS_28930 1795 425 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073845.1 protein_id gnl|my_center|LOCUS_28930 3930 1792 gene locus_tag LOCUS_28940 3930 1792 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356916.1 protein_id gnl|my_center|LOCUS_28940 6182 3927 gene locus_tag LOCUS_28950 6182 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 6645 8309 gene locus_tag LOCUS_28960 6645 8309 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 protein_id gnl|my_center|LOCUS_28960 8382 9146 gene locus_tag LOCUS_28970 8382 9146 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532324.1 protein_id gnl|my_center|LOCUS_28970 9268 9579 gene locus_tag LOCUS_28980 9268 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 9602 9814 gene locus_tag LOCUS_28990 9602 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 10551 9811 gene locus_tag LOCUS_29000 10551 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 11358 10615 gene locus_tag LOCUS_29010 11358 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 12026 12286 gene locus_tag LOCUS_29020 12026 12286 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530040.1 protein_id gnl|my_center|LOCUS_29020 12294 12611 gene locus_tag LOCUS_29030 12294 12611 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143494.1 protein_id gnl|my_center|LOCUS_29030 12613 13032 gene locus_tag LOCUS_29040 12613 13032 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 protein_id gnl|my_center|LOCUS_29040 14090 13020 gene locus_tag LOCUS_29050 14090 13020 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_29050 15283 14090 gene locus_tag LOCUS_29060 15283 14090 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980842.1 protein_id gnl|my_center|LOCUS_29060 15386 16060 gene locus_tag LOCUS_29070 15386 16060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 16216 16070 gene locus_tag LOCUS_29080 16216 16070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 17042 16206 gene locus_tag LOCUS_29090 17042 16206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 18403 17045 gene locus_tag LOCUS_29100 gene xseA 18403 17045 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_29100 >Feature sequence53 <1 782 gene locus_tag LOCUS_29110 <1 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014857633.1:pitrilysin family protein 779 2098 gene locus_tag LOCUS_29120 779 2098 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948372.1 protein_id gnl|my_center|LOCUS_29120 3504 2122 gene locus_tag LOCUS_29130 3504 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 5219 3507 gene locus_tag LOCUS_29140 5219 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 6197 5259 gene locus_tag LOCUS_29150 6197 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 7132 6197 gene locus_tag LOCUS_29160 7132 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 7958 7137 gene locus_tag LOCUS_29170 7958 7137 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546302.1 protein_id gnl|my_center|LOCUS_29170 9043 7967 gene locus_tag LOCUS_29180 gene rfbG 9043 7967 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_29180 9816 9043 gene locus_tag LOCUS_29190 gene rfbF 9816 9043 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261038.1 protein_id gnl|my_center|LOCUS_29190 11494 9851 gene locus_tag LOCUS_29200 11494 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 12661 11585 gene locus_tag LOCUS_29210 12661 11585 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527941.1 protein_id gnl|my_center|LOCUS_29210 14547 12658 gene locus_tag LOCUS_29220 14547 12658 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193219.1 protein_id gnl|my_center|LOCUS_29220 15749 14667 gene locus_tag LOCUS_29230 gene amrS 15749 14667 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_29230 15916 16398 gene locus_tag LOCUS_29240 15916 16398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 17085 16468 gene locus_tag LOCUS_29250 17085 16468 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524311.1 protein_id gnl|my_center|LOCUS_29250 17275 18183 gene locus_tag LOCUS_29260 17275 18183 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073356551.1 protein_id gnl|my_center|LOCUS_29260 >Feature sequence54 1124 384 gene locus_tag LOCUS_29270 1124 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 3307 1184 gene locus_tag LOCUS_29280 3307 1184 CDS product Mu transposase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289290.1 protein_id gnl|my_center|LOCUS_29280 3333 3518 gene locus_tag LOCUS_29290 3333 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 3899 3642 gene locus_tag LOCUS_29300 3899 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 4761 3922 gene locus_tag LOCUS_29310 4761 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 5234 4758 gene locus_tag LOCUS_29320 5234 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 5832 5278 gene locus_tag LOCUS_29330 5832 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 6140 5829 gene locus_tag LOCUS_29340 6140 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 6236 6688 gene locus_tag LOCUS_29350 6236 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 6779 7117 gene locus_tag LOCUS_29360 6779 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 7796 7185 gene locus_tag LOCUS_29370 7796 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 8164 8943 gene locus_tag LOCUS_29380 8164 8943 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968155.1 protein_id gnl|my_center|LOCUS_29380 9193 10212 gene locus_tag LOCUS_29390 9193 10212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 10328 10762 gene locus_tag LOCUS_29400 10328 10762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 10795 11073 gene locus_tag LOCUS_29410 10795 11073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 11294 11527 gene locus_tag LOCUS_29420 11294 11527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 11527 12231 gene locus_tag LOCUS_29430 11527 12231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 12212 13828 gene locus_tag LOCUS_29440 gene terL 12212 13828 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003751157.1 protein_id gnl|my_center|LOCUS_29440 13831 15333 gene locus_tag LOCUS_29450 13831 15333 CDS product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090679.1 protein_id gnl|my_center|LOCUS_29450 15317 16657 gene locus_tag LOCUS_29460 15317 16657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 16766 17320 gene locus_tag LOCUS_29470 16766 17320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 17608 18390 gene locus_tag LOCUS_29480 17608 18390 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140366.1 protein_id gnl|my_center|LOCUS_29480 >Feature sequence55 41 3751 gene locus_tag LOCUS_29490 41 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 4287 3745 gene locus_tag LOCUS_29500 4287 3745 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 protein_id gnl|my_center|LOCUS_29500 5023 4346 gene locus_tag LOCUS_29510 5023 4346 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042064868.1 protein_id gnl|my_center|LOCUS_29510 5774 5016 gene locus_tag LOCUS_29520 gene kdsB 5774 5016 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_29520 6623 5826 gene locus_tag LOCUS_29530 6623 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 7849 6620 gene locus_tag LOCUS_29540 gene tyrS 7849 6620 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 protein_id gnl|my_center|LOCUS_29540 7884 9029 gene locus_tag LOCUS_29550 7884 9029 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770633.1 protein_id gnl|my_center|LOCUS_29550 9134 9469 gene locus_tag LOCUS_29560 9134 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 9523 11103 gene locus_tag LOCUS_29570 9523 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 11242 11763 gene locus_tag LOCUS_29580 gene def 11242 11763 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391097.1 protein_id gnl|my_center|LOCUS_29580 11760 12710 gene locus_tag LOCUS_29590 gene fmt 11760 12710 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114642.1 protein_id gnl|my_center|LOCUS_29590 12827 13333 gene locus_tag LOCUS_29600 gene tpx 12827 13333 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089950.1 protein_id gnl|my_center|LOCUS_29600 13534 14274 gene locus_tag LOCUS_29610 13534 14274 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 protein_id gnl|my_center|LOCUS_29610 14300 15502 gene locus_tag LOCUS_29620 gene neuC 14300 15502 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392276.1 protein_id gnl|my_center|LOCUS_29620 15519 16649 gene locus_tag LOCUS_29630 gene neuB 15519 16649 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403381.1 protein_id gnl|my_center|LOCUS_29630 16646 17353 gene locus_tag LOCUS_29640 16646 17353 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403384.1 protein_id gnl|my_center|LOCUS_29640 18156 17377 gene locus_tag LOCUS_29650 18156 17377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 >Feature sequence56 1 237 gene locus_tag LOCUS_29660 1 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 376 2958 gene locus_tag LOCUS_29670 376 2958 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388093.1 protein_id gnl|my_center|LOCUS_29670 2955 4568 gene locus_tag LOCUS_29680 2955 4568 CDS product CRISPR-associated protein Cse1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388094.1 protein_id gnl|my_center|LOCUS_29680 4555 5106 gene locus_tag LOCUS_29690 4555 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388096.1 protein_id gnl|my_center|LOCUS_29690 5121 6263 gene locus_tag LOCUS_29700 gene cas7e 5121 6263 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388097.1 protein_id gnl|my_center|LOCUS_29700 6256 6975 gene locus_tag LOCUS_29710 gene cas5e 6256 6975 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388098.1 protein_id gnl|my_center|LOCUS_29710 6972 7709 gene locus_tag LOCUS_29720 6972 7709 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388099.1 protein_id gnl|my_center|LOCUS_29720 7712 8590 gene locus_tag LOCUS_29730 gene cas1e 7712 8590 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388100.1 protein_id gnl|my_center|LOCUS_29730 8590 8907 gene locus_tag LOCUS_29740 gene cas2e 8590 8907 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388101.1 protein_id gnl|my_center|LOCUS_29740 8975 9918 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggttcccccgcctgcgcggggatagaccc 10864 10505 gene locus_tag LOCUS_tm00010 10864 10505 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 11325 10960 gene locus_tag LOCUS_29750 11325 10960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 12149 11328 gene locus_tag LOCUS_29760 gene dapB 12149 11328 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095210.1 protein_id gnl|my_center|LOCUS_29760 13443 12301 gene locus_tag LOCUS_29770 gene dnaJ 13443 12301 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395180.1 protein_id gnl|my_center|LOCUS_29770 15377 13449 gene locus_tag LOCUS_29780 gene dnaK 15377 13449 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502156.1 protein_id gnl|my_center|LOCUS_29780 16194 15529 gene locus_tag LOCUS_29790 gene grpE 16194 15529 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026613481.1 protein_id gnl|my_center|LOCUS_29790 <16845 16191 gene locus_tag LOCUS_29800 <16845 16191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940709.1:heat-inducible transcriptional repressor HrcA >Feature sequence57 356 1018 gene locus_tag LOCUS_29810 356 1018 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_29810 1198 2439 gene locus_tag LOCUS_29820 1198 2439 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_29820 2436 2939 gene locus_tag LOCUS_29830 gene ribE 2436 2939 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_29830 2983 3555 gene locus_tag LOCUS_29840 2983 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 3608 4621 gene locus_tag LOCUS_29850 gene thiL 3608 4621 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389573.1 protein_id gnl|my_center|LOCUS_29850 4826 6472 gene locus_tag LOCUS_29860 gene rfbH 4826 6472 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_29860 7795 6530 gene locus_tag LOCUS_29870 7795 6530 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403427.1 protein_id gnl|my_center|LOCUS_29870 9170 7809 gene locus_tag LOCUS_29880 9170 7809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 10055 9189 gene locus_tag LOCUS_29890 10055 9189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 10533 10195 gene locus_tag LOCUS_29900 10533 10195 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_29900 12236 10551 gene locus_tag LOCUS_29910 gene cimA 12236 10551 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546272.1 protein_id gnl|my_center|LOCUS_29910 13428 12184 gene locus_tag LOCUS_29920 13428 12184 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191166.1 protein_id gnl|my_center|LOCUS_29920 14094 13462 gene locus_tag LOCUS_29930 14094 13462 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389552.1 protein_id gnl|my_center|LOCUS_29930 14904 14203 gene locus_tag LOCUS_29940 14904 14203 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704884.1 protein_id gnl|my_center|LOCUS_29940 15806 14901 gene locus_tag LOCUS_29950 gene amgK 15806 14901 CDS product N-acetylmuramate/N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113208.1 protein_id gnl|my_center|LOCUS_29950 >Feature sequence58 2268 1339 gene locus_tag LOCUS_29960 gene ribF 2268 1339 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102619.1 protein_id gnl|my_center|LOCUS_29960 5219 2376 gene locus_tag LOCUS_29970 5219 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 5642 6583 gene locus_tag LOCUS_29980 5642 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 6846 7739 gene locus_tag LOCUS_29990 6846 7739 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461645.1 protein_id gnl|my_center|LOCUS_29990 7951 8799 gene locus_tag LOCUS_30000 7951 8799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 8805 9893 gene locus_tag LOCUS_30010 gene modC 8805 9893 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098212.1 protein_id gnl|my_center|LOCUS_30010 11172 9940 gene locus_tag LOCUS_30020 11172 9940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 11472 13415 gene locus_tag LOCUS_30030 11472 13415 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098131.1 protein_id gnl|my_center|LOCUS_30030 13421 13735 gene locus_tag LOCUS_30040 13421 13735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 >Feature sequence59 384 1421 gene locus_tag LOCUS_30050 384 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 1551 1928 gene locus_tag LOCUS_30060 1551 1928 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936745.1 protein_id gnl|my_center|LOCUS_30060 3307 1976 gene locus_tag LOCUS_30070 3307 1976 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338519.1 protein_id gnl|my_center|LOCUS_30070 3794 3363 gene locus_tag LOCUS_30080 gene rpiB 3794 3363 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719443.1 protein_id gnl|my_center|LOCUS_30080 5078 3861 gene locus_tag LOCUS_30090 gene lapB 5078 3861 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957639.1 protein_id gnl|my_center|LOCUS_30090 5579 5271 gene locus_tag LOCUS_30100 5579 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 5973 5698 gene locus_tag LOCUS_30110 5973 5698 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943239.1 protein_id gnl|my_center|LOCUS_30110 7709 5994 gene locus_tag LOCUS_30120 gene rpsA 7709 5994 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388046.1 protein_id gnl|my_center|LOCUS_30120 8498 7770 gene locus_tag LOCUS_30130 gene cmk 8498 7770 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420163.1 protein_id gnl|my_center|LOCUS_30130 9893 8574 gene locus_tag LOCUS_30140 gene aroA 9893 8574 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943243.1 protein_id gnl|my_center|LOCUS_30140 10822 9908 gene locus_tag LOCUS_30150 10822 9908 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_30150 11926 10826 gene locus_tag LOCUS_30160 gene pheA 11926 10826 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_30160 12776 12120 gene locus_tag LOCUS_30170 12776 12120 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927164.1 protein_id gnl|my_center|LOCUS_30170 13307 14518 gene locus_tag LOCUS_30180 13307 14518 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_30180 >Feature sequence60 <1 1455 gene locus_tag LOCUS_30190 <1 1455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941190.1:DEAD/DEAH box helicase 1498 1977 gene locus_tag LOCUS_30200 gene secB 1498 1977 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687381.1 protein_id gnl|my_center|LOCUS_30200 2242 2463 gene locus_tag LOCUS_30210 2242 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 3945 2482 gene locus_tag LOCUS_30220 3945 2482 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409438.1 protein_id gnl|my_center|LOCUS_30220 4107 4577 gene locus_tag LOCUS_30230 4107 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 4574 5227 gene locus_tag LOCUS_30240 4574 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 6002 6853 gene locus_tag LOCUS_30250 6002 6853 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987021.1 protein_id gnl|my_center|LOCUS_30250 7411 8229 gene locus_tag LOCUS_30260 7411 8229 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073122.1 protein_id gnl|my_center|LOCUS_30260 8499 11003 gene locus_tag LOCUS_30270 8499 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 12187 11015 gene locus_tag LOCUS_30280 12187 11015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 13938 12319 gene locus_tag LOCUS_30290 gene murJ 13938 12319 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_30290 14041 14319 gene locus_tag LOCUS_30300 gene rpsT 14041 14319 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073368.1 protein_id gnl|my_center|LOCUS_30300 >Feature sequence61 531 118 gene locus_tag LOCUS_30310 531 118 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205242.1 protein_id gnl|my_center|LOCUS_30310 1168 533 gene locus_tag LOCUS_30320 1168 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 1901 1182 gene locus_tag LOCUS_30330 1901 1182 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103230.1 protein_id gnl|my_center|LOCUS_30330 2573 1905 gene locus_tag LOCUS_30340 2573 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 3613 2570 gene locus_tag LOCUS_30350 3613 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 4503 3610 gene locus_tag LOCUS_30360 4503 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 6707 4548 gene locus_tag LOCUS_30370 6707 4548 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 protein_id gnl|my_center|LOCUS_30370 7321 7620 gene locus_tag LOCUS_30380 7321 7620 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388797.1 protein_id gnl|my_center|LOCUS_30380 7632 8591 gene locus_tag LOCUS_30390 7632 8591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 8593 9933 gene locus_tag LOCUS_30400 8593 9933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 9930 11447 gene locus_tag LOCUS_30410 9930 11447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 11763 11521 gene locus_tag LOCUS_30420 11763 11521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 11644 12447 gene locus_tag LOCUS_30430 11644 12447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 12462 13163 gene locus_tag LOCUS_30440 12462 13163 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922437.1 protein_id gnl|my_center|LOCUS_30440 13487 13191 gene locus_tag LOCUS_30450 13487 13191 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942712.1 protein_id gnl|my_center|LOCUS_30450 <14350 13502 gene locus_tag LOCUS_30460 <14350 13502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005762959.1:bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase >Feature sequence62 1882 50 gene locus_tag LOCUS_30470 1882 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 3373 2234 gene locus_tag LOCUS_30480 3373 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 4078 3413 gene locus_tag LOCUS_30490 4078 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 4265 4056 gene locus_tag LOCUS_30500 4265 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 7077 4606 gene locus_tag LOCUS_30510 7077 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 7471 7265 gene locus_tag LOCUS_30520 7471 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 9476 7665 gene locus_tag LOCUS_30530 gene aspS 9476 7665 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_30530 10510 9473 gene locus_tag LOCUS_30540 10510 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 10762 12168 gene locus_tag LOCUS_30550 gene gltX 10762 12168 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_30550 >Feature sequence63 81 884 gene locus_tag LOCUS_30560 81 884 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 protein_id gnl|my_center|LOCUS_30560 989 1972 gene locus_tag LOCUS_30570 989 1972 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390710.1 protein_id gnl|my_center|LOCUS_30570 2457 2059 gene locus_tag LOCUS_30580 2457 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 2996 3319 gene locus_tag LOCUS_30590 2996 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 3498 5372 gene locus_tag LOCUS_30600 3498 5372 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941696.1 protein_id gnl|my_center|LOCUS_30600 5409 6221 gene locus_tag LOCUS_30610 5409 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 6240 6821 gene locus_tag LOCUS_30620 6240 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 7118 7321 gene locus_tag LOCUS_30630 7118 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 8474 7281 gene locus_tag LOCUS_30640 8474 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 8841 10139 gene locus_tag LOCUS_30650 8841 10139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 10270 10497 gene locus_tag LOCUS_30660 10270 10497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 >Feature sequence64 220 1155 gene locus_tag LOCUS_30670 220 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 1182 1592 gene locus_tag LOCUS_30680 1182 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 1633 4905 gene locus_tag LOCUS_30690 1633 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 4902 5273 gene locus_tag LOCUS_30700 4902 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 5273 6250 gene locus_tag LOCUS_30710 5273 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 6801 7832 gene locus_tag LOCUS_30720 6801 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 7832 8752 gene locus_tag LOCUS_30730 7832 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 9094 10581 gene locus_tag LOCUS_30740 9094 10581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 10592 11146 gene locus_tag LOCUS_30750 10592 11146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 11143 11445 gene locus_tag LOCUS_30760 11143 11445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 >Feature sequence65 1907 825 gene locus_tag LOCUS_30770 1907 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 3618 2314 gene locus_tag LOCUS_30780 3618 2314 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038178.1 protein_id gnl|my_center|LOCUS_30780 3683 4216 gene locus_tag LOCUS_30790 gene cobO 3683 4216 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258439.1 protein_id gnl|my_center|LOCUS_30790 4242 5168 gene locus_tag LOCUS_30800 gene cbiB 4242 5168 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268581.1 protein_id gnl|my_center|LOCUS_30800 5161 6192 gene locus_tag LOCUS_30810 gene cobD 5161 6192 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 protein_id gnl|my_center|LOCUS_30810 6179 6388 gene locus_tag LOCUS_30820 6179 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 6390 9140 gene locus_tag LOCUS_30830 6390 9140 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092687825.1 protein_id gnl|my_center|LOCUS_30830 <9698 9137 gene locus_tag LOCUS_30840 <9698 9137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057147.1:precorrin-3B C(17)-methyltransferase >Feature sequence66 5569 2849 gene locus_tag LOCUS_30850 5569 2849 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958090.1 protein_id gnl|my_center|LOCUS_30850 5634 6374 gene locus_tag LOCUS_30860 gene fabG 5634 6374 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_30860 6496 6732 gene locus_tag LOCUS_30870 6496 6732 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388176.1 protein_id gnl|my_center|LOCUS_30870 6776 8017 gene locus_tag LOCUS_30880 gene fabF 6776 8017 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_30880 8014 9198 gene locus_tag LOCUS_30890 8014 9198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 >Feature sequence67 845 69 gene locus_tag LOCUS_30900 845 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 1012 1197 gene locus_tag LOCUS_30910 1012 1197 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103638.1 protein_id gnl|my_center|LOCUS_30910 1194 1613 gene locus_tag LOCUS_30920 1194 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 1810 1737 gene locus_tag LOCUS_t00460 1810 1737 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1871 2479 gene locus_tag LOCUS_30930 1871 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 2992 2486 gene locus_tag LOCUS_30940 2992 2486 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941072.1 protein_id gnl|my_center|LOCUS_30940 5609 3237 gene locus_tag LOCUS_30950 5609 3237 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817980.1 protein_id gnl|my_center|LOCUS_30950 5982 7871 gene locus_tag LOCUS_30960 5982 7871 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880333.1 protein_id gnl|my_center|LOCUS_30960 >Feature sequence68 1742 654 gene locus_tag LOCUS_30970 1742 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 2553 2128 gene locus_tag LOCUS_30980 2553 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 2850 4175 gene locus_tag LOCUS_30990 2850 4175 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943971.1 protein_id gnl|my_center|LOCUS_30990 5365 4187 gene locus_tag LOCUS_31000 gene hemW 5365 4187 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310172.1 protein_id gnl|my_center|LOCUS_31000 5524 5796 gene locus_tag LOCUS_31010 5524 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 5805 6839 gene locus_tag LOCUS_31020 5805 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 >Feature sequence69 5509 4160 gene locus_tag LOCUS_31030 5509 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 7073 5655 gene locus_tag LOCUS_31040 7073 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 >Feature sequence70 297 1853 gene locus_tag LOCUS_31050 297 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 1846 2388 gene locus_tag LOCUS_31060 1846 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 2385 3983 gene locus_tag LOCUS_31070 2385 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 4219 4425 gene locus_tag LOCUS_31080 4219 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 4490 6832 gene locus_tag LOCUS_31090 4490 6832 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975506.1 protein_id gnl|my_center|LOCUS_31090 >Feature sequence71 198 482 gene locus_tag LOCUS_31100 198 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 667 954 gene locus_tag LOCUS_31110 667 954 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_31110 1134 4388 gene locus_tag LOCUS_31120 1134 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 4385 5440 gene locus_tag LOCUS_31130 4385 5440 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_31130 >Feature sequence72 199 495 gene locus_tag LOCUS_31140 199 495 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529099.1 protein_id gnl|my_center|LOCUS_31140 885 661 gene locus_tag LOCUS_31150 885 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 1280 1356 gene locus_tag LOCUS_t00470 1280 1356 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1465 3003 gene locus_tag LOCUS_31160 1465 3003 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942551.1 protein_id gnl|my_center|LOCUS_31160 3223 3684 gene locus_tag LOCUS_31170 3223 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 >Feature sequence73 2986 77 gene locus_tag LOCUS_31180 2986 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 3234 2983 gene locus_tag LOCUS_31190 3234 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 4358 3249 gene locus_tag LOCUS_31200 gene rsmH 4358 3249 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966431.1 protein_id gnl|my_center|LOCUS_31200 <5003 4470 gene locus_tag LOCUS_31210 <5003 4470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943694.1:undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase >Feature sequence74 578 2002 gene locus_tag LOCUS_31220 gene murF 578 2002 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388709.1 protein_id gnl|my_center|LOCUS_31220 1992 3080 gene locus_tag LOCUS_31230 gene mraY 1992 3080 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388708.1 protein_id gnl|my_center|LOCUS_31230 3121 4323 gene locus_tag LOCUS_31240 gene spoVE 3121 4323 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_31240 >Feature sequence75 1023 208 gene locus_tag LOCUS_31250 1023 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 1237 1947 gene locus_tag LOCUS_31260 gene ispD 1237 1947 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_31260 1938 2432 gene locus_tag LOCUS_31270 gene ispF 1938 2432 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488386.1 protein_id gnl|my_center|LOCUS_31270 2989 2429 gene locus_tag LOCUS_31280 2989 2429 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157067.1 protein_id gnl|my_center|LOCUS_31280 3112 3774 gene locus_tag LOCUS_31290 gene plsY 3112 3774 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383394.1 protein_id gnl|my_center|LOCUS_31290 3771 4661 gene locus_tag LOCUS_31300 3771 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 >Feature sequence76 818 435 gene locus_tag LOCUS_31310 818 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 1619 909 gene locus_tag LOCUS_31320 1619 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 2399 1632 gene locus_tag LOCUS_31330 2399 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 2884 2399 gene locus_tag LOCUS_31340 2884 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 3717 3373 gene locus_tag LOCUS_31350 3717 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 3949 3728 gene locus_tag LOCUS_31360 3949 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 >Feature sequence77 2026 1661 gene locus_tag LOCUS_31370 2026 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 2136 2816 gene locus_tag LOCUS_31380 gene pyrE 2136 2816 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703811.1 protein_id gnl|my_center|LOCUS_31380 3331 2852 gene locus_tag LOCUS_31390 3331 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 >Feature sequence78 159 749 gene locus_tag LOCUS_31400 159 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552477.1 protein_id gnl|my_center|LOCUS_31400 749 2095 gene locus_tag LOCUS_31410 gene hpnE 749 2095 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930255.1 protein_id gnl|my_center|LOCUS_31410 2213 3061 gene locus_tag LOCUS_31420 2213 3061 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388696.1 protein_id gnl|my_center|LOCUS_31420 >Feature sequence79 969 595 gene locus_tag LOCUS_31430 969 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 1499 966 gene locus_tag LOCUS_31440 gene lspA 1499 966 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004863699.1 protein_id gnl|my_center|LOCUS_31440 <3090 1509 gene locus_tag LOCUS_31450 <3090 1509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943758.1:isoleucine--tRNA ligase >Feature sequence80 <2697 1431 gene locus_tag LOCUS_31460 <2697 1431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392357.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase