>Feature sequence001 24 99 gene locus_tag LOCUS_t00010 24 99 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 383 198 gene locus_tag LOCUS_00010 383 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 586 933 gene locus_tag LOCUS_00020 586 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1364 2038 gene locus_tag LOCUS_00030 1364 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2460 3236 gene locus_tag LOCUS_00040 2460 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3299 4243 gene locus_tag LOCUS_00050 3299 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4233 4784 gene locus_tag LOCUS_00060 4233 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4774 7542 gene locus_tag LOCUS_00070 4774 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7686 8756 gene locus_tag LOCUS_00080 7686 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9104 9289 gene locus_tag LOCUS_00090 9104 9289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9637 9347 gene locus_tag LOCUS_00100 9637 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10732 9680 gene locus_tag LOCUS_00110 10732 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11645 12007 gene locus_tag LOCUS_00120 11645 12007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14272 12263 gene locus_tag LOCUS_00130 14272 12263 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963667.1 protein_id gnl|my_center|LOCUS_00130 14924 14574 gene locus_tag LOCUS_00140 14924 14574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15151 16437 gene locus_tag LOCUS_00150 15151 16437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16770 17912 gene locus_tag LOCUS_00160 16770 17912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18200 18745 gene locus_tag LOCUS_00170 18200 18745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21516 20536 gene locus_tag LOCUS_00180 21516 20536 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918510.1 protein_id gnl|my_center|LOCUS_00180 21887 21513 gene locus_tag LOCUS_00190 21887 21513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00190 22025 22282 gene locus_tag LOCUS_00200 22025 22282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23869 22304 gene locus_tag LOCUS_00210 23869 22304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23983 24240 gene locus_tag LOCUS_00220 23983 24240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24289 24552 gene locus_tag LOCUS_00230 24289 24552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00230 24698 25447 gene locus_tag LOCUS_00240 24698 25447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00240 27020 25782 gene locus_tag LOCUS_00250 27020 25782 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531687.1 protein_id gnl|my_center|LOCUS_00250 27094 27315 gene locus_tag LOCUS_00260 27094 27315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 27616 27831 gene locus_tag LOCUS_00270 27616 27831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 28414 28262 gene locus_tag LOCUS_00280 28414 28262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28944 30065 gene locus_tag LOCUS_00290 28944 30065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 30122 32227 gene locus_tag LOCUS_00300 30122 32227 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_00300 32234 34537 gene locus_tag LOCUS_00310 32234 34537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34570 35118 gene locus_tag LOCUS_00320 34570 35118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 35496 35846 gene locus_tag LOCUS_00330 35496 35846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 35917 36219 gene locus_tag LOCUS_00340 35917 36219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 36415 36549 gene locus_tag LOCUS_00350 36415 36549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 37360 37100 gene locus_tag LOCUS_00360 37360 37100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 37777 37547 gene locus_tag LOCUS_00370 37777 37547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 38511 38086 gene locus_tag LOCUS_00380 38511 38086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 38984 39427 gene locus_tag LOCUS_00390 38984 39427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 39631 40080 gene locus_tag LOCUS_00400 39631 40080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00400 40046 40324 gene locus_tag LOCUS_00410 40046 40324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00410 40857 40450 gene locus_tag LOCUS_00420 40857 40450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 41047 41235 gene locus_tag LOCUS_00430 41047 41235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 41385 42167 gene locus_tag LOCUS_00440 41385 42167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 42465 42241 gene locus_tag LOCUS_00450 42465 42241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 42352 42657 gene locus_tag LOCUS_00460 42352 42657 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139371060.1 protein_id gnl|my_center|LOCUS_00460 42654 43529 gene locus_tag LOCUS_00470 42654 43529 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089600859.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00470 >Feature sequence002 754 320 gene locus_tag LOCUS_00480 754 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 2289 871 gene locus_tag LOCUS_00490 2289 871 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971286.1 protein_id gnl|my_center|LOCUS_00490 3147 2299 gene locus_tag LOCUS_00500 3147 2299 CDS product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337208.1 protein_id gnl|my_center|LOCUS_00500 4411 3125 gene locus_tag LOCUS_00510 4411 3125 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466243.1 protein_id gnl|my_center|LOCUS_00510 6134 4422 gene locus_tag LOCUS_00520 6134 4422 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337210.1 protein_id gnl|my_center|LOCUS_00520 6438 6136 gene locus_tag LOCUS_00530 6438 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 6914 6663 gene locus_tag LOCUS_00540 6914 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 7609 7139 gene locus_tag LOCUS_00550 7609 7139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 8076 7606 gene locus_tag LOCUS_00560 8076 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 8900 8637 gene locus_tag LOCUS_00570 8900 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 9127 8897 gene locus_tag LOCUS_00580 9127 8897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 9476 10108 gene locus_tag LOCUS_00590 9476 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 10410 10114 gene locus_tag LOCUS_00600 10410 10114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 10847 10413 gene locus_tag LOCUS_00610 10847 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 10985 11179 gene locus_tag LOCUS_00620 10985 11179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 11222 11662 gene locus_tag LOCUS_00630 gene hicB 11222 11662 CDS product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077627724.1 protein_id gnl|my_center|LOCUS_00630 13047 11671 gene locus_tag LOCUS_00640 13047 11671 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268012.1 protein_id gnl|my_center|LOCUS_00640 13634 13047 gene locus_tag LOCUS_00650 13634 13047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 14011 13631 gene locus_tag LOCUS_00660 14011 13631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 14279 14001 gene locus_tag LOCUS_00670 14279 14001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 14878 14279 gene locus_tag LOCUS_00680 14878 14279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 15303 14875 gene locus_tag LOCUS_00690 15303 14875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 15572 15384 gene locus_tag LOCUS_00700 15572 15384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 15823 15569 gene locus_tag LOCUS_00710 15823 15569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 15903 16565 gene locus_tag LOCUS_00720 15903 16565 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975816.1 protein_id gnl|my_center|LOCUS_00720 16907 16569 gene locus_tag LOCUS_00730 16907 16569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 17185 16904 gene locus_tag LOCUS_00740 17185 16904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 17555 17806 gene locus_tag LOCUS_00750 17555 17806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 17819 18010 gene locus_tag LOCUS_00760 17819 18010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072625.1 protein_id gnl|my_center|LOCUS_00760 18025 18393 gene locus_tag LOCUS_00770 18025 18393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 18422 19405 gene locus_tag LOCUS_00780 18422 19405 CDS product DUF2303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339628.1 protein_id gnl|my_center|LOCUS_00780 19410 19985 gene locus_tag LOCUS_00790 19410 19985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 19982 20611 gene locus_tag LOCUS_00800 19982 20611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 20620 20805 gene locus_tag LOCUS_00810 20620 20805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 20802 21011 gene locus_tag LOCUS_00820 20802 21011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 21008 21682 gene locus_tag LOCUS_00830 21008 21682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 21679 21873 gene locus_tag LOCUS_00840 21679 21873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 23206 21842 gene locus_tag LOCUS_00850 23206 21842 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339202.1 protein_id gnl|my_center|LOCUS_00850 23760 23476 gene locus_tag LOCUS_00860 23760 23476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 23993 23757 gene locus_tag LOCUS_00870 23993 23757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 24291 23959 gene locus_tag LOCUS_00880 24291 23959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 25316 24288 gene locus_tag LOCUS_00890 25316 24288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 28456 25394 gene locus_tag LOCUS_00900 28456 25394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 29407 28520 gene locus_tag LOCUS_00910 29407 28520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 29928 29461 gene locus_tag LOCUS_00920 29928 29461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 32623 29921 gene locus_tag LOCUS_00930 32623 29921 CDS product DUF1983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103840.1 protein_id gnl|my_center|LOCUS_00930 33031 32627 gene locus_tag LOCUS_00940 33031 32627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384760.1 protein_id gnl|my_center|LOCUS_00940 33291 33031 gene locus_tag LOCUS_00950 33291 33031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 33860 33291 gene locus_tag LOCUS_00960 33860 33291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 34527 33865 gene locus_tag LOCUS_00970 34527 33865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 36275 34527 gene locus_tag LOCUS_00980 36275 34527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 36432 36265 gene locus_tag LOCUS_00990 36432 36265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 36785 36459 gene locus_tag LOCUS_01000 36785 36459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 37017 36775 gene locus_tag LOCUS_01010 37017 36775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 37433 37020 gene locus_tag LOCUS_01020 37433 37020 CDS product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719628.1 protein_id gnl|my_center|LOCUS_01020 37880 37488 gene locus_tag LOCUS_01030 37880 37488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 38245 37877 gene locus_tag LOCUS_01040 38245 37877 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975486.1 protein_id gnl|my_center|LOCUS_01040 38595 38260 gene locus_tag LOCUS_01050 38595 38260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 39176 38595 gene locus_tag LOCUS_01060 39176 38595 CDS product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975492.1 protein_id gnl|my_center|LOCUS_01060 >Feature sequence003 385 723 gene locus_tag LOCUS_01070 385 723 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709636.1 protein_id gnl|my_center|LOCUS_01070 798 2177 gene locus_tag LOCUS_01080 gene amt 798 2177 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383316.1 protein_id gnl|my_center|LOCUS_01080 2498 3721 gene locus_tag LOCUS_01090 2498 3721 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_01090 3962 5143 gene locus_tag LOCUS_01100 3962 5143 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336784.1 protein_id gnl|my_center|LOCUS_01100 5147 7759 gene locus_tag LOCUS_01110 5147 7759 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528892.1 protein_id gnl|my_center|LOCUS_01110 7799 9370 gene locus_tag LOCUS_01120 gene murJ 7799 9370 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528061.1 protein_id gnl|my_center|LOCUS_01120 9431 10465 gene locus_tag LOCUS_01130 gene trpS 9431 10465 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083624.1 protein_id gnl|my_center|LOCUS_01130 10600 11148 gene locus_tag LOCUS_01140 10600 11148 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_01140 11151 11867 gene locus_tag LOCUS_01150 gene tsaB 11151 11867 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083621.1 protein_id gnl|my_center|LOCUS_01150 11860 12366 gene locus_tag LOCUS_01160 gene rimI 11860 12366 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083620.1 protein_id gnl|my_center|LOCUS_01160 12431 12853 gene locus_tag LOCUS_01170 12431 12853 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917946.1 protein_id gnl|my_center|LOCUS_01170 12906 13715 gene locus_tag LOCUS_01180 12906 13715 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391516.1 protein_id gnl|my_center|LOCUS_01180 13789 15174 gene locus_tag LOCUS_01190 gene miaB 13789 15174 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974255.1 protein_id gnl|my_center|LOCUS_01190 15158 16120 gene locus_tag LOCUS_01200 15158 16120 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974256.1 protein_id gnl|my_center|LOCUS_01200 16117 16608 gene locus_tag LOCUS_01210 gene ybeY 16117 16608 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327074.1 protein_id gnl|my_center|LOCUS_01210 16601 17587 gene locus_tag LOCUS_01220 16601 17587 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527674.1 protein_id gnl|my_center|LOCUS_01220 17580 19181 gene locus_tag LOCUS_01230 gene lnt 17580 19181 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083613.1 protein_id gnl|my_center|LOCUS_01230 19333 19773 gene locus_tag LOCUS_01240 19333 19773 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527901.1 protein_id gnl|my_center|LOCUS_01240 19931 21100 gene locus_tag LOCUS_01250 gene metK 19931 21100 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391523.1 protein_id gnl|my_center|LOCUS_01250 21109 21840 gene locus_tag LOCUS_01260 21109 21840 CDS product tRNA (guanosine(46)-N(7))-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399664.1 protein_id gnl|my_center|LOCUS_01260 22583 21783 gene locus_tag LOCUS_01270 22583 21783 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237711.1 protein_id gnl|my_center|LOCUS_01270 24049 22583 gene locus_tag LOCUS_01280 24049 22583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 25939 24164 gene locus_tag LOCUS_01290 25939 24164 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_01290 26153 26806 gene locus_tag LOCUS_01300 26153 26806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 26851 28488 gene locus_tag LOCUS_01310 gene nusA 26851 28488 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968444.1 protein_id gnl|my_center|LOCUS_01310 28500 29135 gene locus_tag LOCUS_01320 28500 29135 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527895.1 protein_id gnl|my_center|LOCUS_01320 29138 31669 gene locus_tag LOCUS_01330 gene infB 29138 31669 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968445.1 protein_id gnl|my_center|LOCUS_01330 31756 32148 gene locus_tag LOCUS_01340 gene rbfA 31756 32148 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385562.1 protein_id gnl|my_center|LOCUS_01340 32150 33076 gene locus_tag LOCUS_01350 gene truB 32150 33076 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172518.1 protein_id gnl|my_center|LOCUS_01350 33115 33384 gene locus_tag LOCUS_01360 gene rpsO 33115 33384 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391531.1 protein_id gnl|my_center|LOCUS_01360 33530 35665 gene locus_tag LOCUS_01370 gene pnp 33530 35665 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527890.1 protein_id gnl|my_center|LOCUS_01370 36669 35743 gene locus_tag LOCUS_01380 36669 35743 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241556.1 protein_id gnl|my_center|LOCUS_01380 >Feature sequence004 310 1485 gene locus_tag LOCUS_01390 310 1485 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243520.1 protein_id gnl|my_center|LOCUS_01390 2366 1566 gene locus_tag LOCUS_01400 2366 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 2546 2860 gene locus_tag LOCUS_01410 2546 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 2898 3425 gene locus_tag LOCUS_01420 2898 3425 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975835.1 protein_id gnl|my_center|LOCUS_01420 3558 3791 gene locus_tag LOCUS_01430 3558 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 3835 4371 gene locus_tag LOCUS_01440 3835 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 4368 5180 gene locus_tag LOCUS_01450 gene tatC 4368 5180 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534569.1 protein_id gnl|my_center|LOCUS_01450 5717 5208 gene locus_tag LOCUS_01460 5717 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 5952 6028 gene locus_tag LOCUS_t00020 5952 6028 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6156 6425 gene locus_tag LOCUS_01470 6156 6425 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919265.1 protein_id gnl|my_center|LOCUS_01470 7045 6422 gene locus_tag LOCUS_01480 7045 6422 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010430079.1 protein_id gnl|my_center|LOCUS_01480 7304 7116 gene locus_tag LOCUS_01490 7304 7116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 8375 7332 gene locus_tag LOCUS_01500 gene hemB 8375 7332 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966342.1 protein_id gnl|my_center|LOCUS_01500 8568 11828 gene locus_tag LOCUS_01510 8568 11828 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_01510 12055 12561 gene locus_tag LOCUS_01520 12055 12561 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312831.1 protein_id gnl|my_center|LOCUS_01520 13135 14670 gene locus_tag LOCUS_01530 13135 14670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 14699 15403 gene locus_tag LOCUS_01540 14699 15403 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119447.1 protein_id gnl|my_center|LOCUS_01540 16006 15419 gene locus_tag LOCUS_01550 gene rsxA 16006 15419 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141550.1 protein_id gnl|my_center|LOCUS_01550 16646 15996 gene locus_tag LOCUS_01560 16646 15996 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 protein_id gnl|my_center|LOCUS_01560 17344 16643 gene locus_tag LOCUS_01570 17344 16643 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940060.1 protein_id gnl|my_center|LOCUS_01570 18402 17341 gene locus_tag LOCUS_01580 18402 17341 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082949.1 protein_id gnl|my_center|LOCUS_01580 19751 18402 gene locus_tag LOCUS_01590 gene rsxC 19751 18402 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_01590 24735 19780 gene locus_tag LOCUS_01600 24735 19780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 25647 24766 gene locus_tag LOCUS_01610 25647 24766 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_01610 26587 25841 gene locus_tag LOCUS_01620 26587 25841 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087891.1 protein_id gnl|my_center|LOCUS_01620 27109 26642 gene locus_tag LOCUS_01630 27109 26642 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975293.1 protein_id gnl|my_center|LOCUS_01630 27843 27208 gene locus_tag LOCUS_01640 27843 27208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 28985 27864 gene locus_tag LOCUS_01650 28985 27864 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528006.1 protein_id gnl|my_center|LOCUS_01650 29868 29107 gene locus_tag LOCUS_01660 29868 29107 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 protein_id gnl|my_center|LOCUS_01660 31122 29881 gene locus_tag LOCUS_01670 31122 29881 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087499.1 protein_id gnl|my_center|LOCUS_01670 32675 31524 gene locus_tag LOCUS_01680 32675 31524 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530610.1 protein_id gnl|my_center|LOCUS_01680 >Feature sequence005 1260 826 gene locus_tag LOCUS_01690 gene trxC 1260 826 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088519.1 protein_id gnl|my_center|LOCUS_01690 1370 2773 gene locus_tag LOCUS_01700 1370 2773 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815311.1 protein_id gnl|my_center|LOCUS_01700 5359 2807 gene locus_tag LOCUS_01710 5359 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 5742 5503 gene locus_tag LOCUS_01720 5742 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 7520 5853 gene locus_tag LOCUS_01730 7520 5853 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389067.1 protein_id gnl|my_center|LOCUS_01730 8531 7686 gene locus_tag LOCUS_01740 8531 7686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 9023 8754 gene locus_tag LOCUS_01750 9023 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 10249 9164 gene locus_tag LOCUS_01760 10249 9164 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336844.1 protein_id gnl|my_center|LOCUS_01760 10724 10257 gene locus_tag LOCUS_01770 gene purE 10724 10257 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077767952.1 protein_id gnl|my_center|LOCUS_01770 11080 10874 gene locus_tag LOCUS_01780 11080 10874 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089847.1 protein_id gnl|my_center|LOCUS_01780 11978 11346 gene locus_tag LOCUS_01790 gene metW 11978 11346 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_01790 13123 11975 gene locus_tag LOCUS_01800 13123 11975 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529386.1 protein_id gnl|my_center|LOCUS_01800 13403 14284 gene locus_tag LOCUS_01810 13403 14284 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084215.1 protein_id gnl|my_center|LOCUS_01810 14289 15398 gene locus_tag LOCUS_01820 gene hisC 14289 15398 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253968.1 protein_id gnl|my_center|LOCUS_01820 15395 16324 gene locus_tag LOCUS_01830 15395 16324 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162911.1 protein_id gnl|my_center|LOCUS_01830 17497 16334 gene locus_tag LOCUS_01840 17497 16334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 17732 18859 gene locus_tag LOCUS_01850 17732 18859 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529351.1 protein_id gnl|my_center|LOCUS_01850 19437 18874 gene locus_tag LOCUS_01860 19437 18874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 19584 20015 gene locus_tag LOCUS_01870 19584 20015 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173696.1 protein_id gnl|my_center|LOCUS_01870 20454 20074 gene locus_tag LOCUS_01880 20454 20074 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930603.1 protein_id gnl|my_center|LOCUS_01880 20922 22673 gene locus_tag LOCUS_01890 20922 22673 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965110.1 protein_id gnl|my_center|LOCUS_01890 22716 23642 gene locus_tag LOCUS_01900 22716 23642 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973309.1 protein_id gnl|my_center|LOCUS_01900 23675 24127 gene locus_tag LOCUS_01910 23675 24127 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066921.1 protein_id gnl|my_center|LOCUS_01910 25238 24174 gene locus_tag LOCUS_01920 25238 24174 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975052.1 protein_id gnl|my_center|LOCUS_01920 25901 25296 gene locus_tag LOCUS_01930 gene mobA 25901 25296 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921607.1 protein_id gnl|my_center|LOCUS_01930 26204 26031 gene locus_tag LOCUS_01940 26204 26031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 26142 26861 gene locus_tag LOCUS_01950 26142 26861 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 protein_id gnl|my_center|LOCUS_01950 27789 26875 gene locus_tag LOCUS_01960 gene folD 27789 26875 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338398.1 protein_id gnl|my_center|LOCUS_01960 28119 27808 gene locus_tag LOCUS_01970 28119 27808 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242528.1 protein_id gnl|my_center|LOCUS_01970 28399 28121 gene locus_tag LOCUS_01980 28399 28121 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391274.1 protein_id gnl|my_center|LOCUS_01980 28587 28662 gene locus_tag LOCUS_t00030 28587 28662 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 28749 28934 gene locus_tag LOCUS_01990 gene rpmF 28749 28934 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507205.1 protein_id gnl|my_center|LOCUS_01990 29035 29433 gene locus_tag LOCUS_02000 29035 29433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529226.1 protein_id gnl|my_center|LOCUS_02000 29442 30092 gene locus_tag LOCUS_02010 29442 30092 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337827.1 protein_id gnl|my_center|LOCUS_02010 30352 30176 gene locus_tag LOCUS_02020 30352 30176 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314700.1 protein_id gnl|my_center|LOCUS_02020 31309 30557 gene locus_tag LOCUS_02030 31309 30557 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083053.1 protein_id gnl|my_center|LOCUS_02030 31466 31780 gene locus_tag LOCUS_02040 31466 31780 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070442.1 protein_id gnl|my_center|LOCUS_02040 >Feature sequence006 240 1550 gene locus_tag LOCUS_02050 240 1550 CDS product DUF2779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846383.1 protein_id gnl|my_center|LOCUS_02050 3133 2393 gene locus_tag LOCUS_02060 3133 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 5248 4172 gene locus_tag LOCUS_02070 5248 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 6377 5241 gene locus_tag LOCUS_02080 6377 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 6827 7156 gene locus_tag LOCUS_02090 6827 7156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 7204 8067 gene locus_tag LOCUS_02100 7204 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 9153 8770 gene locus_tag LOCUS_02110 9153 8770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 9993 9277 gene locus_tag LOCUS_02120 9993 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 10889 10134 gene locus_tag LOCUS_02130 10889 10134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 13206 12355 gene locus_tag LOCUS_02140 13206 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 14037 13303 gene locus_tag LOCUS_02150 14037 13303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 15542 14052 gene locus_tag LOCUS_02160 15542 14052 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931403.1 protein_id gnl|my_center|LOCUS_02160 18423 17008 gene locus_tag LOCUS_02170 18423 17008 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234939668.1 protein_id gnl|my_center|LOCUS_02170 18927 18424 gene locus_tag LOCUS_02180 18927 18424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 19323 18931 gene locus_tag LOCUS_02190 gene cueR 19323 18931 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 protein_id gnl|my_center|LOCUS_02190 19620 19345 gene locus_tag LOCUS_02200 19620 19345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 22053 19624 gene locus_tag LOCUS_02210 22053 19624 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_02210 22679 22290 gene locus_tag LOCUS_02220 22679 22290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 23148 23753 gene locus_tag LOCUS_02230 23148 23753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 23755 24651 gene locus_tag LOCUS_02240 23755 24651 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088649.1 protein_id gnl|my_center|LOCUS_02240 24789 24995 gene locus_tag LOCUS_02250 24789 24995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 25054 26571 gene locus_tag LOCUS_02260 25054 26571 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013995.1 protein_id gnl|my_center|LOCUS_02260 26589 27191 gene locus_tag LOCUS_02270 26589 27191 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083302.1 protein_id gnl|my_center|LOCUS_02270 27694 27446 gene locus_tag LOCUS_02280 27694 27446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 27871 28599 gene locus_tag LOCUS_02290 27871 28599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 28608 28961 gene locus_tag LOCUS_02300 28608 28961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 >Feature sequence007 <1 853 gene locus_tag LOCUS_02310 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003527565.1:RluA family pseudouridine synthase 969 1844 gene locus_tag LOCUS_02320 gene rpoH 969 1844 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314928.1 protein_id gnl|my_center|LOCUS_02320 2953 1877 gene locus_tag LOCUS_02330 2953 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 3195 3878 gene locus_tag LOCUS_02340 3195 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 5267 3975 gene locus_tag LOCUS_02350 5267 3975 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972329.1 protein_id gnl|my_center|LOCUS_02350 5519 6475 gene locus_tag LOCUS_02360 5519 6475 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529687.1 protein_id gnl|my_center|LOCUS_02360 6516 7418 gene locus_tag LOCUS_02370 6516 7418 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389858.1 protein_id gnl|my_center|LOCUS_02370 7415 8206 gene locus_tag LOCUS_02380 7415 8206 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092883.1 protein_id gnl|my_center|LOCUS_02380 8211 9122 gene locus_tag LOCUS_02390 8211 9122 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970157.1 protein_id gnl|my_center|LOCUS_02390 10776 9196 gene locus_tag LOCUS_02400 gene serA 10776 9196 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529159.1 protein_id gnl|my_center|LOCUS_02400 12010 10844 gene locus_tag LOCUS_02410 12010 10844 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529158.1 protein_id gnl|my_center|LOCUS_02410 12769 12215 gene locus_tag LOCUS_02420 12769 12215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 12979 14133 gene locus_tag LOCUS_02430 12979 14133 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_02430 14130 15035 gene locus_tag LOCUS_02440 14130 15035 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310430.1 protein_id gnl|my_center|LOCUS_02440 16425 15088 gene locus_tag LOCUS_02450 gene glmM 16425 15088 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529155.1 protein_id gnl|my_center|LOCUS_02450 17877 16519 gene locus_tag LOCUS_02460 17877 16519 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339373.1 protein_id gnl|my_center|LOCUS_02460 18551 17874 gene locus_tag LOCUS_02470 18551 17874 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313598.1 protein_id gnl|my_center|LOCUS_02470 18862 18551 gene locus_tag LOCUS_02480 18862 18551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 19021 19314 gene locus_tag LOCUS_02490 19021 19314 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970805.1 protein_id gnl|my_center|LOCUS_02490 19317 19913 gene locus_tag LOCUS_02500 19317 19913 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970806.1 protein_id gnl|my_center|LOCUS_02500 21070 20006 gene locus_tag LOCUS_02510 gene folP 21070 20006 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337038.1 protein_id gnl|my_center|LOCUS_02510 23061 21085 gene locus_tag LOCUS_02520 gene ftsH 23061 21085 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089881.1 protein_id gnl|my_center|LOCUS_02520 24258 23119 gene locus_tag LOCUS_02530 gene tilS 24258 23119 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388852.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02530 24298 24426 gene locus_tag LOCUS_02540 24298 24426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 25388 24441 gene locus_tag LOCUS_02550 gene ybgF 25388 24441 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529150.1 protein_id gnl|my_center|LOCUS_02550 25888 25397 gene locus_tag LOCUS_02560 gene pal 25888 25397 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529149.1 protein_id gnl|my_center|LOCUS_02560 27386 26061 gene locus_tag LOCUS_02570 gene tolB 27386 26061 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970163.1 protein_id gnl|my_center|LOCUS_02570 28382 27471 gene locus_tag LOCUS_02580 28382 27471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 28840 28382 gene locus_tag LOCUS_02590 gene tolR 28840 28382 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709285.1 protein_id gnl|my_center|LOCUS_02590 29554 28844 gene locus_tag LOCUS_02600 gene tolQ 29554 28844 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089890.1 protein_id gnl|my_center|LOCUS_02600 >Feature sequence008 1 255 gene locus_tag LOCUS_02610 1 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 679 260 gene locus_tag LOCUS_02620 679 260 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088599.1 protein_id gnl|my_center|LOCUS_02620 784 1671 gene locus_tag LOCUS_02630 784 1671 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529747.1 protein_id gnl|my_center|LOCUS_02630 2295 1726 gene locus_tag LOCUS_02640 2295 1726 CDS product GDYXXLXY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531317.1 protein_id gnl|my_center|LOCUS_02640 3584 2292 gene locus_tag LOCUS_02650 3584 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 3739 4296 gene locus_tag LOCUS_02660 3739 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 4502 5407 gene locus_tag LOCUS_02670 4502 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 5911 5417 gene locus_tag LOCUS_02680 5911 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 6105 6533 gene locus_tag LOCUS_02690 gene arfB 6105 6533 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090218.1 protein_id gnl|my_center|LOCUS_02690 8133 6601 gene locus_tag LOCUS_02700 8133 6601 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531455.1 protein_id gnl|my_center|LOCUS_02700 8949 8197 gene locus_tag LOCUS_02710 8949 8197 CDS product ATP12 family chaperone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975194.1 protein_id gnl|my_center|LOCUS_02710 9626 8949 gene locus_tag LOCUS_02720 9626 8949 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_02720 10601 9630 gene locus_tag LOCUS_02730 10601 9630 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390409.1 protein_id gnl|my_center|LOCUS_02730 10984 10598 gene locus_tag LOCUS_02740 gene crcB 10984 10598 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975197.1 protein_id gnl|my_center|LOCUS_02740 11205 10981 gene locus_tag LOCUS_02750 11205 10981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 12567 11215 gene locus_tag LOCUS_02760 12567 11215 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088123.1 protein_id gnl|my_center|LOCUS_02760 14003 12567 gene locus_tag LOCUS_02770 14003 12567 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967063.1 protein_id gnl|my_center|LOCUS_02770 14547 14122 gene locus_tag LOCUS_02780 gene rplQ 14547 14122 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088131.1 protein_id gnl|my_center|LOCUS_02780 15620 14604 gene locus_tag LOCUS_02790 15620 14604 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088132.1 protein_id gnl|my_center|LOCUS_02790 16093 15704 gene locus_tag LOCUS_02800 gene rpsK 16093 15704 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919150.1 protein_id gnl|my_center|LOCUS_02800 16517 16149 gene locus_tag LOCUS_02810 gene rpsM 16517 16149 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313984.1 protein_id gnl|my_center|LOCUS_02810 17394 16744 gene locus_tag LOCUS_02820 17394 16744 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561944.1 protein_id gnl|my_center|LOCUS_02820 18722 17391 gene locus_tag LOCUS_02830 gene secY 18722 17391 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088135.1 protein_id gnl|my_center|LOCUS_02830 19240 18761 gene locus_tag LOCUS_02840 gene rplO 19240 18761 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328073.1 protein_id gnl|my_center|LOCUS_02840 19479 19285 gene locus_tag LOCUS_02850 gene rpmD 19479 19285 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205449.1 protein_id gnl|my_center|LOCUS_02850 20088 19516 gene locus_tag LOCUS_02860 gene rpsE 20088 19516 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136332.1 protein_id gnl|my_center|LOCUS_02860 20465 20103 gene locus_tag LOCUS_02870 gene rplR 20465 20103 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313980.1 protein_id gnl|my_center|LOCUS_02870 21009 20476 gene locus_tag LOCUS_02880 gene rplF 21009 20476 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313979.1 protein_id gnl|my_center|LOCUS_02880 21419 21024 gene locus_tag LOCUS_02890 gene rpsH 21419 21024 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390424.1 protein_id gnl|my_center|LOCUS_02890 21735 21430 gene locus_tag LOCUS_02900 gene rpsN 21735 21430 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975180.1 protein_id gnl|my_center|LOCUS_02900 22329 21772 gene locus_tag LOCUS_02910 gene rplE 22329 21772 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018239492.1 protein_id gnl|my_center|LOCUS_02910 22645 22322 gene locus_tag LOCUS_02920 gene rplX 22645 22322 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536524.1 protein_id gnl|my_center|LOCUS_02920 23016 22648 gene locus_tag LOCUS_02930 gene rplN 23016 22648 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536525.1 protein_id gnl|my_center|LOCUS_02930 23316 23080 gene locus_tag LOCUS_02940 gene rpsQ 23316 23080 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313974.1 protein_id gnl|my_center|LOCUS_02940 23532 23341 gene locus_tag LOCUS_02950 gene rpmC 23532 23341 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495193.1 protein_id gnl|my_center|LOCUS_02950 23963 23550 gene locus_tag LOCUS_02960 gene rplP 23963 23550 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390431.1 protein_id gnl|my_center|LOCUS_02960 24697 23996 gene locus_tag LOCUS_02970 gene rpsC 24697 23996 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531426.1 protein_id gnl|my_center|LOCUS_02970 25077 24697 gene locus_tag LOCUS_02980 gene rplV 25077 24697 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536535.1 protein_id gnl|my_center|LOCUS_02980 25358 25080 gene locus_tag LOCUS_02990 gene rpsS 25358 25080 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507772.1 protein_id gnl|my_center|LOCUS_02990 26212 25370 gene locus_tag LOCUS_03000 gene rplB 26212 25370 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507771.1 protein_id gnl|my_center|LOCUS_03000 26540 26247 gene locus_tag LOCUS_03010 26540 26247 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531424.1 protein_id gnl|my_center|LOCUS_03010 27157 26537 gene locus_tag LOCUS_03020 gene rplD 27157 26537 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088150.1 protein_id gnl|my_center|LOCUS_03020 27903 27154 gene locus_tag LOCUS_03030 gene rplC 27903 27154 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969195.1 protein_id gnl|my_center|LOCUS_03030 28223 27915 gene locus_tag LOCUS_03040 gene rpsJ 28223 27915 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002712302.1 protein_id gnl|my_center|LOCUS_03040 >Feature sequence009 1572 514 gene locus_tag LOCUS_03050 1572 514 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088337.1 protein_id gnl|my_center|LOCUS_03050 1465 1680 gene locus_tag LOCUS_03060 1465 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 1974 1726 gene locus_tag LOCUS_03070 1974 1726 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007602543.1 protein_id gnl|my_center|LOCUS_03070 1916 2101 gene locus_tag LOCUS_03080 1916 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 2138 2908 gene locus_tag LOCUS_03090 gene tpiA 2138 2908 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087575.1 protein_id gnl|my_center|LOCUS_03090 3021 3329 gene locus_tag LOCUS_03100 3021 3329 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599465.1 protein_id gnl|my_center|LOCUS_03100 3681 4661 gene locus_tag LOCUS_03110 gene pdhA 3681 4661 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975252.1 protein_id gnl|my_center|LOCUS_03110 4651 6057 gene locus_tag LOCUS_03120 4651 6057 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087550.1 protein_id gnl|my_center|LOCUS_03120 6067 7392 gene locus_tag LOCUS_03130 6067 7392 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537612.1 protein_id gnl|my_center|LOCUS_03130 7465 8865 gene locus_tag LOCUS_03140 gene lpdA 7465 8865 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383235.1 protein_id gnl|my_center|LOCUS_03140 8927 9199 gene locus_tag LOCUS_03150 8927 9199 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257144.1 protein_id gnl|my_center|LOCUS_03150 9214 9729 gene locus_tag LOCUS_03160 9214 9729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 9741 10691 gene locus_tag LOCUS_03170 gene lipA 9741 10691 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971620.1 protein_id gnl|my_center|LOCUS_03170 10693 11145 gene locus_tag LOCUS_03180 10693 11145 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531488.1 protein_id gnl|my_center|LOCUS_03180 13341 11251 gene locus_tag LOCUS_03190 13341 11251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 14018 13527 gene locus_tag LOCUS_03200 14018 13527 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975261.1 protein_id gnl|my_center|LOCUS_03200 15236 14046 gene locus_tag LOCUS_03210 15236 14046 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087257.1 protein_id gnl|my_center|LOCUS_03210 15323 16192 gene locus_tag LOCUS_03220 gene dapA 15323 16192 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171604.1 protein_id gnl|my_center|LOCUS_03220 16236 16721 gene locus_tag LOCUS_03230 gene smpB 16236 16721 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087830.1 protein_id gnl|my_center|LOCUS_03230 17209 16808 gene locus_tag LOCUS_03240 17209 16808 CDS product DUF3775 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530064.1 protein_id gnl|my_center|LOCUS_03240 17957 17289 gene locus_tag LOCUS_03250 17957 17289 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_03250 18534 17929 gene locus_tag LOCUS_03260 18534 17929 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 protein_id gnl|my_center|LOCUS_03260 18664 19215 gene locus_tag LOCUS_03270 gene folK 18664 19215 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389611.1 protein_id gnl|my_center|LOCUS_03270 19322 19711 gene locus_tag LOCUS_03280 gene rpoZ 19322 19711 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008133017.1 protein_id gnl|my_center|LOCUS_03280 19785 22043 gene locus_tag LOCUS_03290 19785 22043 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087826.1 protein_id gnl|my_center|LOCUS_03290 22261 22806 gene locus_tag LOCUS_03300 22261 22806 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532587.1 protein_id gnl|my_center|LOCUS_03300 22854 23639 gene locus_tag LOCUS_03310 22854 23639 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389607.1 protein_id gnl|my_center|LOCUS_03310 23636 24043 gene locus_tag LOCUS_03320 gene acpS 23636 24043 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532586.1 protein_id gnl|my_center|LOCUS_03320 24132 24887 gene locus_tag LOCUS_03330 gene lepB 24132 24887 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087823.1 protein_id gnl|my_center|LOCUS_03330 24907 25626 gene locus_tag LOCUS_03340 gene rnc 24907 25626 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722419.1 protein_id gnl|my_center|LOCUS_03340 25623 26534 gene locus_tag LOCUS_03350 gene era 25623 26534 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844236.1 protein_id gnl|my_center|LOCUS_03350 26574 27299 gene locus_tag LOCUS_03360 gene recO 26574 27299 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014529139.1 protein_id gnl|my_center|LOCUS_03360 >Feature sequence010 1730 84 gene locus_tag LOCUS_03370 1730 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 3614 1833 gene locus_tag LOCUS_03380 gene aspS 3614 1833 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086916.1 protein_id gnl|my_center|LOCUS_03380 3748 4944 gene locus_tag LOCUS_03390 gene rnd 3748 4944 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_03390 4985 5569 gene locus_tag LOCUS_03400 4985 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 7145 5616 gene locus_tag LOCUS_03410 gene ppx 7145 5616 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532415.1 protein_id gnl|my_center|LOCUS_03410 9390 7171 gene locus_tag LOCUS_03420 9390 7171 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171108.1 protein_id gnl|my_center|LOCUS_03420 9596 10024 gene locus_tag LOCUS_03430 9596 10024 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243288.1 protein_id gnl|my_center|LOCUS_03430 13995 10303 gene locus_tag LOCUS_03440 13995 10303 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087047.1 protein_id gnl|my_center|LOCUS_03440 14561 15142 gene locus_tag LOCUS_03450 14561 15142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 15228 15620 gene locus_tag LOCUS_03460 15228 15620 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975139.1 protein_id gnl|my_center|LOCUS_03460 15647 16096 gene locus_tag LOCUS_03470 gene mlaD 15647 16096 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597050.1 protein_id gnl|my_center|LOCUS_03470 16105 16860 gene locus_tag LOCUS_03480 16105 16860 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479544.1 protein_id gnl|my_center|LOCUS_03480 17013 17429 gene locus_tag LOCUS_03490 17013 17429 CDS product DUF2155 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401518.1 protein_id gnl|my_center|LOCUS_03490 18025 17351 gene locus_tag LOCUS_03500 gene aat 18025 17351 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087059.1 protein_id gnl|my_center|LOCUS_03500 19383 18040 gene locus_tag LOCUS_03510 gene accC 19383 18040 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531357.1 protein_id gnl|my_center|LOCUS_03510 19874 19389 gene locus_tag LOCUS_03520 gene accB 19874 19389 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971548.1 protein_id gnl|my_center|LOCUS_03520 20332 19892 gene locus_tag LOCUS_03530 gene aroQ 20332 19892 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390186.1 protein_id gnl|my_center|LOCUS_03530 21116 20337 gene locus_tag LOCUS_03540 21116 20337 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087067.1 protein_id gnl|my_center|LOCUS_03540 22537 21146 gene locus_tag LOCUS_03550 22537 21146 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087068.1 protein_id gnl|my_center|LOCUS_03550 22652 23821 gene locus_tag LOCUS_03560 22652 23821 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087069.1 protein_id gnl|my_center|LOCUS_03560 26548 23951 gene locus_tag LOCUS_03570 26548 23951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 >Feature sequence011 186 776 gene locus_tag LOCUS_03580 186 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 1472 1930 gene locus_tag LOCUS_03590 1472 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 2169 2044 gene locus_tag LOCUS_03600 2169 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 2233 2784 gene locus_tag LOCUS_03610 2233 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 2788 4257 gene locus_tag LOCUS_03620 2788 4257 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839831.1 protein_id gnl|my_center|LOCUS_03620 4407 5630 gene locus_tag LOCUS_03630 gene msrB 4407 5630 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479994.1 protein_id gnl|my_center|LOCUS_03630 6343 5750 gene locus_tag LOCUS_03640 6343 5750 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 protein_id gnl|my_center|LOCUS_03640 6597 6869 gene locus_tag LOCUS_03650 6597 6869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 7051 7962 gene locus_tag LOCUS_03660 7051 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 7964 8377 gene locus_tag LOCUS_03670 7964 8377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 8380 10428 gene locus_tag LOCUS_03680 8380 10428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 11335 10430 gene locus_tag LOCUS_03690 11335 10430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 11927 13186 gene locus_tag LOCUS_03700 11927 13186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 13684 13457 gene locus_tag LOCUS_03710 13684 13457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 13804 14814 gene locus_tag LOCUS_03720 13804 14814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 15836 16663 gene locus_tag LOCUS_03730 15836 16663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 17257 16898 gene locus_tag LOCUS_03740 17257 16898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 18020 17274 gene locus_tag LOCUS_03750 18020 17274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 18156 18809 gene locus_tag LOCUS_03760 18156 18809 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397009.1 protein_id gnl|my_center|LOCUS_03760 18828 19115 gene locus_tag LOCUS_03770 18828 19115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 19440 19652 gene locus_tag LOCUS_03780 19440 19652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03780 20034 20876 gene locus_tag LOCUS_03790 20034 20876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 20985 23531 gene locus_tag LOCUS_03800 20985 23531 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935282.1 protein_id gnl|my_center|LOCUS_03800 23548 24411 gene locus_tag LOCUS_03810 23548 24411 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809624.1 protein_id gnl|my_center|LOCUS_03810 24421 25137 gene locus_tag LOCUS_03820 24421 25137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 25143 25574 gene locus_tag LOCUS_03830 25143 25574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 25599 25838 gene locus_tag LOCUS_03840 25599 25838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 25895 26539 gene locus_tag LOCUS_03850 25895 26539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 26599 26886 gene locus_tag LOCUS_03860 26599 26886 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055138255.1 protein_id gnl|my_center|LOCUS_03860 >Feature sequence012 858 13 gene locus_tag LOCUS_03870 858 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 742 1002 gene locus_tag LOCUS_03880 742 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 2171 1809 gene locus_tag LOCUS_03890 2171 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 2366 2989 gene locus_tag LOCUS_03900 2366 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 4788 3043 gene locus_tag LOCUS_03910 4788 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 5055 5630 gene locus_tag LOCUS_03920 5055 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 5648 6328 gene locus_tag LOCUS_03930 5648 6328 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339372.1 protein_id gnl|my_center|LOCUS_03930 6318 7685 gene locus_tag LOCUS_03940 6318 7685 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368556.1 protein_id gnl|my_center|LOCUS_03940 7945 7870 gene locus_tag LOCUS_t00040 7945 7870 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8522 10024 gene locus_tag LOCUS_03950 8522 10024 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966223.1 protein_id gnl|my_center|LOCUS_03950 10063 10791 gene locus_tag LOCUS_03960 10063 10791 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969540.1 protein_id gnl|my_center|LOCUS_03960 10962 12461 gene locus_tag LOCUS_03970 10962 12461 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090848.1 protein_id gnl|my_center|LOCUS_03970 12522 12725 gene locus_tag LOCUS_03980 12522 12725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 13415 12759 gene locus_tag LOCUS_03990 13415 12759 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086294.1 protein_id gnl|my_center|LOCUS_03990 14319 13501 gene locus_tag LOCUS_04000 14319 13501 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400599.1 protein_id gnl|my_center|LOCUS_04000 15396 14410 gene locus_tag LOCUS_04010 gene dusA 15396 14410 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707399.1 protein_id gnl|my_center|LOCUS_04010 15700 15461 gene locus_tag LOCUS_04020 15700 15461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 15982 17679 gene locus_tag LOCUS_04030 15982 17679 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061797.1 protein_id gnl|my_center|LOCUS_04030 17738 20395 gene locus_tag LOCUS_04040 gene pepN 17738 20395 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532626.1 protein_id gnl|my_center|LOCUS_04040 20577 22967 gene locus_tag LOCUS_04050 20577 22967 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085924.1 protein_id gnl|my_center|LOCUS_04050 23440 22985 gene locus_tag LOCUS_04060 23440 22985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 24100 23555 gene locus_tag LOCUS_04070 24100 23555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 24624 24097 gene locus_tag LOCUS_04080 24624 24097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 25234 24644 gene locus_tag LOCUS_04090 25234 24644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 25993 25325 gene locus_tag LOCUS_04100 25993 25325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 <27172 26127 gene locus_tag LOCUS_04110 <27172 26127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085917.1:bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase >Feature sequence013 2437 14 gene locus_tag LOCUS_04120 2437 14 CDS product TIGR02302 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529406.1 protein_id gnl|my_center|LOCUS_04120 3837 2572 gene locus_tag LOCUS_04130 gene lysA 3837 2572 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066759.1 protein_id gnl|my_center|LOCUS_04130 4029 3871 gene locus_tag LOCUS_04140 4029 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 5450 4077 gene locus_tag LOCUS_04150 gene argH 5450 4077 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965353.1 protein_id gnl|my_center|LOCUS_04150 5449 6111 gene locus_tag LOCUS_04160 5449 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 6833 6120 gene locus_tag LOCUS_04170 6833 6120 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387998.1 protein_id gnl|my_center|LOCUS_04170 7888 6830 gene locus_tag LOCUS_04180 7888 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 8227 8300 gene locus_tag LOCUS_t00050 8227 8300 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9353 8472 gene locus_tag LOCUS_04190 9353 8472 CDS product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917986.1 protein_id gnl|my_center|LOCUS_04190 9975 9376 gene locus_tag LOCUS_04200 9975 9376 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083218.1 protein_id gnl|my_center|LOCUS_04200 11129 9975 gene locus_tag LOCUS_04210 11129 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 11337 11921 gene locus_tag LOCUS_04220 11337 11921 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678340.1 protein_id gnl|my_center|LOCUS_04220 11918 13015 gene locus_tag LOCUS_04230 11918 13015 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529194.1 protein_id gnl|my_center|LOCUS_04230 13012 16242 gene locus_tag LOCUS_04240 13012 16242 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529195.1 protein_id gnl|my_center|LOCUS_04240 16350 17279 gene locus_tag LOCUS_04250 16350 17279 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169775301.1 protein_id gnl|my_center|LOCUS_04250 18261 17290 gene locus_tag LOCUS_04260 18261 17290 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084251.1 protein_id gnl|my_center|LOCUS_04260 19278 18274 gene locus_tag LOCUS_04270 19278 18274 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970736.1 protein_id gnl|my_center|LOCUS_04270 20825 19284 gene locus_tag LOCUS_04280 20825 19284 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084253.1 protein_id gnl|my_center|LOCUS_04280 22101 20830 gene locus_tag LOCUS_04290 22101 20830 CDS product CpaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533681.1 protein_id gnl|my_center|LOCUS_04290 22879 22103 gene locus_tag LOCUS_04300 22879 22103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 24354 22903 gene locus_tag LOCUS_04310 24354 22903 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173504.1 protein_id gnl|my_center|LOCUS_04310 25185 24376 gene locus_tag LOCUS_04320 gene cpaB 25185 24376 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965364.1 protein_id gnl|my_center|LOCUS_04320 25940 25419 gene locus_tag LOCUS_04330 25940 25419 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084258.1 protein_id gnl|my_center|LOCUS_04330 >Feature sequence014 842 66 gene locus_tag LOCUS_04340 842 66 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_04340 1620 847 gene locus_tag LOCUS_04350 1620 847 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719613.1 protein_id gnl|my_center|LOCUS_04350 2753 1650 gene locus_tag LOCUS_04360 gene alr 2753 1650 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327819.1 protein_id gnl|my_center|LOCUS_04360 4276 2753 gene locus_tag LOCUS_04370 4276 2753 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086847.1 protein_id gnl|my_center|LOCUS_04370 5123 4413 gene locus_tag LOCUS_04380 5123 4413 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388162.1 protein_id gnl|my_center|LOCUS_04380 6604 5120 gene locus_tag LOCUS_04390 gene purF 6604 5120 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086836.1 protein_id gnl|my_center|LOCUS_04390 7306 6632 gene locus_tag LOCUS_04400 7306 6632 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379721.1 protein_id gnl|my_center|LOCUS_04400 8844 7426 gene locus_tag LOCUS_04410 gene radA 8844 7426 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532526.1 protein_id gnl|my_center|LOCUS_04410 9446 8949 gene locus_tag LOCUS_04420 9446 8949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 11245 9443 gene locus_tag LOCUS_04430 11245 9443 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080080.1 protein_id gnl|my_center|LOCUS_04430 12426 11248 gene locus_tag LOCUS_04440 12426 11248 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146623.1 protein_id gnl|my_center|LOCUS_04440 12958 12428 gene locus_tag LOCUS_04450 12958 12428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 13606 12965 gene locus_tag LOCUS_04460 13606 12965 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053713.1 protein_id gnl|my_center|LOCUS_04460 14518 13613 gene locus_tag LOCUS_04470 14518 13613 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250169.1 protein_id gnl|my_center|LOCUS_04470 17652 14521 gene locus_tag LOCUS_04480 17652 14521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 18002 17646 gene locus_tag LOCUS_04490 18002 17646 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250172.1 protein_id gnl|my_center|LOCUS_04490 18703 18002 gene locus_tag LOCUS_04500 18703 18002 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867828.1 protein_id gnl|my_center|LOCUS_04500 18950 18696 gene locus_tag LOCUS_04510 18950 18696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 19285 18947 gene locus_tag LOCUS_04520 gene mnhG 19285 18947 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971249.1 protein_id gnl|my_center|LOCUS_04520 19545 19285 gene locus_tag LOCUS_04530 19545 19285 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250176.1 protein_id gnl|my_center|LOCUS_04530 20035 19538 gene locus_tag LOCUS_04540 20035 19538 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_04540 20223 20032 gene locus_tag LOCUS_04550 20223 20032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 20894 20595 gene locus_tag LOCUS_04560 20894 20595 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_04560 21380 21051 gene locus_tag LOCUS_04570 21380 21051 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_04570 21574 22395 gene locus_tag LOCUS_04580 gene panB 21574 22395 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086824.1 protein_id gnl|my_center|LOCUS_04580 22522 23184 gene locus_tag LOCUS_04590 22522 23184 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532849.1 protein_id gnl|my_center|LOCUS_04590 23187 24551 gene locus_tag LOCUS_04600 23187 24551 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384150.1 protein_id gnl|my_center|LOCUS_04600 >Feature sequence015 <1 778 gene locus_tag LOCUS_04610 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_234939668.1:multicopper oxidase family protein 1162 836 gene locus_tag LOCUS_04620 1162 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 1540 1304 gene locus_tag LOCUS_04630 1540 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 1891 2724 gene locus_tag LOCUS_04640 1891 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 3969 2872 gene locus_tag LOCUS_04650 3969 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 3895 4155 gene locus_tag LOCUS_04660 3895 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 4912 4259 gene locus_tag LOCUS_04670 4912 4259 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311298.1 protein_id gnl|my_center|LOCUS_04670 5319 5125 gene locus_tag LOCUS_04680 5319 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 5718 6440 gene locus_tag LOCUS_04690 5718 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 6840 6478 gene locus_tag LOCUS_04700 6840 6478 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390780.1 protein_id gnl|my_center|LOCUS_04700 7665 6865 gene locus_tag LOCUS_04710 7665 6865 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_04710 8190 7819 gene locus_tag LOCUS_04720 8190 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 8852 8361 gene locus_tag LOCUS_04730 8852 8361 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810020.1 protein_id gnl|my_center|LOCUS_04730 10155 8869 gene locus_tag LOCUS_04740 10155 8869 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969469.1 protein_id gnl|my_center|LOCUS_04740 11233 10199 gene locus_tag LOCUS_04750 11233 10199 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976088.1 protein_id gnl|my_center|LOCUS_04750 11454 12158 gene locus_tag LOCUS_04760 11454 12158 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243745.1 protein_id gnl|my_center|LOCUS_04760 12381 13865 gene locus_tag LOCUS_04770 12381 13865 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389402.1 protein_id gnl|my_center|LOCUS_04770 16400 13941 gene locus_tag LOCUS_04780 16400 13941 CDS product arsenate reductase (azurin) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257094.1 protein_id gnl|my_center|LOCUS_04780 16923 16417 gene locus_tag LOCUS_04790 16923 16417 CDS product arsenate reductase (azurin) small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229170.1 protein_id gnl|my_center|LOCUS_04790 18382 17093 gene locus_tag LOCUS_04800 18382 17093 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_04800 19850 18420 gene locus_tag LOCUS_04810 19850 18420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 20764 19871 gene locus_tag LOCUS_04820 20764 19871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 21023 21550 gene locus_tag LOCUS_04830 21023 21550 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967578.1 protein_id gnl|my_center|LOCUS_04830 21597 21932 gene locus_tag LOCUS_04840 21597 21932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 22115 22759 gene locus_tag LOCUS_04850 22115 22759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 22783 23058 gene locus_tag LOCUS_04860 22783 23058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 23097 24005 gene locus_tag LOCUS_04870 23097 24005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162493357.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence016 1901 432 gene locus_tag LOCUS_04880 gene sufB 1901 432 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975623.1 protein_id gnl|my_center|LOCUS_04880 3086 1923 gene locus_tag LOCUS_04890 3086 1923 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389780.1 protein_id gnl|my_center|LOCUS_04890 3580 3083 gene locus_tag LOCUS_04900 3580 3083 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 protein_id gnl|my_center|LOCUS_04900 3868 4527 gene locus_tag LOCUS_04910 3868 4527 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008143006.1 protein_id gnl|my_center|LOCUS_04910 4901 5251 gene locus_tag LOCUS_04920 4901 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 5467 5318 gene locus_tag LOCUS_04930 5467 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 7642 5582 gene locus_tag LOCUS_04940 gene parE 7642 5582 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400485.1 protein_id gnl|my_center|LOCUS_04940 7877 8428 gene locus_tag LOCUS_04950 7877 8428 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532060.1 protein_id gnl|my_center|LOCUS_04950 8904 8488 gene locus_tag LOCUS_04960 gene nikR 8904 8488 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083525.1 protein_id gnl|my_center|LOCUS_04960 8999 9586 gene locus_tag LOCUS_04970 8999 9586 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528397.1 protein_id gnl|my_center|LOCUS_04970 10269 9655 gene locus_tag LOCUS_04980 10269 9655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 10603 10941 gene locus_tag LOCUS_04990 10603 10941 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205430.1 protein_id gnl|my_center|LOCUS_04990 11045 12454 gene locus_tag LOCUS_05000 gene glnA 11045 12454 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328343.1 protein_id gnl|my_center|LOCUS_05000 12806 14047 gene locus_tag LOCUS_05010 12806 14047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 14077 14532 gene locus_tag LOCUS_05020 14077 14532 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070884.1 protein_id gnl|my_center|LOCUS_05020 19053 14548 gene locus_tag LOCUS_05030 19053 14548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 19576 19791 gene locus_tag LOCUS_05040 19576 19791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 20848 19805 gene locus_tag LOCUS_05050 20848 19805 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095204.1 protein_id gnl|my_center|LOCUS_05050 21168 20845 gene locus_tag LOCUS_05060 21168 20845 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172265.1 protein_id gnl|my_center|LOCUS_05060 21420 21866 gene locus_tag LOCUS_05070 21420 21866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 22684 23853 gene locus_tag LOCUS_05080 22684 23853 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150041682.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence017 1477 485 gene locus_tag LOCUS_05090 gene cobS 1477 485 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175820.1 protein_id gnl|my_center|LOCUS_05090 1917 1498 gene locus_tag LOCUS_05100 1917 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 1828 2076 gene locus_tag LOCUS_05110 1828 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 2236 2508 gene locus_tag LOCUS_05120 2236 2508 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083017.1 protein_id gnl|my_center|LOCUS_05120 2508 3023 gene locus_tag LOCUS_05130 2508 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 4301 3039 gene locus_tag LOCUS_05140 4301 3039 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083018.1 protein_id gnl|my_center|LOCUS_05140 5431 4298 gene locus_tag LOCUS_05150 gene aroB 5431 4298 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529358.1 protein_id gnl|my_center|LOCUS_05150 5945 5421 gene locus_tag LOCUS_05160 5945 5421 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175815.1 protein_id gnl|my_center|LOCUS_05160 5827 6090 gene locus_tag LOCUS_05170 5827 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 6124 6303 gene locus_tag LOCUS_05180 6124 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 6305 7267 gene locus_tag LOCUS_05190 gene xerD 6305 7267 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240036.1 protein_id gnl|my_center|LOCUS_05190 7365 8324 gene locus_tag LOCUS_05200 7365 8324 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066789.1 protein_id gnl|my_center|LOCUS_05200 8489 9259 gene locus_tag LOCUS_05210 8489 9259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 9369 10733 gene locus_tag LOCUS_05220 9369 10733 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190374.1 protein_id gnl|my_center|LOCUS_05220 10930 11400 gene locus_tag LOCUS_05230 10930 11400 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528912.1 protein_id gnl|my_center|LOCUS_05230 11404 12153 gene locus_tag LOCUS_05240 11404 12153 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083382.1 protein_id gnl|my_center|LOCUS_05240 12798 14744 gene locus_tag LOCUS_05250 gene htpG 12798 14744 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061603.1 protein_id gnl|my_center|LOCUS_05250 14810 15616 gene locus_tag LOCUS_05260 gene pcaD 14810 15616 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223755.1 protein_id gnl|my_center|LOCUS_05260 18482 15732 gene locus_tag LOCUS_05270 gene secA 18482 15732 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066739.1 protein_id gnl|my_center|LOCUS_05270 18658 19557 gene locus_tag LOCUS_05280 18658 19557 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973107.1 protein_id gnl|my_center|LOCUS_05280 19557 20786 gene locus_tag LOCUS_05290 gene argJ 19557 20786 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529442.1 protein_id gnl|my_center|LOCUS_05290 21250 21477 gene locus_tag LOCUS_05300 21250 21477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 21535 21921 gene locus_tag LOCUS_05310 gene mutT 21535 21921 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529444.1 protein_id gnl|my_center|LOCUS_05310 22768 21950 gene locus_tag LOCUS_05320 22768 21950 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966655.1 protein_id gnl|my_center|LOCUS_05320 22854 23639 gene locus_tag LOCUS_05330 22854 23639 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083041.1 protein_id gnl|my_center|LOCUS_05330 23672 23938 gene locus_tag LOCUS_05340 gene grxC 23672 23938 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721669.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence018 755 1681 gene locus_tag LOCUS_05350 gene hemC 755 1681 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970392.1 protein_id gnl|my_center|LOCUS_05350 1720 2436 gene locus_tag LOCUS_05360 1720 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 2541 4532 gene locus_tag LOCUS_05370 2541 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 4538 6187 gene locus_tag LOCUS_05380 4538 6187 CDS product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083393.1 protein_id gnl|my_center|LOCUS_05380 6991 6224 gene locus_tag LOCUS_05390 6991 6224 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083296.1 protein_id gnl|my_center|LOCUS_05390 8962 7184 gene locus_tag LOCUS_05400 8962 7184 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_05400 9134 9209 gene locus_tag LOCUS_t00060 9134 9209 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9582 9361 gene locus_tag LOCUS_05410 9582 9361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 9964 10632 gene locus_tag LOCUS_05420 9964 10632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 10678 11526 gene locus_tag LOCUS_05430 10678 11526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 13647 12454 gene locus_tag LOCUS_05440 gene dacB 13647 12454 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408519.1 protein_id gnl|my_center|LOCUS_05440 13854 15806 gene locus_tag LOCUS_05450 13854 15806 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258398.1 protein_id gnl|my_center|LOCUS_05450 15985 17046 gene locus_tag LOCUS_05460 15985 17046 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763739.1 protein_id gnl|my_center|LOCUS_05460 17043 18056 gene locus_tag LOCUS_05470 17043 18056 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815914.1 protein_id gnl|my_center|LOCUS_05470 18120 18941 gene locus_tag LOCUS_05480 18120 18941 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191802.1 protein_id gnl|my_center|LOCUS_05480 18952 19782 gene locus_tag LOCUS_05490 18952 19782 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244499.1 protein_id gnl|my_center|LOCUS_05490 19779 20801 gene locus_tag LOCUS_05500 19779 20801 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191832.1 protein_id gnl|my_center|LOCUS_05500 20805 21629 gene locus_tag LOCUS_05510 20805 21629 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929635.1 protein_id gnl|my_center|LOCUS_05510 22265 21636 gene locus_tag LOCUS_05520 gene upp 22265 21636 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536149.1 protein_id gnl|my_center|LOCUS_05520 23681 22398 gene locus_tag LOCUS_05530 23681 22398 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938325.1 protein_id gnl|my_center|LOCUS_05530 >Feature sequence019 <1 1048 gene locus_tag LOCUS_05540 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064240741.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA 1045 1362 gene locus_tag LOCUS_05550 1045 1362 CDS product chorismate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968657.1 protein_id gnl|my_center|LOCUS_05550 1385 2863 gene locus_tag LOCUS_05560 gene gatB 1385 2863 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531347.1 protein_id gnl|my_center|LOCUS_05560 2984 4762 gene locus_tag LOCUS_05570 2984 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 4953 5318 gene locus_tag LOCUS_05580 4953 5318 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719664.1 protein_id gnl|my_center|LOCUS_05580 5309 5857 gene locus_tag LOCUS_05590 gene nuoB 5309 5857 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531828.1 protein_id gnl|my_center|LOCUS_05590 5888 6502 gene locus_tag LOCUS_05600 5888 6502 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531091.1 protein_id gnl|my_center|LOCUS_05600 6506 7690 gene locus_tag LOCUS_05610 6506 7690 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312711.1 protein_id gnl|my_center|LOCUS_05610 7687 8703 gene locus_tag LOCUS_05620 7687 8703 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971510.1 protein_id gnl|my_center|LOCUS_05620 8703 10007 gene locus_tag LOCUS_05630 gene nuoF 8703 10007 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087678.1 protein_id gnl|my_center|LOCUS_05630 10014 12062 gene locus_tag LOCUS_05640 gene nuoG 10014 12062 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971511.1 protein_id gnl|my_center|LOCUS_05640 12055 13077 gene locus_tag LOCUS_05650 gene nuoH 12055 13077 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707627.1 protein_id gnl|my_center|LOCUS_05650 13088 13597 gene locus_tag LOCUS_05660 gene nuoI 13088 13597 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707628.1 protein_id gnl|my_center|LOCUS_05660 13620 14225 gene locus_tag LOCUS_05670 13620 14225 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311651.1 protein_id gnl|my_center|LOCUS_05670 14230 14535 gene locus_tag LOCUS_05680 gene nuoK 14230 14535 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719678.1 protein_id gnl|my_center|LOCUS_05680 14541 16469 gene locus_tag LOCUS_05690 gene nuoL 14541 16469 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531100.1 protein_id gnl|my_center|LOCUS_05690 16471 17988 gene locus_tag LOCUS_05700 16471 17988 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531101.1 protein_id gnl|my_center|LOCUS_05700 18000 19433 gene locus_tag LOCUS_05710 gene nuoN 18000 19433 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975095.1 protein_id gnl|my_center|LOCUS_05710 19447 20220 gene locus_tag LOCUS_05720 19447 20220 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919802.1 protein_id gnl|my_center|LOCUS_05720 20217 21902 gene locus_tag LOCUS_05730 20217 21902 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171719.1 protein_id gnl|my_center|LOCUS_05730 21967 22371 gene locus_tag LOCUS_05740 gene mce 21967 22371 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389447.1 protein_id gnl|my_center|LOCUS_05740 22603 22394 gene locus_tag LOCUS_05750 22603 22394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 >Feature sequence020 45 1625 gene locus_tag LOCUS_05760 45 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 2387 4318 gene locus_tag LOCUS_05770 2387 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 4357 4929 gene locus_tag LOCUS_05780 4357 4929 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383606.1 protein_id gnl|my_center|LOCUS_05780 4911 6110 gene locus_tag LOCUS_05790 4911 6110 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967022.1 protein_id gnl|my_center|LOCUS_05790 6111 7106 gene locus_tag LOCUS_05800 6111 7106 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383609.1 protein_id gnl|my_center|LOCUS_05800 7193 8167 gene locus_tag LOCUS_05810 7193 8167 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194087.1 protein_id gnl|my_center|LOCUS_05810 8207 9151 gene locus_tag LOCUS_05820 8207 9151 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868775.1 protein_id gnl|my_center|LOCUS_05820 9144 9995 gene locus_tag LOCUS_05830 9144 9995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 10269 11348 gene locus_tag LOCUS_05840 gene rfbB 10269 11348 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974014.1 protein_id gnl|my_center|LOCUS_05840 11351 12232 gene locus_tag LOCUS_05850 gene rfbD 11351 12232 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532724.1 protein_id gnl|my_center|LOCUS_05850 13261 13782 gene locus_tag LOCUS_05860 13261 13782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 13790 14971 gene locus_tag LOCUS_05870 13790 14971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 15274 16428 gene locus_tag LOCUS_05880 gene rffA 15274 16428 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612080.1 protein_id gnl|my_center|LOCUS_05880 16442 17458 gene locus_tag LOCUS_05890 16442 17458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 17596 18537 gene locus_tag LOCUS_05900 17596 18537 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140943.1 protein_id gnl|my_center|LOCUS_05900 19497 18571 gene locus_tag LOCUS_05910 19497 18571 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057335.1 protein_id gnl|my_center|LOCUS_05910 20605 19490 gene locus_tag LOCUS_05920 20605 19490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 21316 20624 gene locus_tag LOCUS_05930 21316 20624 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963400.1 protein_id gnl|my_center|LOCUS_05930 22830 21313 gene locus_tag LOCUS_05940 22830 21313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103407.1 protein_id gnl|my_center|LOCUS_05940 23343 23029 gene locus_tag LOCUS_05950 23343 23029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 >Feature sequence021 <1 1103 gene locus_tag LOCUS_05960 <1 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384288.1:ATP-binding protein 1107 2471 gene locus_tag LOCUS_05970 1107 2471 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972921.1 protein_id gnl|my_center|LOCUS_05970 2699 4045 gene locus_tag LOCUS_05980 2699 4045 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809603.1 protein_id gnl|my_center|LOCUS_05980 4139 5854 gene locus_tag LOCUS_05990 4139 5854 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819869.1 protein_id gnl|my_center|LOCUS_05990 5851 6921 gene locus_tag LOCUS_06000 5851 6921 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809599.1 protein_id gnl|my_center|LOCUS_06000 7164 8609 gene locus_tag LOCUS_06010 7164 8609 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388889.1 protein_id gnl|my_center|LOCUS_06010 9161 8688 gene locus_tag LOCUS_06020 9161 8688 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_06020 9297 10196 gene locus_tag LOCUS_06030 9297 10196 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388087.1 protein_id gnl|my_center|LOCUS_06030 10272 10802 gene locus_tag LOCUS_06040 gene hpt 10272 10802 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709205.1 protein_id gnl|my_center|LOCUS_06040 11692 10799 gene locus_tag LOCUS_06050 11692 10799 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_06050 12657 11689 gene locus_tag LOCUS_06060 12657 11689 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028324.1 protein_id gnl|my_center|LOCUS_06060 13644 12661 gene locus_tag LOCUS_06070 13644 12661 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 protein_id gnl|my_center|LOCUS_06070 14423 13641 gene locus_tag LOCUS_06080 14423 13641 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315597.1 protein_id gnl|my_center|LOCUS_06080 15670 14435 gene locus_tag LOCUS_06090 15670 14435 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312497.1 protein_id gnl|my_center|LOCUS_06090 16817 15774 gene locus_tag LOCUS_06100 gene xylF 16817 15774 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329224.1 protein_id gnl|my_center|LOCUS_06100 18515 16890 gene locus_tag LOCUS_06110 18515 16890 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090058733.1 protein_id gnl|my_center|LOCUS_06110 19939 18512 gene locus_tag LOCUS_06120 19939 18512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 21254 19941 gene locus_tag LOCUS_06130 gene xylA 21254 19941 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067004.1 protein_id gnl|my_center|LOCUS_06130 22732 21266 gene locus_tag LOCUS_06140 gene xylB 22732 21266 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533060.1 protein_id gnl|my_center|LOCUS_06140 >Feature sequence022 924 1973 gene locus_tag LOCUS_06150 gene mgrA 924 1973 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971691.1 protein_id gnl|my_center|LOCUS_06150 3324 2065 gene locus_tag LOCUS_06160 3324 2065 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310644.1 protein_id gnl|my_center|LOCUS_06160 4242 3412 gene locus_tag LOCUS_06170 4242 3412 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310642.1 protein_id gnl|my_center|LOCUS_06170 5138 4239 gene locus_tag LOCUS_06180 5138 4239 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970865.1 protein_id gnl|my_center|LOCUS_06180 6289 5138 gene locus_tag LOCUS_06190 6289 5138 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992208.1 protein_id gnl|my_center|LOCUS_06190 7015 6386 gene locus_tag LOCUS_06200 7015 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 7120 7893 gene locus_tag LOCUS_06210 7120 7893 CDS product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092173.1 protein_id gnl|my_center|LOCUS_06210 8006 8257 gene locus_tag LOCUS_06220 8006 8257 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529551.1 protein_id gnl|my_center|LOCUS_06220 8943 8368 gene locus_tag LOCUS_06230 8943 8368 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909445.1 protein_id gnl|my_center|LOCUS_06230 9036 9929 gene locus_tag LOCUS_06240 9036 9929 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965893.1 protein_id gnl|my_center|LOCUS_06240 9939 11399 gene locus_tag LOCUS_06250 9939 11399 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090620.1 protein_id gnl|my_center|LOCUS_06250 11433 12818 gene locus_tag LOCUS_06260 11433 12818 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975253.1 protein_id gnl|my_center|LOCUS_06260 12815 13444 gene locus_tag LOCUS_06270 12815 13444 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706131.1 protein_id gnl|my_center|LOCUS_06270 14067 13429 gene locus_tag LOCUS_06280 14067 13429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 14176 15579 gene locus_tag LOCUS_06290 gene trmFO 14176 15579 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087495.1 protein_id gnl|my_center|LOCUS_06290 15675 16268 gene locus_tag LOCUS_06300 15675 16268 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208083.1 protein_id gnl|my_center|LOCUS_06300 16815 16438 gene locus_tag LOCUS_06310 16815 16438 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971713.1 protein_id gnl|my_center|LOCUS_06310 17762 16821 gene locus_tag LOCUS_06320 17762 16821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06320 19403 17781 gene locus_tag LOCUS_06330 gene secD 19403 17781 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087503.1 protein_id gnl|my_center|LOCUS_06330 19795 19466 gene locus_tag LOCUS_06340 gene yajC 19795 19466 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087504.1 protein_id gnl|my_center|LOCUS_06340 19992 20837 gene locus_tag LOCUS_06350 19992 20837 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531304.1 protein_id gnl|my_center|LOCUS_06350 22123 20834 gene locus_tag LOCUS_06360 22123 20834 CDS product LysM peptidoglycan-binding domain-containing M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087511.1 protein_id gnl|my_center|LOCUS_06360 22849 22205 gene locus_tag LOCUS_06370 22849 22205 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389521.1 protein_id gnl|my_center|LOCUS_06370 >Feature sequence023 1468 431 gene locus_tag LOCUS_06380 1468 431 CDS product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039102.1 protein_id gnl|my_center|LOCUS_06380 2153 1482 gene locus_tag LOCUS_06390 2153 1482 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039101.1 protein_id gnl|my_center|LOCUS_06390 2887 2153 gene locus_tag LOCUS_06400 2887 2153 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208961.1 protein_id gnl|my_center|LOCUS_06400 3047 4288 gene locus_tag LOCUS_06410 3047 4288 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057204.1 protein_id gnl|my_center|LOCUS_06410 4434 5351 gene locus_tag LOCUS_06420 4434 5351 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969452.1 protein_id gnl|my_center|LOCUS_06420 5348 5737 gene locus_tag LOCUS_06430 5348 5737 CDS product protocatechuate 4,5-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036041.1 protein_id gnl|my_center|LOCUS_06430 5730 6575 gene locus_tag LOCUS_06440 5730 6575 CDS product gallate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 protein_id gnl|my_center|LOCUS_06440 6598 7572 gene locus_tag LOCUS_06450 6598 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 7559 8569 gene locus_tag LOCUS_06460 7559 8569 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002248.1 protein_id gnl|my_center|LOCUS_06460 8607 9632 gene locus_tag LOCUS_06470 8607 9632 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538040.1 protein_id gnl|my_center|LOCUS_06470 9721 10230 gene locus_tag LOCUS_06480 9721 10230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 10227 11513 gene locus_tag LOCUS_06490 10227 11513 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_06490 11522 11944 gene locus_tag LOCUS_06500 11522 11944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 12393 11935 gene locus_tag LOCUS_06510 12393 11935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 13371 12589 gene locus_tag LOCUS_06520 gene lptB 13371 12589 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083547.1 protein_id gnl|my_center|LOCUS_06520 13943 13416 gene locus_tag LOCUS_06530 13943 13416 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965157.1 protein_id gnl|my_center|LOCUS_06530 14638 13940 gene locus_tag LOCUS_06540 14638 13940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 15383 14772 gene locus_tag LOCUS_06550 15383 14772 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083544.1 protein_id gnl|my_center|LOCUS_06550 15537 15451 gene locus_tag LOCUS_t00070 15537 15451 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15762 16736 gene locus_tag LOCUS_06560 15762 16736 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528195.1 protein_id gnl|my_center|LOCUS_06560 17564 16767 gene locus_tag LOCUS_06570 17564 16767 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387778.1 protein_id gnl|my_center|LOCUS_06570 17737 18426 gene locus_tag LOCUS_06580 17737 18426 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_06580 18430 19596 gene locus_tag LOCUS_06590 gene queG 18430 19596 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528621.1 protein_id gnl|my_center|LOCUS_06590 19530 20498 gene locus_tag LOCUS_06600 19530 20498 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338925.1 protein_id gnl|my_center|LOCUS_06600 20815 21213 gene locus_tag LOCUS_06610 20815 21213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 21345 22892 gene locus_tag LOCUS_06620 gene rpoN 21345 22892 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083548.1 protein_id gnl|my_center|LOCUS_06620 >Feature sequence024 153 899 gene locus_tag LOCUS_06630 gene napG 153 899 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091679.1 protein_id gnl|my_center|LOCUS_06630 896 1873 gene locus_tag LOCUS_06640 896 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 1870 2781 gene locus_tag LOCUS_06650 1870 2781 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730807.1 protein_id gnl|my_center|LOCUS_06650 2795 3271 gene locus_tag LOCUS_06660 2795 3271 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865665.1 protein_id gnl|my_center|LOCUS_06660 3271 4098 gene locus_tag LOCUS_06670 3271 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 4190 5062 gene locus_tag LOCUS_06680 4190 5062 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445511.1 protein_id gnl|my_center|LOCUS_06680 6047 5073 gene locus_tag LOCUS_06690 gene menA 6047 5073 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391135.1 protein_id gnl|my_center|LOCUS_06690 6796 6044 gene locus_tag LOCUS_06700 gene ubiE 6796 6044 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385128.1 protein_id gnl|my_center|LOCUS_06700 7416 6808 gene locus_tag LOCUS_06710 7416 6808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 7580 8317 gene locus_tag LOCUS_06720 gene dnr 7580 8317 CDS product transcriptional regulator Dnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_06720 8554 9006 gene locus_tag LOCUS_06730 8554 9006 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973802.1 protein_id gnl|my_center|LOCUS_06730 9022 10389 gene locus_tag LOCUS_06740 9022 10389 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338149.1 protein_id gnl|my_center|LOCUS_06740 10504 11316 gene locus_tag LOCUS_06750 10504 11316 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086000.1 protein_id gnl|my_center|LOCUS_06750 11338 13245 gene locus_tag LOCUS_06760 11338 13245 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086001.1 protein_id gnl|my_center|LOCUS_06760 13254 13874 gene locus_tag LOCUS_06770 13254 13874 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085996.1 protein_id gnl|my_center|LOCUS_06770 13877 14164 gene locus_tag LOCUS_06780 13877 14164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 14174 14743 gene locus_tag LOCUS_06790 14174 14743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 15514 14942 gene locus_tag LOCUS_06800 gene napC 15514 14942 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208531.1 protein_id gnl|my_center|LOCUS_06800 16048 15608 gene locus_tag LOCUS_06810 gene napB 16048 15608 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081760.1 protein_id gnl|my_center|LOCUS_06810 17024 16104 gene locus_tag LOCUS_06820 gene napH 17024 16104 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705483.1 protein_id gnl|my_center|LOCUS_06820 17859 17029 gene locus_tag LOCUS_06830 gene napG 17859 17029 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705482.1 protein_id gnl|my_center|LOCUS_06830 20577 18016 gene locus_tag LOCUS_06840 gene napA 20577 18016 CDS product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705481.1 protein_id gnl|my_center|LOCUS_06840 20848 20597 gene locus_tag LOCUS_06850 20848 20597 CDS product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973821.1 protein_id gnl|my_center|LOCUS_06850 21348 20845 gene locus_tag LOCUS_06860 gene napF 21348 20845 CDS product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071814.1 protein_id gnl|my_center|LOCUS_06860 23103 21508 gene locus_tag LOCUS_06870 23103 21508 CDS product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497115.1 protein_id gnl|my_center|LOCUS_06870 >Feature sequence025 2340 592 gene locus_tag LOCUS_06880 2340 592 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085312.1 protein_id gnl|my_center|LOCUS_06880 4128 2455 gene locus_tag LOCUS_06890 4128 2455 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085311.1 protein_id gnl|my_center|LOCUS_06890 4263 5180 gene locus_tag LOCUS_06900 4263 5180 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171746.1 protein_id gnl|my_center|LOCUS_06900 5260 5814 gene locus_tag LOCUS_06910 gene moaB 5260 5814 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241194.1 protein_id gnl|my_center|LOCUS_06910 6552 5950 gene locus_tag LOCUS_06920 6552 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 7262 6549 gene locus_tag LOCUS_06930 7262 6549 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939178.1 protein_id gnl|my_center|LOCUS_06930 7326 7541 gene locus_tag LOCUS_06940 7326 7541 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085319.1 protein_id gnl|my_center|LOCUS_06940 7534 8304 gene locus_tag LOCUS_06950 7534 8304 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338460.1 protein_id gnl|my_center|LOCUS_06950 9117 8356 gene locus_tag LOCUS_06960 9117 8356 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202509.1 protein_id gnl|my_center|LOCUS_06960 9271 10149 gene locus_tag LOCUS_06970 9271 10149 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085321.1 protein_id gnl|my_center|LOCUS_06970 10165 10347 gene locus_tag LOCUS_06980 10165 10347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 11222 10365 gene locus_tag LOCUS_06990 11222 10365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 11406 12011 gene locus_tag LOCUS_07000 11406 12011 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084308.1 protein_id gnl|my_center|LOCUS_07000 14821 12023 gene locus_tag LOCUS_07010 14821 12023 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173457.1 protein_id gnl|my_center|LOCUS_07010 15574 14996 gene locus_tag LOCUS_07020 15574 14996 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921226.1 protein_id gnl|my_center|LOCUS_07020 17065 15665 gene locus_tag LOCUS_07030 gene thrC 17065 15665 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921382.1 protein_id gnl|my_center|LOCUS_07030 17374 18057 gene locus_tag LOCUS_07040 17374 18057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 18605 18162 gene locus_tag LOCUS_07050 gene rnhA 18605 18162 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084134.1 protein_id gnl|my_center|LOCUS_07050 19574 18606 gene locus_tag LOCUS_07060 19574 18606 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532770.1 protein_id gnl|my_center|LOCUS_07060 20575 19571 gene locus_tag LOCUS_07070 gene ispH 20575 19571 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537458.1 protein_id gnl|my_center|LOCUS_07070 20715 21296 gene locus_tag LOCUS_07080 20715 21296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 >Feature sequence026 2710 3378 gene locus_tag LOCUS_07090 2710 3378 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024089.1 protein_id gnl|my_center|LOCUS_07090 4128 3382 gene locus_tag LOCUS_07100 gene fliP 4128 3382 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088559.1 protein_id gnl|my_center|LOCUS_07100 4571 4128 gene locus_tag LOCUS_07110 4571 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 4782 5183 gene locus_tag LOCUS_07120 gene flgB 4782 5183 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088557.1 protein_id gnl|my_center|LOCUS_07120 5196 5606 gene locus_tag LOCUS_07130 gene flgC 5196 5606 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007602149.1 protein_id gnl|my_center|LOCUS_07130 5626 5940 gene locus_tag LOCUS_07140 gene fliE 5626 5940 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088556.1 protein_id gnl|my_center|LOCUS_07140 5972 6235 gene locus_tag LOCUS_07150 gene fliQ 5972 6235 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088555.1 protein_id gnl|my_center|LOCUS_07150 6259 7017 gene locus_tag LOCUS_07160 gene fliR 6259 7017 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088554.1 protein_id gnl|my_center|LOCUS_07160 7033 8115 gene locus_tag LOCUS_07170 gene flhB 7033 8115 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088553.1 protein_id gnl|my_center|LOCUS_07170 8118 10733 gene locus_tag LOCUS_07180 8118 10733 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088552.1 protein_id gnl|my_center|LOCUS_07180 11006 10797 gene locus_tag LOCUS_07190 11006 10797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 11105 12079 gene locus_tag LOCUS_07200 11105 12079 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310430.1 protein_id gnl|my_center|LOCUS_07200 13245 12145 gene locus_tag LOCUS_07210 13245 12145 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389499.1 protein_id gnl|my_center|LOCUS_07210 13681 13337 gene locus_tag LOCUS_07220 13681 13337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529096.1 protein_id gnl|my_center|LOCUS_07220 14421 13699 gene locus_tag LOCUS_07230 14421 13699 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389501.1 protein_id gnl|my_center|LOCUS_07230 15269 14418 gene locus_tag LOCUS_07240 15269 14418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 16576 15266 gene locus_tag LOCUS_07250 gene livM 16576 15266 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088418.1 protein_id gnl|my_center|LOCUS_07250 17495 16581 gene locus_tag LOCUS_07260 17495 16581 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088417.1 protein_id gnl|my_center|LOCUS_07260 17711 18805 gene locus_tag LOCUS_07270 gene recA 17711 18805 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314063.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence027 1047 1721 gene locus_tag LOCUS_07280 1047 1721 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918213.1 protein_id gnl|my_center|LOCUS_07280 2024 3445 gene locus_tag LOCUS_07290 2024 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 3598 4314 gene locus_tag LOCUS_07300 3598 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 6020 4395 gene locus_tag LOCUS_07310 6020 4395 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087573.1 protein_id gnl|my_center|LOCUS_07310 6240 6365 gene locus_tag LOCUS_07320 6240 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 7042 6485 gene locus_tag LOCUS_07330 7042 6485 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918592.1 protein_id gnl|my_center|LOCUS_07330 7187 7780 gene locus_tag LOCUS_07340 7187 7780 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083483.1 protein_id gnl|my_center|LOCUS_07340 7821 8798 gene locus_tag LOCUS_07350 7821 8798 CDS product DUF4424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531028.1 protein_id gnl|my_center|LOCUS_07350 9455 8817 gene locus_tag LOCUS_07360 9455 8817 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086294.1 protein_id gnl|my_center|LOCUS_07360 10199 9534 gene locus_tag LOCUS_07370 10199 9534 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391350.1 protein_id gnl|my_center|LOCUS_07370 11614 10196 gene locus_tag LOCUS_07380 11614 10196 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391352.1 protein_id gnl|my_center|LOCUS_07380 12397 11615 gene locus_tag LOCUS_07390 12397 11615 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391353.1 protein_id gnl|my_center|LOCUS_07390 12547 13590 gene locus_tag LOCUS_07400 12547 13590 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337992.1 protein_id gnl|my_center|LOCUS_07400 13724 14287 gene locus_tag LOCUS_07410 13724 14287 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227767.1 protein_id gnl|my_center|LOCUS_07410 14290 15762 gene locus_tag LOCUS_07420 14290 15762 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038755.1 protein_id gnl|my_center|LOCUS_07420 15870 16535 gene locus_tag LOCUS_07430 15870 16535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 17023 16601 gene locus_tag LOCUS_07440 17023 16601 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388775.1 protein_id gnl|my_center|LOCUS_07440 17280 18773 gene locus_tag LOCUS_07450 17280 18773 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530350.1 protein_id gnl|my_center|LOCUS_07450 18805 20028 gene locus_tag LOCUS_07460 18805 20028 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530351.1 protein_id gnl|my_center|LOCUS_07460 20029 21336 gene locus_tag LOCUS_07470 gene glcF 20029 21336 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401223.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence028 3084 1063 gene locus_tag LOCUS_07480 3084 1063 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395919.1 protein_id gnl|my_center|LOCUS_07480 4454 3357 gene locus_tag LOCUS_07490 4454 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 4674 5348 gene locus_tag LOCUS_07500 4674 5348 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244099.1 protein_id gnl|my_center|LOCUS_07500 5345 6718 gene locus_tag LOCUS_07510 5345 6718 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969887.1 protein_id gnl|my_center|LOCUS_07510 6855 7928 gene locus_tag LOCUS_07520 gene gmd 6855 7928 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639973.1 protein_id gnl|my_center|LOCUS_07520 7933 8877 gene locus_tag LOCUS_07530 7933 8877 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639972.1 protein_id gnl|my_center|LOCUS_07530 9138 8914 gene locus_tag LOCUS_07540 9138 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 9345 10475 gene locus_tag LOCUS_07550 9345 10475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 10589 11629 gene locus_tag LOCUS_07560 10589 11629 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921406.1 protein_id gnl|my_center|LOCUS_07560 13250 11799 gene locus_tag LOCUS_07570 13250 11799 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976005.1 protein_id gnl|my_center|LOCUS_07570 15517 13637 gene locus_tag LOCUS_07580 15517 13637 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172931.1 protein_id gnl|my_center|LOCUS_07580 17024 15738 gene locus_tag LOCUS_07590 gene aceA 17024 15738 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787342.1 protein_id gnl|my_center|LOCUS_07590 17397 17116 gene locus_tag LOCUS_07600 17397 17116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 17590 19002 gene locus_tag LOCUS_07610 17590 19002 CDS product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223535.1 protein_id gnl|my_center|LOCUS_07610 >Feature sequence029 130 522 gene locus_tag LOCUS_07620 130 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 638 2632 gene locus_tag LOCUS_07630 638 2632 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 protein_id gnl|my_center|LOCUS_07630 2688 3767 gene locus_tag LOCUS_07640 2688 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 3764 4729 gene locus_tag LOCUS_07650 3764 4729 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_07650 4738 6027 gene locus_tag LOCUS_07660 4738 6027 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943575.1 protein_id gnl|my_center|LOCUS_07660 6024 6890 gene locus_tag LOCUS_07670 6024 6890 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879451.1 protein_id gnl|my_center|LOCUS_07670 6872 7543 gene locus_tag LOCUS_07680 6872 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 10701 7594 gene locus_tag LOCUS_07690 10701 7594 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389847.1 protein_id gnl|my_center|LOCUS_07690 11786 10698 gene locus_tag LOCUS_07700 11786 10698 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389848.1 protein_id gnl|my_center|LOCUS_07700 12129 13151 gene locus_tag LOCUS_07710 12129 13151 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459299.1 protein_id gnl|my_center|LOCUS_07710 13236 15422 gene locus_tag LOCUS_07720 13236 15422 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560769.1 protein_id gnl|my_center|LOCUS_07720 15473 16177 gene locus_tag LOCUS_07730 15473 16177 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941468.1 protein_id gnl|my_center|LOCUS_07730 17465 16188 gene locus_tag LOCUS_07740 17465 16188 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389877.1 protein_id gnl|my_center|LOCUS_07740 17658 19526 gene locus_tag LOCUS_07750 17658 19526 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412627.1 protein_id gnl|my_center|LOCUS_07750 19523 20548 gene locus_tag LOCUS_07760 19523 20548 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222471.1 protein_id gnl|my_center|LOCUS_07760 >Feature sequence030 <1 2607 gene locus_tag LOCUS_07770 <1 2607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391182.1:double-strand break repair protein AddB 2607 6056 gene locus_tag LOCUS_07780 gene addA 2607 6056 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_07780 6159 6479 gene locus_tag LOCUS_07790 gene trxA 6159 6479 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391180.1 protein_id gnl|my_center|LOCUS_07790 7955 6651 gene locus_tag LOCUS_07800 7955 6651 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383296.1 protein_id gnl|my_center|LOCUS_07800 8961 7981 gene locus_tag LOCUS_07810 gene accD 8961 7981 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528321.1 protein_id gnl|my_center|LOCUS_07810 9796 8975 gene locus_tag LOCUS_07820 gene trpA 9796 8975 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083570.1 protein_id gnl|my_center|LOCUS_07820 11019 9793 gene locus_tag LOCUS_07830 gene trpB 11019 9793 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970606.1 protein_id gnl|my_center|LOCUS_07830 11691 11041 gene locus_tag LOCUS_07840 11691 11041 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339435.1 protein_id gnl|my_center|LOCUS_07840 12395 11688 gene locus_tag LOCUS_07850 gene pyrF 12395 11688 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391171.1 protein_id gnl|my_center|LOCUS_07850 13330 12470 gene locus_tag LOCUS_07860 13330 12470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 13709 13374 gene locus_tag LOCUS_07870 13709 13374 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974237.1 protein_id gnl|my_center|LOCUS_07870 14039 13755 gene locus_tag LOCUS_07880 14039 13755 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008539997.1 protein_id gnl|my_center|LOCUS_07880 15033 14071 gene locus_tag LOCUS_07890 gene sppA 15033 14071 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529583.1 protein_id gnl|my_center|LOCUS_07890 16661 15042 gene locus_tag LOCUS_07900 gene rpsA 16661 15042 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027546860.1 protein_id gnl|my_center|LOCUS_07900 17609 16974 gene locus_tag LOCUS_07910 gene cmk 17609 16974 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255020.1 protein_id gnl|my_center|LOCUS_07910 18952 17612 gene locus_tag LOCUS_07920 gene aroA 18952 17612 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965151.1 protein_id gnl|my_center|LOCUS_07920 19150 19506 gene locus_tag LOCUS_07930 19150 19506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 19605 19680 gene locus_tag LOCUS_t00080 19605 19680 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 20511 19822 gene locus_tag LOCUS_07940 20511 19822 CDS product DUF1523 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563682.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence031 250 849 gene locus_tag LOCUS_07950 250 849 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532404.1 protein_id gnl|my_center|LOCUS_07950 1118 906 gene locus_tag LOCUS_07960 1118 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 1059 1637 gene locus_tag LOCUS_07970 gene ccmA 1059 1637 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083298.1 protein_id gnl|my_center|LOCUS_07970 1634 2302 gene locus_tag LOCUS_07980 gene ccmB 1634 2302 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529714.1 protein_id gnl|my_center|LOCUS_07980 2403 3995 gene locus_tag LOCUS_07990 gene purH 2403 3995 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721490.1 protein_id gnl|my_center|LOCUS_07990 4007 4738 gene locus_tag LOCUS_08000 gene trmD 4007 4738 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528859.1 protein_id gnl|my_center|LOCUS_08000 4802 5179 gene locus_tag LOCUS_08010 4802 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 5192 6589 gene locus_tag LOCUS_08020 gene leuC 5192 6589 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529677.1 protein_id gnl|my_center|LOCUS_08020 6621 6911 gene locus_tag LOCUS_08030 6621 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 7595 7377 gene locus_tag LOCUS_08040 7595 7377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 9507 7885 gene locus_tag LOCUS_08050 9507 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 10060 9524 gene locus_tag LOCUS_08060 10060 9524 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_08060 11233 10145 gene locus_tag LOCUS_08070 11233 10145 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_08070 11651 13633 gene locus_tag LOCUS_08080 11651 13633 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337373.1 protein_id gnl|my_center|LOCUS_08080 13630 14454 gene locus_tag LOCUS_08090 13630 14454 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566968.1 protein_id gnl|my_center|LOCUS_08090 14473 15369 gene locus_tag LOCUS_08100 14473 15369 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719438.1 protein_id gnl|my_center|LOCUS_08100 15373 16449 gene locus_tag LOCUS_08110 15373 16449 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719437.1 protein_id gnl|my_center|LOCUS_08110 16650 17960 gene locus_tag LOCUS_08120 16650 17960 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337371.1 protein_id gnl|my_center|LOCUS_08120 18060 18890 gene locus_tag LOCUS_08130 18060 18890 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719435.1 protein_id gnl|my_center|LOCUS_08130 18941 20173 gene locus_tag LOCUS_08140 18941 20173 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391251.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence032 358 762 gene locus_tag LOCUS_08150 358 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 978 1403 gene locus_tag LOCUS_08160 978 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 1762 1517 gene locus_tag LOCUS_08170 1762 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1940 7120 gene locus_tag LOCUS_08180 1940 7120 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 protein_id gnl|my_center|LOCUS_08180 7123 9888 gene locus_tag LOCUS_08190 7123 9888 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_08190 9891 13763 gene locus_tag LOCUS_08200 9891 13763 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_08200 13766 14896 gene locus_tag LOCUS_08210 13766 14896 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257686.1 protein_id gnl|my_center|LOCUS_08210 14893 15663 gene locus_tag LOCUS_08220 14893 15663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 16698 15664 gene locus_tag LOCUS_08230 16698 15664 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_08230 17560 18720 gene locus_tag LOCUS_08240 17560 18720 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240716.1 protein_id gnl|my_center|LOCUS_08240 19143 18976 gene locus_tag LOCUS_08250 19143 18976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence033 331 1221 gene locus_tag LOCUS_08260 331 1221 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393506.1 protein_id gnl|my_center|LOCUS_08260 1319 3856 gene locus_tag LOCUS_08270 1319 3856 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310719.1 protein_id gnl|my_center|LOCUS_08270 3853 4296 gene locus_tag LOCUS_08280 3853 4296 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310720.1 protein_id gnl|my_center|LOCUS_08280 5363 4701 gene locus_tag LOCUS_08290 5363 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 6355 5393 gene locus_tag LOCUS_08300 6355 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 6687 6442 gene locus_tag LOCUS_08310 gene rpsR 6687 6442 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203718.1 protein_id gnl|my_center|LOCUS_08310 7133 6684 gene locus_tag LOCUS_08320 gene rpsF 7133 6684 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314574.1 protein_id gnl|my_center|LOCUS_08320 8293 7391 gene locus_tag LOCUS_08330 8293 7391 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970702.1 protein_id gnl|my_center|LOCUS_08330 8518 9459 gene locus_tag LOCUS_08340 gene fabD 8518 9459 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974943.1 protein_id gnl|my_center|LOCUS_08340 9495 10232 gene locus_tag LOCUS_08350 gene fabG 9495 10232 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_08350 10469 10705 gene locus_tag LOCUS_08360 10469 10705 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203723.1 protein_id gnl|my_center|LOCUS_08360 10872 12137 gene locus_tag LOCUS_08370 gene fabF 10872 12137 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086859.1 protein_id gnl|my_center|LOCUS_08370 12192 13577 gene locus_tag LOCUS_08380 gene mltG 12192 13577 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213162067.1 protein_id gnl|my_center|LOCUS_08380 13693 14583 gene locus_tag LOCUS_08390 13693 14583 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086861.1 protein_id gnl|my_center|LOCUS_08390 14595 15230 gene locus_tag LOCUS_08400 gene gmk 14595 15230 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086862.1 protein_id gnl|my_center|LOCUS_08400 15256 15447 gene locus_tag LOCUS_08410 15256 15447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 16395 15451 gene locus_tag LOCUS_08420 16395 15451 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527944.1 protein_id gnl|my_center|LOCUS_08420 17320 16409 gene locus_tag LOCUS_08430 gene fmt 17320 16409 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338559.1 protein_id gnl|my_center|LOCUS_08430 17856 17320 gene locus_tag LOCUS_08440 gene def 17856 17320 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378195.1 protein_id gnl|my_center|LOCUS_08440 17998 19158 gene locus_tag LOCUS_08450 gene rmuC 17998 19158 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175976.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence034 244 1497 gene locus_tag LOCUS_08460 244 1497 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 protein_id gnl|my_center|LOCUS_08460 1673 2173 gene locus_tag LOCUS_08470 1673 2173 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_08470 2335 3792 gene locus_tag LOCUS_08480 gene guaB 2335 3792 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974584.1 protein_id gnl|my_center|LOCUS_08480 3841 4266 gene locus_tag LOCUS_08490 3841 4266 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378977.1 protein_id gnl|my_center|LOCUS_08490 4270 5595 gene locus_tag LOCUS_08500 4270 5595 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530369.1 protein_id gnl|my_center|LOCUS_08500 5606 7153 gene locus_tag LOCUS_08510 gene guaA 5606 7153 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388108.1 protein_id gnl|my_center|LOCUS_08510 7281 8969 gene locus_tag LOCUS_08520 7281 8969 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528118.1 protein_id gnl|my_center|LOCUS_08520 9841 9119 gene locus_tag LOCUS_08530 9841 9119 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_08530 11532 9844 gene locus_tag LOCUS_08540 11532 9844 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 protein_id gnl|my_center|LOCUS_08540 11762 13612 gene locus_tag LOCUS_08550 11762 13612 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975718.1 protein_id gnl|my_center|LOCUS_08550 13609 14967 gene locus_tag LOCUS_08560 13609 14967 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391769.1 protein_id gnl|my_center|LOCUS_08560 15242 16216 gene locus_tag LOCUS_08570 15242 16216 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256666.1 protein_id gnl|my_center|LOCUS_08570 16379 18106 gene locus_tag LOCUS_08580 16379 18106 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256665.1 protein_id gnl|my_center|LOCUS_08580 18297 18605 gene locus_tag LOCUS_08590 18297 18605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence035 <1 1207 gene locus_tag LOCUS_08600 <1 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393130.1:hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) 1244 2029 gene locus_tag LOCUS_08610 1244 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 2979 2035 gene locus_tag LOCUS_08620 2979 2035 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971111.1 protein_id gnl|my_center|LOCUS_08620 3085 3537 gene locus_tag LOCUS_08630 3085 3537 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971112.1 protein_id gnl|my_center|LOCUS_08630 3741 3965 gene locus_tag LOCUS_08640 gene tusA 3741 3965 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_08640 4972 4052 gene locus_tag LOCUS_08650 4972 4052 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262758.1 protein_id gnl|my_center|LOCUS_08650 5132 5938 gene locus_tag LOCUS_08660 5132 5938 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240527.1 protein_id gnl|my_center|LOCUS_08660 5928 6731 gene locus_tag LOCUS_08670 gene znuB 5928 6731 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240526.1 protein_id gnl|my_center|LOCUS_08670 6746 7153 gene locus_tag LOCUS_08680 6746 7153 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328657.1 protein_id gnl|my_center|LOCUS_08680 7574 7158 gene locus_tag LOCUS_08690 7574 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 10246 7643 gene locus_tag LOCUS_08700 10246 7643 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965129.1 protein_id gnl|my_center|LOCUS_08700 11890 10358 gene locus_tag LOCUS_08710 11890 10358 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028054343.1 protein_id gnl|my_center|LOCUS_08710 12790 11987 gene locus_tag LOCUS_08720 12790 11987 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529670.1 protein_id gnl|my_center|LOCUS_08720 12925 14109 gene locus_tag LOCUS_08730 gene recF 12925 14109 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527878.1 protein_id gnl|my_center|LOCUS_08730 14099 16522 gene locus_tag LOCUS_08740 gene gyrB 14099 16522 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390482.1 protein_id gnl|my_center|LOCUS_08740 16536 17021 gene locus_tag LOCUS_08750 16536 17021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 17121 18794 gene locus_tag LOCUS_08760 17121 18794 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337736.1 protein_id gnl|my_center|LOCUS_08760 >Feature sequence036 1117 374 gene locus_tag LOCUS_08770 1117 374 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975579.1 protein_id gnl|my_center|LOCUS_08770 2896 1208 gene locus_tag LOCUS_08780 gene soxB 2896 1208 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086299.1 protein_id gnl|my_center|LOCUS_08780 3130 2909 gene locus_tag LOCUS_08790 3130 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 4035 3226 gene locus_tag LOCUS_08800 gene soxA 4035 3226 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086298.1 protein_id gnl|my_center|LOCUS_08800 4424 4101 gene locus_tag LOCUS_08810 gene soxZ 4424 4101 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086297.1 protein_id gnl|my_center|LOCUS_08810 4928 4452 gene locus_tag LOCUS_08820 4928 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 5445 4987 gene locus_tag LOCUS_08830 gene soxX 5445 4987 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171929.1 protein_id gnl|my_center|LOCUS_08830 5934 6491 gene locus_tag LOCUS_08840 5934 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 6513 7487 gene locus_tag LOCUS_08850 6513 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 7652 8290 gene locus_tag LOCUS_08860 7652 8290 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818147.1 protein_id gnl|my_center|LOCUS_08860 8313 9617 gene locus_tag LOCUS_08870 8313 9617 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_08870 9752 10117 gene locus_tag LOCUS_08880 9752 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 10114 11382 gene locus_tag LOCUS_08890 10114 11382 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932694.1 protein_id gnl|my_center|LOCUS_08890 11796 11422 gene locus_tag LOCUS_08900 11796 11422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 12387 11944 gene locus_tag LOCUS_08910 12387 11944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 12725 13615 gene locus_tag LOCUS_08920 12725 13615 CDS product SLAC1 anion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788774.1 protein_id gnl|my_center|LOCUS_08920 14031 13693 gene locus_tag LOCUS_08930 14031 13693 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390365.1 protein_id gnl|my_center|LOCUS_08930 14316 14113 gene locus_tag LOCUS_08940 14316 14113 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941064.1 protein_id gnl|my_center|LOCUS_08940 14512 15531 gene locus_tag LOCUS_08950 14512 15531 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967177.1 protein_id gnl|my_center|LOCUS_08950 15528 18809 gene locus_tag LOCUS_08960 15528 18809 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088515.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence037 1669 575 gene locus_tag LOCUS_08970 gene mtnA 1669 575 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_08970 2088 1666 gene locus_tag LOCUS_08980 2088 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 2644 2117 gene locus_tag LOCUS_08990 2644 2117 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383583.1 protein_id gnl|my_center|LOCUS_08990 3611 2721 gene locus_tag LOCUS_09000 3611 2721 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083781.1 protein_id gnl|my_center|LOCUS_09000 4698 3814 gene locus_tag LOCUS_09010 4698 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09010 5952 4705 gene locus_tag LOCUS_09020 5952 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09020 6502 5969 gene locus_tag LOCUS_09030 gene petA 6502 5969 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388117.1 protein_id gnl|my_center|LOCUS_09030 6743 7204 gene locus_tag LOCUS_09040 6743 7204 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529977.1 protein_id gnl|my_center|LOCUS_09040 8495 7227 gene locus_tag LOCUS_09050 8495 7227 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529971.1 protein_id gnl|my_center|LOCUS_09050 8696 8517 gene locus_tag LOCUS_09060 8696 8517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 9285 8701 gene locus_tag LOCUS_09070 9285 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 9342 10331 gene locus_tag LOCUS_09080 9342 10331 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208414242.1 protein_id gnl|my_center|LOCUS_09080 10349 11257 gene locus_tag LOCUS_09090 10349 11257 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388123.1 protein_id gnl|my_center|LOCUS_09090 11257 14013 gene locus_tag LOCUS_09100 11257 14013 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085250.1 protein_id gnl|my_center|LOCUS_09100 14010 16079 gene locus_tag LOCUS_09110 14010 16079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018183745.1 protein_id gnl|my_center|LOCUS_09110 16602 16084 gene locus_tag LOCUS_09120 16602 16084 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090485.1 protein_id gnl|my_center|LOCUS_09120 17276 16806 gene locus_tag LOCUS_09130 17276 16806 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085245.1 protein_id gnl|my_center|LOCUS_09130 17348 17821 gene locus_tag LOCUS_09140 gene msrA 17348 17821 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390115.1 protein_id gnl|my_center|LOCUS_09140 17855 18994 gene locus_tag LOCUS_09150 gene yghO 17855 18994 CDS product protein YghO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305975.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence038 2271 1282 gene locus_tag LOCUS_09160 2271 1282 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396612.1 protein_id gnl|my_center|LOCUS_09160 4761 2287 gene locus_tag LOCUS_09170 4761 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 4930 5211 gene locus_tag LOCUS_09180 4930 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626221.1 protein_id gnl|my_center|LOCUS_09180 5314 5718 gene locus_tag LOCUS_09190 5314 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 5861 6181 gene locus_tag LOCUS_09200 5861 6181 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532979.1 protein_id gnl|my_center|LOCUS_09200 6255 7286 gene locus_tag LOCUS_09210 6255 7286 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531877.1 protein_id gnl|my_center|LOCUS_09210 7449 7724 gene locus_tag LOCUS_09220 7449 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 7822 8589 gene locus_tag LOCUS_09230 7822 8589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 8621 9244 gene locus_tag LOCUS_09240 8621 9244 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921310.1 protein_id gnl|my_center|LOCUS_09240 10122 9283 gene locus_tag LOCUS_09250 gene ppk2 10122 9283 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086042.1 protein_id gnl|my_center|LOCUS_09250 10779 10198 gene locus_tag LOCUS_09260 10779 10198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 11905 10871 gene locus_tag LOCUS_09270 11905 10871 CDS product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969485.1 protein_id gnl|my_center|LOCUS_09270 13353 11902 gene locus_tag LOCUS_09280 13353 11902 CDS product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240445.1 protein_id gnl|my_center|LOCUS_09280 13954 13424 gene locus_tag LOCUS_09290 13954 13424 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393763.1 protein_id gnl|my_center|LOCUS_09290 14705 14076 gene locus_tag LOCUS_09300 14705 14076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 15093 16466 gene locus_tag LOCUS_09310 15093 16466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 16614 18479 gene locus_tag LOCUS_09320 16614 18479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 >Feature sequence039 859 377 gene locus_tag LOCUS_09330 859 377 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967283.1 protein_id gnl|my_center|LOCUS_09330 2019 922 gene locus_tag LOCUS_09340 gene ychF 2019 922 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090173.1 protein_id gnl|my_center|LOCUS_09340 2901 2311 gene locus_tag LOCUS_09350 gene pth 2901 2311 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338521.1 protein_id gnl|my_center|LOCUS_09350 3640 3005 gene locus_tag LOCUS_09360 3640 3005 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529995.1 protein_id gnl|my_center|LOCUS_09360 4827 3880 gene locus_tag LOCUS_09370 4827 3880 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242730.1 protein_id gnl|my_center|LOCUS_09370 5945 4947 gene locus_tag LOCUS_09380 5945 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 7047 6094 gene locus_tag LOCUS_09390 7047 6094 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532109.1 protein_id gnl|my_center|LOCUS_09390 8111 7044 gene locus_tag LOCUS_09400 8111 7044 CDS product DUF1402 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170435.1 protein_id gnl|my_center|LOCUS_09400 9002 8226 gene locus_tag LOCUS_09410 gene pgeF 9002 8226 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976381.1 protein_id gnl|my_center|LOCUS_09410 10133 9027 gene locus_tag LOCUS_09420 10133 9027 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090179.1 protein_id gnl|my_center|LOCUS_09420 10932 10123 gene locus_tag LOCUS_09430 gene lgt 10932 10123 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388399.1 protein_id gnl|my_center|LOCUS_09430 11058 11357 gene locus_tag LOCUS_09440 11058 11357 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090176.1 protein_id gnl|my_center|LOCUS_09440 11602 12102 gene locus_tag LOCUS_09450 11602 12102 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174670.1 protein_id gnl|my_center|LOCUS_09450 12099 12920 gene locus_tag LOCUS_09460 gene proC 12099 12920 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969866.1 protein_id gnl|my_center|LOCUS_09460 12956 13297 gene locus_tag LOCUS_09470 12956 13297 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530010.1 protein_id gnl|my_center|LOCUS_09470 14772 13390 gene locus_tag LOCUS_09480 14772 13390 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090196.1 protein_id gnl|my_center|LOCUS_09480 15467 14775 gene locus_tag LOCUS_09490 15467 14775 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530014.1 protein_id gnl|my_center|LOCUS_09490 16024 15464 gene locus_tag LOCUS_09500 16024 15464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 16238 17074 gene locus_tag LOCUS_09510 16238 17074 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530016.1 protein_id gnl|my_center|LOCUS_09510 17083 17898 gene locus_tag LOCUS_09520 17083 17898 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391810.1 protein_id gnl|my_center|LOCUS_09520 18049 18543 gene locus_tag LOCUS_09530 gene tpx 18049 18543 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439256.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence040 1191 76 gene locus_tag LOCUS_09540 1191 76 CDS product DUF459 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529720.1 protein_id gnl|my_center|LOCUS_09540 1477 1824 gene locus_tag LOCUS_09550 gene cpdR1 1477 1824 CDS product response regulator CpdR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531148.1 protein_id gnl|my_center|LOCUS_09550 2617 1835 gene locus_tag LOCUS_09560 2617 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 3474 2614 gene locus_tag LOCUS_09570 3474 2614 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_09570 3862 3590 gene locus_tag LOCUS_09580 3862 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 4170 5765 gene locus_tag LOCUS_09590 4170 5765 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390109.1 protein_id gnl|my_center|LOCUS_09590 5811 6815 gene locus_tag LOCUS_09600 5811 6815 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527127.1 protein_id gnl|my_center|LOCUS_09600 6818 7729 gene locus_tag LOCUS_09610 6818 7729 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378916.1 protein_id gnl|my_center|LOCUS_09610 7726 8703 gene locus_tag LOCUS_09620 7726 8703 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390112.1 protein_id gnl|my_center|LOCUS_09620 8700 9671 gene locus_tag LOCUS_09630 8700 9671 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400031.1 protein_id gnl|my_center|LOCUS_09630 9724 11538 gene locus_tag LOCUS_09640 9724 11538 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086742.1 protein_id gnl|my_center|LOCUS_09640 11725 12801 gene locus_tag LOCUS_09650 11725 12801 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532971.1 protein_id gnl|my_center|LOCUS_09650 12876 14000 gene locus_tag LOCUS_09660 12876 14000 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_09660 14015 14881 gene locus_tag LOCUS_09670 14015 14881 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112953.1 protein_id gnl|my_center|LOCUS_09670 14878 15735 gene locus_tag LOCUS_09680 14878 15735 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257555.1 protein_id gnl|my_center|LOCUS_09680 15739 16593 gene locus_tag LOCUS_09690 15739 16593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 17713 16601 gene locus_tag LOCUS_09700 17713 16601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 17939 18139 gene locus_tag LOCUS_09710 17939 18139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 >Feature sequence041 1319 414 gene locus_tag LOCUS_09720 1319 414 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327684.1 protein_id gnl|my_center|LOCUS_09720 1809 1330 gene locus_tag LOCUS_09730 1809 1330 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073278.1 protein_id gnl|my_center|LOCUS_09730 2663 1857 gene locus_tag LOCUS_09740 2663 1857 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919036.1 protein_id gnl|my_center|LOCUS_09740 2873 3793 gene locus_tag LOCUS_09750 2873 3793 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085244.1 protein_id gnl|my_center|LOCUS_09750 3840 5069 gene locus_tag LOCUS_09760 3840 5069 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919040.1 protein_id gnl|my_center|LOCUS_09760 5066 6139 gene locus_tag LOCUS_09770 gene lptG 5066 6139 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537773.1 protein_id gnl|my_center|LOCUS_09770 6148 7296 gene locus_tag LOCUS_09780 6148 7296 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919043.1 protein_id gnl|my_center|LOCUS_09780 7293 8243 gene locus_tag LOCUS_09790 7293 8243 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919044.1 protein_id gnl|my_center|LOCUS_09790 8250 9224 gene locus_tag LOCUS_09800 8250 9224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640162.1 protein_id gnl|my_center|LOCUS_09800 9425 9904 gene locus_tag LOCUS_09810 9425 9904 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941579.1 protein_id gnl|my_center|LOCUS_09810 9921 11768 gene locus_tag LOCUS_09820 9921 11768 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_09820 11843 13087 gene locus_tag LOCUS_09830 11843 13087 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812847.1 protein_id gnl|my_center|LOCUS_09830 13101 13352 gene locus_tag LOCUS_09840 13101 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 13393 13659 gene locus_tag LOCUS_09850 13393 13659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 13745 14956 gene locus_tag LOCUS_09860 13745 14956 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085234.1 protein_id gnl|my_center|LOCUS_09860 15597 15884 gene locus_tag LOCUS_09870 15597 15884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 >Feature sequence042 771 163 gene locus_tag LOCUS_09880 gene fixJ 771 163 CDS product response regulator FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085544.1 protein_id gnl|my_center|LOCUS_09880 4960 842 gene locus_tag LOCUS_09890 4960 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 5263 5475 gene locus_tag LOCUS_09900 5263 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 6490 5723 gene locus_tag LOCUS_09910 6490 5723 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896965.1 protein_id gnl|my_center|LOCUS_09910 8204 6483 gene locus_tag LOCUS_09920 8204 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 9582 8524 gene locus_tag LOCUS_09930 gene rsgA 9582 8524 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121027127.1 protein_id gnl|my_center|LOCUS_09930 10290 9970 gene locus_tag LOCUS_09940 10290 9970 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459007.1 protein_id gnl|my_center|LOCUS_09940 10760 10497 gene locus_tag LOCUS_09950 10760 10497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 12591 10789 gene locus_tag LOCUS_09960 12591 10789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 14271 12700 gene locus_tag LOCUS_09970 14271 12700 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403632.1 protein_id gnl|my_center|LOCUS_09970 14389 14405 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14583 17153 gene locus_tag LOCUS_09980 14583 17153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence043 1868 2101 gene locus_tag LOCUS_09990 1868 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 2106 2279 gene locus_tag LOCUS_10000 2106 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 3253 2378 gene locus_tag LOCUS_10010 3253 2378 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089328.1 protein_id gnl|my_center|LOCUS_10010 5578 3317 gene locus_tag LOCUS_10020 5578 3317 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972026.1 protein_id gnl|my_center|LOCUS_10020 5831 6688 gene locus_tag LOCUS_10030 5831 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 8448 6814 gene locus_tag LOCUS_10040 8448 6814 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389287.1 protein_id gnl|my_center|LOCUS_10040 8771 10180 gene locus_tag LOCUS_10050 8771 10180 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626100.1 protein_id gnl|my_center|LOCUS_10050 10345 13758 gene locus_tag LOCUS_10060 10345 13758 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531011.1 protein_id gnl|my_center|LOCUS_10060 14410 13760 gene locus_tag LOCUS_10070 14410 13760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 15552 14446 gene locus_tag LOCUS_10080 15552 14446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 16009 15773 gene locus_tag LOCUS_10090 16009 15773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 17400 16009 gene locus_tag LOCUS_10100 gene fumC 17400 16009 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337260.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence044 1163 495 gene locus_tag LOCUS_10110 1163 495 CDS product sulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528050.1 protein_id gnl|my_center|LOCUS_10110 1592 2578 gene locus_tag LOCUS_10120 1592 2578 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625876.1 protein_id gnl|my_center|LOCUS_10120 2688 3188 gene locus_tag LOCUS_10130 2688 3188 CDS product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135176341.1 protein_id gnl|my_center|LOCUS_10130 3622 4119 gene locus_tag LOCUS_10140 3622 4119 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_10140 4441 4229 gene locus_tag LOCUS_10150 4441 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 5367 4438 gene locus_tag LOCUS_10160 5367 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 5772 7028 gene locus_tag LOCUS_10170 gene dsrA 5772 7028 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_10170 7069 8148 gene locus_tag LOCUS_10180 gene dsrB 7069 8148 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_10180 8276 8635 gene locus_tag LOCUS_10190 gene tusD 8276 8635 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932536.1 protein_id gnl|my_center|LOCUS_10190 8655 9095 gene locus_tag LOCUS_10200 8655 9095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 9130 9426 gene locus_tag LOCUS_10210 gene tusB 9130 9426 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_10210 9470 9802 gene locus_tag LOCUS_10220 9470 9802 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_10220 9920 10681 gene locus_tag LOCUS_10230 gene dsrM 9920 10681 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544992.1 protein_id gnl|my_center|LOCUS_10230 10693 12189 gene locus_tag LOCUS_10240 10693 12189 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_10240 12241 14169 gene locus_tag LOCUS_10250 12241 14169 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932535.1 protein_id gnl|my_center|LOCUS_10250 14185 14661 gene locus_tag LOCUS_10260 14185 14661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 14658 15401 gene locus_tag LOCUS_10270 gene hmeA 14658 15401 CDS product Hdr-like menaquinol oxidoreductase iron-sulfur subunit HmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878006.1 protein_id gnl|my_center|LOCUS_10270 15412 16608 gene locus_tag LOCUS_10280 gene hmeB 15412 16608 CDS product Hdr-like menaquinol oxidoreductase integral membrane subunit HmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_10280 16674 17039 gene locus_tag LOCUS_10290 16674 17039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence045 180 1487 gene locus_tag LOCUS_10300 gene purB 180 1487 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975647.1 protein_id gnl|my_center|LOCUS_10300 1819 1433 gene locus_tag LOCUS_10310 1819 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 2085 1888 gene locus_tag LOCUS_10320 2085 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 2346 2717 gene locus_tag LOCUS_10330 2346 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 3073 3999 gene locus_tag LOCUS_10340 3073 3999 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087855.1 protein_id gnl|my_center|LOCUS_10340 4135 5103 gene locus_tag LOCUS_10350 4135 5103 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087859.1 protein_id gnl|my_center|LOCUS_10350 5103 6410 gene locus_tag LOCUS_10360 5103 6410 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171586.1 protein_id gnl|my_center|LOCUS_10360 6471 7079 gene locus_tag LOCUS_10370 gene plsY 6471 7079 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087861.1 protein_id gnl|my_center|LOCUS_10370 7076 8185 gene locus_tag LOCUS_10380 gene dprA 7076 8185 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531797.1 protein_id gnl|my_center|LOCUS_10380 9057 8500 gene locus_tag LOCUS_10390 9057 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 9462 9169 gene locus_tag LOCUS_10400 gene ihfA 9462 9169 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719760.1 protein_id gnl|my_center|LOCUS_10400 10551 9574 gene locus_tag LOCUS_10410 10551 9574 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087781.1 protein_id gnl|my_center|LOCUS_10410 11648 10548 gene locus_tag LOCUS_10420 gene plsX 11648 10548 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975024.1 protein_id gnl|my_center|LOCUS_10420 12318 11746 gene locus_tag LOCUS_10430 12318 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 12857 12315 gene locus_tag LOCUS_10440 12857 12315 CDS product ubiquinol-cytochrome C chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919243.1 protein_id gnl|my_center|LOCUS_10440 12960 13463 gene locus_tag LOCUS_10450 gene bamE 12960 13463 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171637.1 protein_id gnl|my_center|LOCUS_10450 14245 13526 gene locus_tag LOCUS_10460 14245 13526 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304053.1 protein_id gnl|my_center|LOCUS_10460 14327 15172 gene locus_tag LOCUS_10470 14327 15172 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970367.1 protein_id gnl|my_center|LOCUS_10470 15200 15775 gene locus_tag LOCUS_10480 15200 15775 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339294.1 protein_id gnl|my_center|LOCUS_10480 15860 16531 gene locus_tag LOCUS_10490 15860 16531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence046 1063 707 gene locus_tag LOCUS_10500 gene flaF 1063 707 CDS product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008554779.1 protein_id gnl|my_center|LOCUS_10500 1439 1014 gene locus_tag LOCUS_10510 gene flbT 1439 1014 CDS product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088588.1 protein_id gnl|my_center|LOCUS_10510 2679 1543 gene locus_tag LOCUS_10520 2679 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 3789 2743 gene locus_tag LOCUS_10530 3789 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 4522 4094 gene locus_tag LOCUS_10540 4522 4094 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943643.1 protein_id gnl|my_center|LOCUS_10540 5214 4747 gene locus_tag LOCUS_10550 5214 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 5516 5211 gene locus_tag LOCUS_10560 5516 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 6658 5516 gene locus_tag LOCUS_10570 6658 5516 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173283.1 protein_id gnl|my_center|LOCUS_10570 7023 7328 gene locus_tag LOCUS_10580 7023 7328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 7572 7937 gene locus_tag LOCUS_10590 gene dksA 7572 7937 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531862.1 protein_id gnl|my_center|LOCUS_10590 8794 8051 gene locus_tag LOCUS_10600 gene flgH 8794 8051 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088573.1 protein_id gnl|my_center|LOCUS_10600 9844 8798 gene locus_tag LOCUS_10610 gene flgA 9844 8798 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390471.1 protein_id gnl|my_center|LOCUS_10610 10645 9857 gene locus_tag LOCUS_10620 gene flgG 10645 9857 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390470.1 protein_id gnl|my_center|LOCUS_10620 11443 10667 gene locus_tag LOCUS_10630 gene flgF 11443 10667 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390469.1 protein_id gnl|my_center|LOCUS_10630 11687 12217 gene locus_tag LOCUS_10640 11687 12217 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626461.1 protein_id gnl|my_center|LOCUS_10640 12232 13488 gene locus_tag LOCUS_10650 gene fliM 12232 13488 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640397.1 protein_id gnl|my_center|LOCUS_10650 13485 14126 gene locus_tag LOCUS_10660 13485 14126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 14157 14888 gene locus_tag LOCUS_10670 14157 14888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence047 859 1149 gene locus_tag LOCUS_10680 859 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1146 1337 gene locus_tag LOCUS_10690 1146 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 8983 1856 gene locus_tag LOCUS_10700 8983 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 15825 8995 gene locus_tag LOCUS_10710 15825 8995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 >Feature sequence048 480 1 gene locus_tag LOCUS_10720 480 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 739 1245 gene locus_tag LOCUS_10730 739 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10730 1371 2069 gene locus_tag LOCUS_10740 1371 2069 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480275.1 protein_id gnl|my_center|LOCUS_10740 2062 2352 gene locus_tag LOCUS_10750 2062 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 3242 2394 gene locus_tag LOCUS_10760 3242 2394 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200879.1 protein_id gnl|my_center|LOCUS_10760 3602 3261 gene locus_tag LOCUS_10770 3602 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 5023 3752 gene locus_tag LOCUS_10780 5023 3752 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_10780 6366 5341 gene locus_tag LOCUS_10790 gene ilvC 6366 5341 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089237.1 protein_id gnl|my_center|LOCUS_10790 6967 6455 gene locus_tag LOCUS_10800 gene ilvN 6967 6455 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507555.1 protein_id gnl|my_center|LOCUS_10800 8719 6980 gene locus_tag LOCUS_10810 8719 6980 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386810.1 protein_id gnl|my_center|LOCUS_10810 9769 8906 gene locus_tag LOCUS_10820 gene miaA 9769 8906 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972016.1 protein_id gnl|my_center|LOCUS_10820 9859 10749 gene locus_tag LOCUS_10830 gene serB 9859 10749 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402824.1 protein_id gnl|my_center|LOCUS_10830 12317 10788 gene locus_tag LOCUS_10840 12317 10788 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531033.1 protein_id gnl|my_center|LOCUS_10840 12615 12421 gene locus_tag LOCUS_10850 12615 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 13527 12622 gene locus_tag LOCUS_10860 gene hflC 13527 12622 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390051.1 protein_id gnl|my_center|LOCUS_10860 14654 13527 gene locus_tag LOCUS_10870 gene hflK 14654 13527 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 protein_id gnl|my_center|LOCUS_10870 15266 14763 gene locus_tag LOCUS_10880 15266 14763 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008593045.1 protein_id gnl|my_center|LOCUS_10880 16110 15271 gene locus_tag LOCUS_10890 16110 15271 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089252.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence049 1604 366 gene locus_tag LOCUS_10900 1604 366 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087357.1 protein_id gnl|my_center|LOCUS_10900 4945 5402 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggctcgaaggtgcatattccgcg 5573 6784 gene locus_tag LOCUS_10910 5573 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 7962 6838 gene locus_tag LOCUS_10920 7962 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 8270 9214 gene locus_tag LOCUS_10930 8270 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 9326 10462 gene locus_tag LOCUS_10940 9326 10462 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173681.1 protein_id gnl|my_center|LOCUS_10940 10502 11155 gene locus_tag LOCUS_10950 gene tmk 10502 11155 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919690.1 protein_id gnl|my_center|LOCUS_10950 11152 12258 gene locus_tag LOCUS_10960 11152 12258 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338405.1 protein_id gnl|my_center|LOCUS_10960 12280 13836 gene locus_tag LOCUS_10970 gene metG 12280 13836 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097532087.1 protein_id gnl|my_center|LOCUS_10970 13829 14638 gene locus_tag LOCUS_10980 13829 14638 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389390.1 protein_id gnl|my_center|LOCUS_10980 14640 15449 gene locus_tag LOCUS_10990 14640 15449 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338407.1 protein_id gnl|my_center|LOCUS_10990 15527 16324 gene locus_tag LOCUS_11000 gene mazG 15527 16324 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531500.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence050 1022 2686 gene locus_tag LOCUS_11010 gene fliF 1022 2686 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089736.1 protein_id gnl|my_center|LOCUS_11010 2697 3740 gene locus_tag LOCUS_11020 gene fliG 2697 3740 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089737.1 protein_id gnl|my_center|LOCUS_11020 3784 4476 gene locus_tag LOCUS_11030 3784 4476 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089738.1 protein_id gnl|my_center|LOCUS_11030 4476 4826 gene locus_tag LOCUS_11040 gene fliN 4476 4826 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388300.1 protein_id gnl|my_center|LOCUS_11040 4837 6219 gene locus_tag LOCUS_11050 4837 6219 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089740.1 protein_id gnl|my_center|LOCUS_11050 6259 8415 gene locus_tag LOCUS_11060 gene flhA 6259 8415 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966504.1 protein_id gnl|my_center|LOCUS_11060 8464 9564 gene locus_tag LOCUS_11070 8464 9564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 9561 10403 gene locus_tag LOCUS_11080 9561 10403 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440322.1 protein_id gnl|my_center|LOCUS_11080 10941 10456 gene locus_tag LOCUS_11090 10941 10456 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_11090 11464 11042 gene locus_tag LOCUS_11100 gene fliJ 11464 11042 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084990.1 protein_id gnl|my_center|LOCUS_11100 12806 11466 gene locus_tag LOCUS_11110 gene fliI 12806 11466 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084989.1 protein_id gnl|my_center|LOCUS_11110 13160 13867 gene locus_tag LOCUS_11120 gene ctrA 13160 13867 CDS product cell cycle two-component system response regulator CtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203583.1 protein_id gnl|my_center|LOCUS_11120 14960 13965 gene locus_tag LOCUS_11130 14960 13965 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083222.1 protein_id gnl|my_center|LOCUS_11130 16108 14960 gene locus_tag LOCUS_11140 16108 14960 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084984.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence051 1777 659 gene locus_tag LOCUS_11150 gene dnaN 1777 659 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970806.1 protein_id gnl|my_center|LOCUS_11150 3360 1918 gene locus_tag LOCUS_11160 gene dnaA 3360 1918 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083652.1 protein_id gnl|my_center|LOCUS_11160 4390 4121 gene locus_tag LOCUS_11170 gene rpsT 4390 4121 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241581.1 protein_id gnl|my_center|LOCUS_11170 5308 4535 gene locus_tag LOCUS_11180 5308 4535 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 protein_id gnl|my_center|LOCUS_11180 6300 5464 gene locus_tag LOCUS_11190 gene mutM 6300 5464 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338891.1 protein_id gnl|my_center|LOCUS_11190 6449 7225 gene locus_tag LOCUS_11200 gene ubiE 6449 7225 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529624.1 protein_id gnl|my_center|LOCUS_11200 7232 8836 gene locus_tag LOCUS_11210 gene ubiB 7232 8836 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083583.1 protein_id gnl|my_center|LOCUS_11210 9523 8867 gene locus_tag LOCUS_11220 9523 8867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 9755 10156 gene locus_tag LOCUS_11230 9755 10156 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003505374.1 protein_id gnl|my_center|LOCUS_11230 10159 10464 gene locus_tag LOCUS_11240 10159 10464 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090869.1 protein_id gnl|my_center|LOCUS_11240 10607 12007 gene locus_tag LOCUS_11250 gene ahcY 10607 12007 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391191.1 protein_id gnl|my_center|LOCUS_11250 12111 14597 gene locus_tag LOCUS_11260 12111 14597 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528331.1 protein_id gnl|my_center|LOCUS_11260 14621 16108 gene locus_tag LOCUS_11270 14621 16108 CDS product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528330.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence052 2229 1327 gene locus_tag LOCUS_11280 2229 1327 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390704.1 protein_id gnl|my_center|LOCUS_11280 3094 2396 gene locus_tag LOCUS_11290 3094 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 3539 3156 gene locus_tag LOCUS_11300 3539 3156 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008567674.1 protein_id gnl|my_center|LOCUS_11300 3806 4222 gene locus_tag LOCUS_11310 3806 4222 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 protein_id gnl|my_center|LOCUS_11310 4319 5329 gene locus_tag LOCUS_11320 4319 5329 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337390.1 protein_id gnl|my_center|LOCUS_11320 5490 8393 gene locus_tag LOCUS_11330 gene ileS 5490 8393 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532360.1 protein_id gnl|my_center|LOCUS_11330 8394 8918 gene locus_tag LOCUS_11340 gene lspA 8394 8918 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174654.1 protein_id gnl|my_center|LOCUS_11340 9113 9694 gene locus_tag LOCUS_11350 9113 9694 CDS product DUF3035 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390716.1 protein_id gnl|my_center|LOCUS_11350 10039 11334 gene locus_tag LOCUS_11360 10039 11334 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857633.1 protein_id gnl|my_center|LOCUS_11360 11406 12668 gene locus_tag LOCUS_11370 11406 12668 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967298.1 protein_id gnl|my_center|LOCUS_11370 14186 12696 gene locus_tag LOCUS_11380 14186 12696 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389429.1 protein_id gnl|my_center|LOCUS_11380 15923 14412 gene locus_tag LOCUS_11390 15923 14412 CDS product pilus assembly protein TadG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099864694.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence053 583 14 gene locus_tag LOCUS_11400 583 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1805 573 gene locus_tag LOCUS_11410 1805 573 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463760.1 protein_id gnl|my_center|LOCUS_11410 2532 2056 gene locus_tag LOCUS_11420 2532 2056 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532169.1 protein_id gnl|my_center|LOCUS_11420 2736 6305 gene locus_tag LOCUS_11430 2736 6305 CDS product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171255.1 protein_id gnl|my_center|LOCUS_11430 7570 6317 gene locus_tag LOCUS_11440 gene tyrS 7570 6317 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265745.1 protein_id gnl|my_center|LOCUS_11440 7742 8866 gene locus_tag LOCUS_11450 7742 8866 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087104.1 protein_id gnl|my_center|LOCUS_11450 9505 8876 gene locus_tag LOCUS_11460 9505 8876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 9751 10803 gene locus_tag LOCUS_11470 gene moaA 9751 10803 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072642813.1 protein_id gnl|my_center|LOCUS_11470 11145 10822 gene locus_tag LOCUS_11480 11145 10822 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877119.1 protein_id gnl|my_center|LOCUS_11480 11184 11951 gene locus_tag LOCUS_11490 11184 11951 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919103.1 protein_id gnl|my_center|LOCUS_11490 12183 12716 gene locus_tag LOCUS_11500 12183 12716 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_11500 12750 13283 gene locus_tag LOCUS_11510 12750 13283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265683.1 protein_id gnl|my_center|LOCUS_11510 13601 13314 gene locus_tag LOCUS_11520 13601 13314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 14265 13576 gene locus_tag LOCUS_11530 14265 13576 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090916.1 protein_id gnl|my_center|LOCUS_11530 >Feature sequence054 <1 4052 gene locus_tag LOCUS_11540 <1 4052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090718.1:NAD-glutamate dehydrogenase 5231 4116 gene locus_tag LOCUS_11550 5231 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 6086 5484 gene locus_tag LOCUS_11560 6086 5484 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561934.1 protein_id gnl|my_center|LOCUS_11560 7378 6083 gene locus_tag LOCUS_11570 7378 6083 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258038.1 protein_id gnl|my_center|LOCUS_11570 8504 7371 gene locus_tag LOCUS_11580 gene proB 8504 7371 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083260.1 protein_id gnl|my_center|LOCUS_11580 9541 8501 gene locus_tag LOCUS_11590 gene obgE 9541 8501 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242500.1 protein_id gnl|my_center|LOCUS_11590 9791 9573 gene locus_tag LOCUS_11600 9791 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 10204 9938 gene locus_tag LOCUS_11610 gene rpmA 10204 9938 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003492686.1 protein_id gnl|my_center|LOCUS_11610 10857 10222 gene locus_tag LOCUS_11620 10857 10222 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529062.1 protein_id gnl|my_center|LOCUS_11620 11137 11760 gene locus_tag LOCUS_11630 11137 11760 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929111.1 protein_id gnl|my_center|LOCUS_11630 11833 13155 gene locus_tag LOCUS_11640 11833 13155 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064652.1 protein_id gnl|my_center|LOCUS_11640 13177 13887 gene locus_tag LOCUS_11650 13177 13887 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404948.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence055 1190 198 gene locus_tag LOCUS_11660 1190 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941917.1 protein_id gnl|my_center|LOCUS_11660 1879 1187 gene locus_tag LOCUS_11670 1879 1187 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941916.1 protein_id gnl|my_center|LOCUS_11670 3024 1876 gene locus_tag LOCUS_11680 3024 1876 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941915.1 protein_id gnl|my_center|LOCUS_11680 3350 3021 gene locus_tag LOCUS_11690 3350 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941914.1 protein_id gnl|my_center|LOCUS_11690 3907 3347 gene locus_tag LOCUS_11700 3907 3347 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941913.1 protein_id gnl|my_center|LOCUS_11700 4562 4026 gene locus_tag LOCUS_11710 4562 4026 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941458.1 protein_id gnl|my_center|LOCUS_11710 5143 4754 gene locus_tag LOCUS_11720 5143 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 5887 5300 gene locus_tag LOCUS_11730 5887 5300 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_11730 8057 6048 gene locus_tag LOCUS_11740 8057 6048 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530081.1 protein_id gnl|my_center|LOCUS_11740 8405 8749 gene locus_tag LOCUS_11750 8405 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 9269 8772 gene locus_tag LOCUS_11760 9269 8772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 9449 10339 gene locus_tag LOCUS_11770 9449 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 10926 10381 gene locus_tag LOCUS_11780 10926 10381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 12495 11293 gene locus_tag LOCUS_11790 12495 11293 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919408.1 protein_id gnl|my_center|LOCUS_11790 12770 13093 gene locus_tag LOCUS_11800 12770 13093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 13375 13160 gene locus_tag LOCUS_11810 13375 13160 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530020.1 protein_id gnl|my_center|LOCUS_11810 15056 13626 gene locus_tag LOCUS_11820 15056 13626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence056 2348 654 gene locus_tag LOCUS_11830 2348 654 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 protein_id gnl|my_center|LOCUS_11830 3445 2411 gene locus_tag LOCUS_11840 3445 2411 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974534.1 protein_id gnl|my_center|LOCUS_11840 3579 4070 gene locus_tag LOCUS_11850 3579 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 4538 4173 gene locus_tag LOCUS_11860 4538 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 4689 7076 gene locus_tag LOCUS_11870 4689 7076 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389032.1 protein_id gnl|my_center|LOCUS_11870 7791 7084 gene locus_tag LOCUS_11880 7791 7084 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626143.1 protein_id gnl|my_center|LOCUS_11880 7957 9135 gene locus_tag LOCUS_11890 gene torC 7957 9135 CDS product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389038.1 protein_id gnl|my_center|LOCUS_11890 9128 9811 gene locus_tag LOCUS_11900 gene torD 9128 9811 CDS product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983166.1 protein_id gnl|my_center|LOCUS_11900 9980 12445 gene locus_tag LOCUS_11910 gene torA 9980 12445 CDS product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389042.1 protein_id gnl|my_center|LOCUS_11910 12529 13212 gene locus_tag LOCUS_11920 12529 13212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 14022 13162 gene locus_tag LOCUS_11930 14022 13162 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142947.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence057 368 2167 gene locus_tag LOCUS_11940 gene mutL 368 2167 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390696.1 protein_id gnl|my_center|LOCUS_11940 2656 2177 gene locus_tag LOCUS_11950 2656 2177 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507846.1 protein_id gnl|my_center|LOCUS_11950 2857 3315 gene locus_tag LOCUS_11960 2857 3315 CDS product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918808.1 protein_id gnl|my_center|LOCUS_11960 3385 4173 gene locus_tag LOCUS_11970 3385 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528661.1 protein_id gnl|my_center|LOCUS_11970 4816 4205 gene locus_tag LOCUS_11980 4816 4205 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_11980 4921 5397 gene locus_tag LOCUS_11990 4921 5397 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928801.1 protein_id gnl|my_center|LOCUS_11990 5526 5723 gene locus_tag LOCUS_12000 gene rpmI 5526 5723 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383043.1 protein_id gnl|my_center|LOCUS_12000 5752 6108 gene locus_tag LOCUS_12010 gene rplT 5752 6108 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131615061.1 protein_id gnl|my_center|LOCUS_12010 6236 7318 gene locus_tag LOCUS_12020 gene pheS 6236 7318 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083532.1 protein_id gnl|my_center|LOCUS_12020 7315 9729 gene locus_tag LOCUS_12030 gene pheT 7315 9729 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083531.1 protein_id gnl|my_center|LOCUS_12030 10765 10352 gene locus_tag LOCUS_12040 gene mscL 10765 10352 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932912.1 protein_id gnl|my_center|LOCUS_12040 10977 14492 gene locus_tag LOCUS_12050 10977 14492 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084017.1 protein_id gnl|my_center|LOCUS_12050 >Feature sequence058 3 215 gene locus_tag LOCUS_12060 3 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 387 1277 gene locus_tag LOCUS_12070 387 1277 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310189.1 protein_id gnl|my_center|LOCUS_12070 3573 1297 gene locus_tag LOCUS_12080 3573 1297 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327060.1 protein_id gnl|my_center|LOCUS_12080 3795 3719 gene locus_tag LOCUS_t00090 3795 3719 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4011 5051 gene locus_tag LOCUS_12090 4011 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 6927 5086 gene locus_tag LOCUS_12100 6927 5086 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391425.1 protein_id gnl|my_center|LOCUS_12100 7092 6931 gene locus_tag LOCUS_12110 7092 6931 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887299.1 protein_id gnl|my_center|LOCUS_12110 7572 7099 gene locus_tag LOCUS_12120 7572 7099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 8225 7638 gene locus_tag LOCUS_12130 8225 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 8415 8924 gene locus_tag LOCUS_12140 8415 8924 CDS product ActR/PrrA/RegA family redox response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528072.1 protein_id gnl|my_center|LOCUS_12140 10368 9076 gene locus_tag LOCUS_12150 10368 9076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 10589 10383 gene locus_tag LOCUS_12160 10589 10383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 11161 10718 gene locus_tag LOCUS_12170 11161 10718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 11303 12244 gene locus_tag LOCUS_12180 11303 12244 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013484.1 protein_id gnl|my_center|LOCUS_12180 14328 12262 gene locus_tag LOCUS_12190 14328 12262 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399723.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence059 2140 746 gene locus_tag LOCUS_12200 2140 746 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 protein_id gnl|my_center|LOCUS_12200 3081 2413 gene locus_tag LOCUS_12210 3081 2413 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085905.1 protein_id gnl|my_center|LOCUS_12210 3752 3249 gene locus_tag LOCUS_12220 3752 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 4309 3863 gene locus_tag LOCUS_12230 4309 3863 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974829.1 protein_id gnl|my_center|LOCUS_12230 4458 6770 gene locus_tag LOCUS_12240 4458 6770 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532650.1 protein_id gnl|my_center|LOCUS_12240 6999 7577 gene locus_tag LOCUS_12250 6999 7577 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064537.1 protein_id gnl|my_center|LOCUS_12250 7574 8098 gene locus_tag LOCUS_12260 7574 8098 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532652.1 protein_id gnl|my_center|LOCUS_12260 8912 8112 gene locus_tag LOCUS_12270 8912 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 9179 8976 gene locus_tag LOCUS_12280 9179 8976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 10195 9305 gene locus_tag LOCUS_12290 10195 9305 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721079.1 protein_id gnl|my_center|LOCUS_12290 12029 10251 gene locus_tag LOCUS_12300 12029 10251 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085855.1 protein_id gnl|my_center|LOCUS_12300 12642 13142 gene locus_tag LOCUS_12310 12642 13142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 13448 13840 gene locus_tag LOCUS_12320 13448 13840 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085853.1 protein_id gnl|my_center|LOCUS_12320 14293 13883 gene locus_tag LOCUS_12330 14293 13883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence060 4209 1246 gene locus_tag LOCUS_12340 4209 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 7849 4436 gene locus_tag LOCUS_12350 7849 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 9520 8078 gene locus_tag LOCUS_12360 gene terL 9520 8078 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399999.1 protein_id gnl|my_center|LOCUS_12360 9951 9517 gene locus_tag LOCUS_12370 9951 9517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 11309 9948 gene locus_tag LOCUS_12380 11309 9948 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_12380 11966 12172 gene locus_tag LOCUS_12390 11966 12172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 12169 12585 gene locus_tag LOCUS_12400 12169 12585 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_12400 12582 14222 gene locus_tag LOCUS_12410 12582 14222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 14506 14430 gene locus_tag LOCUS_t00100 14506 14430 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence061 105 845 gene locus_tag LOCUS_12420 105 845 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_12420 842 1657 gene locus_tag LOCUS_12430 842 1657 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_12430 1654 2004 gene locus_tag LOCUS_12440 1654 2004 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_12440 2001 2447 gene locus_tag LOCUS_12450 2001 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 3522 2596 gene locus_tag LOCUS_12460 3522 2596 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_12460 3658 5043 gene locus_tag LOCUS_12470 3658 5043 CDS product ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339170.1 protein_id gnl|my_center|LOCUS_12470 5145 5960 gene locus_tag LOCUS_12480 5145 5960 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967671.1 protein_id gnl|my_center|LOCUS_12480 5998 8244 gene locus_tag LOCUS_12490 5998 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 8407 9081 gene locus_tag LOCUS_12500 8407 9081 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933360.1 protein_id gnl|my_center|LOCUS_12500 10268 9540 gene locus_tag LOCUS_12510 10268 9540 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719573.1 protein_id gnl|my_center|LOCUS_12510 11109 10300 gene locus_tag LOCUS_12520 11109 10300 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337475.1 protein_id gnl|my_center|LOCUS_12520 12060 11113 gene locus_tag LOCUS_12530 12060 11113 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719571.1 protein_id gnl|my_center|LOCUS_12530 13456 12065 gene locus_tag LOCUS_12540 13456 12065 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670024.1 protein_id gnl|my_center|LOCUS_12540 14413 13994 gene locus_tag LOCUS_12550 gene gloA 14413 13994 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence062 1874 669 gene locus_tag LOCUS_12560 1874 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 3563 1878 gene locus_tag LOCUS_12570 3563 1878 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087605.1 protein_id gnl|my_center|LOCUS_12570 4010 4867 gene locus_tag LOCUS_12580 4010 4867 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336969.1 protein_id gnl|my_center|LOCUS_12580 5716 4859 gene locus_tag LOCUS_12590 5716 4859 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742057.1 protein_id gnl|my_center|LOCUS_12590 6805 5933 gene locus_tag LOCUS_12600 6805 5933 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_12600 9278 6831 gene locus_tag LOCUS_12610 9278 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 9713 10627 gene locus_tag LOCUS_12620 gene ppk2 9713 10627 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852184.1 protein_id gnl|my_center|LOCUS_12620 11621 10617 gene locus_tag LOCUS_12630 gene cobD 11621 10617 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338490.1 protein_id gnl|my_center|LOCUS_12630 11922 12989 gene locus_tag LOCUS_12640 11922 12989 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089235.1 protein_id gnl|my_center|LOCUS_12640 13074 13163 gene locus_tag LOCUS_t00110 13074 13163 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 <14354 13197 gene locus_tag LOCUS_12650 <14354 13197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257831.1:class I SAM-dependent methyltransferase >Feature sequence063 3504 4835 gene locus_tag LOCUS_12660 3504 4835 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919797.1 protein_id gnl|my_center|LOCUS_12660 4840 6105 gene locus_tag LOCUS_12670 4840 6105 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087643.1 protein_id gnl|my_center|LOCUS_12670 6102 6809 gene locus_tag LOCUS_12680 6102 6809 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312688.1 protein_id gnl|my_center|LOCUS_12680 9046 6857 gene locus_tag LOCUS_12690 9046 6857 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090647.1 protein_id gnl|my_center|LOCUS_12690 9873 9133 gene locus_tag LOCUS_12700 9873 9133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 10130 11539 gene locus_tag LOCUS_12710 10130 11539 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061372.1 protein_id gnl|my_center|LOCUS_12710 11605 12927 gene locus_tag LOCUS_12720 11605 12927 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933859.1 protein_id gnl|my_center|LOCUS_12720 13889 12939 gene locus_tag LOCUS_12730 13889 12939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 >Feature sequence064 1556 336 gene locus_tag LOCUS_12740 1556 336 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_12740 3933 1570 gene locus_tag LOCUS_12750 3933 1570 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_12750 4664 3939 gene locus_tag LOCUS_12760 4664 3939 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445444.1 protein_id gnl|my_center|LOCUS_12760 5251 4688 gene locus_tag LOCUS_12770 5251 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 5584 11100 gene locus_tag LOCUS_12780 5584 11100 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391582.1 protein_id gnl|my_center|LOCUS_12780 11243 13243 gene locus_tag LOCUS_12790 gene pbpC 11243 13243 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975657.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence065 <1 567 gene locus_tag LOCUS_12800 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389549.1:valine--tRNA ligase 1361 711 gene locus_tag LOCUS_12810 1361 711 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967896.1 protein_id gnl|my_center|LOCUS_12810 2283 1801 gene locus_tag LOCUS_12820 2283 1801 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176079.1 protein_id gnl|my_center|LOCUS_12820 3061 2450 gene locus_tag LOCUS_12830 3061 2450 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531342.1 protein_id gnl|my_center|LOCUS_12830 3371 4096 gene locus_tag LOCUS_12840 3371 4096 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921493.1 protein_id gnl|my_center|LOCUS_12840 4204 4635 gene locus_tag LOCUS_12850 4204 4635 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 protein_id gnl|my_center|LOCUS_12850 5679 4708 gene locus_tag LOCUS_12860 5679 4708 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175852.1 protein_id gnl|my_center|LOCUS_12860 6239 5763 gene locus_tag LOCUS_12870 gene hisI 6239 5763 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918345.1 protein_id gnl|my_center|LOCUS_12870 6886 6275 gene locus_tag LOCUS_12880 gene folE 6886 6275 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918347.1 protein_id gnl|my_center|LOCUS_12880 7267 8067 gene locus_tag LOCUS_12890 7267 8067 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388454.1 protein_id gnl|my_center|LOCUS_12890 8072 8905 gene locus_tag LOCUS_12900 gene murI 8072 8905 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969468.1 protein_id gnl|my_center|LOCUS_12900 9058 9675 gene locus_tag LOCUS_12910 gene rpsD 9058 9675 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532142.1 protein_id gnl|my_center|LOCUS_12910 9796 11001 gene locus_tag LOCUS_12920 9796 11001 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_12920 11029 11673 gene locus_tag LOCUS_12930 11029 11673 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970529.1 protein_id gnl|my_center|LOCUS_12930 11677 12573 gene locus_tag LOCUS_12940 11677 12573 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532275.1 protein_id gnl|my_center|LOCUS_12940 12933 13202 gene locus_tag LOCUS_12950 12933 13202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence066 1319 417 gene locus_tag LOCUS_12960 1319 417 CDS product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083919.1 protein_id gnl|my_center|LOCUS_12960 2212 1301 gene locus_tag LOCUS_12970 gene argF 2212 1301 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970889.1 protein_id gnl|my_center|LOCUS_12970 3405 2209 gene locus_tag LOCUS_12980 3405 2209 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970888.1 protein_id gnl|my_center|LOCUS_12980 3885 3643 gene locus_tag LOCUS_12990 3885 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 4522 4010 gene locus_tag LOCUS_13000 4522 4010 CDS product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083916.1 protein_id gnl|my_center|LOCUS_13000 4813 5598 gene locus_tag LOCUS_13010 4813 5598 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388398.1 protein_id gnl|my_center|LOCUS_13010 7101 5947 gene locus_tag LOCUS_13020 7101 5947 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061528.1 protein_id gnl|my_center|LOCUS_13020 8096 7098 gene locus_tag LOCUS_13030 8096 7098 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061527.1 protein_id gnl|my_center|LOCUS_13030 10030 8099 gene locus_tag LOCUS_13040 10030 8099 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975625.1 protein_id gnl|my_center|LOCUS_13040 11316 10027 gene locus_tag LOCUS_13050 11316 10027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 13192 11318 gene locus_tag LOCUS_13060 13192 11318 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975624.1 protein_id gnl|my_center|LOCUS_13060 <13776 13227 gene locus_tag LOCUS_13070 <13776 13227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975617.1:polysaccharide deacetylase family protein >Feature sequence067 675 2267 gene locus_tag LOCUS_13080 675 2267 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083952.1 protein_id gnl|my_center|LOCUS_13080 3625 2264 gene locus_tag LOCUS_13090 3625 2264 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083960.1 protein_id gnl|my_center|LOCUS_13090 3937 3635 gene locus_tag LOCUS_13100 3937 3635 CDS product DUF6460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172810.1 protein_id gnl|my_center|LOCUS_13100 7419 4081 gene locus_tag LOCUS_13110 7419 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 7717 8121 gene locus_tag LOCUS_13120 7717 8121 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917970.1 protein_id gnl|my_center|LOCUS_13120 8166 9956 gene locus_tag LOCUS_13130 8166 9956 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533660.1 protein_id gnl|my_center|LOCUS_13130 10000 11205 gene locus_tag LOCUS_13140 10000 11205 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533658.1 protein_id gnl|my_center|LOCUS_13140 11220 13412 gene locus_tag LOCUS_13150 11220 13412 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083979.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence068 1616 609 gene locus_tag LOCUS_13160 1616 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1791 2957 gene locus_tag LOCUS_13170 1791 2957 CDS product ceramide glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533639.1 protein_id gnl|my_center|LOCUS_13170 3730 2972 gene locus_tag LOCUS_13180 3730 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 5109 3817 gene locus_tag LOCUS_13190 5109 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 6455 5253 gene locus_tag LOCUS_13200 6455 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 7103 6546 gene locus_tag LOCUS_13210 gene rfbC 7103 6546 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387749.1 protein_id gnl|my_center|LOCUS_13210 7414 8514 gene locus_tag LOCUS_13220 gene lptG 7414 8514 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390823.1 protein_id gnl|my_center|LOCUS_13220 9823 8537 gene locus_tag LOCUS_13230 gene cfa1 9823 8537 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330709.1 protein_id gnl|my_center|LOCUS_13230 10024 10968 gene locus_tag LOCUS_13240 10024 10968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 12392 11061 gene locus_tag LOCUS_13250 12392 11061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 13231 12389 gene locus_tag LOCUS_13260 13231 12389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence069 658 747 gene locus_tag LOCUS_t00120 658 747 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1139 1900 gene locus_tag LOCUS_13270 1139 1900 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531940.1 protein_id gnl|my_center|LOCUS_13270 2052 4223 gene locus_tag LOCUS_13280 2052 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 4232 6181 gene locus_tag LOCUS_13290 4232 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 6195 6968 gene locus_tag LOCUS_13300 6195 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 7269 8042 gene locus_tag LOCUS_13310 7269 8042 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437127.1 protein_id gnl|my_center|LOCUS_13310 8042 9088 gene locus_tag LOCUS_13320 8042 9088 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815923.1 protein_id gnl|my_center|LOCUS_13320 9212 10504 gene locus_tag LOCUS_13330 9212 10504 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940420.1 protein_id gnl|my_center|LOCUS_13330 10573 11460 gene locus_tag LOCUS_13340 10573 11460 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815927.1 protein_id gnl|my_center|LOCUS_13340 11457 12287 gene locus_tag LOCUS_13350 11457 12287 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815929.1 protein_id gnl|my_center|LOCUS_13350 <13194 12580 gene locus_tag LOCUS_13360 <13194 12580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765451.1:MBOAT family protein >Feature sequence070 1576 248 gene locus_tag LOCUS_13370 1576 248 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_13370 1973 2725 gene locus_tag LOCUS_13380 1973 2725 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329401.1 protein_id gnl|my_center|LOCUS_13380 4097 2841 gene locus_tag LOCUS_13390 4097 2841 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_13390 4373 5248 gene locus_tag LOCUS_13400 4373 5248 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125013.1 protein_id gnl|my_center|LOCUS_13400 5464 6399 gene locus_tag LOCUS_13410 5464 6399 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144407.1 protein_id gnl|my_center|LOCUS_13410 6428 8413 gene locus_tag LOCUS_13420 gene tkt 6428 8413 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535989.1 protein_id gnl|my_center|LOCUS_13420 8444 9448 gene locus_tag LOCUS_13430 gene gap 8444 9448 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387975.1 protein_id gnl|my_center|LOCUS_13430 9450 10658 gene locus_tag LOCUS_13440 9450 10658 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393616.1 protein_id gnl|my_center|LOCUS_13440 10769 11839 gene locus_tag LOCUS_13450 gene fba 10769 11839 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388354.1 protein_id gnl|my_center|LOCUS_13450 11969 12652 gene locus_tag LOCUS_13460 gene rpe 11969 12652 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085374.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence071 23 493 gene locus_tag LOCUS_13470 23 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 883 536 gene locus_tag LOCUS_13480 883 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1056 1598 gene locus_tag LOCUS_13490 gene ppa 1056 1598 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917937.1 protein_id gnl|my_center|LOCUS_13490 1760 2359 gene locus_tag LOCUS_13500 1760 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 3487 2384 gene locus_tag LOCUS_13510 3487 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 4731 3484 gene locus_tag LOCUS_13520 gene mtaB 4731 3484 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383138.1 protein_id gnl|my_center|LOCUS_13520 5600 4728 gene locus_tag LOCUS_13530 gene dapF 5600 4728 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083308.1 protein_id gnl|my_center|LOCUS_13530 5677 5808 gene locus_tag LOCUS_13540 5677 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 7056 5821 gene locus_tag LOCUS_13550 7056 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 7850 7179 gene locus_tag LOCUS_13560 7850 7179 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943739.1 protein_id gnl|my_center|LOCUS_13560 9279 7855 gene locus_tag LOCUS_13570 gene baeS 9279 7855 CDS product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097903.1 protein_id gnl|my_center|LOCUS_13570 9329 9880 gene locus_tag LOCUS_13580 9329 9880 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_13580 10399 9833 gene locus_tag LOCUS_13590 gene thpR 10399 9833 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067279.1 protein_id gnl|my_center|LOCUS_13590 10794 10432 gene locus_tag LOCUS_13600 10794 10432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13600 10999 10682 gene locus_tag LOCUS_13610 10999 10682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 11193 10999 gene locus_tag LOCUS_13620 11193 10999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 11929 11186 gene locus_tag LOCUS_13630 11929 11186 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_13630 <12991 11988 gene locus_tag LOCUS_13640 <12991 11988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003531079.1:ferrochelatase >Feature sequence072 1071 1703 gene locus_tag LOCUS_13650 1071 1703 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722129.1 protein_id gnl|my_center|LOCUS_13650 1808 2914 gene locus_tag LOCUS_13660 1808 2914 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532758.1 protein_id gnl|my_center|LOCUS_13660 3179 5857 gene locus_tag LOCUS_13670 gene ppdK 3179 5857 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921419.1 protein_id gnl|my_center|LOCUS_13670 6185 7378 gene locus_tag LOCUS_13680 6185 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 8166 7573 gene locus_tag LOCUS_13690 8166 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13690 8428 8105 gene locus_tag LOCUS_13700 8428 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13700 8217 8240 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10062 8425 gene locus_tag LOCUS_13710 10062 8425 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969040.1 protein_id gnl|my_center|LOCUS_13710 11103 10102 gene locus_tag LOCUS_13720 gene nadA 11103 10102 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085329.1 protein_id gnl|my_center|LOCUS_13720 11102 11428 gene locus_tag LOCUS_13730 11102 11428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 11847 11494 gene locus_tag LOCUS_13740 11847 11494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence073 336 1169 gene locus_tag LOCUS_13750 gene rsmA 336 1169 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384457.1 protein_id gnl|my_center|LOCUS_13750 1214 1903 gene locus_tag LOCUS_13760 1214 1903 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532669.1 protein_id gnl|my_center|LOCUS_13760 3644 1965 gene locus_tag LOCUS_13770 3644 1965 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531895.1 protein_id gnl|my_center|LOCUS_13770 3758 4165 gene locus_tag LOCUS_13780 3758 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 5597 4203 gene locus_tag LOCUS_13790 5597 4203 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086559.1 protein_id gnl|my_center|LOCUS_13790 5874 8258 gene locus_tag LOCUS_13800 5874 8258 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968934.1 protein_id gnl|my_center|LOCUS_13800 8427 8816 gene locus_tag LOCUS_13810 8427 8816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 9648 8887 gene locus_tag LOCUS_13820 9648 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 11228 9870 gene locus_tag LOCUS_13830 gene gor 11228 9870 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531664.1 protein_id gnl|my_center|LOCUS_13830 11923 11225 gene locus_tag LOCUS_13840 gene rpiA 11923 11225 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086536.1 protein_id gnl|my_center|LOCUS_13840 12197 11955 gene locus_tag LOCUS_13850 12197 11955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13850 >Feature sequence074 <1 3198 gene locus_tag LOCUS_13860 <1 3198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531906.1:transcription-repair coupling factor 4531 3212 gene locus_tag LOCUS_13870 4531 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 6218 4566 gene locus_tag LOCUS_13880 6218 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 8194 6245 gene locus_tag LOCUS_13890 8194 6245 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967416.1 protein_id gnl|my_center|LOCUS_13890 8269 8817 gene locus_tag LOCUS_13900 8269 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 10060 8903 gene locus_tag LOCUS_13910 10060 8903 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_13910 11867 10074 gene locus_tag LOCUS_13920 gene oadA 11867 10074 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_13920 12128 11883 gene locus_tag LOCUS_13930 12128 11883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence075 2687 1479 gene locus_tag LOCUS_13940 2687 1479 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048186.1 protein_id gnl|my_center|LOCUS_13940 3939 2680 gene locus_tag LOCUS_13950 3939 2680 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420380.1 protein_id gnl|my_center|LOCUS_13950 6804 4171 gene locus_tag LOCUS_13960 6804 4171 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704330.1 protein_id gnl|my_center|LOCUS_13960 7937 6972 gene locus_tag LOCUS_13970 7937 6972 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_13970 9048 8173 gene locus_tag LOCUS_13980 9048 8173 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268093.1 protein_id gnl|my_center|LOCUS_13980 9429 10592 gene locus_tag LOCUS_13990 9429 10592 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792063.1 protein_id gnl|my_center|LOCUS_13990 11514 10639 gene locus_tag LOCUS_14000 gene galU 11514 10639 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313444.1 protein_id gnl|my_center|LOCUS_14000 >Feature sequence076 3101 345 gene locus_tag LOCUS_14010 3101 345 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083225.1 protein_id gnl|my_center|LOCUS_14010 3958 3302 gene locus_tag LOCUS_14020 3958 3302 CDS product histidine phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967810.1 protein_id gnl|my_center|LOCUS_14020 4054 4911 gene locus_tag LOCUS_14030 gene cysQ 4054 4911 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396169.1 protein_id gnl|my_center|LOCUS_14030 5425 4931 gene locus_tag LOCUS_14040 5425 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 5520 6125 gene locus_tag LOCUS_14050 5520 6125 CDS product DUF1134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084979.1 protein_id gnl|my_center|LOCUS_14050 6237 6878 gene locus_tag LOCUS_14060 6237 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 7923 6892 gene locus_tag LOCUS_14070 7923 6892 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432947.1 protein_id gnl|my_center|LOCUS_14070 8756 8073 gene locus_tag LOCUS_14080 gene phoB 8756 8073 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706736.1 protein_id gnl|my_center|LOCUS_14080 9522 8785 gene locus_tag LOCUS_14090 gene phoU 9522 8785 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083915.1 protein_id gnl|my_center|LOCUS_14090 10413 9589 gene locus_tag LOCUS_14100 gene pstB 10413 9589 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918181.1 protein_id gnl|my_center|LOCUS_14100 12045 10432 gene locus_tag LOCUS_14110 12045 10432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence077 506 54 gene locus_tag LOCUS_14120 506 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1713 547 gene locus_tag LOCUS_14130 1713 547 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815469.1 protein_id gnl|my_center|LOCUS_14130 1946 2488 gene locus_tag LOCUS_14140 1946 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 2550 5150 gene locus_tag LOCUS_14150 gene leuS 2550 5150 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067403.1 protein_id gnl|my_center|LOCUS_14150 5137 5667 gene locus_tag LOCUS_14160 5137 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 5782 6813 gene locus_tag LOCUS_14170 gene holA 5782 6813 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 protein_id gnl|my_center|LOCUS_14170 7155 7658 gene locus_tag LOCUS_14180 7155 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 9155 7674 gene locus_tag LOCUS_14190 9155 7674 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969872.1 protein_id gnl|my_center|LOCUS_14190 10601 9186 gene locus_tag LOCUS_14200 gene uxaC 10601 9186 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338259.1 protein_id gnl|my_center|LOCUS_14200 11362 10607 gene locus_tag LOCUS_14210 11362 10607 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918870.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence078 2591 612 gene locus_tag LOCUS_14220 gene rpoD 2591 612 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976352.1 protein_id gnl|my_center|LOCUS_14220 4642 2759 gene locus_tag LOCUS_14230 gene dnaG 4642 2759 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090085.1 protein_id gnl|my_center|LOCUS_14230 4842 5177 gene locus_tag LOCUS_14240 4842 5177 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010699606.1 protein_id gnl|my_center|LOCUS_14240 5119 5430 gene locus_tag LOCUS_14250 5119 5430 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389752.1 protein_id gnl|my_center|LOCUS_14250 5907 5455 gene locus_tag LOCUS_14260 5907 5455 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532937.1 protein_id gnl|my_center|LOCUS_14260 6259 7422 gene locus_tag LOCUS_14270 gene carA 6259 7422 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530125.1 protein_id gnl|my_center|LOCUS_14270 7493 8524 gene locus_tag LOCUS_14280 7493 8524 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338346.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence079 413 1141 gene locus_tag LOCUS_14290 gene dnaQ 413 1141 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563276.1 protein_id gnl|my_center|LOCUS_14290 1617 1132 gene locus_tag LOCUS_14300 gene secB 1617 1132 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083468.1 protein_id gnl|my_center|LOCUS_14300 2261 1749 gene locus_tag LOCUS_14310 gene fxsA 2261 1749 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 protein_id gnl|my_center|LOCUS_14310 2426 3148 gene locus_tag LOCUS_14320 2426 3148 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968290.1 protein_id gnl|my_center|LOCUS_14320 3214 4362 gene locus_tag LOCUS_14330 3214 4362 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528721.1 protein_id gnl|my_center|LOCUS_14330 4365 4919 gene locus_tag LOCUS_14340 4365 4919 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528720.1 protein_id gnl|my_center|LOCUS_14340 6233 4923 gene locus_tag LOCUS_14350 gene hslU 6233 4923 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528355.1 protein_id gnl|my_center|LOCUS_14350 6823 6269 gene locus_tag LOCUS_14360 gene hslV 6823 6269 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083476.1 protein_id gnl|my_center|LOCUS_14360 7006 7599 gene locus_tag LOCUS_14370 gene hisB 7006 7599 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528350.1 protein_id gnl|my_center|LOCUS_14370 7605 8030 gene locus_tag LOCUS_14380 7605 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 8049 8699 gene locus_tag LOCUS_14390 gene hisH 8049 8699 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970621.1 protein_id gnl|my_center|LOCUS_14390 8709 9464 gene locus_tag LOCUS_14400 gene hisA 8709 9464 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330420.1 protein_id gnl|my_center|LOCUS_14400 9457 10239 gene locus_tag LOCUS_14410 gene hisF 9457 10239 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330419.1 protein_id gnl|my_center|LOCUS_14410 10252 10581 gene locus_tag LOCUS_14420 10252 10581 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528343.1 protein_id gnl|my_center|LOCUS_14420 10595 11554 gene locus_tag LOCUS_14430 gene coaA 10595 11554 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968317.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence080 <1 1074 gene locus_tag LOCUS_14440 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706512.1:HlyD family type I secretion periplasmic adaptor subunit 1543 2892 gene locus_tag LOCUS_14450 1543 2892 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723944.1 protein_id gnl|my_center|LOCUS_14450 3044 4069 gene locus_tag LOCUS_14460 3044 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14460 4074 5255 gene locus_tag LOCUS_14470 4074 5255 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195809.1 protein_id gnl|my_center|LOCUS_14470 5259 6014 gene locus_tag LOCUS_14480 5259 6014 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931109.1 protein_id gnl|my_center|LOCUS_14480 6011 6724 gene locus_tag LOCUS_14490 6011 6724 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966750.1 protein_id gnl|my_center|LOCUS_14490 7145 7534 gene locus_tag LOCUS_14500 7145 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 8614 7769 gene locus_tag LOCUS_14510 8614 7769 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551552.1 protein_id gnl|my_center|LOCUS_14510 8781 9071 gene locus_tag LOCUS_14520 8781 9071 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083363.1 protein_id gnl|my_center|LOCUS_14520 10303 9122 gene locus_tag LOCUS_14530 10303 9122 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706371.1 protein_id gnl|my_center|LOCUS_14530 11296 10346 gene locus_tag LOCUS_14540 11296 10346 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931313.1 protein_id gnl|my_center|LOCUS_14540 11584 11381 gene locus_tag LOCUS_14550 11584 11381 CDS product DUF2783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064480.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence081 2261 969 gene locus_tag LOCUS_14560 2261 969 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173608.1 protein_id gnl|my_center|LOCUS_14560 2931 2275 gene locus_tag LOCUS_14570 2931 2275 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412782.1 protein_id gnl|my_center|LOCUS_14570 3601 2915 gene locus_tag LOCUS_14580 3601 2915 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389226.1 protein_id gnl|my_center|LOCUS_14580 4968 3607 gene locus_tag LOCUS_14590 4968 3607 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532099.1 protein_id gnl|my_center|LOCUS_14590 5731 4973 gene locus_tag LOCUS_14600 5731 4973 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532097.1 protein_id gnl|my_center|LOCUS_14600 6396 5740 gene locus_tag LOCUS_14610 6396 5740 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532096.1 protein_id gnl|my_center|LOCUS_14610 7048 6401 gene locus_tag LOCUS_14620 7048 6401 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532095.1 protein_id gnl|my_center|LOCUS_14620 7907 7128 gene locus_tag LOCUS_14630 7907 7128 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532094.1 protein_id gnl|my_center|LOCUS_14630 8052 9011 gene locus_tag LOCUS_14640 8052 9011 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532093.1 protein_id gnl|my_center|LOCUS_14640 9077 10021 gene locus_tag LOCUS_14650 9077 10021 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_14650 10922 10041 gene locus_tag LOCUS_14660 10922 10041 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390794.1 protein_id gnl|my_center|LOCUS_14660 11107 11682 gene locus_tag LOCUS_14670 11107 11682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence082 1073 471 gene locus_tag LOCUS_14680 1073 471 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085340.1 protein_id gnl|my_center|LOCUS_14680 1933 1070 gene locus_tag LOCUS_14690 1933 1070 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085341.1 protein_id gnl|my_center|LOCUS_14690 2053 3390 gene locus_tag LOCUS_14700 2053 3390 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085342.1 protein_id gnl|my_center|LOCUS_14700 3409 4398 gene locus_tag LOCUS_14710 3409 4398 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529574.1 protein_id gnl|my_center|LOCUS_14710 4436 5074 gene locus_tag LOCUS_14720 4436 5074 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_14720 5336 5064 gene locus_tag LOCUS_14730 5336 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 5967 5521 gene locus_tag LOCUS_14740 5967 5521 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974911.1 protein_id gnl|my_center|LOCUS_14740 6029 6775 gene locus_tag LOCUS_14750 6029 6775 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_14750 6825 8258 gene locus_tag LOCUS_14760 6825 8258 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085355.1 protein_id gnl|my_center|LOCUS_14760 8265 9164 gene locus_tag LOCUS_14770 8265 9164 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976366.1 protein_id gnl|my_center|LOCUS_14770 9161 9586 gene locus_tag LOCUS_14780 9161 9586 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085354.1 protein_id gnl|my_center|LOCUS_14780 10008 9622 gene locus_tag LOCUS_14790 10008 9622 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_14790 10794 10081 gene locus_tag LOCUS_14800 10794 10081 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_14800 10905 11453 gene locus_tag LOCUS_14810 10905 11453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence083 1167 2192 gene locus_tag LOCUS_14820 1167 2192 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525362.1 protein_id gnl|my_center|LOCUS_14820 2735 4033 gene locus_tag LOCUS_14830 gene urtA 2735 4033 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529436.1 protein_id gnl|my_center|LOCUS_14830 4106 5716 gene locus_tag LOCUS_14840 gene urtB 4106 5716 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531848.1 protein_id gnl|my_center|LOCUS_14840 5716 6882 gene locus_tag LOCUS_14850 gene urtC 5716 6882 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244009.1 protein_id gnl|my_center|LOCUS_14850 6896 7648 gene locus_tag LOCUS_14860 gene urtD 6896 7648 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976302.1 protein_id gnl|my_center|LOCUS_14860 7653 8348 gene locus_tag LOCUS_14870 gene urtE 7653 8348 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531845.1 protein_id gnl|my_center|LOCUS_14870 8362 9213 gene locus_tag LOCUS_14880 8362 9213 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256001.1 protein_id gnl|my_center|LOCUS_14880 9228 9530 gene locus_tag LOCUS_14890 9228 9530 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525618.1 protein_id gnl|my_center|LOCUS_14890 9540 9848 gene locus_tag LOCUS_14900 9540 9848 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972299.1 protein_id gnl|my_center|LOCUS_14900 9848 10507 gene locus_tag LOCUS_14910 9848 10507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence084 2975 1239 gene locus_tag LOCUS_14920 2975 1239 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969751.1 protein_id gnl|my_center|LOCUS_14920 3328 2975 gene locus_tag LOCUS_14930 3328 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 4284 3325 gene locus_tag LOCUS_14940 gene rsmH 4284 3325 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966431.1 protein_id gnl|my_center|LOCUS_14940 4838 4356 gene locus_tag LOCUS_14950 gene mraZ 4838 4356 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599021.1 protein_id gnl|my_center|LOCUS_14950 6331 5582 gene locus_tag LOCUS_14960 6331 5582 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089351.1 protein_id gnl|my_center|LOCUS_14960 6993 6328 gene locus_tag LOCUS_14970 6993 6328 CDS product DnaJ family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976235.1 protein_id gnl|my_center|LOCUS_14970 7186 8064 gene locus_tag LOCUS_14980 7186 8064 CDS product Rv2407 family type 3 sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412350.1 protein_id gnl|my_center|LOCUS_14980 8921 8145 gene locus_tag LOCUS_14990 8921 8145 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797789.1 protein_id gnl|my_center|LOCUS_14990 9496 8999 gene locus_tag LOCUS_15000 9496 8999 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984080.1 protein_id gnl|my_center|LOCUS_15000 10214 9576 gene locus_tag LOCUS_15010 10214 9576 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529397.1 protein_id gnl|my_center|LOCUS_15010 10682 10218 gene locus_tag LOCUS_15020 10682 10218 CDS product DUF1348 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529396.1 protein_id gnl|my_center|LOCUS_15020 10793 11692 gene locus_tag LOCUS_15030 10793 11692 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529395.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence085 593 1432 gene locus_tag LOCUS_15040 593 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1539 1901 gene locus_tag LOCUS_15050 1539 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2128 2484 gene locus_tag LOCUS_15060 2128 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2554 3846 gene locus_tag LOCUS_15070 2554 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 3852 4514 gene locus_tag LOCUS_15080 3852 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 4593 5189 gene locus_tag LOCUS_15090 4593 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 5635 5306 gene locus_tag LOCUS_15100 5635 5306 CDS product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532126.1 protein_id gnl|my_center|LOCUS_15100 5819 6586 gene locus_tag LOCUS_15110 5819 6586 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708153.1 protein_id gnl|my_center|LOCUS_15110 6638 6877 gene locus_tag LOCUS_15120 gene purS 6638 6877 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388468.1 protein_id gnl|my_center|LOCUS_15120 6903 7592 gene locus_tag LOCUS_15130 gene purQ 6903 7592 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088468.1 protein_id gnl|my_center|LOCUS_15130 7589 9784 gene locus_tag LOCUS_15140 gene purL 7589 9784 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388466.1 protein_id gnl|my_center|LOCUS_15140 9801 10037 gene locus_tag LOCUS_15150 9801 10037 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909092.1 protein_id gnl|my_center|LOCUS_15150 10125 10466 gene locus_tag LOCUS_15160 gene grxD 10125 10466 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708163.1 protein_id gnl|my_center|LOCUS_15160 10591 10914 gene locus_tag LOCUS_15170 10591 10914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389789.1 protein_id gnl|my_center|LOCUS_15170 10923 11282 gene locus_tag LOCUS_15180 10923 11282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15180 >Feature sequence086 1841 330 gene locus_tag LOCUS_15190 1841 330 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 protein_id gnl|my_center|LOCUS_15190 2318 1845 gene locus_tag LOCUS_15200 2318 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 3395 2409 gene locus_tag LOCUS_15210 3395 2409 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039267.1 protein_id gnl|my_center|LOCUS_15210 4382 3429 gene locus_tag LOCUS_15220 4382 3429 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966538.1 protein_id gnl|my_center|LOCUS_15220 5680 4388 gene locus_tag LOCUS_15230 5680 4388 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166468466.1 protein_id gnl|my_center|LOCUS_15230 6198 5680 gene locus_tag LOCUS_15240 6198 5680 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930617.1 protein_id gnl|my_center|LOCUS_15240 7183 6200 gene locus_tag LOCUS_15250 7183 6200 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808125.1 protein_id gnl|my_center|LOCUS_15250 7890 7210 gene locus_tag LOCUS_15260 7890 7210 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066872391.1 protein_id gnl|my_center|LOCUS_15260 8903 7893 gene locus_tag LOCUS_15270 8903 7893 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207240953.1 protein_id gnl|my_center|LOCUS_15270 9073 9990 gene locus_tag LOCUS_15280 9073 9990 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974581.1 protein_id gnl|my_center|LOCUS_15280 10928 10125 gene locus_tag LOCUS_15290 10928 10125 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085064.1 protein_id gnl|my_center|LOCUS_15290 11673 10921 gene locus_tag LOCUS_15300 11673 10921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence087 711 7 gene locus_tag LOCUS_15310 711 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1706 849 gene locus_tag LOCUS_15320 1706 849 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235433858.1 protein_id gnl|my_center|LOCUS_15320 2455 1703 gene locus_tag LOCUS_15330 2455 1703 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328180.1 protein_id gnl|my_center|LOCUS_15330 2758 4653 gene locus_tag LOCUS_15340 2758 4653 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087576.1 protein_id gnl|my_center|LOCUS_15340 4672 6189 gene locus_tag LOCUS_15350 gene trpE 4672 6189 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_15350 6193 6774 gene locus_tag LOCUS_15360 6193 6774 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919763.1 protein_id gnl|my_center|LOCUS_15360 6822 7835 gene locus_tag LOCUS_15370 gene trpD 6822 7835 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087577.1 protein_id gnl|my_center|LOCUS_15370 7837 8640 gene locus_tag LOCUS_15380 gene trpC 7837 8640 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531739.1 protein_id gnl|my_center|LOCUS_15380 8637 9116 gene locus_tag LOCUS_15390 gene moaC 8637 9116 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531740.1 protein_id gnl|my_center|LOCUS_15390 9163 10368 gene locus_tag LOCUS_15400 9163 10368 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971802.1 protein_id gnl|my_center|LOCUS_15400 11547 10393 gene locus_tag LOCUS_15410 11547 10393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence088 1980 1318 gene locus_tag LOCUS_15420 1980 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 3627 2170 gene locus_tag LOCUS_15430 3627 2170 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704254.1 protein_id gnl|my_center|LOCUS_15430 3918 5549 gene locus_tag LOCUS_15440 gene nirS 3918 5549 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_15440 5712 6131 gene locus_tag LOCUS_15450 5712 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 6218 7003 gene locus_tag LOCUS_15460 6218 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 6984 7283 gene locus_tag LOCUS_15470 6984 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 7280 8458 gene locus_tag LOCUS_15480 gene nirF 7280 8458 CDS product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 protein_id gnl|my_center|LOCUS_15480 8462 9460 gene locus_tag LOCUS_15490 8462 9460 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903402.1 protein_id gnl|my_center|LOCUS_15490 9453 9899 gene locus_tag LOCUS_15500 9453 9899 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084860.1 protein_id gnl|my_center|LOCUS_15500 9896 10378 gene locus_tag LOCUS_15510 9896 10378 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084858.1 protein_id gnl|my_center|LOCUS_15510 10393 11604 gene locus_tag LOCUS_15520 gene nirJ 10393 11604 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence089 <1 709 gene locus_tag LOCUS_15530 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085899.1:MBL fold metallo-hydrolase 1403 3277 gene locus_tag LOCUS_15540 1403 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 3296 4849 gene locus_tag LOCUS_15550 3296 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 5991 6209 gene locus_tag LOCUS_15560 5991 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 6508 6789 gene locus_tag LOCUS_15570 6508 6789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 6822 7385 gene locus_tag LOCUS_15580 6822 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 7680 8411 gene locus_tag LOCUS_15590 7680 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969333.1 protein_id gnl|my_center|LOCUS_15590 10722 8527 gene locus_tag LOCUS_15600 10722 8527 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817980.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence090 1544 582 gene locus_tag LOCUS_15610 1544 582 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053693.1 protein_id gnl|my_center|LOCUS_15610 2864 1650 gene locus_tag LOCUS_15620 2864 1650 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423059.1 protein_id gnl|my_center|LOCUS_15620 3158 4330 gene locus_tag LOCUS_15630 3158 4330 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815015.1 protein_id gnl|my_center|LOCUS_15630 4397 5323 gene locus_tag LOCUS_15640 4397 5323 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815013.1 protein_id gnl|my_center|LOCUS_15640 5320 6315 gene locus_tag LOCUS_15650 5320 6315 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_15650 6308 7054 gene locus_tag LOCUS_15660 6308 7054 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040563.1 protein_id gnl|my_center|LOCUS_15660 7059 7763 gene locus_tag LOCUS_15670 7059 7763 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_15670 7804 8664 gene locus_tag LOCUS_15680 7804 8664 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929728.1 protein_id gnl|my_center|LOCUS_15680 8937 8692 gene locus_tag LOCUS_15690 8937 8692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence091 325 942 gene locus_tag LOCUS_15700 325 942 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338466.1 protein_id gnl|my_center|LOCUS_15700 966 2093 gene locus_tag LOCUS_15710 gene ribB 966 2093 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 protein_id gnl|my_center|LOCUS_15710 2090 2536 gene locus_tag LOCUS_15720 gene ribH 2090 2536 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529297.1 protein_id gnl|my_center|LOCUS_15720 2541 3002 gene locus_tag LOCUS_15730 gene nusB 2541 3002 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532244.1 protein_id gnl|my_center|LOCUS_15730 3013 3981 gene locus_tag LOCUS_15740 gene thiL 3013 3981 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087788.1 protein_id gnl|my_center|LOCUS_15740 4019 5251 gene locus_tag LOCUS_15750 4019 5251 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337692.1 protein_id gnl|my_center|LOCUS_15750 5438 7555 gene locus_tag LOCUS_15760 5438 7555 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087787.1 protein_id gnl|my_center|LOCUS_15760 9525 7843 gene locus_tag LOCUS_15770 9525 7843 CDS product mucoidy inhibitor MuiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089817.1 protein_id gnl|my_center|LOCUS_15770 10082 9753 gene locus_tag LOCUS_15780 gene erpA 10082 9753 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087527.1 protein_id gnl|my_center|LOCUS_15780 10174 11337 gene locus_tag LOCUS_15790 10174 11337 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087526.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence092 661 1200 gene locus_tag LOCUS_15800 661 1200 CDS product DUF1465 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084322.1 protein_id gnl|my_center|LOCUS_15800 1456 1235 gene locus_tag LOCUS_15810 gene rpmE 1456 1235 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529118.1 protein_id gnl|my_center|LOCUS_15810 1710 3575 gene locus_tag LOCUS_15820 1710 3575 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173455.1 protein_id gnl|my_center|LOCUS_15820 3782 3600 gene locus_tag LOCUS_15830 3782 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 5872 3824 gene locus_tag LOCUS_15840 5872 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 8067 6178 gene locus_tag LOCUS_15850 8067 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 9117 8071 gene locus_tag LOCUS_15860 9117 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965387.1 protein_id gnl|my_center|LOCUS_15860 10016 9231 gene locus_tag LOCUS_15870 10016 9231 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529126.1 protein_id gnl|my_center|LOCUS_15870 10635 10072 gene locus_tag LOCUS_15880 gene efp 10635 10072 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529127.1 protein_id gnl|my_center|LOCUS_15880 <11477 10804 gene locus_tag LOCUS_15890 <11477 10804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116269310.1:tetratricopeptide repeat protein >Feature sequence093 1748 1332 gene locus_tag LOCUS_15900 1748 1332 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389874.1 protein_id gnl|my_center|LOCUS_15900 2180 1758 gene locus_tag LOCUS_15910 gene apaG 2180 1758 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533640.1 protein_id gnl|my_center|LOCUS_15910 2959 2321 gene locus_tag LOCUS_15920 2959 2321 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15920 3970 2990 gene locus_tag LOCUS_15930 3970 2990 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_15930 4992 4132 gene locus_tag LOCUS_15940 4992 4132 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918999.1 protein_id gnl|my_center|LOCUS_15940 5208 5390 gene locus_tag LOCUS_15950 5208 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 6062 5817 gene locus_tag LOCUS_15960 6062 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 6730 6059 gene locus_tag LOCUS_15970 6730 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 7389 6949 gene locus_tag LOCUS_15980 7389 6949 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084163.1 protein_id gnl|my_center|LOCUS_15980 8104 7421 gene locus_tag LOCUS_15990 8104 7421 CDS product ribonuclease T2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090200.1 protein_id gnl|my_center|LOCUS_15990 8303 8956 gene locus_tag LOCUS_16000 8303 8956 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265678.1 protein_id gnl|my_center|LOCUS_16000 9596 8967 gene locus_tag LOCUS_16010 9596 8967 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103690.1 protein_id gnl|my_center|LOCUS_16010 9954 11429 gene locus_tag LOCUS_16020 9954 11429 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092113.1 protein_id gnl|my_center|LOCUS_16020 >Feature sequence094 159 1481 gene locus_tag LOCUS_16030 gene cysS 159 1481 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086571.1 protein_id gnl|my_center|LOCUS_16030 1544 3151 gene locus_tag LOCUS_16040 gene cimA 1544 3151 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086573.1 protein_id gnl|my_center|LOCUS_16040 4284 3283 gene locus_tag LOCUS_16050 4284 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 4488 5888 gene locus_tag LOCUS_16060 4488 5888 CDS product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533676.1 protein_id gnl|my_center|LOCUS_16060 6135 6479 gene locus_tag LOCUS_16070 6135 6479 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014766585.1 protein_id gnl|my_center|LOCUS_16070 6476 7333 gene locus_tag LOCUS_16080 6476 7333 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173545.1 protein_id gnl|my_center|LOCUS_16080 8268 7330 gene locus_tag LOCUS_16090 8268 7330 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397656.1 protein_id gnl|my_center|LOCUS_16090 9136 8327 gene locus_tag LOCUS_16100 9136 8327 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086578.1 protein_id gnl|my_center|LOCUS_16100 9836 9141 gene locus_tag LOCUS_16110 9836 9141 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338435.1 protein_id gnl|my_center|LOCUS_16110 11397 9916 gene locus_tag LOCUS_16120 11397 9916 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974923.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence095 924 703 gene locus_tag LOCUS_16130 924 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1159 842 gene locus_tag LOCUS_16140 1159 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1389 2471 gene locus_tag LOCUS_16150 gene aroC 1389 2471 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085417.1 protein_id gnl|my_center|LOCUS_16150 2481 2804 gene locus_tag LOCUS_16160 2481 2804 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088869.1 protein_id gnl|my_center|LOCUS_16160 3136 4143 gene locus_tag LOCUS_16170 gene phnD 3136 4143 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939223.1 protein_id gnl|my_center|LOCUS_16170 4225 5076 gene locus_tag LOCUS_16180 gene phnC 4225 5076 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_16180 5073 5867 gene locus_tag LOCUS_16190 gene phnE 5073 5867 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368504.1 protein_id gnl|my_center|LOCUS_16190 5864 6676 gene locus_tag LOCUS_16200 gene phnE 5864 6676 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104070585.1 protein_id gnl|my_center|LOCUS_16200 6711 7547 gene locus_tag LOCUS_16210 6711 7547 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388273.1 protein_id gnl|my_center|LOCUS_16210 7628 8791 gene locus_tag LOCUS_16220 7628 8791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 9164 8892 gene locus_tag LOCUS_16230 9164 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 10322 9378 gene locus_tag LOCUS_16240 10322 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 10839 10462 gene locus_tag LOCUS_16250 10839 10462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence096 725 1318 gene locus_tag LOCUS_16260 725 1318 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390998.1 protein_id gnl|my_center|LOCUS_16260 1414 2067 gene locus_tag LOCUS_16270 1414 2067 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532754.1 protein_id gnl|my_center|LOCUS_16270 2174 5632 gene locus_tag LOCUS_16280 gene smc 2174 5632 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392558.1 protein_id gnl|my_center|LOCUS_16280 5641 6003 gene locus_tag LOCUS_16290 5641 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 6089 6802 gene locus_tag LOCUS_16300 6089 6802 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532843.1 protein_id gnl|my_center|LOCUS_16300 6842 7075 gene locus_tag LOCUS_16310 6842 7075 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007599451.1 protein_id gnl|my_center|LOCUS_16310 7132 7635 gene locus_tag LOCUS_16320 7132 7635 CDS product F0F1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563084.1 protein_id gnl|my_center|LOCUS_16320 7628 8110 gene locus_tag LOCUS_16330 7628 8110 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532841.1 protein_id gnl|my_center|LOCUS_16330 9129 8200 gene locus_tag LOCUS_16340 9129 8200 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530338.1 protein_id gnl|my_center|LOCUS_16340 9328 9588 gene locus_tag LOCUS_16350 9328 9588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 9590 10468 gene locus_tag LOCUS_16360 9590 10468 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387897.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence097 1430 417 gene locus_tag LOCUS_16370 gene eutC 1430 417 CDS product ectoine utilization protein EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974132.1 protein_id gnl|my_center|LOCUS_16370 2436 1435 gene locus_tag LOCUS_16380 gene eutB 2436 1435 CDS product hydroxyectoine utilization dehydratase EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167355184.1 protein_id gnl|my_center|LOCUS_16380 3218 2433 gene locus_tag LOCUS_16390 gene eutA 3218 2433 CDS product ectoine utilization protein EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401284.1 protein_id gnl|my_center|LOCUS_16390 3684 3241 gene locus_tag LOCUS_16400 3684 3241 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227162.1 protein_id gnl|my_center|LOCUS_16400 4977 3691 gene locus_tag LOCUS_16410 4977 3691 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461221.1 protein_id gnl|my_center|LOCUS_16410 5546 4980 gene locus_tag LOCUS_16420 5546 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 6729 5707 gene locus_tag LOCUS_16430 6729 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 8125 7118 gene locus_tag LOCUS_16440 gene doeB 8125 7118 CDS product N(2)-acetyl-L-2,4-diaminobutanoate deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974130.1 protein_id gnl|my_center|LOCUS_16440 8396 8881 gene locus_tag LOCUS_16450 8396 8881 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401300.1 protein_id gnl|my_center|LOCUS_16450 8905 9663 gene locus_tag LOCUS_16460 8905 9663 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722779.1 protein_id gnl|my_center|LOCUS_16460 9716 10987 gene locus_tag LOCUS_16470 9716 10987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 >Feature sequence098 378 794 gene locus_tag LOCUS_16480 378 794 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918712.1 protein_id gnl|my_center|LOCUS_16480 1589 819 gene locus_tag LOCUS_16490 1589 819 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970076.1 protein_id gnl|my_center|LOCUS_16490 1732 2991 gene locus_tag LOCUS_16500 1732 2991 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529459.1 protein_id gnl|my_center|LOCUS_16500 3092 5323 gene locus_tag LOCUS_16510 gene ptsP 3092 5323 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083049.1 protein_id gnl|my_center|LOCUS_16510 5513 6574 gene locus_tag LOCUS_16520 5513 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 6641 7717 gene locus_tag LOCUS_16530 gene prfA 6641 7717 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066723.1 protein_id gnl|my_center|LOCUS_16530 7714 8577 gene locus_tag LOCUS_16540 gene prmC 7714 8577 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388509.1 protein_id gnl|my_center|LOCUS_16540 9031 9480 gene locus_tag LOCUS_16550 9031 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16550 10313 9543 gene locus_tag LOCUS_16560 10313 9543 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084220.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence099 1487 1032 gene locus_tag LOCUS_16570 gene nrdR 1487 1032 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532250.1 protein_id gnl|my_center|LOCUS_16570 2900 1599 gene locus_tag LOCUS_16580 2900 1599 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338519.1 protein_id gnl|my_center|LOCUS_16580 3254 5935 gene locus_tag LOCUS_16590 3254 5935 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040039036.1 protein_id gnl|my_center|LOCUS_16590 5989 6912 gene locus_tag LOCUS_16600 5989 6912 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188957.1 protein_id gnl|my_center|LOCUS_16600 7037 8314 gene locus_tag LOCUS_16610 7037 8314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 8815 9741 gene locus_tag LOCUS_16620 8815 9741 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083991.1 protein_id gnl|my_center|LOCUS_16620 9763 9882 gene locus_tag LOCUS_16630 9763 9882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 9909 10811 gene locus_tag LOCUS_16640 gene coxB 9909 10811 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083989.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence100 825 1211 gene locus_tag LOCUS_16650 825 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1243 2916 gene locus_tag LOCUS_16660 1243 2916 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969903.1 protein_id gnl|my_center|LOCUS_16660 4280 3462 gene locus_tag LOCUS_16670 4280 3462 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388983.1 protein_id gnl|my_center|LOCUS_16670 4772 4374 gene locus_tag LOCUS_16680 4772 4374 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529039.1 protein_id gnl|my_center|LOCUS_16680 6248 4821 gene locus_tag LOCUS_16690 gene atpD 6248 4821 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067133.1 protein_id gnl|my_center|LOCUS_16690 7164 6268 gene locus_tag LOCUS_16700 7164 6268 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530300.1 protein_id gnl|my_center|LOCUS_16700 8712 7183 gene locus_tag LOCUS_16710 gene atpA 8712 7183 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530298.1 protein_id gnl|my_center|LOCUS_16710 9272 8712 gene locus_tag LOCUS_16720 9272 8712 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169539095.1 protein_id gnl|my_center|LOCUS_16720 <11008 9530 gene locus_tag LOCUS_16730 <11008 9530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067138.1:primosomal protein N' >Feature sequence101 326 60 gene locus_tag LOCUS_16740 326 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1052 366 gene locus_tag LOCUS_16750 1052 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1494 1063 gene locus_tag LOCUS_16760 1494 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 3960 1504 gene locus_tag LOCUS_16770 3960 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 4547 3957 gene locus_tag LOCUS_16780 4547 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939868.1 protein_id gnl|my_center|LOCUS_16780 4839 4552 gene locus_tag LOCUS_16790 4839 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 5160 4843 gene locus_tag LOCUS_16800 5160 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 5249 5971 gene locus_tag LOCUS_16810 gene cobB 5249 5971 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391392.1 protein_id gnl|my_center|LOCUS_16810 6151 6954 gene locus_tag LOCUS_16820 6151 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 7906 7025 gene locus_tag LOCUS_16830 gene yghX 7906 7025 CDS product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382657.1 protein_id gnl|my_center|LOCUS_16830 8120 8428 gene locus_tag LOCUS_16840 8120 8428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 9227 8487 gene locus_tag LOCUS_16850 9227 8487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 9848 10576 gene locus_tag LOCUS_16860 9848 10576 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029628.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence102 1344 7 gene locus_tag LOCUS_16870 gene atoC 1344 7 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125283.1 protein_id gnl|my_center|LOCUS_16870 2810 1341 gene locus_tag LOCUS_16880 2810 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3691 2807 gene locus_tag LOCUS_16890 3691 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 3983 5608 gene locus_tag LOCUS_16900 3983 5608 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 protein_id gnl|my_center|LOCUS_16900 5612 6232 gene locus_tag LOCUS_16910 5612 6232 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_16910 6331 8889 gene locus_tag LOCUS_16920 6331 8889 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272623.1 protein_id gnl|my_center|LOCUS_16920 8920 9696 gene locus_tag LOCUS_16930 8920 9696 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461607.1 protein_id gnl|my_center|LOCUS_16930 9767 10393 gene locus_tag LOCUS_16940 9767 10393 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461608.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence103 530 1750 gene locus_tag LOCUS_16950 530 1750 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546769.1 protein_id gnl|my_center|LOCUS_16950 3441 1939 gene locus_tag LOCUS_16960 gene abfD 3441 1939 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_16960 4388 3597 gene locus_tag LOCUS_16970 4388 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 4857 7565 gene locus_tag LOCUS_16980 4857 7565 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_16980 7628 8677 gene locus_tag LOCUS_16990 gene gnd 7628 8677 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_16990 8674 10059 gene locus_tag LOCUS_17000 gene zwf 8674 10059 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528919.1 protein_id gnl|my_center|LOCUS_17000 10070 10762 gene locus_tag LOCUS_17010 gene pgl 10070 10762 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence104 <1 858 gene locus_tag LOCUS_17020 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167526312.1:flagellar hook-length control protein FliK 855 1109 gene locus_tag LOCUS_17030 855 1109 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919773.1 protein_id gnl|my_center|LOCUS_17030 1935 1084 gene locus_tag LOCUS_17040 gene pdxY 1935 1084 CDS product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563606.1 protein_id gnl|my_center|LOCUS_17040 2062 2922 gene locus_tag LOCUS_17050 2062 2922 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222029.1 protein_id gnl|my_center|LOCUS_17050 3038 3448 gene locus_tag LOCUS_17060 gene sdhC 3038 3448 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 protein_id gnl|my_center|LOCUS_17060 3463 3837 gene locus_tag LOCUS_17070 gene sdhD 3463 3837 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531168.1 protein_id gnl|my_center|LOCUS_17070 3841 5673 gene locus_tag LOCUS_17080 gene sdhA 3841 5673 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083345.1 protein_id gnl|my_center|LOCUS_17080 5764 6582 gene locus_tag LOCUS_17090 5764 6582 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972458.1 protein_id gnl|my_center|LOCUS_17090 6665 7066 gene locus_tag LOCUS_17100 6665 7066 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088362.1 protein_id gnl|my_center|LOCUS_17100 7106 8224 gene locus_tag LOCUS_17110 gene zapE 7106 8224 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083288.1 protein_id gnl|my_center|LOCUS_17110 8309 9280 gene locus_tag LOCUS_17120 gene mdh 8309 9280 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067155.1 protein_id gnl|my_center|LOCUS_17120 9323 10492 gene locus_tag LOCUS_17130 gene sucC 9323 10492 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388966.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence105 233 694 gene locus_tag LOCUS_17140 gene rirA 233 694 CDS product iron-responsive transcriptional regulator RirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527122.1 protein_id gnl|my_center|LOCUS_17140 2236 734 gene locus_tag LOCUS_17150 2236 734 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382837.1 protein_id gnl|my_center|LOCUS_17150 2770 2330 gene locus_tag LOCUS_17160 2770 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 3837 2848 gene locus_tag LOCUS_17170 3837 2848 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816062.1 protein_id gnl|my_center|LOCUS_17170 4311 5750 gene locus_tag LOCUS_17180 4311 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 6420 6334 gene locus_tag LOCUS_t00130 6420 6334 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6542 7123 gene locus_tag LOCUS_17190 6542 7123 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114135.1 protein_id gnl|my_center|LOCUS_17190 8518 7133 gene locus_tag LOCUS_17200 8518 7133 CDS product ActS/PrrB/RegB family redox-sensitive histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528073.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence106 1293 448 gene locus_tag LOCUS_17210 1293 448 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200941.1 protein_id gnl|my_center|LOCUS_17210 2517 1381 gene locus_tag LOCUS_17220 2517 1381 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390215.1 protein_id gnl|my_center|LOCUS_17220 2921 4180 gene locus_tag LOCUS_17230 2921 4180 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082638.1 protein_id gnl|my_center|LOCUS_17230 5980 4751 gene locus_tag LOCUS_17240 5980 4751 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525384.1 protein_id gnl|my_center|LOCUS_17240 6499 6077 gene locus_tag LOCUS_17250 6499 6077 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971569.1 protein_id gnl|my_center|LOCUS_17250 6777 6496 gene locus_tag LOCUS_17260 6777 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 6938 8365 gene locus_tag LOCUS_17270 gene glgA 6938 8365 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389900.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence107 885 13 gene locus_tag LOCUS_17280 885 13 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969940.1 protein_id gnl|my_center|LOCUS_17280 2283 973 gene locus_tag LOCUS_17290 2283 973 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525578.1 protein_id gnl|my_center|LOCUS_17290 3416 2463 gene locus_tag LOCUS_17300 3416 2463 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329274.1 protein_id gnl|my_center|LOCUS_17300 4501 3512 gene locus_tag LOCUS_17310 4501 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 6370 4523 gene locus_tag LOCUS_17320 gene ilvD 6370 4523 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626247.1 protein_id gnl|my_center|LOCUS_17320 8167 6803 gene locus_tag LOCUS_17330 8167 6803 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074039.1 protein_id gnl|my_center|LOCUS_17330 8363 9460 gene locus_tag LOCUS_17340 8363 9460 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531324.1 protein_id gnl|my_center|LOCUS_17340 10255 9482 gene locus_tag LOCUS_17350 gene gcvA 10255 9482 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389869.1 protein_id gnl|my_center|LOCUS_17350 10160 10417 gene locus_tag LOCUS_17360 10160 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 10521 10760 gene locus_tag LOCUS_17370 10521 10760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 >Feature sequence108 1712 411 gene locus_tag LOCUS_17380 1712 411 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039976.1 protein_id gnl|my_center|LOCUS_17380 2299 1709 gene locus_tag LOCUS_17390 2299 1709 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930617.1 protein_id gnl|my_center|LOCUS_17390 3395 2421 gene locus_tag LOCUS_17400 3395 2421 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811098.1 protein_id gnl|my_center|LOCUS_17400 3568 7179 gene locus_tag LOCUS_17410 3568 7179 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530942.1 protein_id gnl|my_center|LOCUS_17410 7418 8302 gene locus_tag LOCUS_17420 7418 8302 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388147.1 protein_id gnl|my_center|LOCUS_17420 8623 8339 gene locus_tag LOCUS_17430 8623 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 9866 8652 gene locus_tag LOCUS_17440 9866 8652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256189.1 protein_id gnl|my_center|LOCUS_17440 10434 10243 gene locus_tag LOCUS_17450 10434 10243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 10433 10561 gene locus_tag LOCUS_17460 10433 10561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence109 1628 849 gene locus_tag LOCUS_17470 1628 849 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970106.1 protein_id gnl|my_center|LOCUS_17470 2297 1695 gene locus_tag LOCUS_17480 2297 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3349 2366 gene locus_tag LOCUS_17490 3349 2366 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084208.1 protein_id gnl|my_center|LOCUS_17490 4025 3366 gene locus_tag LOCUS_17500 gene ftsE 4025 3366 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010911739.1 protein_id gnl|my_center|LOCUS_17500 4281 5186 gene locus_tag LOCUS_17510 4281 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17510 5187 5567 gene locus_tag LOCUS_17520 5187 5567 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084205.1 protein_id gnl|my_center|LOCUS_17520 5651 6217 gene locus_tag LOCUS_17530 5651 6217 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084194.1 protein_id gnl|my_center|LOCUS_17530 6230 6925 gene locus_tag LOCUS_17540 6230 6925 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240065.1 protein_id gnl|my_center|LOCUS_17540 7041 7790 gene locus_tag LOCUS_17550 7041 7790 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982194.1 protein_id gnl|my_center|LOCUS_17550 7790 8728 gene locus_tag LOCUS_17560 7790 8728 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_17560 8806 9681 gene locus_tag LOCUS_17570 8806 9681 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970098.1 protein_id gnl|my_center|LOCUS_17570 10508 10125 gene locus_tag LOCUS_17580 10508 10125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence110 <1 1833 gene locus_tag LOCUS_17590 <1 1833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973829.1:PhoX family phosphatase 1864 2244 gene locus_tag LOCUS_17600 1864 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2720 2253 gene locus_tag LOCUS_17610 2720 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265691.1 protein_id gnl|my_center|LOCUS_17610 3345 4949 gene locus_tag LOCUS_17620 3345 4949 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919601.1 protein_id gnl|my_center|LOCUS_17620 4993 5892 gene locus_tag LOCUS_17630 4993 5892 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532353.1 protein_id gnl|my_center|LOCUS_17630 6040 6231 gene locus_tag LOCUS_17640 6040 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 6310 7038 gene locus_tag LOCUS_17650 6310 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 7569 7138 gene locus_tag LOCUS_17660 7569 7138 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337364.1 protein_id gnl|my_center|LOCUS_17660 7747 8763 gene locus_tag LOCUS_17670 7747 8763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 8738 9313 gene locus_tag LOCUS_17680 gene rsmD 8738 9313 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532356.1 protein_id gnl|my_center|LOCUS_17680 9350 10357 gene locus_tag LOCUS_17690 gene meaB 9350 10357 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085832.1 protein_id gnl|my_center|LOCUS_17690 10354 10584 gene locus_tag LOCUS_17700 10354 10584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence111 5635 5180 gene locus_tag LOCUS_17710 5635 5180 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530371.1 protein_id gnl|my_center|LOCUS_17710 5776 6240 gene locus_tag LOCUS_17720 5776 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 6437 6724 gene locus_tag LOCUS_17730 6437 6724 CDS product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931203.1 protein_id gnl|my_center|LOCUS_17730 6740 7642 gene locus_tag LOCUS_17740 6740 7642 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665800.1 protein_id gnl|my_center|LOCUS_17740 7639 8418 gene locus_tag LOCUS_17750 7639 8418 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521491.1 protein_id gnl|my_center|LOCUS_17750 8436 8930 gene locus_tag LOCUS_17760 8436 8930 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921090.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence112 532 1539 gene locus_tag LOCUS_17770 532 1539 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_17770 1606 2607 gene locus_tag LOCUS_17780 1606 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 2768 3832 gene locus_tag LOCUS_17790 2768 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 4292 3846 gene locus_tag LOCUS_17800 4292 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 5274 4354 gene locus_tag LOCUS_17810 5274 4354 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073715.1 protein_id gnl|my_center|LOCUS_17810 6706 5381 gene locus_tag LOCUS_17820 6706 5381 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394859.1 protein_id gnl|my_center|LOCUS_17820 8387 6756 gene locus_tag LOCUS_17830 8387 6756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 9475 8585 gene locus_tag LOCUS_17840 9475 8585 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972399.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence113 1743 445 gene locus_tag LOCUS_17850 gene hemN 1743 445 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390257.1 protein_id gnl|my_center|LOCUS_17850 2094 3725 gene locus_tag LOCUS_17860 gene ccoN 2094 3725 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085548.1 protein_id gnl|my_center|LOCUS_17860 3739 4494 gene locus_tag LOCUS_17870 gene ccoO 3739 4494 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085549.1 protein_id gnl|my_center|LOCUS_17870 4509 4658 gene locus_tag LOCUS_17880 4509 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 4663 5529 gene locus_tag LOCUS_17890 gene ccoP 4663 5529 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085551.1 protein_id gnl|my_center|LOCUS_17890 5795 7243 gene locus_tag LOCUS_17900 gene ccoG 5795 7243 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088522.1 protein_id gnl|my_center|LOCUS_17900 7391 7867 gene locus_tag LOCUS_17910 7391 7867 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391072.1 protein_id gnl|my_center|LOCUS_17910 7864 10059 gene locus_tag LOCUS_17920 7864 10059 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085554.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence114 1471 683 gene locus_tag LOCUS_17930 1471 683 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039072.1 protein_id gnl|my_center|LOCUS_17930 2301 1468 gene locus_tag LOCUS_17940 2301 1468 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896977.1 protein_id gnl|my_center|LOCUS_17940 3179 2301 gene locus_tag LOCUS_17950 3179 2301 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066678.1 protein_id gnl|my_center|LOCUS_17950 4639 3299 gene locus_tag LOCUS_17960 4639 3299 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582870.1 protein_id gnl|my_center|LOCUS_17960 4788 5834 gene locus_tag LOCUS_17970 4788 5834 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525573.1 protein_id gnl|my_center|LOCUS_17970 5875 7218 gene locus_tag LOCUS_17980 5875 7218 CDS product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082995.1 protein_id gnl|my_center|LOCUS_17980 7221 7787 gene locus_tag LOCUS_17990 7221 7787 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389121.1 protein_id gnl|my_center|LOCUS_17990 7799 8569 gene locus_tag LOCUS_18000 7799 8569 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728936.1 protein_id gnl|my_center|LOCUS_18000 9206 8607 gene locus_tag LOCUS_18010 9206 8607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence115 105 746 gene locus_tag LOCUS_18020 105 746 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809123.1 protein_id gnl|my_center|LOCUS_18020 3884 765 gene locus_tag LOCUS_18030 3884 765 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_18030 5116 3881 gene locus_tag LOCUS_18040 5116 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 5435 6598 gene locus_tag LOCUS_18050 gene argE 5435 6598 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106035.1 protein_id gnl|my_center|LOCUS_18050 6830 7204 gene locus_tag LOCUS_18060 6830 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 7815 7264 gene locus_tag LOCUS_18070 7815 7264 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920788.1 protein_id gnl|my_center|LOCUS_18070 8411 7827 gene locus_tag LOCUS_18080 8411 7827 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242000.1 protein_id gnl|my_center|LOCUS_18080 8545 9927 gene locus_tag LOCUS_18090 gene eno 8545 9927 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975249.1 protein_id gnl|my_center|LOCUS_18090 9990 10066 gene locus_tag LOCUS_t00140 9990 10066 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence116 837 7 gene locus_tag LOCUS_18100 837 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 2192 903 gene locus_tag LOCUS_18110 gene glgC 2192 903 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 protein_id gnl|my_center|LOCUS_18110 2491 3855 gene locus_tag LOCUS_18120 2491 3855 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388889.1 protein_id gnl|my_center|LOCUS_18120 4039 5787 gene locus_tag LOCUS_18130 4039 5787 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 protein_id gnl|my_center|LOCUS_18130 7011 5794 gene locus_tag LOCUS_18140 7011 5794 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085615.1 protein_id gnl|my_center|LOCUS_18140 7331 7011 gene locus_tag LOCUS_18150 7331 7011 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 protein_id gnl|my_center|LOCUS_18150 7591 8439 gene locus_tag LOCUS_18160 7591 8439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 8475 9932 gene locus_tag LOCUS_18170 8475 9932 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394946.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence117 1705 431 gene locus_tag LOCUS_18180 gene clpX 1705 431 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312723.1 protein_id gnl|my_center|LOCUS_18180 2015 2797 gene locus_tag LOCUS_18190 2015 2797 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921271.1 protein_id gnl|my_center|LOCUS_18190 3511 2873 gene locus_tag LOCUS_18200 3511 2873 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087708.1 protein_id gnl|my_center|LOCUS_18200 3738 4169 gene locus_tag LOCUS_18210 3738 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 5684 4245 gene locus_tag LOCUS_18220 gene tig 5684 4245 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532009.1 protein_id gnl|my_center|LOCUS_18220 6641 5850 gene locus_tag LOCUS_18230 6641 5850 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172853.1 protein_id gnl|my_center|LOCUS_18230 6847 7338 gene locus_tag LOCUS_18240 6847 7338 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531271.1 protein_id gnl|my_center|LOCUS_18240 7825 7349 gene locus_tag LOCUS_18250 7825 7349 CDS product lpg2434 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948137.1 protein_id gnl|my_center|LOCUS_18250 8209 7847 gene locus_tag LOCUS_18260 8209 7847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 8384 8300 gene locus_tag LOCUS_t00150 8384 8300 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8705 8487 gene locus_tag LOCUS_18270 8705 8487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 9384 8866 gene locus_tag LOCUS_18280 9384 8866 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975614.1 protein_id gnl|my_center|LOCUS_18280 10022 9381 gene locus_tag LOCUS_18290 10022 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 >Feature sequence118 6045 1915 gene locus_tag LOCUS_18300 gene rpoB 6045 1915 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536195.1 protein_id gnl|my_center|LOCUS_18300 6611 6237 gene locus_tag LOCUS_18310 gene rplL 6611 6237 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088160.1 protein_id gnl|my_center|LOCUS_18310 7177 6659 gene locus_tag LOCUS_18320 gene rplJ 7177 6659 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531412.1 protein_id gnl|my_center|LOCUS_18320 8217 7519 gene locus_tag LOCUS_18330 gene rplA 8217 7519 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536190.1 protein_id gnl|my_center|LOCUS_18330 8648 8220 gene locus_tag LOCUS_18340 gene rplK 8648 8220 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088164.1 protein_id gnl|my_center|LOCUS_18340 9292 8762 gene locus_tag LOCUS_18350 gene nusG 9292 8762 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707742.1 protein_id gnl|my_center|LOCUS_18350 9570 9313 gene locus_tag LOCUS_18360 9570 9313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 9731 9656 gene locus_tag LOCUS_t00160 9731 9656 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence119 751 275 gene locus_tag LOCUS_18370 gene rlmH 751 275 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083264.1 protein_id gnl|my_center|LOCUS_18370 1176 940 gene locus_tag LOCUS_18380 1176 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 1063 1374 gene locus_tag LOCUS_18390 1063 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 2743 1514 gene locus_tag LOCUS_18400 gene ispG 2743 1514 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083758.1 protein_id gnl|my_center|LOCUS_18400 3633 2854 gene locus_tag LOCUS_18410 3633 2854 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310857.1 protein_id gnl|my_center|LOCUS_18410 3775 4371 gene locus_tag LOCUS_18420 3775 4371 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_18420 4368 5174 gene locus_tag LOCUS_18430 gene fetB 4368 5174 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_18430 5686 5204 gene locus_tag LOCUS_18440 5686 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 5685 5864 gene locus_tag LOCUS_18450 5685 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 5947 7170 gene locus_tag LOCUS_18460 5947 7170 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918018.1 protein_id gnl|my_center|LOCUS_18460 7209 7772 gene locus_tag LOCUS_18470 7209 7772 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083303.1 protein_id gnl|my_center|LOCUS_18470 7769 8224 gene locus_tag LOCUS_18480 7769 8224 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740056.1 protein_id gnl|my_center|LOCUS_18480 8805 8239 gene locus_tag LOCUS_18490 8805 8239 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006328497.1 protein_id gnl|my_center|LOCUS_18490 8947 9855 gene locus_tag LOCUS_18500 8947 9855 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970113.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence120 <1 957 gene locus_tag LOCUS_18510 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444101.1:catalase/peroxidase HPI 1609 1103 gene locus_tag LOCUS_18520 1609 1103 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415815.1 protein_id gnl|my_center|LOCUS_18520 2592 1606 gene locus_tag LOCUS_18530 gene alc 2592 1606 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531999.1 protein_id gnl|my_center|LOCUS_18530 3459 2611 gene locus_tag LOCUS_18540 gene qapR 3459 2611 CDS product transcriptional repressor QapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099726.1 protein_id gnl|my_center|LOCUS_18540 3586 4104 gene locus_tag LOCUS_18550 3586 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 4108 5388 gene locus_tag LOCUS_18560 4108 5388 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113810.1 protein_id gnl|my_center|LOCUS_18560 5432 6472 gene locus_tag LOCUS_18570 5432 6472 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253036.1 protein_id gnl|my_center|LOCUS_18570 6557 7750 gene locus_tag LOCUS_18580 6557 7750 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064255.1 protein_id gnl|my_center|LOCUS_18580 7751 9010 gene locus_tag LOCUS_18590 7751 9010 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence121 607 2043 gene locus_tag LOCUS_18600 607 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 2296 4023 gene locus_tag LOCUS_18610 2296 4023 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085840.1 protein_id gnl|my_center|LOCUS_18610 4020 6164 gene locus_tag LOCUS_18620 gene scpA 4020 6164 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085838.1 protein_id gnl|my_center|LOCUS_18620 6478 6179 gene locus_tag LOCUS_18630 6478 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 8304 6613 gene locus_tag LOCUS_18640 8304 6613 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114551.1 protein_id gnl|my_center|LOCUS_18640 8992 8402 gene locus_tag LOCUS_18650 8992 8402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 9620 9216 gene locus_tag LOCUS_18660 9620 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence122 465 184 gene locus_tag LOCUS_18670 465 184 CDS product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503495.1 protein_id gnl|my_center|LOCUS_18670 1281 481 gene locus_tag LOCUS_18680 1281 481 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067119.1 protein_id gnl|my_center|LOCUS_18680 2147 1281 gene locus_tag LOCUS_18690 2147 1281 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531810.1 protein_id gnl|my_center|LOCUS_18690 3224 2157 gene locus_tag LOCUS_18700 3224 2157 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067117.1 protein_id gnl|my_center|LOCUS_18700 4332 3259 gene locus_tag LOCUS_18710 4332 3259 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973409.1 protein_id gnl|my_center|LOCUS_18710 6246 4507 gene locus_tag LOCUS_18720 6246 4507 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148771775.1 protein_id gnl|my_center|LOCUS_18720 6403 7173 gene locus_tag LOCUS_18730 6403 7173 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531814.1 protein_id gnl|my_center|LOCUS_18730 7270 8796 gene locus_tag LOCUS_18740 gene glpD 7270 8796 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085223.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence123 523 1029 gene locus_tag LOCUS_18750 523 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102045240.1 protein_id gnl|my_center|LOCUS_18750 1440 1066 gene locus_tag LOCUS_18760 1440 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 1695 1991 gene locus_tag LOCUS_18770 1695 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 2022 2489 gene locus_tag LOCUS_18780 2022 2489 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334532.1 protein_id gnl|my_center|LOCUS_18780 2553 3458 gene locus_tag LOCUS_18790 gene rimK 2553 3458 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096254.1 protein_id gnl|my_center|LOCUS_18790 3497 4540 gene locus_tag LOCUS_18800 3497 4540 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_18800 5171 4548 gene locus_tag LOCUS_18810 5171 4548 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970026.1 protein_id gnl|my_center|LOCUS_18810 6291 5182 gene locus_tag LOCUS_18820 6291 5182 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_18820 7063 6293 gene locus_tag LOCUS_18830 gene kduD 7063 6293 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_18830 7916 7092 gene locus_tag LOCUS_18840 gene kduI 7916 7092 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972792.1 protein_id gnl|my_center|LOCUS_18840 8331 8014 gene locus_tag LOCUS_18850 8331 8014 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338257.1 protein_id gnl|my_center|LOCUS_18850 9623 8343 gene locus_tag LOCUS_18860 9623 8343 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720648.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence124 16 942 gene locus_tag LOCUS_18870 gene tsf 16 942 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312544.1 protein_id gnl|my_center|LOCUS_18870 1145 1861 gene locus_tag LOCUS_18880 gene pyrH 1145 1861 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919787.1 protein_id gnl|my_center|LOCUS_18880 1880 2461 gene locus_tag LOCUS_18890 gene frr 1880 2461 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171750.1 protein_id gnl|my_center|LOCUS_18890 2526 3284 gene locus_tag LOCUS_18900 2526 3284 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971573.1 protein_id gnl|my_center|LOCUS_18900 3358 4131 gene locus_tag LOCUS_18910 3358 4131 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969257.1 protein_id gnl|my_center|LOCUS_18910 4125 5354 gene locus_tag LOCUS_18920 4125 5354 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389467.1 protein_id gnl|my_center|LOCUS_18920 5382 6515 gene locus_tag LOCUS_18930 gene rseP 5382 6515 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087622.1 protein_id gnl|my_center|LOCUS_18930 6613 8910 gene locus_tag LOCUS_18940 gene bamA 6613 8910 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640362.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence125 647 1042 gene locus_tag LOCUS_18950 647 1042 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529181.1 protein_id gnl|my_center|LOCUS_18950 1219 1557 gene locus_tag LOCUS_18960 1219 1557 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529180.1 protein_id gnl|my_center|LOCUS_18960 1912 2493 gene locus_tag LOCUS_18970 1912 2493 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709746.1 protein_id gnl|my_center|LOCUS_18970 3227 2520 gene locus_tag LOCUS_18980 3227 2520 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387844.1 protein_id gnl|my_center|LOCUS_18980 4742 3336 gene locus_tag LOCUS_18990 gene lpdA 4742 3336 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083281.1 protein_id gnl|my_center|LOCUS_18990 5971 4751 gene locus_tag LOCUS_19000 gene odhB 5971 4751 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972452.1 protein_id gnl|my_center|LOCUS_19000 8947 5990 gene locus_tag LOCUS_19010 8947 5990 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083284.1 protein_id gnl|my_center|LOCUS_19010 <9629 9048 gene locus_tag LOCUS_19020 <9629 9048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388967.1:succinate--CoA ligase subunit alpha >Feature sequence126 909 2165 gene locus_tag LOCUS_19030 909 2165 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336782.1 protein_id gnl|my_center|LOCUS_19030 2568 2212 gene locus_tag LOCUS_19040 2568 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 3161 2706 gene locus_tag LOCUS_19050 3161 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 3487 3411 gene locus_tag LOCUS_t00170 3487 3411 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3614 3688 gene locus_tag LOCUS_t00180 3614 3688 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4660 3743 gene locus_tag LOCUS_19060 4660 3743 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338180.1 protein_id gnl|my_center|LOCUS_19060 5963 4680 gene locus_tag LOCUS_19070 gene glpB 5963 4680 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939225.1 protein_id gnl|my_center|LOCUS_19070 7576 5960 gene locus_tag LOCUS_19080 gene glpA 7576 5960 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939226.1 protein_id gnl|my_center|LOCUS_19080 8871 7573 gene locus_tag LOCUS_19090 8871 7573 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939741.1 protein_id gnl|my_center|LOCUS_19090 <9608 8893 gene locus_tag LOCUS_19100 <9608 8893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531806.1:glycerol kinase GlpK >Feature sequence127 166 1692 gene locus_tag LOCUS_19110 166 1692 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724194.1 protein_id gnl|my_center|LOCUS_19110 1685 2944 gene locus_tag LOCUS_19120 1685 2944 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529614.1 protein_id gnl|my_center|LOCUS_19120 4273 2948 gene locus_tag LOCUS_19130 4273 2948 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529438.1 protein_id gnl|my_center|LOCUS_19130 5436 4270 gene locus_tag LOCUS_19140 5436 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 5676 6872 gene locus_tag LOCUS_19150 5676 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 8259 6946 gene locus_tag LOCUS_19160 8259 6946 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931585.1 protein_id gnl|my_center|LOCUS_19160 8738 8310 gene locus_tag LOCUS_19170 8738 8310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 <9505 8750 gene locus_tag LOCUS_19180 <9505 8750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387830.1:ABC transporter ATP-binding protein >Feature sequence128 1877 1578 gene locus_tag LOCUS_19190 1877 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 2160 2678 gene locus_tag LOCUS_19200 2160 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 2682 3359 gene locus_tag LOCUS_19210 2682 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 3397 3705 gene locus_tag LOCUS_19220 3397 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 3709 3915 gene locus_tag LOCUS_19230 3709 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 4030 4299 gene locus_tag LOCUS_19240 4030 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 4302 5264 gene locus_tag LOCUS_19250 4302 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 5266 5559 gene locus_tag LOCUS_19260 5266 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 5584 5862 gene locus_tag LOCUS_19270 5584 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 5879 6070 gene locus_tag LOCUS_19280 5879 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 6104 7051 gene locus_tag LOCUS_19290 6104 7051 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970702.1 protein_id gnl|my_center|LOCUS_19290 7069 7749 gene locus_tag LOCUS_19300 7069 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 7746 9053 gene locus_tag LOCUS_19310 7746 9053 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135359221.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence129 194 658 gene locus_tag LOCUS_19320 194 658 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531968.1 protein_id gnl|my_center|LOCUS_19320 658 1542 gene locus_tag LOCUS_19330 658 1542 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 protein_id gnl|my_center|LOCUS_19330 2096 1518 gene locus_tag LOCUS_19340 2096 1518 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157335780.1 protein_id gnl|my_center|LOCUS_19340 2550 2341 gene locus_tag LOCUS_19350 2550 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2453 4144 gene locus_tag LOCUS_19360 2453 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 6180 4258 gene locus_tag LOCUS_19370 gene thrS 6180 4258 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391234.1 protein_id gnl|my_center|LOCUS_19370 6595 6230 gene locus_tag LOCUS_19380 6595 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 7038 6592 gene locus_tag LOCUS_19390 7038 6592 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088271.1 protein_id gnl|my_center|LOCUS_19390 7432 9057 gene locus_tag LOCUS_19400 7432 9057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 >Feature sequence130 618 1400 gene locus_tag LOCUS_19410 618 1400 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 protein_id gnl|my_center|LOCUS_19410 2883 1525 gene locus_tag LOCUS_19420 2883 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 3472 2873 gene locus_tag LOCUS_19430 gene napC 3472 2873 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815830.1 protein_id gnl|my_center|LOCUS_19430 4246 3518 gene locus_tag LOCUS_19440 4246 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 4465 5895 gene locus_tag LOCUS_19450 4465 5895 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401097.1 protein_id gnl|my_center|LOCUS_19450 5895 6578 gene locus_tag LOCUS_19460 5895 6578 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528674.1 protein_id gnl|my_center|LOCUS_19460 7306 6587 gene locus_tag LOCUS_19470 7306 6587 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085503.1 protein_id gnl|my_center|LOCUS_19470 8825 7362 gene locus_tag LOCUS_19480 8825 7362 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388889.1 protein_id gnl|my_center|LOCUS_19480 9353 9042 gene locus_tag LOCUS_19490 9353 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 >Feature sequence131 237 461 gene locus_tag LOCUS_19500 237 461 CDS product FeoC-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390224.1 protein_id gnl|my_center|LOCUS_19500 585 1094 gene locus_tag LOCUS_19510 gene gpt 585 1094 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175425.1 protein_id gnl|my_center|LOCUS_19510 2340 1267 gene locus_tag LOCUS_19520 2340 1267 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_19520 3315 2389 gene locus_tag LOCUS_19530 3315 2389 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 protein_id gnl|my_center|LOCUS_19530 4391 3315 gene locus_tag LOCUS_19540 4391 3315 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 protein_id gnl|my_center|LOCUS_19540 6004 4388 gene locus_tag LOCUS_19550 6004 4388 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389658.1 protein_id gnl|my_center|LOCUS_19550 6280 6852 gene locus_tag LOCUS_19560 6280 6852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529921.1 protein_id gnl|my_center|LOCUS_19560 7061 8788 gene locus_tag LOCUS_19570 7061 8788 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640164.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence132 114 1286 gene locus_tag LOCUS_19580 114 1286 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388922.1 protein_id gnl|my_center|LOCUS_19580 1286 1627 gene locus_tag LOCUS_19590 gene hypA 1286 1627 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084541.1 protein_id gnl|my_center|LOCUS_19590 1949 1605 gene locus_tag LOCUS_19600 1949 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 1872 2552 gene locus_tag LOCUS_19610 gene hypB 1872 2552 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388924.1 protein_id gnl|my_center|LOCUS_19610 2566 2814 gene locus_tag LOCUS_19620 2566 2814 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_19620 2811 3947 gene locus_tag LOCUS_19630 gene hypD 2811 3947 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_19630 3944 4993 gene locus_tag LOCUS_19640 gene hypE 3944 4993 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_19640 5009 6724 gene locus_tag LOCUS_19650 5009 6724 CDS product hydrogenase maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089664.1 protein_id gnl|my_center|LOCUS_19650 6721 8193 gene locus_tag LOCUS_19660 6721 8193 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089663.1 protein_id gnl|my_center|LOCUS_19660 >Feature sequence133 207 584 gene locus_tag LOCUS_19670 207 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 1575 622 gene locus_tag LOCUS_19680 1575 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 1816 1995 gene locus_tag LOCUS_19690 1816 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 2485 2210 gene locus_tag LOCUS_19700 2485 2210 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165613498.1 protein_id gnl|my_center|LOCUS_19700 2774 2496 gene locus_tag LOCUS_19710 2774 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 2945 4057 gene locus_tag LOCUS_19720 2945 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 5217 4660 gene locus_tag LOCUS_19730 5217 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 7736 5298 gene locus_tag LOCUS_19740 7736 5298 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941696.1 protein_id gnl|my_center|LOCUS_19740 8538 8059 gene locus_tag LOCUS_19750 8538 8059 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671531.1 protein_id gnl|my_center|LOCUS_19750 8780 8932 gene locus_tag LOCUS_19760 8780 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence134 158 1501 gene locus_tag LOCUS_19770 158 1501 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152045320.1 protein_id gnl|my_center|LOCUS_19770 1694 3979 gene locus_tag LOCUS_19780 1694 3979 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083797.1 protein_id gnl|my_center|LOCUS_19780 3976 4683 gene locus_tag LOCUS_19790 3976 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 5126 4596 gene locus_tag LOCUS_19800 5126 4596 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533965.1 protein_id gnl|my_center|LOCUS_19800 5581 5123 gene locus_tag LOCUS_19810 5581 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 6259 5720 gene locus_tag LOCUS_19820 6259 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 6899 6531 gene locus_tag LOCUS_19830 6899 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 >Feature sequence135 631 2130 gene locus_tag LOCUS_19840 631 2130 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529737.1 protein_id gnl|my_center|LOCUS_19840 2224 3930 gene locus_tag LOCUS_19850 2224 3930 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337736.1 protein_id gnl|my_center|LOCUS_19850 2276 2352 gene locus_tag LOCUS_t00190 2276 2352 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4238 5698 gene locus_tag LOCUS_19860 4238 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 6044 5799 gene locus_tag LOCUS_19870 6044 5799 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066896.1 protein_id gnl|my_center|LOCUS_19870 6923 6087 gene locus_tag LOCUS_19880 6923 6087 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973301.1 protein_id gnl|my_center|LOCUS_19880 7230 7598 gene locus_tag LOCUS_19890 7230 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 7595 9034 gene locus_tag LOCUS_19900 gene pyk 7595 9034 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529204.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence136 <1 1089 gene locus_tag LOCUS_19910 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390236.1:5'-nucleotidase C-terminal domain-containing protein 1127 2179 gene locus_tag LOCUS_19920 1127 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2277 2447 gene locus_tag LOCUS_19930 2277 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2991 2512 gene locus_tag LOCUS_19940 2991 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 4257 3214 gene locus_tag LOCUS_19950 4257 3214 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206266.1 protein_id gnl|my_center|LOCUS_19950 4672 4881 gene locus_tag LOCUS_19960 4672 4881 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920741.1 protein_id gnl|my_center|LOCUS_19960 5203 6453 gene locus_tag LOCUS_19970 5203 6453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 7618 6479 gene locus_tag LOCUS_19980 7618 6479 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966323.1 protein_id gnl|my_center|LOCUS_19980 8093 7731 gene locus_tag LOCUS_19990 8093 7731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 8766 8149 gene locus_tag LOCUS_20000 8766 8149 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390033.1 protein_id gnl|my_center|LOCUS_20000 9084 8857 gene locus_tag LOCUS_20010 9084 8857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 >Feature sequence137 1526 333 gene locus_tag LOCUS_20020 1526 333 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037257.1 protein_id gnl|my_center|LOCUS_20020 3579 1519 gene locus_tag LOCUS_20030 3579 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039745.1 protein_id gnl|my_center|LOCUS_20030 4003 3584 gene locus_tag LOCUS_20040 4003 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 7087 4337 gene locus_tag LOCUS_20050 7087 4337 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048879517.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence138 611 808 gene locus_tag LOCUS_20060 611 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 2896 812 gene locus_tag LOCUS_20070 2896 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 3616 3954 gene locus_tag LOCUS_20080 3616 3954 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528889.1 protein_id gnl|my_center|LOCUS_20080 3968 5260 gene locus_tag LOCUS_20090 3968 5260 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388884.1 protein_id gnl|my_center|LOCUS_20090 7497 5779 gene locus_tag LOCUS_20100 7497 5779 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 protein_id gnl|my_center|LOCUS_20100 7964 7494 gene locus_tag LOCUS_20110 7964 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 <8990 7969 gene locus_tag LOCUS_20120 <8990 7969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880594.1:(Fe-S)-binding protein >Feature sequence139 <1 2790 gene locus_tag LOCUS_20130 <1 2790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_060563188.1:type I polyketide synthase 2787 4163 gene locus_tag LOCUS_20140 2787 4163 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391972.1 protein_id gnl|my_center|LOCUS_20140 4173 4844 gene locus_tag LOCUS_20150 4173 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 5007 6836 gene locus_tag LOCUS_20160 5007 6836 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531038.1 protein_id gnl|my_center|LOCUS_20160 7045 7794 gene locus_tag LOCUS_20170 7045 7794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 8055 7980 gene locus_tag LOCUS_t00200 8055 7980 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 8661 8125 gene locus_tag LOCUS_20180 8661 8125 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086924.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence140 833 1876 gene locus_tag LOCUS_20190 833 1876 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784324.1 protein_id gnl|my_center|LOCUS_20190 1946 4045 gene locus_tag LOCUS_20200 1946 4045 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168575.1 protein_id gnl|my_center|LOCUS_20200 4101 5171 gene locus_tag LOCUS_20210 gene fbpC 4101 5171 CDS product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816658.1 protein_id gnl|my_center|LOCUS_20210 5361 5984 gene locus_tag LOCUS_20220 5361 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 7772 6009 gene locus_tag LOCUS_20230 7772 6009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 8719 8006 gene locus_tag LOCUS_20240 8719 8006 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967636.1 protein_id gnl|my_center|LOCUS_20240 >Feature sequence141 981 328 gene locus_tag LOCUS_20250 981 328 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965381.1 protein_id gnl|my_center|LOCUS_20250 1667 1038 gene locus_tag LOCUS_20260 1667 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 2132 2899 gene locus_tag LOCUS_20270 2132 2899 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086581.1 protein_id gnl|my_center|LOCUS_20270 2912 3766 gene locus_tag LOCUS_20280 2912 3766 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086582.1 protein_id gnl|my_center|LOCUS_20280 4669 3776 gene locus_tag LOCUS_20290 4669 3776 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965125.1 protein_id gnl|my_center|LOCUS_20290 5628 4786 gene locus_tag LOCUS_20300 5628 4786 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083458.1 protein_id gnl|my_center|LOCUS_20300 6245 5634 gene locus_tag LOCUS_20310 gene rsmG 6245 5634 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391373.1 protein_id gnl|my_center|LOCUS_20310 8141 6276 gene locus_tag LOCUS_20320 gene mnmG 8141 6276 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083460.1 protein_id gnl|my_center|LOCUS_20320 <8881 8186 gene locus_tag LOCUS_20330 <8881 8186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083461.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE >Feature sequence142 2 274 gene locus_tag LOCUS_20340 2 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 1283 327 gene locus_tag LOCUS_20350 1283 327 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_20350 1787 1302 gene locus_tag LOCUS_20360 1787 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 2044 4359 gene locus_tag LOCUS_20370 2044 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20370 3717 3728 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4247 4837 gene locus_tag LOCUS_20380 4247 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 4834 4998 gene locus_tag LOCUS_20390 4834 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 5030 5860 gene locus_tag LOCUS_20400 5030 5860 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088209.1 protein_id gnl|my_center|LOCUS_20400 5921 6412 gene locus_tag LOCUS_20410 gene coaD 5921 6412 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087462.1 protein_id gnl|my_center|LOCUS_20410 6472 7089 gene locus_tag LOCUS_20420 6472 7089 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389495.1 protein_id gnl|my_center|LOCUS_20420 7119 7595 gene locus_tag LOCUS_20430 7119 7595 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087459.1 protein_id gnl|my_center|LOCUS_20430 >Feature sequence143 323 934 gene locus_tag LOCUS_20440 323 934 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532395.1 protein_id gnl|my_center|LOCUS_20440 1819 983 gene locus_tag LOCUS_20450 1819 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 1984 3507 gene locus_tag LOCUS_20460 1984 3507 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921024.1 protein_id gnl|my_center|LOCUS_20460 3523 4356 gene locus_tag LOCUS_20470 gene kdsA 3523 4356 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087568.1 protein_id gnl|my_center|LOCUS_20470 4353 5393 gene locus_tag LOCUS_20480 gene siaP 4353 5393 CDS product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694430.1 protein_id gnl|my_center|LOCUS_20480 5535 6683 gene locus_tag LOCUS_20490 gene msrB 5535 6683 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479994.1 protein_id gnl|my_center|LOCUS_20490 7279 6704 gene locus_tag LOCUS_20500 7279 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence144 299 961 gene locus_tag LOCUS_20510 299 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 1247 996 gene locus_tag LOCUS_20520 1247 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 1463 1314 gene locus_tag LOCUS_20530 1463 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 6242 1467 gene locus_tag LOCUS_20540 6242 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 6901 7200 gene locus_tag LOCUS_20550 6901 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 >Feature sequence145 850 1833 gene locus_tag LOCUS_20560 850 1833 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526839.1 protein_id gnl|my_center|LOCUS_20560 1867 2445 gene locus_tag LOCUS_20570 1867 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 2519 2713 gene locus_tag LOCUS_20580 2519 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 2844 3506 gene locus_tag LOCUS_20590 2844 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 3520 5004 gene locus_tag LOCUS_20600 3520 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 5029 6516 gene locus_tag LOCUS_20610 5029 6516 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969453.1 protein_id gnl|my_center|LOCUS_20610 7151 6687 gene locus_tag LOCUS_20620 7151 6687 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_20620 7888 7199 gene locus_tag LOCUS_20630 7888 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 >Feature sequence146 655 1305 gene locus_tag LOCUS_20640 655 1305 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880523.1 protein_id gnl|my_center|LOCUS_20640 1516 2130 gene locus_tag LOCUS_20650 1516 2130 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969359.1 protein_id gnl|my_center|LOCUS_20650 3089 2145 gene locus_tag LOCUS_20660 3089 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 3244 5007 gene locus_tag LOCUS_20670 3244 5007 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171602985.1 protein_id gnl|my_center|LOCUS_20670 5111 5911 gene locus_tag LOCUS_20680 5111 5911 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170843.1 protein_id gnl|my_center|LOCUS_20680 5980 6693 gene locus_tag LOCUS_20690 5980 6693 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922379.1 protein_id gnl|my_center|LOCUS_20690 6826 7815 gene locus_tag LOCUS_20700 6826 7815 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390879.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence147 2851 110 gene locus_tag LOCUS_20710 gene mutS 2851 110 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083746.1 protein_id gnl|my_center|LOCUS_20710 2975 3865 gene locus_tag LOCUS_20720 gene mepA 2975 3865 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968392.1 protein_id gnl|my_center|LOCUS_20720 3862 4644 gene locus_tag LOCUS_20730 3862 4644 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083731.1 protein_id gnl|my_center|LOCUS_20730 4650 5852 gene locus_tag LOCUS_20740 4650 5852 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706371.1 protein_id gnl|my_center|LOCUS_20740 7902 5842 gene locus_tag LOCUS_20750 7902 5842 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241759.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence148 <1 513 gene locus_tag LOCUS_20760 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969961.1:urease subunit alpha 522 1013 gene locus_tag LOCUS_20770 522 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 1021 1734 gene locus_tag LOCUS_20780 1021 1734 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084275.1 protein_id gnl|my_center|LOCUS_20780 1731 2354 gene locus_tag LOCUS_20790 gene ureG 1731 2354 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084276.1 protein_id gnl|my_center|LOCUS_20790 2430 3203 gene locus_tag LOCUS_20800 gene modA 2430 3203 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808340.1 protein_id gnl|my_center|LOCUS_20800 3207 3884 gene locus_tag LOCUS_20810 gene modB 3207 3884 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_20810 3889 4986 gene locus_tag LOCUS_20820 gene modC 3889 4986 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972403.1 protein_id gnl|my_center|LOCUS_20820 6003 4957 gene locus_tag LOCUS_20830 6003 4957 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967713.1 protein_id gnl|my_center|LOCUS_20830 6234 7445 gene locus_tag LOCUS_20840 6234 7445 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482300.1 protein_id gnl|my_center|LOCUS_20840 7560 7952 gene locus_tag LOCUS_20850 7560 7952 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114392.1 protein_id gnl|my_center|LOCUS_20850 >Feature sequence149 <1 4179 gene locus_tag LOCUS_20860 <1 4179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099258551.1:cadherin domain-containing protein 4176 7142 gene locus_tag LOCUS_20870 4176 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 7139 7906 gene locus_tag LOCUS_20880 7139 7906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 >Feature sequence150 84 1442 gene locus_tag LOCUS_20890 84 1442 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529844.1 protein_id gnl|my_center|LOCUS_20890 1492 3666 gene locus_tag LOCUS_20900 1492 3666 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529845.1 protein_id gnl|my_center|LOCUS_20900 3696 4979 gene locus_tag LOCUS_20910 3696 4979 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529846.1 protein_id gnl|my_center|LOCUS_20910 5021 5605 gene locus_tag LOCUS_20920 5021 5605 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502654.1 protein_id gnl|my_center|LOCUS_20920 6484 5618 gene locus_tag LOCUS_20930 6484 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence151 <1 688 gene locus_tag LOCUS_20940 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971139.1:SURF1 family protein 1163 669 gene locus_tag LOCUS_20950 1163 669 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258625.1 protein_id gnl|my_center|LOCUS_20950 2481 1156 gene locus_tag LOCUS_20960 2481 1156 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142660068.1 protein_id gnl|my_center|LOCUS_20960 3250 2474 gene locus_tag LOCUS_20970 3250 2474 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_20970 4120 3254 gene locus_tag LOCUS_20980 4120 3254 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948171.1 protein_id gnl|my_center|LOCUS_20980 4685 4149 gene locus_tag LOCUS_20990 4685 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 5865 4687 gene locus_tag LOCUS_21000 5865 4687 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_21000 6443 6192 gene locus_tag LOCUS_21010 6443 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 7708 6443 gene locus_tag LOCUS_21020 gene dinB 7708 6443 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392743.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence152 1745 1128 gene locus_tag LOCUS_21030 gene rdgB 1745 1128 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399607.1 protein_id gnl|my_center|LOCUS_21030 2463 1750 gene locus_tag LOCUS_21040 gene rph 2463 1750 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528632.1 protein_id gnl|my_center|LOCUS_21040 2571 3623 gene locus_tag LOCUS_21050 gene hrcA 2571 3623 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528633.1 protein_id gnl|my_center|LOCUS_21050 3684 4361 gene locus_tag LOCUS_21060 3684 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 4408 7272 gene locus_tag LOCUS_21070 gene polA 4408 7272 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173101.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence153 1717 320 gene locus_tag LOCUS_21080 gene tolC 1717 320 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328210.1 protein_id gnl|my_center|LOCUS_21080 2218 1865 gene locus_tag LOCUS_21090 2218 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2492 3769 gene locus_tag LOCUS_21100 2492 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 3929 4651 gene locus_tag LOCUS_21110 3929 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 4684 6249 gene locus_tag LOCUS_21120 4684 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 6405 7829 gene locus_tag LOCUS_21130 6405 7829 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence154 <1 1090 gene locus_tag LOCUS_21140 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532445.1:phosphoribosylformylglycinamidine cyclo-ligase 1093 1746 gene locus_tag LOCUS_21150 gene purN 1093 1746 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390017.1 protein_id gnl|my_center|LOCUS_21150 2019 2549 gene locus_tag LOCUS_21160 2019 2549 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876531.1 protein_id gnl|my_center|LOCUS_21160 3982 2627 gene locus_tag LOCUS_21170 3982 2627 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_21170 5483 4200 gene locus_tag LOCUS_21180 5483 4200 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187435849.1 protein_id gnl|my_center|LOCUS_21180 6036 5614 gene locus_tag LOCUS_21190 gene ndk 6036 5614 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531616.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence155 422 177 gene locus_tag LOCUS_21200 422 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 437 1489 gene locus_tag LOCUS_21210 437 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 1641 2393 gene locus_tag LOCUS_21220 1641 2393 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537698.1 protein_id gnl|my_center|LOCUS_21220 2504 2890 gene locus_tag LOCUS_21230 2504 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 3208 4422 gene locus_tag LOCUS_21240 gene hemA 3208 4422 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257975.1 protein_id gnl|my_center|LOCUS_21240 4419 4619 gene locus_tag LOCUS_21250 4419 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 5340 4648 gene locus_tag LOCUS_21260 5340 4648 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087800.1 protein_id gnl|my_center|LOCUS_21260 6060 5533 gene locus_tag LOCUS_21270 6060 5533 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171628.1 protein_id gnl|my_center|LOCUS_21270 6165 6659 gene locus_tag LOCUS_21280 6165 6659 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206712.1 protein_id gnl|my_center|LOCUS_21280 6771 7370 gene locus_tag LOCUS_21290 6771 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 7624 7382 gene locus_tag LOCUS_21300 7624 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence156 210 788 gene locus_tag LOCUS_21310 210 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 885 1253 gene locus_tag LOCUS_21320 885 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21320 1193 1645 gene locus_tag LOCUS_21330 1193 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21330 3655 1712 gene locus_tag LOCUS_21340 3655 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 3830 3621 gene locus_tag LOCUS_21350 3830 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 5311 3803 gene locus_tag LOCUS_21360 5311 3803 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069332664.1 protein_id gnl|my_center|LOCUS_21360 5744 5397 gene locus_tag LOCUS_21370 gene tnpB 5744 5397 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624622.1 protein_id gnl|my_center|LOCUS_21370 6151 5741 gene locus_tag LOCUS_21380 6151 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 7762 6986 gene locus_tag LOCUS_21390 gene rfbF 7762 6986 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707823.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence157 530 1075 gene locus_tag LOCUS_21400 530 1075 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 protein_id gnl|my_center|LOCUS_21400 1221 2234 gene locus_tag LOCUS_21410 1221 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2470 3654 gene locus_tag LOCUS_21420 2470 3654 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533638.1 protein_id gnl|my_center|LOCUS_21420 3707 4174 gene locus_tag LOCUS_21430 3707 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 4312 6741 gene locus_tag LOCUS_21440 gene copA1 4312 6741 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_21440 6738 7154 gene locus_tag LOCUS_21450 gene cueR 6738 7154 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 protein_id gnl|my_center|LOCUS_21450 7249 7593 gene locus_tag LOCUS_21460 7249 7593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 7676 7751 gene locus_tag LOCUS_t00210 7676 7751 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence158 503 39 gene locus_tag LOCUS_21470 503 39 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971051.1 protein_id gnl|my_center|LOCUS_21470 659 1675 gene locus_tag LOCUS_21480 659 1675 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971052.1 protein_id gnl|my_center|LOCUS_21480 2108 5080 gene locus_tag LOCUS_21490 2108 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 6786 5359 gene locus_tag LOCUS_21500 gene nhaD 6786 5359 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_21500 <7696 6818 gene locus_tag LOCUS_21510 <7696 6818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083903.1:polysaccharide deacetylase family protein >Feature sequence159 282 1247 gene locus_tag LOCUS_21520 282 1247 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393683.1 protein_id gnl|my_center|LOCUS_21520 1279 1518 gene locus_tag LOCUS_21530 1279 1518 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095205.1 protein_id gnl|my_center|LOCUS_21530 1610 2146 gene locus_tag LOCUS_21540 1610 2146 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336847.1 protein_id gnl|my_center|LOCUS_21540 2274 3152 gene locus_tag LOCUS_21550 2274 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 3637 3182 gene locus_tag LOCUS_21560 3637 3182 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053808215.1 protein_id gnl|my_center|LOCUS_21560 3874 4659 gene locus_tag LOCUS_21570 3874 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 4779 5057 gene locus_tag LOCUS_21580 4779 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 6141 5086 gene locus_tag LOCUS_21590 6141 5086 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919898.1 protein_id gnl|my_center|LOCUS_21590 6919 6167 gene locus_tag LOCUS_21600 6919 6167 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810311.1 protein_id gnl|my_center|LOCUS_21600 7020 7466 gene locus_tag LOCUS_21610 7020 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence160 343 354 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 373 921 gene locus_tag LOCUS_21620 373 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21620 1065 1562 gene locus_tag LOCUS_21630 1065 1562 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329720.1 protein_id gnl|my_center|LOCUS_21630 1559 2056 gene locus_tag LOCUS_21640 1559 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 2517 2053 gene locus_tag LOCUS_21650 2517 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 3268 2903 gene locus_tag LOCUS_21660 3268 2903 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293844.1 protein_id gnl|my_center|LOCUS_21660 3511 3927 gene locus_tag LOCUS_21670 gene aprB 3511 3927 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932545.1 protein_id gnl|my_center|LOCUS_21670 4049 5983 gene locus_tag LOCUS_21680 gene aprA 4049 5983 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932546.1 protein_id gnl|my_center|LOCUS_21680 6222 7199 gene locus_tag LOCUS_21690 6222 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 >Feature sequence161 1520 21 gene locus_tag LOCUS_21700 1520 21 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086915.1 protein_id gnl|my_center|LOCUS_21700 1767 3062 gene locus_tag LOCUS_21710 1767 3062 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252179.1 protein_id gnl|my_center|LOCUS_21710 6115 3065 gene locus_tag LOCUS_21720 6115 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 7537 6272 gene locus_tag LOCUS_21730 gene glgC 7537 6272 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544940.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence162 1110 2042 gene locus_tag LOCUS_21740 1110 2042 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338408.1 protein_id gnl|my_center|LOCUS_21740 2569 2063 gene locus_tag LOCUS_21750 2569 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 4472 2571 gene locus_tag LOCUS_21760 4472 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 5615 4557 gene locus_tag LOCUS_21770 5615 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 7060 5666 gene locus_tag LOCUS_21780 7060 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 >Feature sequence163 576 2402 gene locus_tag LOCUS_21790 576 2402 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542552.1 protein_id gnl|my_center|LOCUS_21790 2437 3333 gene locus_tag LOCUS_21800 2437 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 3326 4459 gene locus_tag LOCUS_21810 3326 4459 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869713.1 protein_id gnl|my_center|LOCUS_21810 4456 5304 gene locus_tag LOCUS_21820 4456 5304 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942115.1 protein_id gnl|my_center|LOCUS_21820 5309 5854 gene locus_tag LOCUS_21830 5309 5854 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_21830 5863 7170 gene locus_tag LOCUS_21840 gene paaF 5863 7170 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329391.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence164 387 1010 gene locus_tag LOCUS_21850 387 1010 CDS product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479666.1 protein_id gnl|my_center|LOCUS_21850 1068 1496 gene locus_tag LOCUS_21860 1068 1496 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140715.1 protein_id gnl|my_center|LOCUS_21860 1486 2253 gene locus_tag LOCUS_21870 1486 2253 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269051.1 protein_id gnl|my_center|LOCUS_21870 2250 3512 gene locus_tag LOCUS_21880 2250 3512 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479643.1 protein_id gnl|my_center|LOCUS_21880 3527 4060 gene locus_tag LOCUS_21890 3527 4060 CDS product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417389.1 protein_id gnl|my_center|LOCUS_21890 4220 5134 gene locus_tag LOCUS_21900 4220 5134 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976065.1 protein_id gnl|my_center|LOCUS_21900 6145 5168 gene locus_tag LOCUS_21910 6145 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 6373 7041 gene locus_tag LOCUS_21920 6373 7041 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180938030.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence165 230 811 gene locus_tag LOCUS_21930 gene rsxA 230 811 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723764.1 protein_id gnl|my_center|LOCUS_21930 825 1373 gene locus_tag LOCUS_21940 gene rsxB 825 1373 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072472.1 protein_id gnl|my_center|LOCUS_21940 1390 2877 gene locus_tag LOCUS_21950 gene rsxC 1390 2877 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339117.1 protein_id gnl|my_center|LOCUS_21950 2874 3953 gene locus_tag LOCUS_21960 2874 3953 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339118.1 protein_id gnl|my_center|LOCUS_21960 3963 4601 gene locus_tag LOCUS_21970 gene rsxG 3963 4601 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339119.1 protein_id gnl|my_center|LOCUS_21970 4598 5302 gene locus_tag LOCUS_21980 4598 5302 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119632344.1 protein_id gnl|my_center|LOCUS_21980 5320 5622 gene locus_tag LOCUS_21990 5320 5622 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649214.1 protein_id gnl|my_center|LOCUS_21990 5879 7054 gene locus_tag LOCUS_22000 5879 7054 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930732.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence166 255 22 gene locus_tag LOCUS_22010 255 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 667 287 gene locus_tag LOCUS_22020 667 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22020 364 368 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 874 671 gene locus_tag LOCUS_22030 874 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 1337 888 gene locus_tag LOCUS_22040 1337 888 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532504.1 protein_id gnl|my_center|LOCUS_22040 2854 1334 gene locus_tag LOCUS_22050 2854 1334 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971399.1 protein_id gnl|my_center|LOCUS_22050 3366 3157 gene locus_tag LOCUS_22060 3366 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 3329 5476 gene locus_tag LOCUS_22070 3329 5476 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971397.1 protein_id gnl|my_center|LOCUS_22070 5563 6570 gene locus_tag LOCUS_22080 5563 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence167 1792 986 gene locus_tag LOCUS_22090 1792 986 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968582.1 protein_id gnl|my_center|LOCUS_22090 2593 3063 gene locus_tag LOCUS_22100 2593 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 3066 4916 gene locus_tag LOCUS_22110 gene yidC 3066 4916 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966085.1 protein_id gnl|my_center|LOCUS_22110 4947 5642 gene locus_tag LOCUS_22120 gene yihA 4947 5642 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391087.1 protein_id gnl|my_center|LOCUS_22120 5706 6635 gene locus_tag LOCUS_22130 gene argB 5706 6635 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391088.1 protein_id gnl|my_center|LOCUS_22130 >Feature sequence168 1060 116 gene locus_tag LOCUS_22140 1060 116 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921532.1 protein_id gnl|my_center|LOCUS_22140 2207 1131 gene locus_tag LOCUS_22150 2207 1131 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339184.1 protein_id gnl|my_center|LOCUS_22150 3058 2213 gene locus_tag LOCUS_22160 gene ugpE 3058 2213 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811259.1 protein_id gnl|my_center|LOCUS_22160 3939 3058 gene locus_tag LOCUS_22170 gene ugpA 3939 3058 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975291.1 protein_id gnl|my_center|LOCUS_22170 5321 4002 gene locus_tag LOCUS_22180 gene ugpB 5321 4002 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039943.1 protein_id gnl|my_center|LOCUS_22180 5555 6460 gene locus_tag LOCUS_22190 5555 6460 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703333.1 protein_id gnl|my_center|LOCUS_22190 <7268 6469 gene locus_tag LOCUS_22200 <7268 6469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971570.1:GNAT family N-acetyltransferase >Feature sequence169 151 684 gene locus_tag LOCUS_22210 151 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 994 782 gene locus_tag LOCUS_22220 994 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 876 1241 gene locus_tag LOCUS_22230 876 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 1369 3486 gene locus_tag LOCUS_22240 1369 3486 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391199.1 protein_id gnl|my_center|LOCUS_22240 3553 3990 gene locus_tag LOCUS_22250 3553 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 4016 4828 gene locus_tag LOCUS_22260 4016 4828 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_22260 4818 5204 gene locus_tag LOCUS_22270 4818 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 5216 5620 gene locus_tag LOCUS_22280 5216 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 5620 6513 gene locus_tag LOCUS_22290 5620 6513 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089808.1 protein_id gnl|my_center|LOCUS_22290 >Feature sequence170 3608 2229 gene locus_tag LOCUS_22300 3608 2229 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969212.1 protein_id gnl|my_center|LOCUS_22300 3685 5643 gene locus_tag LOCUS_22310 3685 5643 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815954.1 protein_id gnl|my_center|LOCUS_22310 5640 6161 gene locus_tag LOCUS_22320 5640 6161 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_22320 6175 6813 gene locus_tag LOCUS_22330 6175 6813 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391247.1 protein_id gnl|my_center|LOCUS_22330 >Feature sequence171 1387 269 gene locus_tag LOCUS_22340 gene murG 1387 269 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252472.1 protein_id gnl|my_center|LOCUS_22340 2526 1384 gene locus_tag LOCUS_22350 gene ftsW 2526 1384 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530956.1 protein_id gnl|my_center|LOCUS_22350 3936 2527 gene locus_tag LOCUS_22360 gene murD 3936 2527 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530955.1 protein_id gnl|my_center|LOCUS_22360 5032 3941 gene locus_tag LOCUS_22370 gene mraY 5032 3941 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089345.1 protein_id gnl|my_center|LOCUS_22370 6427 5054 gene locus_tag LOCUS_22380 6427 5054 CDS product UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-diaminopimelate--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530953.1 protein_id gnl|my_center|LOCUS_22380 <7159 6454 gene locus_tag LOCUS_22390 <7159 6454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089347.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence172 404 727 gene locus_tag LOCUS_22400 404 727 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214438544.1 protein_id gnl|my_center|LOCUS_22400 764 1654 gene locus_tag LOCUS_22410 gene nifU 764 1654 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_22410 1666 2874 gene locus_tag LOCUS_22420 gene nifS 1666 2874 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_22420 2867 4069 gene locus_tag LOCUS_22430 gene nifV 2867 4069 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 protein_id gnl|my_center|LOCUS_22430 4066 4380 gene locus_tag LOCUS_22440 gene nifW 4066 4380 CDS product nitrogenase stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533506.1 protein_id gnl|my_center|LOCUS_22440 4392 4862 gene locus_tag LOCUS_22450 4392 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 4859 5770 gene locus_tag LOCUS_22460 4859 5770 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941029.1 protein_id gnl|my_center|LOCUS_22460 6914 6396 gene locus_tag LOCUS_22470 6914 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence173 313 1404 gene locus_tag LOCUS_22480 313 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2164 1412 gene locus_tag LOCUS_22490 gene scpB 2164 1412 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919870.1 protein_id gnl|my_center|LOCUS_22490 2967 2161 gene locus_tag LOCUS_22500 2967 2161 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531293.1 protein_id gnl|my_center|LOCUS_22500 3976 2960 gene locus_tag LOCUS_22510 gene nagZ 3976 2960 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389530.1 protein_id gnl|my_center|LOCUS_22510 5320 3992 gene locus_tag LOCUS_22520 5320 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 <7138 5392 gene locus_tag LOCUS_22530 <7138 5392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967253.1:arginine--tRNA ligase >Feature sequence174 790 305 gene locus_tag LOCUS_22540 790 305 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975398.1 protein_id gnl|my_center|LOCUS_22540 1113 1616 gene locus_tag LOCUS_22550 1113 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 1831 2445 gene locus_tag LOCUS_22560 1831 2445 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731839.1 protein_id gnl|my_center|LOCUS_22560 3088 2516 gene locus_tag LOCUS_22570 3088 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 4243 3281 gene locus_tag LOCUS_22580 4243 3281 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338457.1 protein_id gnl|my_center|LOCUS_22580 5061 4240 gene locus_tag LOCUS_22590 5061 4240 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918022.1 protein_id gnl|my_center|LOCUS_22590 5171 6952 gene locus_tag LOCUS_22600 5171 6952 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392664.1 protein_id gnl|my_center|LOCUS_22600 >Feature sequence175 787 272 gene locus_tag LOCUS_22610 787 272 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972555.1 protein_id gnl|my_center|LOCUS_22610 2076 901 gene locus_tag LOCUS_22620 2076 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 3514 2195 gene locus_tag LOCUS_22630 3514 2195 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083266.1 protein_id gnl|my_center|LOCUS_22630 4830 3514 gene locus_tag LOCUS_22640 4830 3514 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083265.1 protein_id gnl|my_center|LOCUS_22640 5340 4939 gene locus_tag LOCUS_22650 5340 4939 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965096.1 protein_id gnl|my_center|LOCUS_22650 5555 6340 gene locus_tag LOCUS_22660 5555 6340 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918013.1 protein_id gnl|my_center|LOCUS_22660 >Feature sequence176 2311 968 gene locus_tag LOCUS_22670 gene gcvPA 2311 968 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921182.1 protein_id gnl|my_center|LOCUS_22670 2691 2317 gene locus_tag LOCUS_22680 gene gcvH 2691 2317 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088496.1 protein_id gnl|my_center|LOCUS_22680 3853 2717 gene locus_tag LOCUS_22690 gene gcvT 3853 2717 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390799.1 protein_id gnl|my_center|LOCUS_22690 4363 4752 gene locus_tag LOCUS_22700 4363 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 4757 5602 gene locus_tag LOCUS_22710 4757 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 <7004 5667 gene locus_tag LOCUS_22720 <7004 5667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085716.1:methyl-accepting chemotaxis protein >Feature sequence177 1973 1308 gene locus_tag LOCUS_22730 1973 1308 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918197.1 protein_id gnl|my_center|LOCUS_22730 2262 2780 gene locus_tag LOCUS_22740 2262 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 3817 2855 gene locus_tag LOCUS_22750 gene ubiA 3817 2855 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090253.1 protein_id gnl|my_center|LOCUS_22750 3954 4661 gene locus_tag LOCUS_22760 3954 4661 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992221.1 protein_id gnl|my_center|LOCUS_22760 4909 5592 gene locus_tag LOCUS_22770 4909 5592 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531667.1 protein_id gnl|my_center|LOCUS_22770 5983 6351 gene locus_tag LOCUS_22780 5983 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 6972 6496 gene locus_tag LOCUS_22790 6972 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence178 1514 3 gene locus_tag LOCUS_22800 1514 3 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706263.1 protein_id gnl|my_center|LOCUS_22800 1810 1736 gene locus_tag LOCUS_t00220 1810 1736 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1945 2448 gene locus_tag LOCUS_22810 1945 2448 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388878.1 protein_id gnl|my_center|LOCUS_22810 2486 3376 gene locus_tag LOCUS_22820 gene trxA 2486 3376 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528773.1 protein_id gnl|my_center|LOCUS_22820 3508 4089 gene locus_tag LOCUS_22830 3508 4089 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083424.1 protein_id gnl|my_center|LOCUS_22830 4252 4482 gene locus_tag LOCUS_22840 4252 4482 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917997.1 protein_id gnl|my_center|LOCUS_22840 4534 4908 gene locus_tag LOCUS_22850 4534 4908 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975729.1 protein_id gnl|my_center|LOCUS_22850 4952 5554 gene locus_tag LOCUS_22860 4952 5554 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528992.1 protein_id gnl|my_center|LOCUS_22860 5568 6338 gene locus_tag LOCUS_22870 5568 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 6338 6952 gene locus_tag LOCUS_22880 6338 6952 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381663.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence179 <1 631 gene locus_tag LOCUS_22890 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063755.1:glutamine amidotransferase 1265 984 gene locus_tag LOCUS_22900 1265 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 1703 1470 gene locus_tag LOCUS_22910 1703 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 1980 6533 gene locus_tag LOCUS_22920 1980 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187336415.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22920 6841 6765 gene locus_tag LOCUS_t00230 6841 6765 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence180 3147 247 gene locus_tag LOCUS_22930 gene uvrA 3147 247 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531840.1 protein_id gnl|my_center|LOCUS_22930 3291 5297 gene locus_tag LOCUS_22940 3291 5297 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531942.1 protein_id gnl|my_center|LOCUS_22940 5330 6577 gene locus_tag LOCUS_22950 gene cfa1 5330 6577 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330709.1 protein_id gnl|my_center|LOCUS_22950 6589 6858 gene locus_tag LOCUS_22960 6589 6858 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390404.1 protein_id gnl|my_center|LOCUS_22960 >Feature sequence181 846 2225 gene locus_tag LOCUS_22970 846 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 2433 5339 gene locus_tag LOCUS_22980 2433 5339 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149111012.1 protein_id gnl|my_center|LOCUS_22980 6373 5636 gene locus_tag LOCUS_22990 gene nfsA 6373 5636 CDS product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705684.1 protein_id gnl|my_center|LOCUS_22990 >Feature sequence182 804 229 gene locus_tag LOCUS_23000 804 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 1178 864 gene locus_tag LOCUS_23010 1178 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 1539 1183 gene locus_tag LOCUS_23020 1539 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 1785 2198 gene locus_tag LOCUS_23030 1785 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 2227 2886 gene locus_tag LOCUS_23040 2227 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 3404 2901 gene locus_tag LOCUS_23050 3404 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 3663 3992 gene locus_tag LOCUS_23060 3663 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 4016 4237 gene locus_tag LOCUS_23070 4016 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 5005 4499 gene locus_tag LOCUS_23080 5005 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 5127 5489 gene locus_tag LOCUS_23090 5127 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 5545 5736 gene locus_tag LOCUS_23100 5545 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 6246 5773 gene locus_tag LOCUS_23110 6246 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 >Feature sequence183 273 896 gene locus_tag LOCUS_23120 273 896 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_23120 2218 953 gene locus_tag LOCUS_23130 2218 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 3206 2307 gene locus_tag LOCUS_23140 gene gluQRS 3206 2307 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970092.1 protein_id gnl|my_center|LOCUS_23140 6646 3209 gene locus_tag LOCUS_23150 6646 3209 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528208.1 protein_id gnl|my_center|LOCUS_23150 >Feature sequence184 1042 146 gene locus_tag LOCUS_23160 gene metF 1042 146 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173518.1 protein_id gnl|my_center|LOCUS_23160 2071 1055 gene locus_tag LOCUS_23170 2071 1055 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530933.1 protein_id gnl|my_center|LOCUS_23170 2311 3336 gene locus_tag LOCUS_23180 2311 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 3434 4009 gene locus_tag LOCUS_23190 3434 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 4051 4665 gene locus_tag LOCUS_23200 4051 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 6343 4673 gene locus_tag LOCUS_23210 gene ettA 6343 4673 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720754.1 protein_id gnl|my_center|LOCUS_23210 >Feature sequence185 1254 2978 gene locus_tag LOCUS_23220 1254 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 3026 4837 gene locus_tag LOCUS_23230 3026 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 <6752 4922 gene locus_tag LOCUS_23240 <6752 4922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064253835.1:ATP-dependent chaperone ClpB >Feature sequence186 2231 957 gene locus_tag LOCUS_23250 2231 957 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813565.1 protein_id gnl|my_center|LOCUS_23250 2750 2232 gene locus_tag LOCUS_23260 2750 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 3812 2817 gene locus_tag LOCUS_23270 3812 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 4081 4797 gene locus_tag LOCUS_23280 4081 4797 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174758.1 protein_id gnl|my_center|LOCUS_23280 6090 4825 gene locus_tag LOCUS_23290 gene glgC 6090 4825 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313778.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence187 268 1206 gene locus_tag LOCUS_23300 268 1206 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530960.1 protein_id gnl|my_center|LOCUS_23300 1203 2120 gene locus_tag LOCUS_23310 1203 2120 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530961.1 protein_id gnl|my_center|LOCUS_23310 2117 3430 gene locus_tag LOCUS_23320 gene ftsA 2117 3430 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242933.1 protein_id gnl|my_center|LOCUS_23320 3650 5323 gene locus_tag LOCUS_23330 gene ftsZ 3650 5323 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037431030.1 protein_id gnl|my_center|LOCUS_23330 5577 6458 gene locus_tag LOCUS_23340 5577 6458 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089334.1 protein_id gnl|my_center|LOCUS_23340 >Feature sequence188 2345 714 gene locus_tag LOCUS_23350 2345 714 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968391.1 protein_id gnl|my_center|LOCUS_23350 3442 2342 gene locus_tag LOCUS_23360 3442 2342 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173513.1 protein_id gnl|my_center|LOCUS_23360 4559 3447 gene locus_tag LOCUS_23370 4559 3447 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527941.1 protein_id gnl|my_center|LOCUS_23370 6437 4569 gene locus_tag LOCUS_23380 6437 4569 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173514.1 protein_id gnl|my_center|LOCUS_23380 >Feature sequence189 32 283 gene locus_tag LOCUS_23390 32 283 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248097.1 protein_id gnl|my_center|LOCUS_23390 296 1480 gene locus_tag LOCUS_23400 296 1480 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524972.1 protein_id gnl|my_center|LOCUS_23400 1841 1566 gene locus_tag LOCUS_23410 1841 1566 CDS product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002714638.1 protein_id gnl|my_center|LOCUS_23410 2652 1975 gene locus_tag LOCUS_23420 2652 1975 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089735.1 protein_id gnl|my_center|LOCUS_23420 4203 2668 gene locus_tag LOCUS_23430 4203 2668 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089734.1 protein_id gnl|my_center|LOCUS_23430 4375 5556 gene locus_tag LOCUS_23440 gene mnmA 4375 5556 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089733.1 protein_id gnl|my_center|LOCUS_23440 5795 6490 gene locus_tag LOCUS_23450 5795 6490 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720903.1 protein_id gnl|my_center|LOCUS_23450 6626 6702 gene locus_tag LOCUS_t00240 6626 6702 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence190 998 510 gene locus_tag LOCUS_23460 998 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 2154 2276 gene locus_tag LOCUS_23470 2154 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 3298 2822 gene locus_tag LOCUS_23480 3298 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 3736 3909 gene locus_tag LOCUS_23490 3736 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 3896 5335 gene locus_tag LOCUS_23500 3896 5335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532721.1 protein_id gnl|my_center|LOCUS_23500 5711 6448 gene locus_tag LOCUS_23510 gene lexA 5711 6448 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531746.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence191 1779 469 gene locus_tag LOCUS_23520 1779 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 2769 1780 gene locus_tag LOCUS_23530 2769 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 3936 2902 gene locus_tag LOCUS_23540 3936 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 4622 4098 gene locus_tag LOCUS_23550 4622 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 5772 4951 gene locus_tag LOCUS_23560 5772 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 6334 6528 gene locus_tag LOCUS_23570 6334 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence192 1061 126 gene locus_tag LOCUS_23580 1061 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 1343 1594 gene locus_tag LOCUS_23590 1343 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 2780 4591 gene locus_tag LOCUS_23600 2780 4591 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969278.1 protein_id gnl|my_center|LOCUS_23600 4661 5377 gene locus_tag LOCUS_23610 gene cmoA 4661 5377 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859101.1 protein_id gnl|my_center|LOCUS_23610 5412 6458 gene locus_tag LOCUS_23620 5412 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 >Feature sequence193 87 1307 gene locus_tag LOCUS_23630 gene fabB 87 1307 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083592.1 protein_id gnl|my_center|LOCUS_23630 1349 2161 gene locus_tag LOCUS_23640 gene fabI 1349 2161 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527887.1 protein_id gnl|my_center|LOCUS_23640 2600 2127 gene locus_tag LOCUS_23650 2600 2127 CDS product HPr kinase/phosphatase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391196.1 protein_id gnl|my_center|LOCUS_23650 4384 2600 gene locus_tag LOCUS_23660 4384 2600 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528336.1 protein_id gnl|my_center|LOCUS_23660 5093 4392 gene locus_tag LOCUS_23670 5093 4392 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528337.1 protein_id gnl|my_center|LOCUS_23670 5256 5891 gene locus_tag LOCUS_23680 5256 5891 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844958.1 protein_id gnl|my_center|LOCUS_23680 6142 5978 gene locus_tag LOCUS_23690 6142 5978 CDS product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084259.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence194 1597 248 gene locus_tag LOCUS_23700 1597 248 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397017.1 protein_id gnl|my_center|LOCUS_23700 2840 1791 gene locus_tag LOCUS_23710 2840 1791 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 protein_id gnl|my_center|LOCUS_23710 4269 2947 gene locus_tag LOCUS_23720 4269 2947 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719484.1 protein_id gnl|my_center|LOCUS_23720 4775 4266 gene locus_tag LOCUS_23730 4775 4266 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 protein_id gnl|my_center|LOCUS_23730 5590 4775 gene locus_tag LOCUS_23740 5590 4775 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397019.1 protein_id gnl|my_center|LOCUS_23740 >Feature sequence195 3342 1390 gene locus_tag LOCUS_23750 3342 1390 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529951.1 protein_id gnl|my_center|LOCUS_23750 4496 3363 gene locus_tag LOCUS_23760 4496 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529952.1 protein_id gnl|my_center|LOCUS_23760 5531 4497 gene locus_tag LOCUS_23770 5531 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969909.1 protein_id gnl|my_center|LOCUS_23770 5715 5750 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6106 5825 gene locus_tag LOCUS_23780 6106 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 >Feature sequence196 2223 586 gene locus_tag LOCUS_23790 2223 586 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532916.1 protein_id gnl|my_center|LOCUS_23790 2396 4300 gene locus_tag LOCUS_23800 2396 4300 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528095.1 protein_id gnl|my_center|LOCUS_23800 4359 5147 gene locus_tag LOCUS_23810 4359 5147 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041164662.1 protein_id gnl|my_center|LOCUS_23810 >Feature sequence197 916 644 gene locus_tag LOCUS_23820 916 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 2359 932 gene locus_tag LOCUS_23830 2359 932 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_23830 3289 2447 gene locus_tag LOCUS_23840 3289 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 4025 4411 gene locus_tag LOCUS_23850 4025 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 5149 4769 gene locus_tag LOCUS_23860 5149 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 5760 5443 gene locus_tag LOCUS_23870 5760 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence198 737 111 gene locus_tag LOCUS_23880 737 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 879 1634 gene locus_tag LOCUS_23890 879 1634 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084239.1 protein_id gnl|my_center|LOCUS_23890 1631 2506 gene locus_tag LOCUS_23900 1631 2506 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_23900 2884 4725 gene locus_tag LOCUS_23910 2884 4725 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090838.1 protein_id gnl|my_center|LOCUS_23910 4722 5045 gene locus_tag LOCUS_23920 4722 5045 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527931.1 protein_id gnl|my_center|LOCUS_23920 5119 5889 gene locus_tag LOCUS_23930 5119 5889 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528853.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence199 2445 169 gene locus_tag LOCUS_23940 2445 169 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085781.1 protein_id gnl|my_center|LOCUS_23940 3041 2634 gene locus_tag LOCUS_23950 3041 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 3370 3819 gene locus_tag LOCUS_23960 3370 3819 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842874.1 protein_id gnl|my_center|LOCUS_23960 3816 4241 gene locus_tag LOCUS_23970 3816 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 4238 5338 gene locus_tag LOCUS_23980 4238 5338 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880596.1 protein_id gnl|my_center|LOCUS_23980 5335 5997 gene locus_tag LOCUS_23990 5335 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 >Feature sequence200 1599 325 gene locus_tag LOCUS_24000 1599 325 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312734.1 protein_id gnl|my_center|LOCUS_24000 2218 1688 gene locus_tag LOCUS_24010 2218 1688 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532199.1 protein_id gnl|my_center|LOCUS_24010 3017 2229 gene locus_tag LOCUS_24020 3017 2229 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966315.1 protein_id gnl|my_center|LOCUS_24020 3589 3014 gene locus_tag LOCUS_24030 3589 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 3656 4090 gene locus_tag LOCUS_24040 3656 4090 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087727.1 protein_id gnl|my_center|LOCUS_24040 4246 4707 gene locus_tag LOCUS_24050 gene rplM 4246 4707 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720164.1 protein_id gnl|my_center|LOCUS_24050 4713 5210 gene locus_tag LOCUS_24060 gene rpsI 4713 5210 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087725.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence201 1712 2368 gene locus_tag LOCUS_24070 1712 2368 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529177.1 protein_id gnl|my_center|LOCUS_24070 2575 3135 gene locus_tag LOCUS_24080 2575 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 3289 3765 gene locus_tag LOCUS_24090 3289 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 4265 3903 gene locus_tag LOCUS_24100 4265 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 5416 4364 gene locus_tag LOCUS_24110 5416 4364 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972886.1 protein_id gnl|my_center|LOCUS_24110 <6325 5426 gene locus_tag LOCUS_24120 <6325 5426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459065.1:TRAP transporter large permease subunit >Feature sequence202 201 2426 gene locus_tag LOCUS_24130 201 2426 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089908.1 protein_id gnl|my_center|LOCUS_24130 2984 3508 gene locus_tag LOCUS_24140 2984 3508 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085759.1 protein_id gnl|my_center|LOCUS_24140 3483 4865 gene locus_tag LOCUS_24150 3483 4865 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172347.1 protein_id gnl|my_center|LOCUS_24150 5337 5834 gene locus_tag LOCUS_24160 5337 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 6294 6218 gene locus_tag LOCUS_t00250 6294 6218 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence203 20 238 gene locus_tag LOCUS_24170 20 238 CDS product DUF3126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535016.1 protein_id gnl|my_center|LOCUS_24170 1732 263 gene locus_tag LOCUS_24180 1732 263 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532222.1 protein_id gnl|my_center|LOCUS_24180 3097 1979 gene locus_tag LOCUS_24190 3097 1979 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532221.1 protein_id gnl|my_center|LOCUS_24190 3761 3204 gene locus_tag LOCUS_24200 gene uppC 3761 3204 CDS product polysaccharide export protein UppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971492.1 protein_id gnl|my_center|LOCUS_24200 3942 6257 gene locus_tag LOCUS_24210 3942 6257 CDS product exopolysaccharide transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087735.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence204 <1 1767 gene locus_tag LOCUS_24220 <1 1767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037391272.1:heme lyase CcmF/NrfE family subunit 1779 2267 gene locus_tag LOCUS_24230 1779 2267 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974838.1 protein_id gnl|my_center|LOCUS_24230 2885 2280 gene locus_tag LOCUS_24240 2885 2280 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684133.1 protein_id gnl|my_center|LOCUS_24240 3032 4522 gene locus_tag LOCUS_24250 3032 4522 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844141.1 protein_id gnl|my_center|LOCUS_24250 4698 5381 gene locus_tag LOCUS_24260 4698 5381 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023812818.1 protein_id gnl|my_center|LOCUS_24260 >Feature sequence205 646 2031 gene locus_tag LOCUS_24270 646 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 2883 2164 gene locus_tag LOCUS_24280 2883 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 4078 3923 gene locus_tag LOCUS_24290 4078 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 4646 4164 gene locus_tag LOCUS_24300 4646 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 <6214 4874 gene locus_tag LOCUS_24310 <6214 4874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098955.1:glycerone kinase >Feature sequence206 <1 820 gene locus_tag LOCUS_24320 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000869721.1:cytochrome-c peroxidase 831 1415 gene locus_tag LOCUS_24330 831 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 2083 1451 gene locus_tag LOCUS_24340 2083 1451 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395790.1 protein_id gnl|my_center|LOCUS_24340 2505 3041 gene locus_tag LOCUS_24350 2505 3041 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351315.1 protein_id gnl|my_center|LOCUS_24350 3046 3894 gene locus_tag LOCUS_24360 3046 3894 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337391.1 protein_id gnl|my_center|LOCUS_24360 3903 4376 gene locus_tag LOCUS_24370 3903 4376 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387828.1 protein_id gnl|my_center|LOCUS_24370 4731 4360 gene locus_tag LOCUS_24380 4731 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 5514 5963 gene locus_tag LOCUS_24390 5514 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence207 89 15 gene locus_tag LOCUS_t00260 89 15 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 295 465 gene locus_tag LOCUS_24400 295 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 638 1927 gene locus_tag LOCUS_24410 gene murA 638 1927 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530201.1 protein_id gnl|my_center|LOCUS_24410 1938 2447 gene locus_tag LOCUS_24420 1938 2447 CDS product DUF2948 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970967.1 protein_id gnl|my_center|LOCUS_24420 2452 3756 gene locus_tag LOCUS_24430 gene hisD 2452 3756 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391986.1 protein_id gnl|my_center|LOCUS_24430 3778 4293 gene locus_tag LOCUS_24440 3778 4293 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327288.1 protein_id gnl|my_center|LOCUS_24440 4297 4752 gene locus_tag LOCUS_24450 4297 4752 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920202.1 protein_id gnl|my_center|LOCUS_24450 4867 5085 gene locus_tag LOCUS_24460 gene infA 4867 5085 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327290.1 protein_id gnl|my_center|LOCUS_24460 5158 5709 gene locus_tag LOCUS_24470 5158 5709 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084077.1 protein_id gnl|my_center|LOCUS_24470 >Feature sequence208 598 35 gene locus_tag LOCUS_24480 598 35 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704609.1 protein_id gnl|my_center|LOCUS_24480 1330 755 gene locus_tag LOCUS_24490 1330 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 3630 1327 gene locus_tag LOCUS_24500 3630 1327 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085781.1 protein_id gnl|my_center|LOCUS_24500 3820 4848 gene locus_tag LOCUS_24510 3820 4848 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_24510 4851 5348 gene locus_tag LOCUS_24520 4851 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 >Feature sequence209 450 37 gene locus_tag LOCUS_24530 450 37 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_24530 1388 531 gene locus_tag LOCUS_24540 gene panC 1388 531 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920027.1 protein_id gnl|my_center|LOCUS_24540 1538 2404 gene locus_tag LOCUS_24550 1538 2404 CDS product division plane positioning ATPase MipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087919.1 protein_id gnl|my_center|LOCUS_24550 4195 2732 gene locus_tag LOCUS_24560 4195 2732 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531777.1 protein_id gnl|my_center|LOCUS_24560 4481 4840 gene locus_tag LOCUS_24570 gene clpS 4481 4840 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535011.1 protein_id gnl|my_center|LOCUS_24570 >Feature sequence210 557 354 gene locus_tag LOCUS_24580 557 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970183.1 protein_id gnl|my_center|LOCUS_24580 1243 878 gene locus_tag LOCUS_24590 1243 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 1857 2105 gene locus_tag LOCUS_24600 1857 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 3242 2262 gene locus_tag LOCUS_24610 3242 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530138.1 protein_id gnl|my_center|LOCUS_24610 5348 3429 gene locus_tag LOCUS_24620 5348 3429 CDS product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966821.1 protein_id gnl|my_center|LOCUS_24620 5518 5940 gene locus_tag LOCUS_24630 5518 5940 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086994.1 protein_id gnl|my_center|LOCUS_24630 >Feature sequence211 14 559 gene locus_tag LOCUS_24640 14 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 578 925 gene locus_tag LOCUS_24650 578 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 927 1769 gene locus_tag LOCUS_24660 927 1769 CDS product gallate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 protein_id gnl|my_center|LOCUS_24660 1783 2211 gene locus_tag LOCUS_24670 1783 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 2569 2246 gene locus_tag LOCUS_24680 2569 2246 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 protein_id gnl|my_center|LOCUS_24680 3807 2644 gene locus_tag LOCUS_24690 3807 2644 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731407.1 protein_id gnl|my_center|LOCUS_24690 3878 4852 gene locus_tag LOCUS_24700 3878 4852 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061538724.1 protein_id gnl|my_center|LOCUS_24700 4888 5931 gene locus_tag LOCUS_24710 4888 5931 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368551.1 protein_id gnl|my_center|LOCUS_24710 >Feature sequence212 3454 212 gene locus_tag LOCUS_24720 3454 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 4511 3717 gene locus_tag LOCUS_24730 4511 3717 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530156.1 protein_id gnl|my_center|LOCUS_24730 4992 4567 gene locus_tag LOCUS_24740 4992 4567 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327209.1 protein_id gnl|my_center|LOCUS_24740 <6055 5060 gene locus_tag LOCUS_24750 <6055 5060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390784.1:ATP-dependent DNA helicase >Feature sequence213 <1 1252 gene locus_tag LOCUS_24760 <1 1252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009563408.1:MFS transporter 2713 1322 gene locus_tag LOCUS_24770 2713 1322 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528935.1 protein_id gnl|my_center|LOCUS_24770 3160 2717 gene locus_tag LOCUS_24780 3160 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 4287 3157 gene locus_tag LOCUS_24790 4287 3157 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965507.1 protein_id gnl|my_center|LOCUS_24790 4683 4471 gene locus_tag LOCUS_24800 4683 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 4877 5002 gene locus_tag LOCUS_24810 gene ykgO 4877 5002 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006611362.1 protein_id gnl|my_center|LOCUS_24810 5167 5694 gene locus_tag LOCUS_24820 5167 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence214 1011 2045 gene locus_tag LOCUS_24830 1011 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 3075 2053 gene locus_tag LOCUS_24840 gene galE 3075 2053 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090307.1 protein_id gnl|my_center|LOCUS_24840 3372 4580 gene locus_tag LOCUS_24850 3372 4580 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890820.1 protein_id gnl|my_center|LOCUS_24850 4614 5831 gene locus_tag LOCUS_24860 4614 5831 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215505108.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence215 1109 1528 gene locus_tag LOCUS_24870 1109 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 2336 1575 gene locus_tag LOCUS_24880 2336 1575 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085409.1 protein_id gnl|my_center|LOCUS_24880 3048 2422 gene locus_tag LOCUS_24890 gene pdxH 3048 2422 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974711.1 protein_id gnl|my_center|LOCUS_24890 3225 4145 gene locus_tag LOCUS_24900 3225 4145 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101778793.1 protein_id gnl|my_center|LOCUS_24900 4135 4647 gene locus_tag LOCUS_24910 4135 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 4778 5569 gene locus_tag LOCUS_24920 gene fabI 4778 5569 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532347.1 protein_id gnl|my_center|LOCUS_24920 >Feature sequence216 <1 612 gene locus_tag LOCUS_24930 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338566.1:3-mercaptopyruvate sulfurtransferase 609 1127 gene locus_tag LOCUS_24940 609 1127 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531462.1 protein_id gnl|my_center|LOCUS_24940 1933 1151 gene locus_tag LOCUS_24950 1933 1151 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874280.1 protein_id gnl|my_center|LOCUS_24950 3073 1946 gene locus_tag LOCUS_24960 3073 1946 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764114.1 protein_id gnl|my_center|LOCUS_24960 4307 3087 gene locus_tag LOCUS_24970 4307 3087 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805343.1 protein_id gnl|my_center|LOCUS_24970 5414 4398 gene locus_tag LOCUS_24980 5414 4398 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 protein_id gnl|my_center|LOCUS_24980 >Feature sequence217 5635 4499 gene locus_tag LOCUS_24990 5635 4499 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054081054.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence218 4521 436 gene locus_tag LOCUS_25000 4521 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 >Feature sequence219 45 437 gene locus_tag LOCUS_25010 45 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 1877 441 gene locus_tag LOCUS_25020 1877 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 3233 1890 gene locus_tag LOCUS_25030 3233 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 3529 3906 gene locus_tag LOCUS_25040 3529 3906 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082961.1 protein_id gnl|my_center|LOCUS_25040 5748 3913 gene locus_tag LOCUS_25050 5748 3913 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529979.1 protein_id gnl|my_center|LOCUS_25050 >Feature sequence220 448 1926 gene locus_tag LOCUS_25060 448 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25060 2242 1907 gene locus_tag LOCUS_25070 2242 1907 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087895.1 protein_id gnl|my_center|LOCUS_25070 2984 2235 gene locus_tag LOCUS_25080 2984 2235 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393451.1 protein_id gnl|my_center|LOCUS_25080 4282 2981 gene locus_tag LOCUS_25090 4282 2981 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072019.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence221 367 14 gene locus_tag LOCUS_25100 367 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 1249 371 gene locus_tag LOCUS_25110 1249 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 1496 1705 gene locus_tag LOCUS_25120 1496 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 3474 1810 gene locus_tag LOCUS_25130 3474 1810 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_25130 5044 3518 gene locus_tag LOCUS_25140 5044 3518 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_25140 5554 5078 gene locus_tag LOCUS_25150 5554 5078 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921090.1 protein_id gnl|my_center|LOCUS_25150 >Feature sequence222 2051 420 gene locus_tag LOCUS_25160 2051 420 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962335.1 protein_id gnl|my_center|LOCUS_25160 2742 3332 gene locus_tag LOCUS_25170 2742 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 3084 3099 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3346 3720 gene locus_tag LOCUS_25180 3346 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 4690 3890 gene locus_tag LOCUS_25190 4690 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 5763 4687 gene locus_tag LOCUS_25200 5763 4687 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_25200 >Feature sequence223 2415 1846 gene locus_tag LOCUS_25210 2415 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 3302 2436 gene locus_tag LOCUS_25220 3302 2436 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 protein_id gnl|my_center|LOCUS_25220 3425 4042 gene locus_tag LOCUS_25230 3425 4042 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_25230 4052 4786 gene locus_tag LOCUS_25240 4052 4786 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083961.1 protein_id gnl|my_center|LOCUS_25240 4783 5421 gene locus_tag LOCUS_25250 4783 5421 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992314.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence224 336 1406 gene locus_tag LOCUS_25260 336 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 1415 2209 gene locus_tag LOCUS_25270 1415 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 3169 2288 gene locus_tag LOCUS_25280 3169 2288 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529342.1 protein_id gnl|my_center|LOCUS_25280 3408 4841 gene locus_tag LOCUS_25290 3408 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 4891 5454 gene locus_tag LOCUS_25300 4891 5454 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965738.1 protein_id gnl|my_center|LOCUS_25300 >Feature sequence225 54 815 gene locus_tag LOCUS_25310 54 815 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969973.1 protein_id gnl|my_center|LOCUS_25310 820 1059 gene locus_tag LOCUS_25320 820 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 1178 1861 gene locus_tag LOCUS_25330 1178 1861 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975415.1 protein_id gnl|my_center|LOCUS_25330 3282 2419 gene locus_tag LOCUS_25340 3282 2419 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971568.1 protein_id gnl|my_center|LOCUS_25340 3355 4359 gene locus_tag LOCUS_25350 3355 4359 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035437.1 protein_id gnl|my_center|LOCUS_25350 4972 4544 gene locus_tag LOCUS_25360 4972 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 >Feature sequence226 1923 184 gene locus_tag LOCUS_25370 1923 184 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940631.1 protein_id gnl|my_center|LOCUS_25370 3318 1966 gene locus_tag LOCUS_25380 3318 1966 CDS product TIGR03808 family TAT-translocated repetitive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532675.1 protein_id gnl|my_center|LOCUS_25380 4633 3401 gene locus_tag LOCUS_25390 4633 3401 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532223.1 protein_id gnl|my_center|LOCUS_25390 5002 4784 gene locus_tag LOCUS_25400 5002 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 >Feature sequence227 2700 445 gene locus_tag LOCUS_25410 2700 445 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706513.1 protein_id gnl|my_center|LOCUS_25410 4307 2697 gene locus_tag LOCUS_25420 4307 2697 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529845.1 protein_id gnl|my_center|LOCUS_25420 >Feature sequence228 1201 218 gene locus_tag LOCUS_25430 1201 218 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809986.1 protein_id gnl|my_center|LOCUS_25430 1469 2392 gene locus_tag LOCUS_25440 1469 2392 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527033.1 protein_id gnl|my_center|LOCUS_25440 2794 3609 gene locus_tag LOCUS_25450 2794 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 3638 4747 gene locus_tag LOCUS_25460 3638 4747 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104670.1 protein_id gnl|my_center|LOCUS_25460 <5626 4773 gene locus_tag LOCUS_25470 <5626 4773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_139076345.1:isocitrate/isopropylmalate dehydrogenase family protein >Feature sequence229 1510 284 gene locus_tag LOCUS_25480 1510 284 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310733.1 protein_id gnl|my_center|LOCUS_25480 2103 1561 gene locus_tag LOCUS_25490 2103 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 2426 2217 gene locus_tag LOCUS_25500 2426 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 3459 2482 gene locus_tag LOCUS_25510 3459 2482 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966168.1 protein_id gnl|my_center|LOCUS_25510 3654 5540 gene locus_tag LOCUS_25520 3654 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 >Feature sequence230 1448 543 gene locus_tag LOCUS_25530 1448 543 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_25530 2068 1469 gene locus_tag LOCUS_25540 2068 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 4013 2079 gene locus_tag LOCUS_25550 4013 2079 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878165.1 protein_id gnl|my_center|LOCUS_25550 4346 4092 gene locus_tag LOCUS_25560 4346 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25560 <5544 4365 gene locus_tag LOCUS_25570 <5544 4365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546111.1:CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein >Feature sequence231 1381 725 gene locus_tag LOCUS_25580 gene thiE 1381 725 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972915.1 protein_id gnl|my_center|LOCUS_25580 2166 1378 gene locus_tag LOCUS_25590 gene thiM 2166 1378 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182157.1 protein_id gnl|my_center|LOCUS_25590 2168 2548 gene locus_tag LOCUS_25600 2168 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 2569 2643 gene locus_tag LOCUS_t00270 2569 2643 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4667 2742 gene locus_tag LOCUS_25610 4667 2742 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970318.1 protein_id gnl|my_center|LOCUS_25610 >Feature sequence232 2654 540 gene locus_tag LOCUS_25620 gene glgX 2654 540 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389296.1 protein_id gnl|my_center|LOCUS_25620 4840 2651 gene locus_tag LOCUS_25630 gene glgB 4840 2651 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_25630 5220 4843 gene locus_tag LOCUS_25640 5220 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence233 1478 300 gene locus_tag LOCUS_25650 1478 300 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090256.1 protein_id gnl|my_center|LOCUS_25650 2284 1535 gene locus_tag LOCUS_25660 2284 1535 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404185.1 protein_id gnl|my_center|LOCUS_25660 1577 1581 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3774 2281 gene locus_tag LOCUS_25670 gene hisS 3774 2281 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325488.1 protein_id gnl|my_center|LOCUS_25670 4647 3919 gene locus_tag LOCUS_25680 4647 3919 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174613.1 protein_id gnl|my_center|LOCUS_25680 <5510 4750 gene locus_tag LOCUS_25690 <5510 4750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387919.1:cache domain-containing protein >Feature sequence234 2767 2096 gene locus_tag LOCUS_25700 2767 2096 CDS product DUF2497 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967575.1 protein_id gnl|my_center|LOCUS_25700 4250 2889 gene locus_tag LOCUS_25710 4250 2889 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087245.1 protein_id gnl|my_center|LOCUS_25710 5113 4442 gene locus_tag LOCUS_25720 5113 4442 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971822.1 protein_id gnl|my_center|LOCUS_25720 >Feature sequence235 372 91 gene locus_tag LOCUS_25730 gene hypC 372 91 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334908.1 protein_id gnl|my_center|LOCUS_25730 929 363 gene locus_tag LOCUS_25740 929 363 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173947.1 protein_id gnl|my_center|LOCUS_25740 2638 935 gene locus_tag LOCUS_25750 gene hybC 2638 935 CDS product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817177.1 protein_id gnl|my_center|LOCUS_25750 3853 2711 gene locus_tag LOCUS_25760 gene hybB 3853 2711 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017694.1 protein_id gnl|my_center|LOCUS_25760 4827 3850 gene locus_tag LOCUS_25770 gene hybA 4827 3850 CDS product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081870.1 protein_id gnl|my_center|LOCUS_25770 <5439 4839 gene locus_tag LOCUS_25780 <5439 4839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005173957.1:hydrogenase 2 small subunit >Feature sequence236 759 271 gene locus_tag LOCUS_25790 759 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 1911 1150 gene locus_tag LOCUS_25800 1911 1150 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533649.1 protein_id gnl|my_center|LOCUS_25800 2110 1892 gene locus_tag LOCUS_25810 2110 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 2748 2107 gene locus_tag LOCUS_25820 2748 2107 CDS product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533650.1 protein_id gnl|my_center|LOCUS_25820 3725 2988 gene locus_tag LOCUS_25830 3725 2988 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533651.1 protein_id gnl|my_center|LOCUS_25830 4017 4817 gene locus_tag LOCUS_25840 4017 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 4801 5226 gene locus_tag LOCUS_25850 4801 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 >Feature sequence237 205 1131 gene locus_tag LOCUS_25860 205 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 2349 1195 gene locus_tag LOCUS_25870 2349 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 2879 2517 gene locus_tag LOCUS_25880 2879 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529850.1 protein_id gnl|my_center|LOCUS_25880 <5387 2955 gene locus_tag LOCUS_25890 <5387 2955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226013942.1:retention module-containing protein >Feature sequence238 629 1837 gene locus_tag LOCUS_25900 629 1837 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389758.1 protein_id gnl|my_center|LOCUS_25900 2556 1822 gene locus_tag LOCUS_25910 2556 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 4298 2757 gene locus_tag LOCUS_25920 4298 2757 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241846.1 protein_id gnl|my_center|LOCUS_25920 4476 4886 gene locus_tag LOCUS_25930 4476 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974781.1 protein_id gnl|my_center|LOCUS_25930 4960 5370 gene locus_tag LOCUS_25940 4960 5370 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946351.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence239 1060 128 gene locus_tag LOCUS_25950 gene paaX 1060 128 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085674.1 protein_id gnl|my_center|LOCUS_25950 1368 2393 gene locus_tag LOCUS_25960 1368 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980499.1 protein_id gnl|my_center|LOCUS_25960 2390 3481 gene locus_tag LOCUS_25970 2390 3481 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_25970 4965 3478 gene locus_tag LOCUS_25980 gene xylB 4965 3478 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522654.1 protein_id gnl|my_center|LOCUS_25980 >Feature sequence240 3912 1618 gene locus_tag LOCUS_25990 3912 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 5159 4020 gene locus_tag LOCUS_26000 5159 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 >Feature sequence241 553 1335 gene locus_tag LOCUS_26010 gene hefB 553 1335 CDS product efflux RND transporter periplasmic adaptor subunit HefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619658.1 protein_id gnl|my_center|LOCUS_26010 1343 2800 gene locus_tag LOCUS_26020 1343 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 2800 4920 gene locus_tag LOCUS_26030 2800 4920 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117761.1 protein_id gnl|my_center|LOCUS_26030 >Feature sequence242 <1 526 gene locus_tag LOCUS_26040 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947291.1:bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase 560 2056 gene locus_tag LOCUS_26050 560 2056 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175987.1 protein_id gnl|my_center|LOCUS_26050 2053 2964 gene locus_tag LOCUS_26060 2053 2964 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083951.1 protein_id gnl|my_center|LOCUS_26060 3313 2966 gene locus_tag LOCUS_26070 gene arsC 3313 2966 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098232.1 protein_id gnl|my_center|LOCUS_26070 4387 3326 gene locus_tag LOCUS_26080 4387 3326 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388272.1 protein_id gnl|my_center|LOCUS_26080 4555 5187 gene locus_tag LOCUS_26090 4555 5187 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327211.1 protein_id gnl|my_center|LOCUS_26090 >Feature sequence243 663 22 gene locus_tag LOCUS_26100 663 22 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338642.1 protein_id gnl|my_center|LOCUS_26100 1346 660 gene locus_tag LOCUS_26110 1346 660 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532294.1 protein_id gnl|my_center|LOCUS_26110 2125 1343 gene locus_tag LOCUS_26120 2125 1343 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531508.1 protein_id gnl|my_center|LOCUS_26120 3198 2122 gene locus_tag LOCUS_26130 3198 2122 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974316.1 protein_id gnl|my_center|LOCUS_26130 4344 3322 gene locus_tag LOCUS_26140 4344 3322 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309888.1 protein_id gnl|my_center|LOCUS_26140 >Feature sequence244 86 1 gene locus_tag LOCUS_t00280 86 1 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1045 239 gene locus_tag LOCUS_26150 1045 239 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088357.1 protein_id gnl|my_center|LOCUS_26150 1515 1523 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1557 1850 gene locus_tag LOCUS_26160 1557 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26160 1913 2752 gene locus_tag LOCUS_26170 gene map 1913 2752 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532002.1 protein_id gnl|my_center|LOCUS_26170 2773 3486 gene locus_tag LOCUS_26180 gene radC 2773 3486 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969427.1 protein_id gnl|my_center|LOCUS_26180 5033 3597 gene locus_tag LOCUS_26190 5033 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 >Feature sequence245 1372 80 gene locus_tag LOCUS_26200 gene gltA 1372 80 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328205.1 protein_id gnl|my_center|LOCUS_26200 2948 1533 gene locus_tag LOCUS_26210 gene gltX 2948 1533 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087606.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence246 52 348 gene locus_tag LOCUS_26220 52 348 CDS product DUF3572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531933.1 protein_id gnl|my_center|LOCUS_26220 1224 364 gene locus_tag LOCUS_26230 1224 364 CDS product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171560.1 protein_id gnl|my_center|LOCUS_26230 1322 2284 gene locus_tag LOCUS_26240 1322 2284 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389568.1 protein_id gnl|my_center|LOCUS_26240 2293 3078 gene locus_tag LOCUS_26250 gene xth 2293 3078 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967248.1 protein_id gnl|my_center|LOCUS_26250 4231 3119 gene locus_tag LOCUS_26260 4231 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 >Feature sequence247 841 2757 gene locus_tag LOCUS_26270 gene dnaK 841 2757 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067591.1 protein_id gnl|my_center|LOCUS_26270 2855 3985 gene locus_tag LOCUS_26280 gene dnaJ 2855 3985 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390648.1 protein_id gnl|my_center|LOCUS_26280 4262 4083 gene locus_tag LOCUS_26290 4262 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 >Feature sequence248 1002 715 gene locus_tag LOCUS_26300 gene gatC 1002 715 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531787.1 protein_id gnl|my_center|LOCUS_26300 1550 1738 gene locus_tag LOCUS_26310 1550 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 1879 2727 gene locus_tag LOCUS_26320 1879 2727 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971771.1 protein_id gnl|my_center|LOCUS_26320 2732 3196 gene locus_tag LOCUS_26330 2732 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 3828 3175 gene locus_tag LOCUS_26340 3828 3175 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530940.1 protein_id gnl|my_center|LOCUS_26340 5074 3833 gene locus_tag LOCUS_26350 5074 3833 CDS product DUF3419 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530941.1 protein_id gnl|my_center|LOCUS_26350 >Feature sequence249 1524 151 gene locus_tag LOCUS_26360 gene dctD 1524 151 CDS product C4-dicarboxylate transport transcriptional regulatory protein DctD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529421.1 protein_id gnl|my_center|LOCUS_26360 3287 1521 gene locus_tag LOCUS_26370 3287 1521 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975718.1 protein_id gnl|my_center|LOCUS_26370 3924 3475 gene locus_tag LOCUS_26380 3924 3475 CDS product DUF2852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081159057.1 protein_id gnl|my_center|LOCUS_26380 >Feature sequence250 <1 1628 gene locus_tag LOCUS_26390 <1 1628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966353.1:lytic transglycosylase domain-containing protein 2371 1754 gene locus_tag LOCUS_26400 2371 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 4783 2624 gene locus_tag LOCUS_26410 4783 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 >Feature sequence251 <1 1165 gene locus_tag LOCUS_26420 <1 1165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087079.1:N-acetylmuramoyl-L-alanine amidase 1358 3817 gene locus_tag LOCUS_26430 1358 3817 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531366.1 protein_id gnl|my_center|LOCUS_26430 >Feature sequence252 3167 2508 gene locus_tag LOCUS_26440 3167 2508 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470636.1 protein_id gnl|my_center|LOCUS_26440 3277 3906 gene locus_tag LOCUS_26450 3277 3906 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528820.1 protein_id gnl|my_center|LOCUS_26450 >Feature sequence253 <1 2107 gene locus_tag LOCUS_26460 <1 2107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726709.1:formate dehydrogenase subunit alpha 4634 4107 gene locus_tag LOCUS_26470 gene mobB 4634 4107 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969528.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence254 337 1167 gene locus_tag LOCUS_26480 337 1167 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387628.1 protein_id gnl|my_center|LOCUS_26480 1177 2178 gene locus_tag LOCUS_26490 1177 2178 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525573.1 protein_id gnl|my_center|LOCUS_26490 2175 2948 gene locus_tag LOCUS_26500 2175 2948 CDS product L-iditol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103118.1 protein_id gnl|my_center|LOCUS_26500 2995 4473 gene locus_tag LOCUS_26510 2995 4473 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528418.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence255 456 2741 gene locus_tag LOCUS_26520 gene rnr 456 2741 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087872.1 protein_id gnl|my_center|LOCUS_26520 2753 3496 gene locus_tag LOCUS_26530 2753 3496 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531919.1 protein_id gnl|my_center|LOCUS_26530 3577 3744 gene locus_tag LOCUS_26540 gene rpmG 3577 3744 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975118.1 protein_id gnl|my_center|LOCUS_26540 <4936 3875 gene locus_tag LOCUS_26550 <4936 3875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001288051.1:DASS family sodium-coupled anion symporter >Feature sequence256 670 59 gene locus_tag LOCUS_26560 670 59 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968286.1 protein_id gnl|my_center|LOCUS_26560 1478 660 gene locus_tag LOCUS_26570 1478 660 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083464.1 protein_id gnl|my_center|LOCUS_26570 1852 2883 gene locus_tag LOCUS_26580 gene hemE 1852 2883 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391363.1 protein_id gnl|my_center|LOCUS_26580 2884 3336 gene locus_tag LOCUS_26590 gene hemJ 2884 3336 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338807.1 protein_id gnl|my_center|LOCUS_26590 3602 4867 gene locus_tag LOCUS_26600 gene rho 3602 4867 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083462.1 protein_id gnl|my_center|LOCUS_26600 >Feature sequence257 1981 167 gene locus_tag LOCUS_26610 1981 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 2187 1981 gene locus_tag LOCUS_26620 2187 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 2794 2327 gene locus_tag LOCUS_26630 2794 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 4468 2876 gene locus_tag LOCUS_26640 4468 2876 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041937541.1 protein_id gnl|my_center|LOCUS_26640 4754 4353 gene locus_tag LOCUS_26650 4754 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 >Feature sequence258 1347 217 gene locus_tag LOCUS_26660 1347 217 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703745.1 protein_id gnl|my_center|LOCUS_26660 1608 1973 gene locus_tag LOCUS_26670 1608 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 2163 3479 gene locus_tag LOCUS_26680 2163 3479 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257295.1 protein_id gnl|my_center|LOCUS_26680 3783 4751 gene locus_tag LOCUS_26690 3783 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 >Feature sequence259 152 2014 gene locus_tag LOCUS_26700 gene typA 152 2014 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387909.1 protein_id gnl|my_center|LOCUS_26700 2048 2860 gene locus_tag LOCUS_26710 gene hisN 2048 2860 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090456.1 protein_id gnl|my_center|LOCUS_26710 3847 2888 gene locus_tag LOCUS_26720 3847 2888 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090464.1 protein_id gnl|my_center|LOCUS_26720 4069 4524 gene locus_tag LOCUS_26730 4069 4524 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709372.1 protein_id gnl|my_center|LOCUS_26730 >Feature sequence260 674 1351 gene locus_tag LOCUS_26740 674 1351 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003151.1 protein_id gnl|my_center|LOCUS_26740 1356 2102 gene locus_tag LOCUS_26750 gene pphC 1356 2102 CDS product protein-serine/threonine phosphatase PphC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119090.1 protein_id gnl|my_center|LOCUS_26750 2332 2030 gene locus_tag LOCUS_26760 2332 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 2749 2564 gene locus_tag LOCUS_26770 2749 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 4395 4319 gene locus_tag LOCUS_t00290 4395 4319 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence261 <1 738 gene locus_tag LOCUS_26780 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887358.1:GT4 family glycosyltransferase PelF 981 1955 gene locus_tag LOCUS_26790 981 1955 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919030.1 protein_id gnl|my_center|LOCUS_26790 >Feature sequence262 <1 583 gene locus_tag LOCUS_26800 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087259.1:ATP-binding protein 586 2064 gene locus_tag LOCUS_26810 gene ntrC 586 2064 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087260.1 protein_id gnl|my_center|LOCUS_26810 2242 4521 gene locus_tag LOCUS_26820 2242 4521 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967572.1 protein_id gnl|my_center|LOCUS_26820 >Feature sequence263 2463 1060 gene locus_tag LOCUS_26830 gene tcuA 2463 1060 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 protein_id gnl|my_center|LOCUS_26830 2608 3297 gene locus_tag LOCUS_26840 2608 3297 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537566.1 protein_id gnl|my_center|LOCUS_26840 3294 4241 gene locus_tag LOCUS_26850 3294 4241 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268235.1 protein_id gnl|my_center|LOCUS_26850 >Feature sequence264 3114 1180 gene locus_tag LOCUS_26860 gene acs 3114 1180 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174953.1 protein_id gnl|my_center|LOCUS_26860 3588 3229 gene locus_tag LOCUS_26870 3588 3229 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237140.1 protein_id gnl|my_center|LOCUS_26870 4585 3581 gene locus_tag LOCUS_26880 4585 3581 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639871.1 protein_id gnl|my_center|LOCUS_26880 >Feature sequence265 1208 3 gene locus_tag LOCUS_26890 1208 3 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971887.1 protein_id gnl|my_center|LOCUS_26890 1921 1208 gene locus_tag LOCUS_26900 1921 1208 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971886.1 protein_id gnl|my_center|LOCUS_26900 3242 1932 gene locus_tag LOCUS_26910 3242 1932 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971885.1 protein_id gnl|my_center|LOCUS_26910 4307 3384 gene locus_tag LOCUS_26920 4307 3384 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390650.1 protein_id gnl|my_center|LOCUS_26920 >Feature sequence266 1130 21 gene locus_tag LOCUS_26930 gene leuB 1130 21 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390438.1 protein_id gnl|my_center|LOCUS_26930 1839 1234 gene locus_tag LOCUS_26940 gene leuD 1839 1234 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083326.1 protein_id gnl|my_center|LOCUS_26940 2053 4743 gene locus_tag LOCUS_26950 gene acnA 2053 4743 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921494.1 protein_id gnl|my_center|LOCUS_26950 >Feature sequence267 849 109 gene locus_tag LOCUS_26960 849 109 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262155.1 protein_id gnl|my_center|LOCUS_26960 1553 852 gene locus_tag LOCUS_26970 gene hisQ 1553 852 CDS product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965511.1 protein_id gnl|my_center|LOCUS_26970 2375 1596 gene locus_tag LOCUS_26980 2375 1596 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759079.1 protein_id gnl|my_center|LOCUS_26980 3198 2407 gene locus_tag LOCUS_26990 3198 2407 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096153.1 protein_id gnl|my_center|LOCUS_26990 4048 3293 gene locus_tag LOCUS_27000 gene cobS 4048 3293 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388426.1 protein_id gnl|my_center|LOCUS_27000 <4683 4048 gene locus_tag LOCUS_27010 <4683 4048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003535313.1:nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase >Feature sequence268 628 1185 gene locus_tag LOCUS_27020 628 1185 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313108.1 protein_id gnl|my_center|LOCUS_27020 1186 3129 gene locus_tag LOCUS_27030 1186 3129 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392706.1 protein_id gnl|my_center|LOCUS_27030 4448 3156 gene locus_tag LOCUS_27040 4448 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 >Feature sequence269 361 1047 gene locus_tag LOCUS_27050 361 1047 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529672.1 protein_id gnl|my_center|LOCUS_27050 1044 1508 gene locus_tag LOCUS_27060 1044 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 1851 1531 gene locus_tag LOCUS_27070 1851 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 1982 2071 gene locus_tag LOCUS_t00300 1982 2071 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2612 3007 gene locus_tag LOCUS_27080 2612 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 >Feature sequence270 130 417 gene locus_tag LOCUS_27090 gene groES 130 417 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975443.1 protein_id gnl|my_center|LOCUS_27090 497 2161 gene locus_tag LOCUS_27100 gene groL 497 2161 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974613.1 protein_id gnl|my_center|LOCUS_27100 2327 3040 gene locus_tag LOCUS_27110 2327 3040 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092922.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence271 <1 925 gene locus_tag LOCUS_27120 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528604.1:malate synthase G 1577 1005 gene locus_tag LOCUS_27130 1577 1005 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968145.1 protein_id gnl|my_center|LOCUS_27130 3109 1574 gene locus_tag LOCUS_27140 3109 1574 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918202.1 protein_id gnl|my_center|LOCUS_27140 3258 3878 gene locus_tag LOCUS_27150 3258 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 >Feature sequence272 16 92 gene locus_tag LOCUS_t00310 16 92 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 292 816 gene locus_tag LOCUS_27160 292 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 967 1905 gene locus_tag LOCUS_27170 967 1905 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721044.1 protein_id gnl|my_center|LOCUS_27170 3017 1902 gene locus_tag LOCUS_27180 3017 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 3187 3819 gene locus_tag LOCUS_27190 3187 3819 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337693.1 protein_id gnl|my_center|LOCUS_27190 3839 4297 gene locus_tag LOCUS_27200 3839 4297 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086743.1 protein_id gnl|my_center|LOCUS_27200 >Feature sequence273 1952 684 gene locus_tag LOCUS_27210 1952 684 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339050.1 protein_id gnl|my_center|LOCUS_27210 2627 2121 gene locus_tag LOCUS_27220 2627 2121 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222428.1 protein_id gnl|my_center|LOCUS_27220 2866 3252 gene locus_tag LOCUS_27230 2866 3252 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902347.1 protein_id gnl|my_center|LOCUS_27230 3399 4328 gene locus_tag LOCUS_27240 gene znuA 3399 4328 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002053233.1 protein_id gnl|my_center|LOCUS_27240 >Feature sequence274 780 1112 gene locus_tag LOCUS_27250 780 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 1512 2066 gene locus_tag LOCUS_27260 1512 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 4245 2629 gene locus_tag LOCUS_27270 4245 2629 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_27270 >Feature sequence275 809 339 gene locus_tag LOCUS_27280 gene rpsG 809 339 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008875664.1 protein_id gnl|my_center|LOCUS_27280 1144 842 gene locus_tag LOCUS_27290 gene rpsL 1144 842 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390503.1 protein_id gnl|my_center|LOCUS_27290 <4461 1658 gene locus_tag LOCUS_27300 <4461 1658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975167.1:DNA-directed RNA polymerase subunit beta' >Feature sequence276 1300 800 gene locus_tag LOCUS_27310 1300 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 2388 1399 gene locus_tag LOCUS_27320 2388 1399 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976088.1 protein_id gnl|my_center|LOCUS_27320 3128 2415 gene locus_tag LOCUS_27330 3128 2415 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967032.1 protein_id gnl|my_center|LOCUS_27330 >Feature sequence277 375 79 gene locus_tag LOCUS_27340 375 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 699 2033 gene locus_tag LOCUS_27350 699 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 2043 2387 gene locus_tag LOCUS_27360 2043 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 3980 2805 gene locus_tag LOCUS_27370 3980 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 4168 4092 gene locus_tag LOCUS_t00320 4168 4092 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence278 1643 1389 gene locus_tag LOCUS_27380 gene hfq 1643 1389 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007591126.1 protein_id gnl|my_center|LOCUS_27380 3226 1850 gene locus_tag LOCUS_27390 gene trkA 3226 1850 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975268.1 protein_id gnl|my_center|LOCUS_27390 <4435 3248 gene locus_tag LOCUS_27400 <4435 3248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003535439.1:two-component system response regulator NtrX >Feature sequence279 <1 618 gene locus_tag LOCUS_27410 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528601.1:glutathione synthase 1087 2889 gene locus_tag LOCUS_27420 gene lepA 1087 2889 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528692.1 protein_id gnl|my_center|LOCUS_27420 3016 4227 gene locus_tag LOCUS_27430 3016 4227 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000235.1 protein_id gnl|my_center|LOCUS_27430 >Feature sequence280 1557 1117 gene locus_tag LOCUS_27440 1557 1117 CDS product DUF1489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536712.1 protein_id gnl|my_center|LOCUS_27440 1885 1583 gene locus_tag LOCUS_27450 1885 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 2193 2909 gene locus_tag LOCUS_27460 gene fnrL 2193 2909 CDS product Crp/Fnr family transcriptional regulator FnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720880.1 protein_id gnl|my_center|LOCUS_27460 3010 3444 gene locus_tag LOCUS_27470 3010 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 4008 3709 gene locus_tag LOCUS_27480 4008 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 >Feature sequence281 524 1102 gene locus_tag LOCUS_27490 524 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 1260 1099 gene locus_tag LOCUS_27500 1260 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 1259 1741 gene locus_tag LOCUS_27510 1259 1741 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087183.1 protein_id gnl|my_center|LOCUS_27510 3877 1763 gene locus_tag LOCUS_27520 gene recG 3877 1763 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531908.1 protein_id gnl|my_center|LOCUS_27520 3980 4252 gene locus_tag LOCUS_27530 3980 4252 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975556.1 protein_id gnl|my_center|LOCUS_27530 >Feature sequence282 <1 995 gene locus_tag LOCUS_27540 <1 995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_082100799.1:EAL domain-containing protein 4059 1084 gene locus_tag LOCUS_27550 4059 1084 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390194.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence283 2453 543 gene locus_tag LOCUS_27560 2453 543 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395243.1 protein_id gnl|my_center|LOCUS_27560 2602 2612 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence284 75 626 gene locus_tag LOCUS_27570 75 626 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583226.1 protein_id gnl|my_center|LOCUS_27570 1671 649 gene locus_tag LOCUS_27580 1671 649 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391537.1 protein_id gnl|my_center|LOCUS_27580 1900 2478 gene locus_tag LOCUS_27590 1900 2478 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527882.1 protein_id gnl|my_center|LOCUS_27590 3161 2736 gene locus_tag LOCUS_27600 3161 2736 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037377824.1 protein_id gnl|my_center|LOCUS_27600 3562 4071 gene locus_tag LOCUS_27610 gene fabA 3562 4071 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037377826.1 protein_id gnl|my_center|LOCUS_27610 >Feature sequence285 <1 1887 gene locus_tag LOCUS_27620 <1 1887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478902.1:efflux RND transporter permease subunit VmeI 1974 3320 gene locus_tag LOCUS_27630 1974 3320 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809603.1 protein_id gnl|my_center|LOCUS_27630 >Feature sequence286 877 1914 gene locus_tag LOCUS_27640 877 1914 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067007.1 protein_id gnl|my_center|LOCUS_27640 2080 3402 gene locus_tag LOCUS_27650 2080 3402 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528077.1 protein_id gnl|my_center|LOCUS_27650 >Feature sequence287 <1 1298 gene locus_tag LOCUS_27660 <1 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084568.1:nitrogenase cofactor biosynthesis protein NifB 1309 1584 gene locus_tag LOCUS_27670 1309 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 1595 2863 gene locus_tag LOCUS_27680 1595 2863 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140334.1 protein_id gnl|my_center|LOCUS_27680 2924 3214 gene locus_tag LOCUS_27690 gene fdxC 2924 3214 CDS product ferredoxin FdxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723760.1 protein_id gnl|my_center|LOCUS_27690 3267 3626 gene locus_tag LOCUS_27700 3267 3626 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389669.1 protein_id gnl|my_center|LOCUS_27700 3626 4216 gene locus_tag LOCUS_27710 3626 4216 CDS product nitrogen fixation protein NifQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389936.1 protein_id gnl|my_center|LOCUS_27710 >Feature sequence288 313 224 gene locus_tag LOCUS_t00330 313 224 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1085 375 gene locus_tag LOCUS_27720 1085 375 CDS product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 protein_id gnl|my_center|LOCUS_27720 3436 1085 gene locus_tag LOCUS_27730 gene hypF 3436 1085 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338264.1 protein_id gnl|my_center|LOCUS_27730 <4236 3436 gene locus_tag LOCUS_27740 <4236 3436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089681.1:nickel-dependent hydrogenase large subunit >Feature sequence289 1507 542 gene locus_tag LOCUS_27750 1507 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 2258 1518 gene locus_tag LOCUS_27760 2258 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 2335 2943 gene locus_tag LOCUS_27770 2335 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 3672 4037 gene locus_tag LOCUS_27780 3672 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 4210 4135 gene locus_tag LOCUS_t00340 4210 4135 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence290 3015 3701 gene locus_tag LOCUS_27790 3015 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 >Feature sequence291 1158 382 gene locus_tag LOCUS_27800 1158 382 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265631.1 protein_id gnl|my_center|LOCUS_27800 1905 1240 gene locus_tag LOCUS_27810 1905 1240 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040654.1 protein_id gnl|my_center|LOCUS_27810 2642 1902 gene locus_tag LOCUS_27820 2642 1902 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_27820 4053 2719 gene locus_tag LOCUS_27830 4053 2719 CDS product pilus assembly protein TadG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395073.1 protein_id gnl|my_center|LOCUS_27830 >Feature sequence292 646 224 gene locus_tag LOCUS_27840 646 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 988 815 gene locus_tag LOCUS_27850 988 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 1305 1096 gene locus_tag LOCUS_27860 1305 1096 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002905.1 protein_id gnl|my_center|LOCUS_27860 2027 1611 gene locus_tag LOCUS_27870 2027 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 2904 2137 gene locus_tag LOCUS_27880 gene yaaA 2904 2137 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921214.1 protein_id gnl|my_center|LOCUS_27880 3740 3177 gene locus_tag LOCUS_27890 gene phnN 3740 3177 CDS product phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170982.1 protein_id gnl|my_center|LOCUS_27890 >Feature sequence293 340 3432 gene locus_tag LOCUS_27900 340 3432 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 protein_id gnl|my_center|LOCUS_27900 3867 3463 gene locus_tag LOCUS_27910 3867 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 >Feature sequence294 1401 2039 gene locus_tag LOCUS_27920 1401 2039 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098179.1 protein_id gnl|my_center|LOCUS_27920 2494 2018 gene locus_tag LOCUS_27930 2494 2018 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338436.1 protein_id gnl|my_center|LOCUS_27930 2614 3732 gene locus_tag LOCUS_27940 gene ald 2614 3732 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391433.1 protein_id gnl|my_center|LOCUS_27940 3858 3992 gene locus_tag LOCUS_27950 3858 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 >Feature sequence295 564 2873 gene locus_tag LOCUS_27960 gene nosZ 564 2873 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_27960 2965 3681 gene locus_tag LOCUS_27970 2965 3681 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074258.1 protein_id gnl|my_center|LOCUS_27970 >Feature sequence296 726 938 gene locus_tag LOCUS_27980 726 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 1008 1130 gene locus_tag LOCUS_27990 1008 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 1127 1606 gene locus_tag LOCUS_28000 1127 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 1603 2544 gene locus_tag LOCUS_28010 1603 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 2541 2903 gene locus_tag LOCUS_28020 2541 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 2900 3520 gene locus_tag LOCUS_28030 2900 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087777.1 protein_id gnl|my_center|LOCUS_28030 3513 3680 gene locus_tag LOCUS_28040 3513 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 >Feature sequence297 <1 502 gene locus_tag LOCUS_28050 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028175983.1:DUF1036 domain-containing protein 535 1212 gene locus_tag LOCUS_28060 535 1212 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090825.1 protein_id gnl|my_center|LOCUS_28060 1332 2174 gene locus_tag LOCUS_28070 gene dapD 1332 2174 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493576.1 protein_id gnl|my_center|LOCUS_28070 2228 3400 gene locus_tag LOCUS_28080 gene dapE 2228 3400 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970848.1 protein_id gnl|my_center|LOCUS_28080 >Feature sequence298 14 2188 gene locus_tag LOCUS_28090 14 2188 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_28090 2288 3952 gene locus_tag LOCUS_28100 2288 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 >Feature sequence299 1 1641 gene locus_tag LOCUS_28110 1 1641 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271912.1 protein_id gnl|my_center|LOCUS_28110 1866 2594 gene locus_tag LOCUS_28120 1866 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 <3976 2614 gene locus_tag LOCUS_28130 <3976 2614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969907.1:winged helix-turn-helix domain-containing tetratricopeptide repeat protein >Feature sequence300 1594 2694 gene locus_tag LOCUS_28140 1594 2694 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965785.1 protein_id gnl|my_center|LOCUS_28140 >Feature sequence301 304 1383 gene locus_tag LOCUS_28150 304 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 1428 2093 gene locus_tag LOCUS_28160 1428 2093 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086898.1 protein_id gnl|my_center|LOCUS_28160 2090 3187 gene locus_tag LOCUS_28170 2090 3187 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532443.1 protein_id gnl|my_center|LOCUS_28170 3180 3890 gene locus_tag LOCUS_28180 gene hdaA 3180 3890 CDS product DnaA regulatory inactivator HdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532442.1 protein_id gnl|my_center|LOCUS_28180 >Feature sequence302 954 3746 gene locus_tag LOCUS_28190 954 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 >Feature sequence303 1250 567 gene locus_tag LOCUS_28200 1250 567 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945885.1 protein_id gnl|my_center|LOCUS_28200 1418 2548 gene locus_tag LOCUS_28210 gene tgt 1418 2548 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328449.1 protein_id gnl|my_center|LOCUS_28210 2679 3113 gene locus_tag LOCUS_28220 2679 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 <3884 3211 gene locus_tag LOCUS_28230 <3884 3211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337049.1:lipoyl(octanoyl) transferase LipB >Feature sequence304 1696 635 gene locus_tag LOCUS_28240 1696 635 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957761.1 protein_id gnl|my_center|LOCUS_28240 2886 1693 gene locus_tag LOCUS_28250 2886 1693 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918249.1 protein_id gnl|my_center|LOCUS_28250 <3863 3098 gene locus_tag LOCUS_28260 <3863 3098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970550.1:aspartate aminotransferase family protein >Feature sequence305 1390 347 gene locus_tag LOCUS_28270 gene ruvB 1390 347 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535962.1 protein_id gnl|my_center|LOCUS_28270 1998 1387 gene locus_tag LOCUS_28280 gene ruvA 1998 1387 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084352.1 protein_id gnl|my_center|LOCUS_28280 2516 1995 gene locus_tag LOCUS_28290 gene ruvC 2516 1995 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720722.1 protein_id gnl|my_center|LOCUS_28290 3259 2516 gene locus_tag LOCUS_28300 3259 2516 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970171.1 protein_id gnl|my_center|LOCUS_28300 >Feature sequence306 <1 1149 gene locus_tag LOCUS_28310 <1 1149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011974721.1:cytochrome c oxidase subunit I 1177 1326 gene locus_tag LOCUS_28320 1177 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 1337 1933 gene locus_tag LOCUS_28330 1337 1933 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309822.1 protein_id gnl|my_center|LOCUS_28330 1962 2798 gene locus_tag LOCUS_28340 1962 2798 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083994.1 protein_id gnl|my_center|LOCUS_28340 2873 3289 gene locus_tag LOCUS_28350 2873 3289 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083995.1 protein_id gnl|my_center|LOCUS_28350 >Feature sequence307 115 750 gene locus_tag LOCUS_28360 115 750 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648011.1 protein_id gnl|my_center|LOCUS_28360 785 2077 gene locus_tag LOCUS_28370 785 2077 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897686.1 protein_id gnl|my_center|LOCUS_28370 3694 2081 gene locus_tag LOCUS_28380 3694 2081 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522103.1 protein_id gnl|my_center|LOCUS_28380 >Feature sequence308 282 94 gene locus_tag LOCUS_28390 282 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 562 1371 gene locus_tag LOCUS_28400 562 1371 CDS product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162991851.1 protein_id gnl|my_center|LOCUS_28400 1486 2751 gene locus_tag LOCUS_28410 1486 2751 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947610.1 protein_id gnl|my_center|LOCUS_28410 <3812 2924 gene locus_tag LOCUS_28420 <3812 2924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090469.1:glutamate synthase subunit beta >Feature sequence309 2 769 gene locus_tag LOCUS_28430 2 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 773 2035 gene locus_tag LOCUS_28440 773 2035 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532158.1 protein_id gnl|my_center|LOCUS_28440 2047 2472 gene locus_tag LOCUS_28450 2047 2472 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532157.1 protein_id gnl|my_center|LOCUS_28450 2484 2867 gene locus_tag LOCUS_28460 2484 2867 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640349.1 protein_id gnl|my_center|LOCUS_28460 2916 3230 gene locus_tag LOCUS_28470 2916 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 <3812 3234 gene locus_tag LOCUS_28480 <3812 3234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966301.1:cation transporter >Feature sequence310 337 732 gene locus_tag LOCUS_28490 337 732 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537642.1 protein_id gnl|my_center|LOCUS_28490 738 2111 gene locus_tag LOCUS_28500 738 2111 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087882.1 protein_id gnl|my_center|LOCUS_28500 2273 3553 gene locus_tag LOCUS_28510 gene serS 2273 3553 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534571.1 protein_id gnl|my_center|LOCUS_28510 >Feature sequence311 40 1095 gene locus_tag LOCUS_28520 40 1095 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183508.1 protein_id gnl|my_center|LOCUS_28520 1805 1104 gene locus_tag LOCUS_28530 1805 1104 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_28530 2580 1810 gene locus_tag LOCUS_28540 2580 1810 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040055.1 protein_id gnl|my_center|LOCUS_28540 3521 2577 gene locus_tag LOCUS_28550 3521 2577 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_28550 3799 3518 gene locus_tag LOCUS_28560 3799 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 >Feature sequence312 1508 30 gene locus_tag LOCUS_28570 gene nifD 1508 30 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084552.1 protein_id gnl|my_center|LOCUS_28570 2483 1599 gene locus_tag LOCUS_28580 gene nifH 2483 1599 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943447.1 protein_id gnl|my_center|LOCUS_28580 2925 3776 gene locus_tag LOCUS_28590 2925 3776 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338304.1 protein_id gnl|my_center|LOCUS_28590 >Feature sequence313 1415 1858 gene locus_tag LOCUS_28600 1415 1858 CDS product host attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529560.1 protein_id gnl|my_center|LOCUS_28600 <3774 2491 gene locus_tag LOCUS_28610 <3774 2491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034350815.1:aminotransferase class V-fold PLP-dependent enzyme >Feature sequence314 13 366 gene locus_tag LOCUS_28620 13 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 405 1904 gene locus_tag LOCUS_28630 405 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 2476 3441 gene locus_tag LOCUS_28640 gene pip 2476 3441 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532557.1 protein_id gnl|my_center|LOCUS_28640 >Feature sequence315 242 1573 gene locus_tag LOCUS_28650 242 1573 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391106.1 protein_id gnl|my_center|LOCUS_28650 1573 2553 gene locus_tag LOCUS_28660 gene cbiB 1573 2553 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966031.1 protein_id gnl|my_center|LOCUS_28660 <3745 2502 gene locus_tag LOCUS_28670 <3745 2502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338494.1:cobyric acid synthase >Feature sequence316 1253 210 gene locus_tag LOCUS_28680 1253 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 1377 2141 gene locus_tag LOCUS_28690 1377 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 2141 3496 gene locus_tag LOCUS_28700 2141 3496 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971719.1 protein_id gnl|my_center|LOCUS_28700 >Feature sequence317 <1 735 gene locus_tag LOCUS_28710 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528060.1:[protein-PII] uridylyltransferase 1543 743 gene locus_tag LOCUS_28720 gene moeB 1543 743 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083588.1 protein_id gnl|my_center|LOCUS_28720 2533 1547 gene locus_tag LOCUS_28730 gene cysK 2533 1547 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310159.1 protein_id gnl|my_center|LOCUS_28730 3009 2542 gene locus_tag LOCUS_28740 3009 2542 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 protein_id gnl|my_center|LOCUS_28740 3493 2990 gene locus_tag LOCUS_28750 gene dut 3493 2990 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083581.1 protein_id gnl|my_center|LOCUS_28750 >Feature sequence318 1304 810 gene locus_tag LOCUS_28760 1304 810 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140066.1 protein_id gnl|my_center|LOCUS_28760 1418 1762 gene locus_tag LOCUS_28770 1418 1762 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089312.1 protein_id gnl|my_center|LOCUS_28770 2726 1785 gene locus_tag LOCUS_28780 2726 1785 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087807.1 protein_id gnl|my_center|LOCUS_28780 <3639 2726 gene locus_tag LOCUS_28790 <3639 2726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087809.1:inactive transglutaminase family protein >Feature sequence319 <1 685 gene locus_tag LOCUS_28800 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015923258.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPB 682 999 gene locus_tag LOCUS_28810 682 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 1030 1593 gene locus_tag LOCUS_28820 1030 1593 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880137.1 protein_id gnl|my_center|LOCUS_28820 1804 2460 gene locus_tag LOCUS_28830 1804 2460 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142691.1 protein_id gnl|my_center|LOCUS_28830 >Feature sequence320 3578 2001 gene locus_tag LOCUS_28840 3578 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 >Feature sequence321 <1 842 gene locus_tag LOCUS_28850 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339117.1:electron transport complex subunit RsxC 839 1912 gene locus_tag LOCUS_28860 839 1912 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339118.1 protein_id gnl|my_center|LOCUS_28860 1909 2652 gene locus_tag LOCUS_28870 gene rsxG 1909 2652 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339119.1 protein_id gnl|my_center|LOCUS_28870 2649 3344 gene locus_tag LOCUS_28880 2649 3344 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561393.1 protein_id gnl|my_center|LOCUS_28880 >Feature sequence322 1556 2968 gene locus_tag LOCUS_28890 1556 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 >Feature sequence323 <1 931 gene locus_tag LOCUS_28900 <1 931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085323.1:glycine--tRNA ligase subunit beta 1228 2784 gene locus_tag LOCUS_28910 gene xseA 1228 2784 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968483.1 protein_id gnl|my_center|LOCUS_28910 2845 3072 gene locus_tag LOCUS_28920 2845 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 >Feature sequence324 383 2038 gene locus_tag LOCUS_28930 gene recN 383 2038 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530966.1 protein_id gnl|my_center|LOCUS_28930 >Feature sequence325 2034 880 gene locus_tag LOCUS_28940 2034 880 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337843.1 protein_id gnl|my_center|LOCUS_28940 2467 2048 gene locus_tag LOCUS_28950 2467 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 2692 3141 gene locus_tag LOCUS_28960 2692 3141 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035384.1 protein_id gnl|my_center|LOCUS_28960 >Feature sequence326 2599 1247 gene locus_tag LOCUS_28970 gene glmU 2599 1247 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626497.1 protein_id gnl|my_center|LOCUS_28970 >Feature sequence327 <1 1482 gene locus_tag LOCUS_28980 <1 1482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529369.1:cobaltochelatase subunit CobT 1479 2495 gene locus_tag LOCUS_28990 1479 2495 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083009.1 protein_id gnl|my_center|LOCUS_28990 3138 2497 gene locus_tag LOCUS_29000 3138 2497 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973191.1 protein_id gnl|my_center|LOCUS_29000 >Feature sequence328 298 1341 gene locus_tag LOCUS_29010 298 1341 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140332.1 protein_id gnl|my_center|LOCUS_29010 3442 3122 gene locus_tag LOCUS_29020 3442 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 >Feature sequence329 1466 183 gene locus_tag LOCUS_29030 gene nhaA 1466 183 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387889.1 protein_id gnl|my_center|LOCUS_29030 2187 1594 gene locus_tag LOCUS_29040 2187 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 2549 2184 gene locus_tag LOCUS_29050 2549 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 3172 2555 gene locus_tag LOCUS_29060 3172 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 >Feature sequence330 <1 2380 gene locus_tag LOCUS_29070 <1 2380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085336.1:DUF2339 domain-containing protein 2565 3008 gene locus_tag LOCUS_29080 2565 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 >Feature sequence331 533 321 gene locus_tag LOCUS_29090 533 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 721 1860 gene locus_tag LOCUS_29100 721 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 1909 2637 gene locus_tag LOCUS_29110 1909 2637 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211429.1 protein_id gnl|my_center|LOCUS_29110 >Feature sequence332 <1 1154 gene locus_tag LOCUS_29120 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088394.1:ABC transporter permease 1239 1733 gene locus_tag LOCUS_29130 1239 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 1859 2725 gene locus_tag LOCUS_29140 1859 2725 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920871.1 protein_id gnl|my_center|LOCUS_29140 >Feature sequence333 807 571 gene locus_tag LOCUS_29150 807 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 1104 2930 gene locus_tag LOCUS_29160 1104 2930 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113792.1 protein_id gnl|my_center|LOCUS_29160 >Feature sequence334 312 845 gene locus_tag LOCUS_29170 gene cobU 312 845 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395402.1 protein_id gnl|my_center|LOCUS_29170 853 1911 gene locus_tag LOCUS_29180 gene cobW 853 1911 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969596.1 protein_id gnl|my_center|LOCUS_29180 >Feature sequence335 2128 917 gene locus_tag LOCUS_29190 2128 917 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969423.1 protein_id gnl|my_center|LOCUS_29190 2501 2283 gene locus_tag LOCUS_29200 2501 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 >Feature sequence336 773 243 gene locus_tag LOCUS_29210 gene rimM 773 243 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388941.1 protein_id gnl|my_center|LOCUS_29210 1190 783 gene locus_tag LOCUS_29220 1190 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 2770 1271 gene locus_tag LOCUS_29230 gene ffh 2770 1271 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528802.1 protein_id gnl|my_center|LOCUS_29230 >Feature sequence337 386 237 gene locus_tag LOCUS_29240 386 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 592 2142 gene locus_tag LOCUS_29250 592 2142 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224276.1 protein_id gnl|my_center|LOCUS_29250 >Feature sequence338 933 334 gene locus_tag LOCUS_29260 933 334 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_29260 1087 2250 gene locus_tag LOCUS_29270 1087 2250 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530516.1 protein_id gnl|my_center|LOCUS_29270 2697 2272 gene locus_tag LOCUS_29280 2697 2272 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531220.1 protein_id gnl|my_center|LOCUS_29280 >Feature sequence339 1700 1254 gene locus_tag LOCUS_29290 1700 1254 CDS product diheme cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337163.1 protein_id gnl|my_center|LOCUS_29290 2121 1726 gene locus_tag LOCUS_29300 2121 1726 CDS product DUF1924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337164.1 protein_id gnl|my_center|LOCUS_29300 <3213 2133 gene locus_tag LOCUS_29310 <3213 2133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337165.1:cytochrome b/b6 domain-containing protein >Feature sequence340 1497 520 gene locus_tag LOCUS_29320 1497 520 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967041.1 protein_id gnl|my_center|LOCUS_29320 2324 1494 gene locus_tag LOCUS_29330 gene ppk2 2324 1494 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121626.1 protein_id gnl|my_center|LOCUS_29330 2945 2352 gene locus_tag LOCUS_29340 2945 2352 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071857.1 protein_id gnl|my_center|LOCUS_29340 >Feature sequence341 358 873 gene locus_tag LOCUS_29350 358 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 1013 2251 gene locus_tag LOCUS_29360 1013 2251 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_29360 >Feature sequence342 274 1539 gene locus_tag LOCUS_29370 gene hemL 274 1539 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331929.1 protein_id gnl|my_center|LOCUS_29370 2716 1589 gene locus_tag LOCUS_29380 2716 1589 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_29380 >Feature sequence343 >Feature sequence344 562 107 gene locus_tag LOCUS_29390 gene ccmE 562 107 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532635.1 protein_id gnl|my_center|LOCUS_29390 1843 608 gene locus_tag LOCUS_29400 gene ccmI 1843 608 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085909.1 protein_id gnl|my_center|LOCUS_29400 >Feature sequence345 407 715 gene locus_tag LOCUS_29410 407 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 1348 803 gene locus_tag LOCUS_29420 1348 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 2107 1526 gene locus_tag LOCUS_29430 2107 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 >Feature sequence346 523 2085 gene locus_tag LOCUS_29440 523 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085511.1 protein_id gnl|my_center|LOCUS_29440 2164 2553 gene locus_tag LOCUS_29450 2164 2553 CDS product glutamyl-tRNA amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214035.1 protein_id gnl|my_center|LOCUS_29450 >Feature sequence347 85 984 gene locus_tag LOCUS_29460 85 984 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965825.1 protein_id gnl|my_center|LOCUS_29460 1835 2101 gene locus_tag LOCUS_29470 1835 2101 CDS product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706878.1 protein_id gnl|my_center|LOCUS_29470 2140 3033 gene locus_tag LOCUS_29480 2140 3033 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508789.1 protein_id gnl|my_center|LOCUS_29480 >Feature sequence348 236 949 gene locus_tag LOCUS_29490 236 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 1215 982 gene locus_tag LOCUS_29500 1215 982 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104925.1 protein_id gnl|my_center|LOCUS_29500 1403 2101 gene locus_tag LOCUS_29510 1403 2101 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530738.1 protein_id gnl|my_center|LOCUS_29510 2139 2429 gene locus_tag LOCUS_29520 2139 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 <3091 2493 gene locus_tag LOCUS_29530 <3091 2493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015923333.1:aldo/keto reductase >Feature sequence349 865 1824 gene locus_tag LOCUS_29540 865 1824 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083775.1 protein_id gnl|my_center|LOCUS_29540 1821 2288 gene locus_tag LOCUS_29550 1821 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 >Feature sequence350 432 1325 gene locus_tag LOCUS_29560 432 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence351 23 832 gene locus_tag LOCUS_29570 23 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 964 2490 gene locus_tag LOCUS_29580 gene nifA 964 2490 CDS product nif-specific transcriptional activator NifA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084834.1 protein_id gnl|my_center|LOCUS_29580 >Feature sequence352 <1 2578 gene locus_tag LOCUS_29590 <1 2578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975897.1:cobaltochelatase subunit CobN >Feature sequence353 2715 1426 gene locus_tag LOCUS_29600 2715 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 >Feature sequence354 <1 1378 gene locus_tag LOCUS_29610 <1 1378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532189.1:endopeptidase La 1538 1813 gene locus_tag LOCUS_29620 1538 1813 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_29620 1990 2065 gene locus_tag LOCUS_t00350 1990 2065 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 <3027 2104 gene locus_tag LOCUS_29630 <3027 2104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029301722.1:EAL domain-containing response regulator >Feature sequence355 346 1605 gene locus_tag LOCUS_29640 346 1605 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970648.1 protein_id gnl|my_center|LOCUS_29640 1744 2922 gene locus_tag LOCUS_29650 1744 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 >Feature sequence356 1239 124 gene locus_tag LOCUS_29660 1239 124 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_29660 2530 1244 gene locus_tag LOCUS_29670 gene purD 2530 1244 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327551.1 protein_id gnl|my_center|LOCUS_29670 >Feature sequence357 1702 1289 gene locus_tag LOCUS_29680 1702 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 2121 1918 gene locus_tag LOCUS_29690 2121 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 >Feature sequence358 <1 1045 gene locus_tag LOCUS_29700 <1 1045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066398080.1:N-acetylneuraminate synthase 1051 2208 gene locus_tag LOCUS_29710 gene neuC 1051 2208 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545909.1 protein_id gnl|my_center|LOCUS_29710 >Feature sequence359 203 1117 gene locus_tag LOCUS_29720 203 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29720 1136 1561 gene locus_tag LOCUS_29730 1136 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29730 1558 1917 gene locus_tag LOCUS_29740 1558 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 2924 1923 gene locus_tag LOCUS_29750 2924 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 >Feature sequence360 167 1408 gene locus_tag LOCUS_29760 167 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 1511 2077 gene locus_tag LOCUS_29770 1511 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29770 2080 2919 gene locus_tag LOCUS_29780 2080 2919 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811924.1 protein_id gnl|my_center|LOCUS_29780 >Feature sequence361 739 1854 gene locus_tag LOCUS_29790 739 1854 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815494.1 protein_id gnl|my_center|LOCUS_29790 >Feature sequence362 522 16 gene locus_tag LOCUS_29800 gene mopJ 522 16 CDS product motility/cell cycle regulatory protein MopJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265646.1 protein_id gnl|my_center|LOCUS_29800 1170 757 gene locus_tag LOCUS_29810 1170 757 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532660.1 protein_id gnl|my_center|LOCUS_29810 1744 2142 gene locus_tag LOCUS_29820 gene msrB 1744 2142 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391288.1 protein_id gnl|my_center|LOCUS_29820 >Feature sequence363 1297 752 gene locus_tag LOCUS_29830 1297 752 CDS product DUF2585 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528354.1 protein_id gnl|my_center|LOCUS_29830 2628 1486 gene locus_tag LOCUS_29840 2628 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 >Feature sequence364 21 980 gene locus_tag LOCUS_29850 gene glpX 21 980 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531987.1 protein_id gnl|my_center|LOCUS_29850 977 2773 gene locus_tag LOCUS_29860 gene recJ 977 2773 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967117.1 protein_id gnl|my_center|LOCUS_29860 2859 2933 gene locus_tag LOCUS_t00360 2859 2933 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence365 388 1770 gene locus_tag LOCUS_29870 388 1770 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946411.1 protein_id gnl|my_center|LOCUS_29870 2730 1864 gene locus_tag LOCUS_29880 2730 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 >Feature sequence366 2237 1287 gene locus_tag LOCUS_29890 gene htpX 2237 1287 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391326.1 protein_id gnl|my_center|LOCUS_29890 2443 2631 gene locus_tag LOCUS_29900 2443 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 2776 2865 gene locus_tag LOCUS_t00370 2776 2865 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence367 1210 20 gene locus_tag LOCUS_29910 gene tuf 1210 20 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390512.1 protein_id gnl|my_center|LOCUS_29910 <2878 1268 gene locus_tag LOCUS_29920 <2878 1268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969194.1:elongation factor G >Feature sequence368 2763 475 gene locus_tag LOCUS_29930 gene maeB 2763 475 CDS product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342642.1 protein_id gnl|my_center|LOCUS_29930 >Feature sequence369 1402 953 gene locus_tag LOCUS_29940 gene paaI 1402 953 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577719.1 protein_id gnl|my_center|LOCUS_29940 2196 1399 gene locus_tag LOCUS_29950 gene paaG 2196 1399 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528003.1 protein_id gnl|my_center|LOCUS_29950 >Feature sequence370 <1 669 gene locus_tag LOCUS_29960 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975552.1:cobalt-precorrin-6A reductase 656 1888 gene locus_tag LOCUS_29970 656 1888 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390740.1 protein_id gnl|my_center|LOCUS_29970 1889 2650 gene locus_tag LOCUS_29980 gene cobM 1889 2650 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970288.1 protein_id gnl|my_center|LOCUS_29980 >Feature sequence371 1099 578 gene locus_tag LOCUS_29990 1099 578 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 protein_id gnl|my_center|LOCUS_29990 2389 1289 gene locus_tag LOCUS_30000 2389 1289 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389867.1 protein_id gnl|my_center|LOCUS_30000 2439 2455 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence372 1397 402 gene locus_tag LOCUS_30010 1397 402 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026615005.1 protein_id gnl|my_center|LOCUS_30010 2487 1390 gene locus_tag LOCUS_30020 2487 1390 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528081.1 protein_id gnl|my_center|LOCUS_30020 2679 2491 gene locus_tag LOCUS_30030 2679 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528080.1 protein_id gnl|my_center|LOCUS_30030 >Feature sequence373 1177 398 gene locus_tag LOCUS_30040 1177 398 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531889.1 protein_id gnl|my_center|LOCUS_30040 2105 1236 gene locus_tag LOCUS_30050 2105 1236 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391395.1 protein_id gnl|my_center|LOCUS_30050 2644 2141 gene locus_tag LOCUS_30060 2644 2141 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_30060 >Feature sequence374 2437 590 gene locus_tag LOCUS_30070 2437 590 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391166.1 protein_id gnl|my_center|LOCUS_30070 >Feature sequence375 <1 1160 gene locus_tag LOCUS_30080 <1 1160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001093933.1:DUF1116 domain-containing protein 1171 2118 gene locus_tag LOCUS_30090 gene arcC 1171 2118 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393607.1 protein_id gnl|my_center|LOCUS_30090 >Feature sequence376 1041 2003 gene locus_tag LOCUS_30100 1041 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 2242 2604 gene locus_tag LOCUS_30110 2242 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 >Feature sequence377 <2741 1238 gene locus_tag LOCUS_30120 <2741 1238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037393568.1:M3 family oligoendopeptidase >Feature sequence378 383 93 gene locus_tag LOCUS_30130 383 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 1252 425 gene locus_tag LOCUS_30140 1252 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 2466 1249 gene locus_tag LOCUS_30150 2466 1249 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_30150 >Feature sequence379 1184 180 gene locus_tag LOCUS_30160 1184 180 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047167.1 protein_id gnl|my_center|LOCUS_30160 1360 2007 gene locus_tag LOCUS_30170 1360 2007 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_30170 2119 2307 gene locus_tag LOCUS_30180 2119 2307 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_30180 >Feature sequence380 885 175 gene locus_tag LOCUS_30190 885 175 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531460.1 protein_id gnl|my_center|LOCUS_30190 1948 914 gene locus_tag LOCUS_30200 1948 914 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719301.1 protein_id gnl|my_center|LOCUS_30200 >Feature sequence381 459 1388 gene locus_tag LOCUS_30210 459 1388 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393024.1 protein_id gnl|my_center|LOCUS_30210 484 493 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1381 2643 gene locus_tag LOCUS_30220 1381 2643 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810308.1 protein_id gnl|my_center|LOCUS_30220 >Feature sequence382 >Feature sequence383 403 957 gene locus_tag LOCUS_30230 403 957 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967909.1 protein_id gnl|my_center|LOCUS_30230 1729 974 gene locus_tag LOCUS_30240 1729 974 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083882.1 protein_id gnl|my_center|LOCUS_30240 2204 1971 gene locus_tag LOCUS_30250 2204 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 >Feature sequence384 104 451 gene locus_tag LOCUS_30260 104 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 848 681 gene locus_tag LOCUS_30270 848 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 1434 1096 gene locus_tag LOCUS_30280 1434 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 2202 1672 gene locus_tag LOCUS_30290 2202 1672 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456626.1 protein_id gnl|my_center|LOCUS_30290 >Feature sequence385 313 432 gene locus_tag LOCUS_30300 313 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 2057 2500 gene locus_tag LOCUS_30310 2057 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30310 >Feature sequence386 <1 1335 gene locus_tag LOCUS_30320 <1 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531774.1:ATP-dependent Clp protease ATP-binding subunit ClpA >Feature sequence387 <1 891 gene locus_tag LOCUS_30330 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974131.1:ectoine hydrolase DoeA 2332 953 gene locus_tag LOCUS_30340 2332 953 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975296.1 protein_id gnl|my_center|LOCUS_30340 >Feature sequence388 <2643 1348 gene locus_tag LOCUS_30350 <2643 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084554.1:nitrogenase iron-molybdenum cofactor biosynthesis protein NifE >Feature sequence389 1966 380 gene locus_tag LOCUS_30360 1966 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 >Feature sequence390 1343 177 gene locus_tag LOCUS_30370 1343 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 2284 1343 gene locus_tag LOCUS_30380 2284 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 >Feature sequence391 1236 874 gene locus_tag LOCUS_30390 1236 874 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329728.1 protein_id gnl|my_center|LOCUS_30390 1538 1260 gene locus_tag LOCUS_30400 1538 1260 CDS product DUF4164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066868.1 protein_id gnl|my_center|LOCUS_30400 1699 2316 gene locus_tag LOCUS_30410 gene thiE 1699 2316 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388835.1 protein_id gnl|my_center|LOCUS_30410 >Feature sequence392 146 757 gene locus_tag LOCUS_30420 146 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941488.1 protein_id gnl|my_center|LOCUS_30420 2084 771 gene locus_tag LOCUS_30430 2084 771 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720129.1 protein_id gnl|my_center|LOCUS_30430 >Feature sequence393 669 400 gene locus_tag LOCUS_30440 669 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 1414 806 gene locus_tag LOCUS_30450 1414 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 2313 1486 gene locus_tag LOCUS_30460 2313 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 >Feature sequence394 546 1481 gene locus_tag LOCUS_30470 546 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 1530 2543 gene locus_tag LOCUS_30480 1530 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390337.1 protein_id gnl|my_center|LOCUS_30480 >Feature sequence395 2178 625 gene locus_tag LOCUS_30490 gene fdrA 2178 625 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865648.1 protein_id gnl|my_center|LOCUS_30490 >Feature sequence396 1393 284 gene locus_tag LOCUS_30500 1393 284 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144408.1 protein_id gnl|my_center|LOCUS_30500 <2506 1564 gene locus_tag LOCUS_30510 <2506 1564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546373.1:cytochrome c peroxidase >Feature sequence397 876 265 gene locus_tag LOCUS_30520 876 265 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142691.1 protein_id gnl|my_center|LOCUS_30520 1117 1683 gene locus_tag LOCUS_30530 1117 1683 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_30530 1782 2429 gene locus_tag LOCUS_30540 1782 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 >Feature sequence398 2162 561 gene locus_tag LOCUS_30550 2162 561 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815953.1 protein_id gnl|my_center|LOCUS_30550 >Feature sequence399 <1 663 gene locus_tag LOCUS_30560 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064242895.1:iron-containing alcohol dehydrogenase 2071 1475 gene locus_tag LOCUS_30570 2071 1475 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329392.1 protein_id gnl|my_center|LOCUS_30570 >Feature sequence400 7 642 gene locus_tag LOCUS_30580 7 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 >Feature sequence401 626 459 gene locus_tag LOCUS_30590 626 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 1270 623 gene locus_tag LOCUS_30600 1270 623 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066656.1 protein_id gnl|my_center|LOCUS_30600 1559 1484 gene locus_tag LOCUS_t00380 1559 1484 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2157 1771 gene locus_tag LOCUS_30610 2157 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 >Feature sequence402 >Feature sequence403 2212 1412 gene locus_tag LOCUS_30620 2212 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 >Feature sequence404 242 628 gene locus_tag LOCUS_30630 242 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30630 662 1327 gene locus_tag LOCUS_30640 gene modB 662 1327 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089690.1 protein_id gnl|my_center|LOCUS_30640 >Feature sequence405 1877 1161 gene locus_tag LOCUS_30650 1877 1161 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 protein_id gnl|my_center|LOCUS_30650 2241 1870 gene locus_tag LOCUS_30660 2241 1870 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258957.1 protein_id gnl|my_center|LOCUS_30660 >Feature sequence406 >Feature sequence407 298 1245 gene locus_tag LOCUS_30670 gene trxB 298 1245 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090115.1 protein_id gnl|my_center|LOCUS_30670 1252 1689 gene locus_tag LOCUS_30680 1252 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 <2219 1695 gene locus_tag LOCUS_30690 <2219 1695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011837011.1:DUF4336 domain-containing protein >Feature sequence408 1807 842 gene locus_tag LOCUS_30700 1807 842 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531656.1 protein_id gnl|my_center|LOCUS_30700 >Feature sequence409 1076 540 gene locus_tag LOCUS_30710 1076 540 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 protein_id gnl|my_center|LOCUS_30710 1436 1936 gene locus_tag LOCUS_30720 1436 1936 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243242.1 protein_id gnl|my_center|LOCUS_30720 >Feature sequence410 417 1442 gene locus_tag LOCUS_30730 417 1442 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338262.1 protein_id gnl|my_center|LOCUS_30730 >Feature sequence411 1347 43 gene locus_tag LOCUS_30740 1347 43 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244067.1 protein_id gnl|my_center|LOCUS_30740 >Feature sequence412 196 429 gene locus_tag LOCUS_30750 196 429 CDS product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379087.1 protein_id gnl|my_center|LOCUS_30750 506 1717 gene locus_tag LOCUS_30760 506 1717 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037385982.1 protein_id gnl|my_center|LOCUS_30760 >Feature sequence413 711 460 gene locus_tag LOCUS_30770 gene moaD 711 460 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090205.1 protein_id gnl|my_center|LOCUS_30770 1298 711 gene locus_tag LOCUS_30780 gene pgsA 1298 711 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974979.1 protein_id gnl|my_center|LOCUS_30780 <2175 1456 gene locus_tag LOCUS_30790 <2175 1456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389875.1:excinuclease ABC subunit UvrC >Feature sequence414 1840 560 gene locus_tag LOCUS_30800 1840 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 >Feature sequence415 62 265 gene locus_tag LOCUS_30810 62 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 258 542 gene locus_tag LOCUS_30820 258 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 >Feature sequence416 280 570 gene locus_tag LOCUS_30830 280 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 1409 582 gene locus_tag LOCUS_30840 1409 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 1519 1782 gene locus_tag LOCUS_30850 1519 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 >Feature sequence417 296 138 gene locus_tag LOCUS_30860 296 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 819 289 gene locus_tag LOCUS_30870 819 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 1674 883 gene locus_tag LOCUS_30880 1674 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 >Feature sequence418 811 1641 gene locus_tag LOCUS_30890 gene cysE 811 1641 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535018.1 protein_id gnl|my_center|LOCUS_30890 1742 1960 gene locus_tag LOCUS_30900 1742 1960 CDS product DUF3126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535016.1 protein_id gnl|my_center|LOCUS_30900 >Feature sequence419 176 1276 gene locus_tag LOCUS_30910 176 1276 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_30910 >Feature sequence420 638 372 gene locus_tag LOCUS_30920 638 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 1327 824 gene locus_tag LOCUS_30930 1327 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 1788 1979 gene locus_tag LOCUS_30940 1788 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 >Feature sequence421 293 147 gene locus_tag LOCUS_30950 293 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 >Feature sequence422 1179 604 gene locus_tag LOCUS_30960 1179 604 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971126.1 protein_id gnl|my_center|LOCUS_30960 <2060 1176 gene locus_tag LOCUS_30970 <2060 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014625896.1:glycosyltransferase family 4 protein >Feature sequence423 1523 981 gene locus_tag LOCUS_30980 1523 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 >Feature sequence424 940 755 gene locus_tag LOCUS_30990 940 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 <2048 953 gene locus_tag LOCUS_31000 <2048 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087634.1:DNA polymerase III subunit alpha >Feature sequence425 631 1206 gene locus_tag LOCUS_31010 gene raiA 631 1206 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083549.1 protein_id gnl|my_center|LOCUS_31010 1415 1879 gene locus_tag LOCUS_31020 gene ptsN 1415 1879 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387770.1 protein_id gnl|my_center|LOCUS_31020 >Feature sequence426 364 440 gene locus_tag LOCUS_t00390 364 440 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 747 526 gene locus_tag LOCUS_31030 747 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090162.1 protein_id gnl|my_center|LOCUS_31030 1057 1551 gene locus_tag LOCUS_31040 1057 1551 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 protein_id gnl|my_center|LOCUS_31040 >Feature sequence427 77 541 gene locus_tag LOCUS_31050 77 541 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920736.1 protein_id gnl|my_center|LOCUS_31050 >Feature sequence428 324 1886 gene locus_tag LOCUS_31060 gene gpmI 324 1886 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388989.1 protein_id gnl|my_center|LOCUS_31060 >Feature sequence429 719 171 gene locus_tag LOCUS_31070 719 171 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390527.1 protein_id gnl|my_center|LOCUS_31070 <2002 812 gene locus_tag LOCUS_31080 <2002 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041170147.1:S9 family peptidase