>Feature sequence01 691 1026 gene locus_tag LOCUS_00010 gene trxA 691 1026 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871903.1 protein_id gnl|my_center|LOCUS_00010 1869 1060 gene locus_tag LOCUS_00020 1869 1060 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903001.1 protein_id gnl|my_center|LOCUS_00020 2096 1917 gene locus_tag LOCUS_00030 2096 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3422 2196 gene locus_tag LOCUS_00040 gene hflX 3422 2196 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902924.1 protein_id gnl|my_center|LOCUS_00040 3702 4043 gene locus_tag LOCUS_00050 3702 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4805 4080 gene locus_tag LOCUS_00060 4805 4080 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902925.1 protein_id gnl|my_center|LOCUS_00060 5805 4873 gene locus_tag LOCUS_00070 5805 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5731 6036 gene locus_tag LOCUS_00080 5731 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7001 6519 gene locus_tag LOCUS_00090 gene moaC 7001 6519 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902923.1 protein_id gnl|my_center|LOCUS_00090 8448 7003 gene locus_tag LOCUS_00100 8448 7003 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289301.1 protein_id gnl|my_center|LOCUS_00100 8612 8902 gene locus_tag LOCUS_00110 8612 8902 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902407.1 protein_id gnl|my_center|LOCUS_00110 8967 9215 gene locus_tag LOCUS_00120 8967 9215 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902408.1 protein_id gnl|my_center|LOCUS_00120 10640 9495 gene locus_tag LOCUS_00130 10640 9495 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289209.1 protein_id gnl|my_center|LOCUS_00130 10827 11906 gene locus_tag LOCUS_00140 10827 11906 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289210.1 protein_id gnl|my_center|LOCUS_00140 12554 12093 gene locus_tag LOCUS_00150 12554 12093 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902933.1 protein_id gnl|my_center|LOCUS_00150 12853 12644 gene locus_tag LOCUS_00160 12853 12644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 13318 12929 gene locus_tag LOCUS_00170 13318 12929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 13837 13412 gene locus_tag LOCUS_00180 13837 13412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 13968 14459 gene locus_tag LOCUS_00190 13968 14459 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_00190 14456 15709 gene locus_tag LOCUS_00200 14456 15709 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_00200 16435 15782 gene locus_tag LOCUS_00210 16435 15782 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289247.1 protein_id gnl|my_center|LOCUS_00210 17523 16663 gene locus_tag LOCUS_00220 17523 16663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00220 18486 18692 gene locus_tag LOCUS_00230 18486 18692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 18696 19664 gene locus_tag LOCUS_00240 18696 19664 CDS product DUF5794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902715.1 protein_id gnl|my_center|LOCUS_00240 19718 19942 gene locus_tag LOCUS_00250 19718 19942 CDS product DUF5795 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902716.1 protein_id gnl|my_center|LOCUS_00250 21182 20826 gene locus_tag LOCUS_00260 21182 20826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 21613 21179 gene locus_tag LOCUS_00270 21613 21179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 21980 22168 gene locus_tag LOCUS_00280 21980 22168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 22335 22586 gene locus_tag LOCUS_00290 22335 22586 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892515.1 protein_id gnl|my_center|LOCUS_00290 23449 22808 gene locus_tag LOCUS_00300 23449 22808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 24401 23649 gene locus_tag LOCUS_00310 24401 23649 CDS product GTP cyclohydrolase IIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902721.1 protein_id gnl|my_center|LOCUS_00310 24601 25371 gene locus_tag LOCUS_00320 24601 25371 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902620.1 protein_id gnl|my_center|LOCUS_00320 25460 25600 gene locus_tag LOCUS_00330 25460 25600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 26105 25707 gene locus_tag LOCUS_00340 26105 25707 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289270.1 protein_id gnl|my_center|LOCUS_00340 26911 26195 gene locus_tag LOCUS_00350 26911 26195 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902743.1 protein_id gnl|my_center|LOCUS_00350 27488 27018 gene locus_tag LOCUS_00360 27488 27018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 29273 27621 gene locus_tag LOCUS_00370 29273 27621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 32113 29159 gene locus_tag LOCUS_00380 32113 29159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 34405 32321 gene locus_tag LOCUS_00390 34405 32321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 34885 34793 gene locus_tag LOCUS_t00010 34885 34793 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 36016 34952 gene locus_tag LOCUS_00400 36016 34952 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393432.1 protein_id gnl|my_center|LOCUS_00400 36188 37678 gene locus_tag LOCUS_00410 gene malQ 36188 37678 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056555.1 protein_id gnl|my_center|LOCUS_00410 37746 38483 gene locus_tag LOCUS_00420 37746 38483 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289269.1 protein_id gnl|my_center|LOCUS_00420 39191 38532 gene locus_tag LOCUS_00430 gene tpiA 39191 38532 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902734.1 protein_id gnl|my_center|LOCUS_00430 39545 39252 gene locus_tag LOCUS_00440 39545 39252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 39544 39855 gene locus_tag LOCUS_00450 39544 39855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 39931 40068 gene locus_tag LOCUS_00460 39931 40068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 42403 40052 gene locus_tag LOCUS_00470 42403 40052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903117.1 protein_id gnl|my_center|LOCUS_00470 43226 42408 gene locus_tag LOCUS_00480 43226 42408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 43922 43305 gene locus_tag LOCUS_00490 43922 43305 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902736.1 protein_id gnl|my_center|LOCUS_00490 44476 43919 gene locus_tag LOCUS_00500 44476 43919 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902737.1 protein_id gnl|my_center|LOCUS_00500 45579 44473 gene locus_tag LOCUS_00510 gene hisC 45579 44473 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289267.1 protein_id gnl|my_center|LOCUS_00510 45704 46465 gene locus_tag LOCUS_00520 45704 46465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903680.1 protein_id gnl|my_center|LOCUS_00520 45992 45917 gene locus_tag LOCUS_t00020 45992 45917 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 47056 46583 gene locus_tag LOCUS_00530 47056 46583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 48444 47140 gene locus_tag LOCUS_00540 gene hflX 48444 47140 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902924.1 protein_id gnl|my_center|LOCUS_00540 48991 48710 gene locus_tag LOCUS_00550 48991 48710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 52203 48988 gene locus_tag LOCUS_00560 52203 48988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 52805 52404 gene locus_tag LOCUS_00570 52805 52404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 53860 52874 gene locus_tag LOCUS_00580 53860 52874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 54147 53857 gene locus_tag LOCUS_00590 54147 53857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 54729 54301 gene locus_tag LOCUS_00600 gene lrpA1 54729 54301 CDS product HTH-type transcriptional regulator LrpA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902807.1 protein_id gnl|my_center|LOCUS_00600 55792 54854 gene locus_tag LOCUS_00610 55792 54854 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902808.1 protein_id gnl|my_center|LOCUS_00610 57687 55795 gene locus_tag LOCUS_00620 57687 55795 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289282.1 protein_id gnl|my_center|LOCUS_00620 57892 60594 gene locus_tag LOCUS_00630 57892 60594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 61136 61348 gene locus_tag LOCUS_00640 61136 61348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 61345 62064 gene locus_tag LOCUS_00650 61345 62064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 63285 62098 gene locus_tag LOCUS_00660 gene aroC 63285 62098 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902889.1 protein_id gnl|my_center|LOCUS_00660 64777 63401 gene locus_tag LOCUS_00670 64777 63401 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289154.1 protein_id gnl|my_center|LOCUS_00670 66081 64888 gene locus_tag LOCUS_00680 66081 64888 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903607.1 protein_id gnl|my_center|LOCUS_00680 67618 66323 gene locus_tag LOCUS_00690 gene aroA 67618 66323 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289296.1 protein_id gnl|my_center|LOCUS_00690 67800 69014 gene locus_tag LOCUS_00700 67800 69014 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902891.1 protein_id gnl|my_center|LOCUS_00700 69096 69683 gene locus_tag LOCUS_00710 69096 69683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 69859 70725 gene locus_tag LOCUS_00720 69859 70725 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902893.1 protein_id gnl|my_center|LOCUS_00720 70722 72146 gene locus_tag LOCUS_00730 70722 72146 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902894.1 protein_id gnl|my_center|LOCUS_00730 72625 72197 gene locus_tag LOCUS_00740 72625 72197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 72917 72579 gene locus_tag LOCUS_00750 72917 72579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 73414 73677 gene locus_tag LOCUS_00760 73414 73677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 75094 73646 gene locus_tag LOCUS_00770 gene thiC 75094 73646 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902492.1 protein_id gnl|my_center|LOCUS_00770 75849 75457 gene locus_tag LOCUS_00780 75849 75457 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048201672.1 protein_id gnl|my_center|LOCUS_00780 76161 75850 gene locus_tag LOCUS_00790 76161 75850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 76491 77324 gene locus_tag LOCUS_00800 76491 77324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 77383 79935 gene locus_tag LOCUS_00810 77383 79935 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902063.1 protein_id gnl|my_center|LOCUS_00810 80346 80585 gene locus_tag LOCUS_00820 80346 80585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 80582 80935 gene locus_tag LOCUS_00830 gene ndoA 80582 80935 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635963.1 protein_id gnl|my_center|LOCUS_00830 81766 81215 gene locus_tag LOCUS_00840 81766 81215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 81898 84222 gene locus_tag LOCUS_00850 81898 84222 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404341.1 protein_id gnl|my_center|LOCUS_00850 84726 84361 gene locus_tag LOCUS_00860 84726 84361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 85121 84810 gene locus_tag LOCUS_00870 85121 84810 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902900.1 protein_id gnl|my_center|LOCUS_00870 86010 85138 gene locus_tag LOCUS_00880 86010 85138 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902901.1 protein_id gnl|my_center|LOCUS_00880 86672 86067 gene locus_tag LOCUS_00890 86672 86067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 87145 86669 gene locus_tag LOCUS_00900 87145 86669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 88432 87149 gene locus_tag LOCUS_00910 88432 87149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 88516 89265 gene locus_tag LOCUS_00920 88516 89265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 89267 89500 gene locus_tag LOCUS_00930 89267 89500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 89676 90950 gene locus_tag LOCUS_00940 89676 90950 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901978.1 protein_id gnl|my_center|LOCUS_00940 91134 91000 gene locus_tag LOCUS_00950 91134 91000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 91648 91196 gene locus_tag LOCUS_00960 91648 91196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 91810 92901 gene locus_tag LOCUS_00970 91810 92901 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902123.1 protein_id gnl|my_center|LOCUS_00970 93264 93169 gene locus_tag LOCUS_t00030 93264 93169 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 93649 94086 gene locus_tag LOCUS_00980 93649 94086 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903814.1 protein_id gnl|my_center|LOCUS_00980 94740 94213 gene locus_tag LOCUS_00990 94740 94213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 94909 96285 gene locus_tag LOCUS_01000 94909 96285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 96060 96096 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 96179 96469 gene locus_tag LOCUS_01010 96179 96469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 96466 97149 gene locus_tag LOCUS_01020 96466 97149 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902614.1 protein_id gnl|my_center|LOCUS_01020 97425 98447 gene locus_tag LOCUS_01030 gene purM 97425 98447 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902615.1 protein_id gnl|my_center|LOCUS_01030 98542 99357 gene locus_tag LOCUS_01040 98542 99357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902320.1 protein_id gnl|my_center|LOCUS_01040 101483 99354 gene locus_tag LOCUS_01050 101483 99354 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138655632.1 protein_id gnl|my_center|LOCUS_01050 101737 103050 gene locus_tag LOCUS_01060 101737 103050 CDS product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879035.1 protein_id gnl|my_center|LOCUS_01060 103181 103909 gene locus_tag LOCUS_01070 103181 103909 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_01070 104022 111531 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcagacgaacccttgtggggttgaagc 111619 112206 gene locus_tag LOCUS_01080 111619 112206 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902314.1 protein_id gnl|my_center|LOCUS_01080 112512 112240 gene locus_tag LOCUS_01090 112512 112240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 113062 112595 gene locus_tag LOCUS_01100 113062 112595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 113189 113746 gene locus_tag LOCUS_01110 113189 113746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 113838 114671 gene locus_tag LOCUS_01120 113838 114671 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902630.1 protein_id gnl|my_center|LOCUS_01120 116052 114766 gene locus_tag LOCUS_01130 116052 114766 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904192.1 protein_id gnl|my_center|LOCUS_01130 116436 116197 gene locus_tag LOCUS_01140 116436 116197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 116435 117670 gene locus_tag LOCUS_01150 116435 117670 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902627.1 protein_id gnl|my_center|LOCUS_01150 118036 117839 gene locus_tag LOCUS_01160 118036 117839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 118798 118265 gene locus_tag LOCUS_01170 118798 118265 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902626.1 protein_id gnl|my_center|LOCUS_01170 118979 119902 gene locus_tag LOCUS_01180 gene rfaD 118979 119902 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880173.1 protein_id gnl|my_center|LOCUS_01180 120343 121290 gene locus_tag LOCUS_01190 120343 121290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 121352 122254 gene locus_tag LOCUS_01200 gene rocF 121352 122254 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808692.1 protein_id gnl|my_center|LOCUS_01200 124817 122280 gene locus_tag LOCUS_01210 gene gyrA 124817 122280 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902625.1 protein_id gnl|my_center|LOCUS_01210 126819 124885 gene locus_tag LOCUS_01220 gene gyrB 126819 124885 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049928262.1 protein_id gnl|my_center|LOCUS_01220 127089 128819 gene locus_tag LOCUS_01230 127089 128819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01230 128816 129454 gene locus_tag LOCUS_01240 128816 129454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 129455 130570 gene locus_tag LOCUS_01250 129455 130570 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902622.1 protein_id gnl|my_center|LOCUS_01250 131490 130567 gene locus_tag LOCUS_01260 131490 130567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 132335 131559 gene locus_tag LOCUS_01270 132335 131559 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902621.1 protein_id gnl|my_center|LOCUS_01270 132606 132364 gene locus_tag LOCUS_01280 132606 132364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 134378 132603 gene locus_tag LOCUS_01290 gene ligA 134378 132603 CDS product ATP-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902619.1 protein_id gnl|my_center|LOCUS_01290 134632 136200 gene locus_tag LOCUS_01300 134632 136200 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927109.1 protein_id gnl|my_center|LOCUS_01300 137176 136451 gene locus_tag LOCUS_01310 gene psmB 137176 136451 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289244.1 protein_id gnl|my_center|LOCUS_01310 137459 137241 gene locus_tag LOCUS_01320 137459 137241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 137761 138129 gene locus_tag LOCUS_01330 137761 138129 CDS product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902617.1 protein_id gnl|my_center|LOCUS_01330 138183 138722 gene locus_tag LOCUS_01340 138183 138722 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902616.1 protein_id gnl|my_center|LOCUS_01340 139946 138780 gene locus_tag LOCUS_01350 gene dnaJ 139946 138780 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902321.1 protein_id gnl|my_center|LOCUS_01350 140470 141759 gene locus_tag LOCUS_01360 140470 141759 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289527.1 protein_id gnl|my_center|LOCUS_01360 144191 142263 gene locus_tag LOCUS_01370 gene dnaK 144191 142263 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902322.1 protein_id gnl|my_center|LOCUS_01370 144980 144363 gene locus_tag LOCUS_01380 144980 144363 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902324.1 protein_id gnl|my_center|LOCUS_01380 145615 144977 gene locus_tag LOCUS_01390 145615 144977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 145596 146447 gene locus_tag LOCUS_01400 145596 146447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 146641 147987 gene locus_tag LOCUS_01410 146641 147987 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022374.1 protein_id gnl|my_center|LOCUS_01410 148443 148042 gene locus_tag LOCUS_01420 148443 148042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 148623 150212 gene locus_tag LOCUS_01430 148623 150212 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877864.1 protein_id gnl|my_center|LOCUS_01430 150776 150237 gene locus_tag LOCUS_01440 150776 150237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902326.1 protein_id gnl|my_center|LOCUS_01440 151810 150773 gene locus_tag LOCUS_01450 151810 150773 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902327.1 protein_id gnl|my_center|LOCUS_01450 151876 152616 gene locus_tag LOCUS_01460 151876 152616 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902328.1 protein_id gnl|my_center|LOCUS_01460 152865 153983 gene locus_tag LOCUS_01470 152865 153983 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902330.1 protein_id gnl|my_center|LOCUS_01470 154104 154784 gene locus_tag LOCUS_01480 154104 154784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 156011 154830 gene locus_tag LOCUS_01490 156011 154830 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902332.1 protein_id gnl|my_center|LOCUS_01490 156124 156318 gene locus_tag LOCUS_01500 156124 156318 CDS product DUF5800 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902336.1 protein_id gnl|my_center|LOCUS_01500 156609 156352 gene locus_tag LOCUS_01510 156609 156352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 157404 156670 gene locus_tag LOCUS_01520 157404 156670 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289293.1 protein_id gnl|my_center|LOCUS_01520 157706 158419 gene locus_tag LOCUS_01530 157706 158419 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289554.1 protein_id gnl|my_center|LOCUS_01530 159787 158678 gene locus_tag LOCUS_01540 159787 158678 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902588.1 protein_id gnl|my_center|LOCUS_01540 160284 159784 gene locus_tag LOCUS_01550 160284 159784 CDS product DUF5805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289235.1 protein_id gnl|my_center|LOCUS_01550 161477 162547 gene locus_tag LOCUS_01560 161477 162547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 163282 162560 gene locus_tag LOCUS_01570 163282 162560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 165253 163799 gene locus_tag LOCUS_01580 165253 163799 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903750.1 protein_id gnl|my_center|LOCUS_01580 166389 165250 gene locus_tag LOCUS_01590 166389 165250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903751.1 protein_id gnl|my_center|LOCUS_01590 167843 166389 gene locus_tag LOCUS_01600 167843 166389 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903752.1 protein_id gnl|my_center|LOCUS_01600 168893 167847 gene locus_tag LOCUS_01610 168893 167847 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903753.1 protein_id gnl|my_center|LOCUS_01610 171139 168977 gene locus_tag LOCUS_01620 171139 168977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 171336 172301 gene locus_tag LOCUS_01630 171336 172301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 172305 173330 gene locus_tag LOCUS_01640 172305 173330 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903880.1 protein_id gnl|my_center|LOCUS_01640 174169 173360 gene locus_tag LOCUS_01650 174169 173360 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903881.1 protein_id gnl|my_center|LOCUS_01650 174811 175191 gene locus_tag LOCUS_01660 174811 175191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 175188 176141 gene locus_tag LOCUS_01670 175188 176141 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060919.1 protein_id gnl|my_center|LOCUS_01670 177839 176391 gene locus_tag LOCUS_01680 177839 176391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 178967 178068 gene locus_tag LOCUS_01690 178967 178068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902593.1 protein_id gnl|my_center|LOCUS_01690 180631 179030 gene locus_tag LOCUS_01700 180631 179030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902594.1 protein_id gnl|my_center|LOCUS_01700 181203 180733 gene locus_tag LOCUS_01710 181203 180733 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289215.1 protein_id gnl|my_center|LOCUS_01710 182124 181273 gene locus_tag LOCUS_01720 182124 181273 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892496.1 protein_id gnl|my_center|LOCUS_01720 182275 182439 gene locus_tag LOCUS_01730 182275 182439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 183576 182539 gene locus_tag LOCUS_01740 gene dph2 183576 182539 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902598.1 protein_id gnl|my_center|LOCUS_01740 184435 183797 gene locus_tag LOCUS_01750 184435 183797 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878668.1 protein_id gnl|my_center|LOCUS_01750 185132 184449 gene locus_tag LOCUS_01760 185132 184449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 185628 185227 gene locus_tag LOCUS_01770 185628 185227 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902597.1 protein_id gnl|my_center|LOCUS_01770 185964 185704 gene locus_tag LOCUS_01780 185964 185704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 187042 186041 gene locus_tag LOCUS_01790 187042 186041 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902937.1 protein_id gnl|my_center|LOCUS_01790 187178 187804 gene locus_tag LOCUS_01800 gene cyaB 187178 187804 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902939.1 protein_id gnl|my_center|LOCUS_01800 187865 189079 gene locus_tag LOCUS_01810 187865 189079 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902940.1 protein_id gnl|my_center|LOCUS_01810 189833 189360 gene locus_tag LOCUS_01820 189833 189360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 189932 190903 gene locus_tag LOCUS_01830 189932 190903 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902943.1 protein_id gnl|my_center|LOCUS_01830 191455 191000 gene locus_tag LOCUS_01840 191455 191000 CDS product DUF5804 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289303.1 protein_id gnl|my_center|LOCUS_01840 193647 191452 gene locus_tag LOCUS_01850 193647 191452 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289305.1 protein_id gnl|my_center|LOCUS_01850 194249 195109 gene locus_tag LOCUS_01860 194249 195109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 195441 196103 gene locus_tag LOCUS_01870 195441 196103 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903007.1 protein_id gnl|my_center|LOCUS_01870 196955 196107 gene locus_tag LOCUS_01880 196955 196107 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903009.1 protein_id gnl|my_center|LOCUS_01880 197771 196959 gene locus_tag LOCUS_01890 gene dacZ 197771 196959 CDS product diadenylate cyclase DacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903010.1 protein_id gnl|my_center|LOCUS_01890 198480 198887 gene locus_tag LOCUS_01900 198480 198887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 199198 199114 gene locus_tag LOCUS_t00040 199198 199114 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 199283 199573 gene locus_tag LOCUS_01910 199283 199573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 199767 199543 gene locus_tag LOCUS_01920 199767 199543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 200269 199769 gene locus_tag LOCUS_01930 200269 199769 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903012.1 protein_id gnl|my_center|LOCUS_01930 200824 200306 gene locus_tag LOCUS_01940 200824 200306 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903013.1 protein_id gnl|my_center|LOCUS_01940 201996 200887 gene locus_tag LOCUS_01950 201996 200887 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903015.1 protein_id gnl|my_center|LOCUS_01950 202843 202169 gene locus_tag LOCUS_01960 202843 202169 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902848.1 protein_id gnl|my_center|LOCUS_01960 203717 202836 gene locus_tag LOCUS_01970 203717 202836 CDS product NOP5/NOP56 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902847.1 protein_id gnl|my_center|LOCUS_01970 203851 204702 gene locus_tag LOCUS_01980 203851 204702 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314298.1 protein_id gnl|my_center|LOCUS_01980 204854 205597 gene locus_tag LOCUS_01990 204854 205597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01990 205533 206057 gene locus_tag LOCUS_02000 205533 206057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02000 206191 206631 gene locus_tag LOCUS_02010 206191 206631 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903814.1 protein_id gnl|my_center|LOCUS_02010 206834 206760 gene locus_tag LOCUS_t00050 206834 206760 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 206970 208418 gene locus_tag LOCUS_02020 206970 208418 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902698.1 protein_id gnl|my_center|LOCUS_02020 209009 208713 gene locus_tag LOCUS_02030 209009 208713 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902697.1 protein_id gnl|my_center|LOCUS_02030 211383 209104 gene locus_tag LOCUS_02040 211383 209104 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904206.1 protein_id gnl|my_center|LOCUS_02040 211924 211376 gene locus_tag LOCUS_02050 211924 211376 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289746.1 protein_id gnl|my_center|LOCUS_02050 212039 215107 gene locus_tag LOCUS_02060 212039 215107 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903811.1 protein_id gnl|my_center|LOCUS_02060 216789 215551 gene locus_tag LOCUS_02070 216789 215551 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902696.1 protein_id gnl|my_center|LOCUS_02070 217332 216898 gene locus_tag LOCUS_02080 217332 216898 CDS product DUF123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902479.1 protein_id gnl|my_center|LOCUS_02080 217802 217329 gene locus_tag LOCUS_02090 217802 217329 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986773.1 protein_id gnl|my_center|LOCUS_02090 217935 218360 gene locus_tag LOCUS_02100 217935 218360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 218427 218882 gene locus_tag LOCUS_02110 218427 218882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 218955 221399 gene locus_tag LOCUS_02120 218955 221399 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022632.1 protein_id gnl|my_center|LOCUS_02120 221553 222836 gene locus_tag LOCUS_02130 221553 222836 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387853.1 protein_id gnl|my_center|LOCUS_02130 222847 223917 gene locus_tag LOCUS_02140 222847 223917 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387854.1 protein_id gnl|my_center|LOCUS_02140 223914 224867 gene locus_tag LOCUS_02150 223914 224867 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172776.1 protein_id gnl|my_center|LOCUS_02150 225120 226268 gene locus_tag LOCUS_02160 225120 226268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904134.1 protein_id gnl|my_center|LOCUS_02160 227064 226444 gene locus_tag LOCUS_02170 227064 226444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 228227 227241 gene locus_tag LOCUS_02180 228227 227241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 228917 228369 gene locus_tag LOCUS_02190 gene msrA 228917 228369 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902851.1 protein_id gnl|my_center|LOCUS_02190 229635 229282 gene locus_tag LOCUS_02200 229635 229282 CDS product CHY zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405189.1 protein_id gnl|my_center|LOCUS_02200 230213 229884 gene locus_tag LOCUS_02210 230213 229884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 230137 230149 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 232418 230220 gene locus_tag LOCUS_02220 232418 230220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 232908 232834 gene locus_tag LOCUS_t00060 232908 232834 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 233492 232947 gene locus_tag LOCUS_02230 233492 232947 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902879.1 protein_id gnl|my_center|LOCUS_02230 233701 234798 gene locus_tag LOCUS_02240 233701 234798 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_02240 234795 236543 gene locus_tag LOCUS_02250 234795 236543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 236540 237412 gene locus_tag LOCUS_02260 236540 237412 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720081.1 protein_id gnl|my_center|LOCUS_02260 237409 238530 gene locus_tag LOCUS_02270 237409 238530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 238914 238666 gene locus_tag LOCUS_02280 238914 238666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 241055 239115 gene locus_tag LOCUS_02290 241055 239115 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902947.1 protein_id gnl|my_center|LOCUS_02290 241908 241105 gene locus_tag LOCUS_02300 241908 241105 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902948.1 protein_id gnl|my_center|LOCUS_02300 242375 242004 gene locus_tag LOCUS_02310 242375 242004 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902949.1 protein_id gnl|my_center|LOCUS_02310 242799 242377 gene locus_tag LOCUS_02320 gene sdhC 242799 242377 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289306.1 protein_id gnl|my_center|LOCUS_02320 243885 242938 gene locus_tag LOCUS_02330 243885 242938 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455969.1 protein_id gnl|my_center|LOCUS_02330 244201 244401 gene locus_tag LOCUS_02340 244201 244401 CDS product DUF5786 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903530.1 protein_id gnl|my_center|LOCUS_02340 245397 244732 gene locus_tag LOCUS_02350 245397 244732 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902951.1 protein_id gnl|my_center|LOCUS_02350 245519 247513 gene locus_tag LOCUS_02360 245519 247513 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902952.1 protein_id gnl|my_center|LOCUS_02360 248415 247798 gene locus_tag LOCUS_02370 248415 247798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 249310 248486 gene locus_tag LOCUS_02380 249310 248486 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941357.1 protein_id gnl|my_center|LOCUS_02380 250077 249403 gene locus_tag LOCUS_02390 250077 249403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 249967 250236 gene locus_tag LOCUS_02400 249967 250236 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902985.1 protein_id gnl|my_center|LOCUS_02400 251098 250274 gene locus_tag LOCUS_02410 251098 250274 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903268.1 protein_id gnl|my_center|LOCUS_02410 251191 251919 gene locus_tag LOCUS_02420 251191 251919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 252845 252102 gene locus_tag LOCUS_02430 gene psmA 252845 252102 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902078.1 protein_id gnl|my_center|LOCUS_02430 253228 253013 gene locus_tag LOCUS_02440 253228 253013 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755950.1 protein_id gnl|my_center|LOCUS_02440 254325 253315 gene locus_tag LOCUS_02450 254325 253315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 255021 254371 gene locus_tag LOCUS_02460 255021 254371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 256055 255021 gene locus_tag LOCUS_02470 256055 255021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 256145 256711 gene locus_tag LOCUS_02480 256145 256711 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902963.1 protein_id gnl|my_center|LOCUS_02480 257647 256808 gene locus_tag LOCUS_02490 257647 256808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 258018 257644 gene locus_tag LOCUS_02500 258018 257644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 258801 258202 gene locus_tag LOCUS_02510 gene sod 258801 258202 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902860.1 protein_id gnl|my_center|LOCUS_02510 >Feature sequence02 1019 654 gene locus_tag LOCUS_02520 1019 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 2410 1016 gene locus_tag LOCUS_02530 2410 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902642.1 protein_id gnl|my_center|LOCUS_02530 2510 3376 gene locus_tag LOCUS_02540 2510 3376 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902453.1 protein_id gnl|my_center|LOCUS_02540 3734 3414 gene locus_tag LOCUS_02550 3734 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 4180 3731 gene locus_tag LOCUS_02560 4180 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 4565 4182 gene locus_tag LOCUS_02570 4565 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 4649 5785 gene locus_tag LOCUS_02580 4649 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02580 6798 6415 gene locus_tag LOCUS_02590 6798 6415 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141520.1 protein_id gnl|my_center|LOCUS_02590 7019 6888 gene locus_tag LOCUS_02600 7019 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 7148 7648 gene locus_tag LOCUS_02610 7148 7648 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144262395.1 protein_id gnl|my_center|LOCUS_02610 7713 7913 gene locus_tag LOCUS_02620 7713 7913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 8026 8625 gene locus_tag LOCUS_02630 8026 8625 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086598.1 protein_id gnl|my_center|LOCUS_02630 8940 8722 gene locus_tag LOCUS_02640 8940 8722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 9069 11666 gene locus_tag LOCUS_02650 9069 11666 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902482.1 protein_id gnl|my_center|LOCUS_02650 13286 11757 gene locus_tag LOCUS_02660 13286 11757 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902486.1 protein_id gnl|my_center|LOCUS_02660 13743 13519 gene locus_tag LOCUS_02670 13743 13519 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223929.1 protein_id gnl|my_center|LOCUS_02670 15509 13809 gene locus_tag LOCUS_02680 15509 13809 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817748.1 protein_id gnl|my_center|LOCUS_02680 15639 16616 gene locus_tag LOCUS_02690 15639 16616 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_02690 16839 18182 gene locus_tag LOCUS_02700 16839 18182 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903433.1 protein_id gnl|my_center|LOCUS_02700 18323 18547 gene locus_tag LOCUS_02710 18323 18547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 18609 18881 gene locus_tag LOCUS_02720 18609 18881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 19751 18915 gene locus_tag LOCUS_02730 19751 18915 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902445.1 protein_id gnl|my_center|LOCUS_02730 21342 19885 gene locus_tag LOCUS_02740 21342 19885 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902444.1 protein_id gnl|my_center|LOCUS_02740 23012 21510 gene locus_tag LOCUS_02750 23012 21510 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289203.1 protein_id gnl|my_center|LOCUS_02750 24544 23012 gene locus_tag LOCUS_02760 24544 23012 CDS product NuoM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902442.1 protein_id gnl|my_center|LOCUS_02760 26583 24541 gene locus_tag LOCUS_02770 gene nuoL 26583 24541 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902441.1 protein_id gnl|my_center|LOCUS_02770 26890 26588 gene locus_tag LOCUS_02780 gene nuoK 26890 26588 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902440.1 protein_id gnl|my_center|LOCUS_02780 27270 26890 gene locus_tag LOCUS_02790 27270 26890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 27542 27267 gene locus_tag LOCUS_02800 27542 27267 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902438.1 protein_id gnl|my_center|LOCUS_02800 27862 28719 gene locus_tag LOCUS_02810 27862 28719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 29554 29093 gene locus_tag LOCUS_02820 29554 29093 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902437.1 protein_id gnl|my_center|LOCUS_02820 30630 29551 gene locus_tag LOCUS_02830 30630 29551 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289200.1 protein_id gnl|my_center|LOCUS_02830 32300 30630 gene locus_tag LOCUS_02840 32300 30630 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902435.1 protein_id gnl|my_center|LOCUS_02840 33004 32303 gene locus_tag LOCUS_02850 33004 32303 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902434.1 protein_id gnl|my_center|LOCUS_02850 33421 33008 gene locus_tag LOCUS_02860 33421 33008 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902433.1 protein_id gnl|my_center|LOCUS_02860 34097 33672 gene locus_tag LOCUS_02870 34097 33672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 34728 34114 gene locus_tag LOCUS_02880 gene purE 34728 34114 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902432.1 protein_id gnl|my_center|LOCUS_02880 35948 34725 gene locus_tag LOCUS_02890 35948 34725 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892490.1 protein_id gnl|my_center|LOCUS_02890 38040 36016 gene locus_tag LOCUS_02900 38040 36016 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902430.1 protein_id gnl|my_center|LOCUS_02900 38250 38678 gene locus_tag LOCUS_02910 gene ribH 38250 38678 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902429.1 protein_id gnl|my_center|LOCUS_02910 38675 39853 gene locus_tag LOCUS_02920 38675 39853 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902428.1 protein_id gnl|my_center|LOCUS_02920 39868 40149 gene locus_tag LOCUS_02930 39868 40149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 40735 40271 gene locus_tag LOCUS_02940 40735 40271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 40991 40791 gene locus_tag LOCUS_02950 40991 40791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 41911 42594 gene locus_tag LOCUS_02960 gene nthB 41911 42594 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087268.1 protein_id gnl|my_center|LOCUS_02960 42715 43962 gene locus_tag LOCUS_02970 42715 43962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 44102 46099 gene locus_tag LOCUS_02980 44102 46099 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903767.1 protein_id gnl|my_center|LOCUS_02980 47473 46115 gene locus_tag LOCUS_02990 47473 46115 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483378.1 protein_id gnl|my_center|LOCUS_02990 47645 50047 gene locus_tag LOCUS_03000 47645 50047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 50327 50097 gene locus_tag LOCUS_03010 50327 50097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 50997 50581 gene locus_tag LOCUS_03020 50997 50581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 53044 51263 gene locus_tag LOCUS_03030 53044 51263 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903716.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03030 53279 53142 gene locus_tag LOCUS_03040 53279 53142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 53441 54274 gene locus_tag LOCUS_03050 gene suhB 53441 54274 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460178.1 protein_id gnl|my_center|LOCUS_03050 55409 54492 gene locus_tag LOCUS_03060 55409 54492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 55513 56076 gene locus_tag LOCUS_03070 55513 56076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 56621 56232 gene locus_tag LOCUS_03080 56621 56232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 57465 56821 gene locus_tag LOCUS_03090 gene eda 57465 56821 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_03090 57824 58042 gene locus_tag LOCUS_03100 57824 58042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 58908 58129 gene locus_tag LOCUS_03110 58908 58129 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902459.1 protein_id gnl|my_center|LOCUS_03110 59924 58905 gene locus_tag LOCUS_03120 59924 58905 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902458.1 protein_id gnl|my_center|LOCUS_03120 60301 60014 gene locus_tag LOCUS_03130 60301 60014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 60433 61119 gene locus_tag LOCUS_03140 60433 61119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 61412 61170 gene locus_tag LOCUS_03150 61412 61170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 61761 61522 gene locus_tag LOCUS_03160 61761 61522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 62573 61878 gene locus_tag LOCUS_03170 62573 61878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289461.1 protein_id gnl|my_center|LOCUS_03170 64012 62576 gene locus_tag LOCUS_03180 gene cyoE 64012 62576 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902456.1 protein_id gnl|my_center|LOCUS_03180 64260 65021 gene locus_tag LOCUS_03190 gene coxB 64260 65021 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902455.1 protein_id gnl|my_center|LOCUS_03190 65091 65237 gene locus_tag LOCUS_03200 65091 65237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 65691 65419 gene locus_tag LOCUS_03210 65691 65419 CDS product amphi-Trp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903036.1 protein_id gnl|my_center|LOCUS_03210 65898 66176 gene locus_tag LOCUS_03220 65898 66176 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903037.1 protein_id gnl|my_center|LOCUS_03220 67379 66195 gene locus_tag LOCUS_03230 67379 66195 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903039.1 protein_id gnl|my_center|LOCUS_03230 67508 68791 gene locus_tag LOCUS_03240 67508 68791 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361690.1 protein_id gnl|my_center|LOCUS_03240 68904 70253 gene locus_tag LOCUS_03250 68904 70253 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903110.1 protein_id gnl|my_center|LOCUS_03250 70644 70291 gene locus_tag LOCUS_03260 70644 70291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289346.1 protein_id gnl|my_center|LOCUS_03260 70982 70677 gene locus_tag LOCUS_03270 70982 70677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 71104 72018 gene locus_tag LOCUS_03280 71104 72018 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903108.1 protein_id gnl|my_center|LOCUS_03280 73146 72076 gene locus_tag LOCUS_03290 73146 72076 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383268.1 protein_id gnl|my_center|LOCUS_03290 73180 73449 gene locus_tag LOCUS_03300 73180 73449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 73558 74982 gene locus_tag LOCUS_03310 73558 74982 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 protein_id gnl|my_center|LOCUS_03310 76566 75094 gene locus_tag LOCUS_03320 76566 75094 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_03320 77878 76991 gene locus_tag LOCUS_03330 77878 76991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 77986 78270 gene locus_tag LOCUS_03340 77986 78270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 78386 79531 gene locus_tag LOCUS_03350 gene sucC 78386 79531 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289349.1 protein_id gnl|my_center|LOCUS_03350 79659 80528 gene locus_tag LOCUS_03360 gene sucD 79659 80528 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903125.1 protein_id gnl|my_center|LOCUS_03360 80753 80565 gene locus_tag LOCUS_03370 80753 80565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 80930 81550 gene locus_tag LOCUS_03380 80930 81550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 81495 82388 gene locus_tag LOCUS_03390 81495 82388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 82352 82495 gene locus_tag LOCUS_03400 82352 82495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 83317 82535 gene locus_tag LOCUS_03410 83317 82535 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527984.1 protein_id gnl|my_center|LOCUS_03410 83596 83363 gene locus_tag LOCUS_03420 83596 83363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 84011 83718 gene locus_tag LOCUS_03430 84011 83718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 85835 84021 gene locus_tag LOCUS_03440 85835 84021 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_03440 86233 85883 gene locus_tag LOCUS_03450 86233 85883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 86383 86598 gene locus_tag LOCUS_03460 86383 86598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 86999 86652 gene locus_tag LOCUS_03470 86999 86652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03470 87247 86924 gene locus_tag LOCUS_03480 87247 86924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 87654 88721 gene locus_tag LOCUS_03490 87654 88721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903193.1 protein_id gnl|my_center|LOCUS_03490 89180 88791 gene locus_tag LOCUS_03500 89180 88791 CDS product DUF5830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903194.1 protein_id gnl|my_center|LOCUS_03500 89353 90033 gene locus_tag LOCUS_03510 89353 90033 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903195.1 protein_id gnl|my_center|LOCUS_03510 90998 90396 gene locus_tag LOCUS_03520 90998 90396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03520 91089 91619 gene locus_tag LOCUS_03530 91089 91619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 92057 92232 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 92539 93171 gene locus_tag LOCUS_03540 92539 93171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 94135 93185 gene locus_tag LOCUS_03550 gene uppS 94135 93185 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903300.1 protein_id gnl|my_center|LOCUS_03550 95161 94241 gene locus_tag LOCUS_03560 95161 94241 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902838.1 protein_id gnl|my_center|LOCUS_03560 96440 95295 gene locus_tag LOCUS_03570 gene cofG 96440 95295 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892527.1 protein_id gnl|my_center|LOCUS_03570 96683 97348 gene locus_tag LOCUS_03580 96683 97348 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049924277.1 protein_id gnl|my_center|LOCUS_03580 98015 97377 gene locus_tag LOCUS_03590 gene cofC 98015 97377 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903420.1 protein_id gnl|my_center|LOCUS_03590 98815 98039 gene locus_tag LOCUS_03600 98815 98039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903419.1 protein_id gnl|my_center|LOCUS_03600 99980 98799 gene locus_tag LOCUS_03610 99980 98799 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289408.1 protein_id gnl|my_center|LOCUS_03610 100178 100255 gene locus_tag LOCUS_t00070 100178 100255 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 101187 100252 gene locus_tag LOCUS_03620 101187 100252 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892525.1 protein_id gnl|my_center|LOCUS_03620 101360 103033 gene locus_tag LOCUS_03630 101360 103033 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903337.1 protein_id gnl|my_center|LOCUS_03630 103033 103950 gene locus_tag LOCUS_03640 gene guaA 103033 103950 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903336.1 protein_id gnl|my_center|LOCUS_03640 104068 104403 gene locus_tag LOCUS_03650 104068 104403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903335.1 protein_id gnl|my_center|LOCUS_03650 104590 105387 gene locus_tag LOCUS_03660 104590 105387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 105859 106194 gene locus_tag LOCUS_03670 105859 106194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 106674 106297 gene locus_tag LOCUS_03680 106674 106297 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903217.1 protein_id gnl|my_center|LOCUS_03680 107475 106780 gene locus_tag LOCUS_03690 gene radB 107475 106780 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903214.1 protein_id gnl|my_center|LOCUS_03690 109116 107740 gene locus_tag LOCUS_03700 109116 107740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 109310 111535 gene locus_tag LOCUS_03710 109310 111535 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903216.1 protein_id gnl|my_center|LOCUS_03710 112617 111880 gene locus_tag LOCUS_03720 112617 111880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 113551 112619 gene locus_tag LOCUS_03730 113551 112619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 114699 114028 gene locus_tag LOCUS_03740 gene phoU 114699 114028 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892486.1 protein_id gnl|my_center|LOCUS_03740 114873 115040 gene locus_tag LOCUS_03750 114873 115040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 116140 115256 gene locus_tag LOCUS_03760 gene pstB 116140 115256 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902290.1 protein_id gnl|my_center|LOCUS_03760 117784 116150 gene locus_tag LOCUS_03770 gene pstA 117784 116150 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902291.1 protein_id gnl|my_center|LOCUS_03770 118785 117784 gene locus_tag LOCUS_03780 gene pstC 118785 117784 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878854.1 protein_id gnl|my_center|LOCUS_03780 119889 118855 gene locus_tag LOCUS_03790 119889 118855 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064375.1 protein_id gnl|my_center|LOCUS_03790 120162 121085 gene locus_tag LOCUS_03800 120162 121085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03800 122710 121280 gene locus_tag LOCUS_03810 122710 121280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03810 123177 122707 gene locus_tag LOCUS_03820 123177 122707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03820 124490 123174 gene locus_tag LOCUS_03830 124490 123174 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151112700.1 protein_id gnl|my_center|LOCUS_03830 124902 124639 gene locus_tag LOCUS_03840 124902 124639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 124901 125362 gene locus_tag LOCUS_03850 124901 125362 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903293.1 protein_id gnl|my_center|LOCUS_03850 125368 127266 gene locus_tag LOCUS_03860 125368 127266 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289376.1 protein_id gnl|my_center|LOCUS_03860 128261 127359 gene locus_tag LOCUS_03870 128261 127359 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403067.1 protein_id gnl|my_center|LOCUS_03870 128703 128311 gene locus_tag LOCUS_03880 128703 128311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 129733 128693 gene locus_tag LOCUS_03890 129733 128693 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903331.1 protein_id gnl|my_center|LOCUS_03890 129877 130275 gene locus_tag LOCUS_03900 129877 130275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 130320 130703 gene locus_tag LOCUS_03910 130320 130703 CDS product DUF2178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902306.1 protein_id gnl|my_center|LOCUS_03910 130700 130903 gene locus_tag LOCUS_03920 130700 130903 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902305.1 protein_id gnl|my_center|LOCUS_03920 130967 131443 gene locus_tag LOCUS_03930 130967 131443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 131470 132054 gene locus_tag LOCUS_03940 131470 132054 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903332.1 protein_id gnl|my_center|LOCUS_03940 132459 133037 gene locus_tag LOCUS_03950 132459 133037 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903263.1 protein_id gnl|my_center|LOCUS_03950 133043 134002 gene locus_tag LOCUS_03960 133043 134002 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289369.1 protein_id gnl|my_center|LOCUS_03960 134129 135271 gene locus_tag LOCUS_03970 134129 135271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 135371 135441 gene locus_tag LOCUS_t00080 135371 135441 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 136164 135655 gene locus_tag LOCUS_03980 136164 135655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 136219 137268 gene locus_tag LOCUS_03990 136219 137268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 137420 138640 gene locus_tag LOCUS_04000 137420 138640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 140651 138879 gene locus_tag LOCUS_04010 gene ilvD 140651 138879 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839606.1 protein_id gnl|my_center|LOCUS_04010 140866 142692 gene locus_tag LOCUS_04020 140866 142692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 147316 143036 gene locus_tag LOCUS_04030 147316 143036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 147709 147927 gene locus_tag LOCUS_04040 147709 147927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 147986 148585 gene locus_tag LOCUS_04050 gene tmk 147986 148585 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903416.1 protein_id gnl|my_center|LOCUS_04050 148756 149562 gene locus_tag LOCUS_04060 148756 149562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 149583 150422 gene locus_tag LOCUS_04070 149583 150422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 150875 150555 gene locus_tag LOCUS_04080 150875 150555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 150999 152063 gene locus_tag LOCUS_04090 150999 152063 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892524.1 protein_id gnl|my_center|LOCUS_04090 152324 152088 gene locus_tag LOCUS_04100 152324 152088 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289406.1 protein_id gnl|my_center|LOCUS_04100 152385 153110 gene locus_tag LOCUS_04110 152385 153110 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289405.1 protein_id gnl|my_center|LOCUS_04110 153907 153122 gene locus_tag LOCUS_04120 153907 153122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 154083 155336 gene locus_tag LOCUS_04130 154083 155336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 155762 155457 gene locus_tag LOCUS_04140 155762 155457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 156812 155910 gene locus_tag LOCUS_04150 156812 155910 CDS product Vms1/Ankzf1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289389.1 protein_id gnl|my_center|LOCUS_04150 157712 156933 gene locus_tag LOCUS_04160 157712 156933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 158196 157825 gene locus_tag LOCUS_04170 158196 157825 CDS product DUF5802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289390.1 protein_id gnl|my_center|LOCUS_04170 158391 159197 gene locus_tag LOCUS_04180 158391 159197 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289160.1 protein_id gnl|my_center|LOCUS_04180 159352 159513 gene locus_tag LOCUS_04190 159352 159513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 162253 159551 gene locus_tag LOCUS_04200 gene ppc 162253 159551 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_04200 162494 163384 gene locus_tag LOCUS_04210 162494 163384 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902393.1 protein_id gnl|my_center|LOCUS_04210 163479 163868 gene locus_tag LOCUS_04220 163479 163868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 163993 164991 gene locus_tag LOCUS_04230 gene trpD 163993 164991 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903202.1 protein_id gnl|my_center|LOCUS_04230 164991 165650 gene locus_tag LOCUS_04240 164991 165650 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903201.1 protein_id gnl|my_center|LOCUS_04240 165647 167566 gene locus_tag LOCUS_04250 gene trpE 165647 167566 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903200.1 protein_id gnl|my_center|LOCUS_04250 167563 168156 gene locus_tag LOCUS_04260 gene trpG 167563 168156 CDS product anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903199.1 protein_id gnl|my_center|LOCUS_04260 168341 170830 gene locus_tag LOCUS_04270 168341 170830 CDS product DUF5059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902140.1 protein_id gnl|my_center|LOCUS_04270 170908 172182 gene locus_tag LOCUS_04280 170908 172182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 172355 173815 gene locus_tag LOCUS_04290 172355 173815 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021937.1 protein_id gnl|my_center|LOCUS_04290 174380 173829 gene locus_tag LOCUS_04300 174380 173829 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289404.1 protein_id gnl|my_center|LOCUS_04300 174494 175534 gene locus_tag LOCUS_04310 174494 175534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 175774 175565 gene locus_tag LOCUS_04320 175774 175565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 176425 177312 gene locus_tag LOCUS_04330 176425 177312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04330 177237 177479 gene locus_tag LOCUS_04340 177237 177479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04340 177597 178661 gene locus_tag LOCUS_04350 177597 178661 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903402.1 protein_id gnl|my_center|LOCUS_04350 178718 179272 gene locus_tag LOCUS_04360 178718 179272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 180055 179285 gene locus_tag LOCUS_04370 180055 179285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 181170 180118 gene locus_tag LOCUS_04380 181170 180118 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903344.1 protein_id gnl|my_center|LOCUS_04380 182195 181173 gene locus_tag LOCUS_04390 182195 181173 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903345.1 protein_id gnl|my_center|LOCUS_04390 182906 184258 gene locus_tag LOCUS_04400 182906 184258 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296552.1 protein_id gnl|my_center|LOCUS_04400 184743 184555 gene locus_tag LOCUS_04410 184743 184555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 184842 185096 gene locus_tag LOCUS_04420 184842 185096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 185447 185363 gene locus_tag LOCUS_t00090 185447 185363 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 185830 185489 gene locus_tag LOCUS_04430 185830 185489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903405.1 protein_id gnl|my_center|LOCUS_04430 187457 185889 gene locus_tag LOCUS_04440 187457 185889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 188557 187736 gene locus_tag LOCUS_04450 188557 187736 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021474.1 protein_id gnl|my_center|LOCUS_04450 188622 189293 gene locus_tag LOCUS_04460 188622 189293 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903340.1 protein_id gnl|my_center|LOCUS_04460 189516 189734 gene locus_tag LOCUS_04470 189516 189734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 190189 189866 gene locus_tag LOCUS_04480 190189 189866 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289371.1 protein_id gnl|my_center|LOCUS_04480 191021 190221 gene locus_tag LOCUS_04490 191021 190221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 191885 191022 gene locus_tag LOCUS_04500 191885 191022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903271.1 protein_id gnl|my_center|LOCUS_04500 192792 191956 gene locus_tag LOCUS_04510 192792 191956 CDS product HtlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903270.1 protein_id gnl|my_center|LOCUS_04510 193947 192940 gene locus_tag LOCUS_04520 193947 192940 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 protein_id gnl|my_center|LOCUS_04520 194854 194057 gene locus_tag LOCUS_04530 194854 194057 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902422.1 protein_id gnl|my_center|LOCUS_04530 195023 194835 gene locus_tag LOCUS_04540 195023 194835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 195126 195782 gene locus_tag LOCUS_04550 195126 195782 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902025.1 protein_id gnl|my_center|LOCUS_04550 >Feature sequence03 95 643 gene locus_tag LOCUS_04560 95 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 950 1873 gene locus_tag LOCUS_04570 950 1873 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902245.1 protein_id gnl|my_center|LOCUS_04570 2023 3036 gene locus_tag LOCUS_04580 2023 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 3158 4309 gene locus_tag LOCUS_04590 3158 4309 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902244.1 protein_id gnl|my_center|LOCUS_04590 4510 4322 gene locus_tag LOCUS_04600 4510 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 5342 4554 gene locus_tag LOCUS_04610 5342 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 6236 5400 gene locus_tag LOCUS_04620 6236 5400 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289160.1 protein_id gnl|my_center|LOCUS_04620 7132 6365 gene locus_tag LOCUS_04630 7132 6365 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902364.1 protein_id gnl|my_center|LOCUS_04630 7582 8418 gene locus_tag LOCUS_04640 7582 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 8710 8516 gene locus_tag LOCUS_04650 8710 8516 CDS product RNA-protein complex protein Nop10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902365.1 protein_id gnl|my_center|LOCUS_04650 9517 8717 gene locus_tag LOCUS_04660 9517 8717 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902366.1 protein_id gnl|my_center|LOCUS_04660 9799 9626 gene locus_tag LOCUS_04670 9799 9626 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902367.1 protein_id gnl|my_center|LOCUS_04670 10083 9802 gene locus_tag LOCUS_04680 10083 9802 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289179.1 protein_id gnl|my_center|LOCUS_04680 11556 10180 gene locus_tag LOCUS_04690 11556 10180 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902279.1 protein_id gnl|my_center|LOCUS_04690 12806 11667 gene locus_tag LOCUS_04700 12806 11667 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903593.1 protein_id gnl|my_center|LOCUS_04700 13365 14906 gene locus_tag LOCUS_04710 gene gpmI 13365 14906 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903383.1 protein_id gnl|my_center|LOCUS_04710 16271 14928 gene locus_tag LOCUS_04720 gene dnaG 16271 14928 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289379.1 protein_id gnl|my_center|LOCUS_04720 16494 17312 gene locus_tag LOCUS_04730 16494 17312 CDS product YqcI/YcgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902790.1 protein_id gnl|my_center|LOCUS_04730 17312 17983 gene locus_tag LOCUS_04740 17312 17983 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902791.1 protein_id gnl|my_center|LOCUS_04740 18582 17971 gene locus_tag LOCUS_04750 18582 17971 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902192.1 protein_id gnl|my_center|LOCUS_04750 19963 18803 gene locus_tag LOCUS_04760 19963 18803 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902193.1 protein_id gnl|my_center|LOCUS_04760 20707 20069 gene locus_tag LOCUS_04770 20707 20069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 21031 20732 gene locus_tag LOCUS_04780 21031 20732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 22851 21079 gene locus_tag LOCUS_04790 gene pyk 22851 21079 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902196.1 protein_id gnl|my_center|LOCUS_04790 23315 23046 gene locus_tag LOCUS_04800 23315 23046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902191.1 protein_id gnl|my_center|LOCUS_04800 23565 25451 gene locus_tag LOCUS_04810 23565 25451 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902190.1 protein_id gnl|my_center|LOCUS_04810 26074 25496 gene locus_tag LOCUS_04820 gene yjjX 26074 25496 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061167.1 protein_id gnl|my_center|LOCUS_04820 26179 26745 gene locus_tag LOCUS_04830 26179 26745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 26742 28154 gene locus_tag LOCUS_04840 gene mre11 26742 28154 CDS product DNA double-strand break repair protein Mre11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902340.1 protein_id gnl|my_center|LOCUS_04840 28151 30856 gene locus_tag LOCUS_04850 gene rad50 28151 30856 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902341.1 protein_id gnl|my_center|LOCUS_04850 31338 30919 gene locus_tag LOCUS_04860 31338 30919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289168.1 protein_id gnl|my_center|LOCUS_04860 31791 31387 gene locus_tag LOCUS_04870 31791 31387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 32019 31849 gene locus_tag LOCUS_04880 32019 31849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 32272 36342 gene locus_tag LOCUS_04890 32272 36342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 36482 37399 gene locus_tag LOCUS_04900 36482 37399 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902347.1 protein_id gnl|my_center|LOCUS_04900 37456 38886 gene locus_tag LOCUS_04910 gene sufB 37456 38886 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902348.1 protein_id gnl|my_center|LOCUS_04910 38921 40138 gene locus_tag LOCUS_04920 gene sufD 38921 40138 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902349.1 protein_id gnl|my_center|LOCUS_04920 41598 40261 gene locus_tag LOCUS_04930 41598 40261 CDS product trans-acting enoyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412609.1 protein_id gnl|my_center|LOCUS_04930 42993 41686 gene locus_tag LOCUS_04940 42993 41686 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903808.1 protein_id gnl|my_center|LOCUS_04940 43181 43666 gene locus_tag LOCUS_04950 43181 43666 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892592.1 protein_id gnl|my_center|LOCUS_04950 43669 44106 gene locus_tag LOCUS_04960 43669 44106 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902351.1 protein_id gnl|my_center|LOCUS_04960 44227 44376 gene locus_tag LOCUS_04970 44227 44376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 44460 44532 gene locus_tag LOCUS_t00100 44460 44532 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 45636 44683 gene locus_tag LOCUS_04980 45636 44683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 46282 45638 gene locus_tag LOCUS_04990 46282 45638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 46747 47973 gene locus_tag LOCUS_05000 46747 47973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 48359 48234 gene locus_tag LOCUS_05010 48359 48234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 48502 49185 gene locus_tag LOCUS_05020 gene nth 48502 49185 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902399.1 protein_id gnl|my_center|LOCUS_05020 49274 49489 gene locus_tag LOCUS_05030 49274 49489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 50027 49542 gene locus_tag LOCUS_05040 50027 49542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902397.1 protein_id gnl|my_center|LOCUS_05040 50191 51207 gene locus_tag LOCUS_05050 50191 51207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 51303 51920 gene locus_tag LOCUS_05060 51303 51920 CDS product plastocyanin/azurin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902395.1 protein_id gnl|my_center|LOCUS_05060 51924 52310 gene locus_tag LOCUS_05070 51924 52310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902394.1 protein_id gnl|my_center|LOCUS_05070 52315 53121 gene locus_tag LOCUS_05080 52315 53121 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902392.1 protein_id gnl|my_center|LOCUS_05080 53126 53896 gene locus_tag LOCUS_05090 53126 53896 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902391.1 protein_id gnl|my_center|LOCUS_05090 54082 54606 gene locus_tag LOCUS_05100 54082 54606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 54611 54874 gene locus_tag LOCUS_05110 54611 54874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902389.1 protein_id gnl|my_center|LOCUS_05110 54928 55914 gene locus_tag LOCUS_05120 54928 55914 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903363.1 protein_id gnl|my_center|LOCUS_05120 57402 56152 gene locus_tag LOCUS_05130 57402 56152 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903362.1 protein_id gnl|my_center|LOCUS_05130 58344 57640 gene locus_tag LOCUS_05140 gene deoC 58344 57640 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903361.1 protein_id gnl|my_center|LOCUS_05140 58478 59323 gene locus_tag LOCUS_05150 58478 59323 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903357.1 protein_id gnl|my_center|LOCUS_05150 59380 59955 gene locus_tag LOCUS_05160 59380 59955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 60388 59987 gene locus_tag LOCUS_05170 60388 59987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 61276 60851 gene locus_tag LOCUS_05180 61276 60851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 63574 61556 gene locus_tag LOCUS_05190 63574 61556 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081422749.1 protein_id gnl|my_center|LOCUS_05190 63696 64958 gene locus_tag LOCUS_05200 gene icd 63696 64958 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903372.1 protein_id gnl|my_center|LOCUS_05200 65844 65116 gene locus_tag LOCUS_05210 65844 65116 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892481.1 protein_id gnl|my_center|LOCUS_05210 67243 65921 gene locus_tag LOCUS_05220 67243 65921 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903314.1 protein_id gnl|my_center|LOCUS_05220 67346 67687 gene locus_tag LOCUS_05230 67346 67687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 67797 68330 gene locus_tag LOCUS_05240 67797 68330 CDS product DUF5815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903323.1 protein_id gnl|my_center|LOCUS_05240 68589 71927 gene locus_tag LOCUS_05250 gene carB 68589 71927 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141767.1 protein_id gnl|my_center|LOCUS_05250 72910 72089 gene locus_tag LOCUS_05260 72910 72089 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903393.1 protein_id gnl|my_center|LOCUS_05260 72991 74451 gene locus_tag LOCUS_05270 72991 74451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 75306 74620 gene locus_tag LOCUS_05280 75306 74620 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902661.1 protein_id gnl|my_center|LOCUS_05280 75861 75436 gene locus_tag LOCUS_05290 75861 75436 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_05290 77920 75947 gene locus_tag LOCUS_05300 77920 75947 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903390.1 protein_id gnl|my_center|LOCUS_05300 78008 78343 gene locus_tag LOCUS_05310 78008 78343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903389.1 protein_id gnl|my_center|LOCUS_05310 79707 78448 gene locus_tag LOCUS_05320 79707 78448 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903386.1 protein_id gnl|my_center|LOCUS_05320 79909 80364 gene locus_tag LOCUS_05330 79909 80364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 80769 80386 gene locus_tag LOCUS_05340 80769 80386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903219.1 protein_id gnl|my_center|LOCUS_05340 81317 80769 gene locus_tag LOCUS_05350 81317 80769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 82621 81404 gene locus_tag LOCUS_05360 82621 81404 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289167.1 protein_id gnl|my_center|LOCUS_05360 82749 83018 gene locus_tag LOCUS_05370 82749 83018 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902339.1 protein_id gnl|my_center|LOCUS_05370 84011 83223 gene locus_tag LOCUS_05380 84011 83223 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902189.1 protein_id gnl|my_center|LOCUS_05380 84189 85187 gene locus_tag LOCUS_05390 84189 85187 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_05390 85241 86020 gene locus_tag LOCUS_05400 85241 86020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 86071 86433 gene locus_tag LOCUS_05410 86071 86433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 87722 86517 gene locus_tag LOCUS_05420 87722 86517 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902185.1 protein_id gnl|my_center|LOCUS_05420 88712 87915 gene locus_tag LOCUS_05430 88712 87915 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902183.1 protein_id gnl|my_center|LOCUS_05430 89614 88757 gene locus_tag LOCUS_05440 gene trpA 89614 88757 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902182.1 protein_id gnl|my_center|LOCUS_05440 90912 89611 gene locus_tag LOCUS_05450 gene trpB 90912 89611 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902181.1 protein_id gnl|my_center|LOCUS_05450 91751 90909 gene locus_tag LOCUS_05460 gene trpC 91751 90909 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902180.1 protein_id gnl|my_center|LOCUS_05460 91905 92384 gene locus_tag LOCUS_05470 91905 92384 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289136.1 protein_id gnl|my_center|LOCUS_05470 92973 92491 gene locus_tag LOCUS_05480 92973 92491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 93870 93022 gene locus_tag LOCUS_05490 93870 93022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 96003 93883 gene locus_tag LOCUS_05500 gene lonB 96003 93883 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902178.1 protein_id gnl|my_center|LOCUS_05500 96170 96730 gene locus_tag LOCUS_05510 96170 96730 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902177.1 protein_id gnl|my_center|LOCUS_05510 96738 97547 gene locus_tag LOCUS_05520 96738 97547 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289134.1 protein_id gnl|my_center|LOCUS_05520 97664 98497 gene locus_tag LOCUS_05530 97664 98497 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902174.1 protein_id gnl|my_center|LOCUS_05530 99449 98538 gene locus_tag LOCUS_05540 99449 98538 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902173.1 protein_id gnl|my_center|LOCUS_05540 99918 99646 gene locus_tag LOCUS_05550 99918 99646 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902171.1 protein_id gnl|my_center|LOCUS_05550 100169 100318 gene locus_tag LOCUS_05560 100169 100318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 101666 100350 gene locus_tag LOCUS_05570 101666 100350 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904192.1 protein_id gnl|my_center|LOCUS_05570 101971 102180 gene locus_tag LOCUS_05580 101971 102180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 102278 102982 gene locus_tag LOCUS_05590 102278 102982 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289133.1 protein_id gnl|my_center|LOCUS_05590 103375 102992 gene locus_tag LOCUS_05600 103375 102992 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902168.1 protein_id gnl|my_center|LOCUS_05600 104397 103456 gene locus_tag LOCUS_05610 104397 103456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 104534 104746 gene locus_tag LOCUS_05620 104534 104746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 105620 104775 gene locus_tag LOCUS_05630 105620 104775 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902170.1 protein_id gnl|my_center|LOCUS_05630 107401 105620 gene locus_tag LOCUS_05640 107401 105620 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902165.1 protein_id gnl|my_center|LOCUS_05640 107873 107628 gene locus_tag LOCUS_05650 107873 107628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 108823 107939 gene locus_tag LOCUS_05660 108823 107939 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361083.1 protein_id gnl|my_center|LOCUS_05660 108938 109096 gene locus_tag LOCUS_05670 108938 109096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 109099 109719 gene locus_tag LOCUS_05680 109099 109719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 110934 109726 gene locus_tag LOCUS_05690 110934 109726 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902162.1 protein_id gnl|my_center|LOCUS_05690 111701 110934 gene locus_tag LOCUS_05700 111701 110934 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289375.1 protein_id gnl|my_center|LOCUS_05700 112600 111794 gene locus_tag LOCUS_05710 112600 111794 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289131.1 protein_id gnl|my_center|LOCUS_05710 112909 113049 gene locus_tag LOCUS_05720 112909 113049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 113724 113062 gene locus_tag LOCUS_05730 113724 113062 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902159.1 protein_id gnl|my_center|LOCUS_05730 114848 113721 gene locus_tag LOCUS_05740 114848 113721 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902157.1 protein_id gnl|my_center|LOCUS_05740 115070 115315 gene locus_tag LOCUS_05750 115070 115315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 115308 116789 gene locus_tag LOCUS_05760 115308 116789 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903305.1 protein_id gnl|my_center|LOCUS_05760 116837 117784 gene locus_tag LOCUS_05770 116837 117784 CDS product DUF6293 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892517.1 protein_id gnl|my_center|LOCUS_05770 118906 117815 gene locus_tag LOCUS_05780 118906 117815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 119800 118934 gene locus_tag LOCUS_05790 119800 118934 CDS product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903310.1 protein_id gnl|my_center|LOCUS_05790 120066 120773 gene locus_tag LOCUS_05800 120066 120773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 120812 121645 gene locus_tag LOCUS_05810 120812 121645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 122198 121674 gene locus_tag LOCUS_05820 122198 121674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 122346 123590 gene locus_tag LOCUS_05830 gene gatD 122346 123590 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903349.1 protein_id gnl|my_center|LOCUS_05830 123587 124534 gene locus_tag LOCUS_05840 123587 124534 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289391.1 protein_id gnl|my_center|LOCUS_05840 124715 124966 gene locus_tag LOCUS_05850 124715 124966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 125006 125260 gene locus_tag LOCUS_05860 125006 125260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 125756 125289 gene locus_tag LOCUS_05870 125756 125289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903260.1 protein_id gnl|my_center|LOCUS_05870 125953 126579 gene locus_tag LOCUS_05880 125953 126579 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903261.1 protein_id gnl|my_center|LOCUS_05880 126661 127566 gene locus_tag LOCUS_05890 126661 127566 CDS product EMC3/TMCO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903262.1 protein_id gnl|my_center|LOCUS_05890 128175 127606 gene locus_tag LOCUS_05900 128175 127606 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903275.1 protein_id gnl|my_center|LOCUS_05900 128417 129937 gene locus_tag LOCUS_05910 gene crtI 128417 129937 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903230.1 protein_id gnl|my_center|LOCUS_05910 129945 130805 gene locus_tag LOCUS_05920 129945 130805 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903229.1 protein_id gnl|my_center|LOCUS_05920 130802 131719 gene locus_tag LOCUS_05930 gene cruF 130802 131719 CDS product bisanhydrobacterioruberin hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903228.1 protein_id gnl|my_center|LOCUS_05930 132740 131781 gene locus_tag LOCUS_05940 132740 131781 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903227.1 protein_id gnl|my_center|LOCUS_05940 133123 132956 gene locus_tag LOCUS_05950 133123 132956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 133239 134765 gene locus_tag LOCUS_05960 133239 134765 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742208.1 protein_id gnl|my_center|LOCUS_05960 135020 135634 gene locus_tag LOCUS_05970 135020 135634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05970 135955 135641 gene locus_tag LOCUS_05980 135955 135641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 136959 135952 gene locus_tag LOCUS_05990 136959 135952 CDS product PGF-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903207.1 protein_id gnl|my_center|LOCUS_05990 137074 137472 gene locus_tag LOCUS_06000 137074 137472 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878487.1 protein_id gnl|my_center|LOCUS_06000 137554 138093 gene locus_tag LOCUS_06010 137554 138093 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148881916.1 protein_id gnl|my_center|LOCUS_06010 139345 138101 gene locus_tag LOCUS_06020 139345 138101 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876500.1 protein_id gnl|my_center|LOCUS_06020 140382 139444 gene locus_tag LOCUS_06030 140382 139444 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111129.1 protein_id gnl|my_center|LOCUS_06030 140825 140379 gene locus_tag LOCUS_06040 140825 140379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 141371 141180 gene locus_tag LOCUS_06050 141371 141180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 141503 141823 gene locus_tag LOCUS_06060 141503 141823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 143447 141984 gene locus_tag LOCUS_06070 gene secY 143447 141984 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903257.1 protein_id gnl|my_center|LOCUS_06070 144122 143640 gene locus_tag LOCUS_06080 144122 143640 CDS product uL15m family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903256.1 protein_id gnl|my_center|LOCUS_06080 144580 144122 gene locus_tag LOCUS_06090 144580 144122 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117363797.1 protein_id gnl|my_center|LOCUS_06090 145227 144580 gene locus_tag LOCUS_06100 145227 144580 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903254.1 protein_id gnl|my_center|LOCUS_06100 145783 145220 gene locus_tag LOCUS_06110 145783 145220 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903253.1 protein_id gnl|my_center|LOCUS_06110 146244 145783 gene locus_tag LOCUS_06120 146244 145783 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903252.1 protein_id gnl|my_center|LOCUS_06120 146942 146241 gene locus_tag LOCUS_06130 146942 146241 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903251.1 protein_id gnl|my_center|LOCUS_06130 147512 146943 gene locus_tag LOCUS_06140 147512 146943 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903250.1 protein_id gnl|my_center|LOCUS_06140 147907 147515 gene locus_tag LOCUS_06150 147907 147515 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903249.1 protein_id gnl|my_center|LOCUS_06150 148101 147910 gene locus_tag LOCUS_06160 148101 147910 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903248.1 protein_id gnl|my_center|LOCUS_06160 148628 148098 gene locus_tag LOCUS_06170 148628 148098 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903247.1 protein_id gnl|my_center|LOCUS_06170 149383 148625 gene locus_tag LOCUS_06180 149383 148625 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903246.1 protein_id gnl|my_center|LOCUS_06180 149747 149385 gene locus_tag LOCUS_06190 gene rplX 149747 149385 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903245.1 protein_id gnl|my_center|LOCUS_06190 150142 149744 gene locus_tag LOCUS_06200 150142 149744 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903244.1 protein_id gnl|my_center|LOCUS_06200 150474 150142 gene locus_tag LOCUS_06210 150474 150142 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903243.1 protein_id gnl|my_center|LOCUS_06210 150974 150474 gene locus_tag LOCUS_06220 150974 150474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 151195 150980 gene locus_tag LOCUS_06230 gene rpmC 151195 150980 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903241.1 protein_id gnl|my_center|LOCUS_06230 152143 151199 gene locus_tag LOCUS_06240 152143 151199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 152604 152143 gene locus_tag LOCUS_06250 152604 152143 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903239.1 protein_id gnl|my_center|LOCUS_06250 153028 152606 gene locus_tag LOCUS_06260 153028 152606 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903238.1 protein_id gnl|my_center|LOCUS_06260 153758 153030 gene locus_tag LOCUS_06270 153758 153030 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903237.1 protein_id gnl|my_center|LOCUS_06270 154014 153760 gene locus_tag LOCUS_06280 154014 153760 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903236.1 protein_id gnl|my_center|LOCUS_06280 154757 154011 gene locus_tag LOCUS_06290 gene rpl4p 154757 154011 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903235.1 protein_id gnl|my_center|LOCUS_06290 155773 154757 gene locus_tag LOCUS_06300 155773 154757 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903234.1 protein_id gnl|my_center|LOCUS_06300 156618 155785 gene locus_tag LOCUS_06310 156618 155785 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903233.1 protein_id gnl|my_center|LOCUS_06310 156889 156959 gene locus_tag LOCUS_t00110 156889 156959 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 157279 158478 gene locus_tag LOCUS_06320 157279 158478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 158955 158533 gene locus_tag LOCUS_06330 158955 158533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 159224 158952 gene locus_tag LOCUS_06340 159224 158952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 159456 159851 gene locus_tag LOCUS_06350 159456 159851 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980432.1 protein_id gnl|my_center|LOCUS_06350 160005 160319 gene locus_tag LOCUS_06360 160005 160319 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903375.1 protein_id gnl|my_center|LOCUS_06360 160496 161359 gene locus_tag LOCUS_06370 gene pyrF 160496 161359 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903220.1 protein_id gnl|my_center|LOCUS_06370 161438 163219 gene locus_tag LOCUS_06380 161438 163219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 163384 163244 gene locus_tag LOCUS_06390 163384 163244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 163582 164103 gene locus_tag LOCUS_06400 163582 164103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 164387 166006 gene locus_tag LOCUS_06410 164387 166006 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903224.1 protein_id gnl|my_center|LOCUS_06410 166803 166054 gene locus_tag LOCUS_06420 166803 166054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902751.1 protein_id gnl|my_center|LOCUS_06420 >Feature sequence04 2635 1832 gene locus_tag LOCUS_06430 2635 1832 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903740.1 protein_id gnl|my_center|LOCUS_06430 3531 2632 gene locus_tag LOCUS_06440 gene cobA 3531 2632 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903739.1 protein_id gnl|my_center|LOCUS_06440 4917 3532 gene locus_tag LOCUS_06450 gene hemC 4917 3532 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903738.1 protein_id gnl|my_center|LOCUS_06450 5304 6665 gene locus_tag LOCUS_06460 5304 6665 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903821.1 protein_id gnl|my_center|LOCUS_06460 6666 8171 gene locus_tag LOCUS_06470 gene argH 6666 8171 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903820.1 protein_id gnl|my_center|LOCUS_06470 8539 8709 gene locus_tag LOCUS_06480 gene lysW 8539 8709 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256240.1 protein_id gnl|my_center|LOCUS_06480 8711 9640 gene locus_tag LOCUS_06490 gene lysX 8711 9640 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_06490 9637 10692 gene locus_tag LOCUS_06500 gene argC 9637 10692 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256242.1 protein_id gnl|my_center|LOCUS_06500 10689 12707 gene locus_tag LOCUS_06510 10689 12707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 12710 14797 gene locus_tag LOCUS_06520 12710 14797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 17211 15040 gene locus_tag LOCUS_06530 17211 15040 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903824.1 protein_id gnl|my_center|LOCUS_06530 17262 18092 gene locus_tag LOCUS_06540 17262 18092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 20774 18186 gene locus_tag LOCUS_06550 20774 18186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 22164 21127 gene locus_tag LOCUS_06560 22164 21127 CDS product Brp/Blh family beta-carotene 15,15'-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289439.1 protein_id gnl|my_center|LOCUS_06560 22937 22164 gene locus_tag LOCUS_06570 gene crtY 22937 22164 CDS product lycopene beta-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289440.1 protein_id gnl|my_center|LOCUS_06570 23151 23891 gene locus_tag LOCUS_06580 23151 23891 CDS product bacteriorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903069.1 protein_id gnl|my_center|LOCUS_06580 24284 24042 gene locus_tag LOCUS_06590 24284 24042 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903766.1 protein_id gnl|my_center|LOCUS_06590 24512 24363 gene locus_tag LOCUS_06600 24512 24363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 24664 25365 gene locus_tag LOCUS_06610 gene rpiA 24664 25365 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903689.1 protein_id gnl|my_center|LOCUS_06610 25599 25420 gene locus_tag LOCUS_06620 25599 25420 CDS product DUF1931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903690.1 protein_id gnl|my_center|LOCUS_06620 25710 26516 gene locus_tag LOCUS_06630 gene larB 25710 26516 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020480.1 protein_id gnl|my_center|LOCUS_06630 27039 27260 gene locus_tag LOCUS_06640 27039 27260 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903691.1 protein_id gnl|my_center|LOCUS_06640 27693 27274 gene locus_tag LOCUS_06650 27693 27274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 28337 27690 gene locus_tag LOCUS_06660 28337 27690 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903176.1 protein_id gnl|my_center|LOCUS_06660 28476 29798 gene locus_tag LOCUS_06670 28476 29798 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903692.1 protein_id gnl|my_center|LOCUS_06670 29800 30258 gene locus_tag LOCUS_06680 29800 30258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 30840 30277 gene locus_tag LOCUS_06690 30840 30277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 31037 30837 gene locus_tag LOCUS_06700 31037 30837 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289475.1 protein_id gnl|my_center|LOCUS_06700 31171 34728 gene locus_tag LOCUS_06710 31171 34728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 35790 34828 gene locus_tag LOCUS_06720 35790 34828 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838058.1 protein_id gnl|my_center|LOCUS_06720 35816 36385 gene locus_tag LOCUS_06730 35816 36385 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289508.1 protein_id gnl|my_center|LOCUS_06730 37338 36592 gene locus_tag LOCUS_06740 37338 36592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 37498 38661 gene locus_tag LOCUS_06750 37498 38661 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289518.1 protein_id gnl|my_center|LOCUS_06750 39139 38777 gene locus_tag LOCUS_06760 39139 38777 CDS product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903865.1 protein_id gnl|my_center|LOCUS_06760 39790 39185 gene locus_tag LOCUS_06770 39790 39185 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337074.1 protein_id gnl|my_center|LOCUS_06770 40523 40209 gene locus_tag LOCUS_06780 40523 40209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 40688 41029 gene locus_tag LOCUS_06790 40688 41029 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903863.1 protein_id gnl|my_center|LOCUS_06790 41438 41058 gene locus_tag LOCUS_06800 41438 41058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 41653 41429 gene locus_tag LOCUS_06810 41653 41429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 43854 41731 gene locus_tag LOCUS_06820 43854 41731 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289484.1 protein_id gnl|my_center|LOCUS_06820 43969 44565 gene locus_tag LOCUS_06830 43969 44565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289482.1 protein_id gnl|my_center|LOCUS_06830 44848 45612 gene locus_tag LOCUS_06840 44848 45612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289480.1 protein_id gnl|my_center|LOCUS_06840 46287 45652 gene locus_tag LOCUS_06850 46287 45652 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903724.1 protein_id gnl|my_center|LOCUS_06850 46809 46297 gene locus_tag LOCUS_06860 46809 46297 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903723.1 protein_id gnl|my_center|LOCUS_06860 47082 46810 gene locus_tag LOCUS_06870 47082 46810 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903722.1 protein_id gnl|my_center|LOCUS_06870 47296 48615 gene locus_tag LOCUS_06880 47296 48615 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903721.1 protein_id gnl|my_center|LOCUS_06880 48679 49548 gene locus_tag LOCUS_06890 48679 49548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 50780 49578 gene locus_tag LOCUS_06900 50780 49578 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903720.1 protein_id gnl|my_center|LOCUS_06900 51080 50898 gene locus_tag LOCUS_06910 51080 50898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 51745 51179 gene locus_tag LOCUS_06920 51745 51179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06920 52793 52029 gene locus_tag LOCUS_06930 gene pcaD 52793 52029 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727990.1 protein_id gnl|my_center|LOCUS_06930 52979 54004 gene locus_tag LOCUS_06940 52979 54004 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289509.1 protein_id gnl|my_center|LOCUS_06940 55122 55403 gene locus_tag LOCUS_06950 55122 55403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 55396 55863 gene locus_tag LOCUS_06960 55396 55863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 58735 55976 gene locus_tag LOCUS_06970 58735 55976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 56068 55978 gene locus_tag LOCUS_t00120 56068 55978 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 58839 61607 gene locus_tag LOCUS_06980 gene alaS 58839 61607 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903698.1 protein_id gnl|my_center|LOCUS_06980 61732 62766 gene locus_tag LOCUS_06990 61732 62766 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903831.1 protein_id gnl|my_center|LOCUS_06990 63107 63265 gene locus_tag LOCUS_07000 63107 63265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 63787 63329 gene locus_tag LOCUS_07010 gene lrp 63787 63329 CDS product HTH-type transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903541.1 protein_id gnl|my_center|LOCUS_07010 63893 65296 gene locus_tag LOCUS_07020 gene glnA 63893 65296 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060929.1 protein_id gnl|my_center|LOCUS_07020 66836 65664 gene locus_tag LOCUS_07030 66836 65664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 68113 67112 gene locus_tag LOCUS_07040 68113 67112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 68520 68110 gene locus_tag LOCUS_07050 68520 68110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903538.1 protein_id gnl|my_center|LOCUS_07050 68932 68609 gene locus_tag LOCUS_07060 68932 68609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 69976 69056 gene locus_tag LOCUS_07070 69976 69056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 71159 70044 gene locus_tag LOCUS_07080 71159 70044 CDS product tRNA (guanine(26)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903537.1 protein_id gnl|my_center|LOCUS_07080 71240 71737 gene locus_tag LOCUS_07090 71240 71737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 72707 72024 gene locus_tag LOCUS_07100 72707 72024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 72845 73291 gene locus_tag LOCUS_07110 72845 73291 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289446.1 protein_id gnl|my_center|LOCUS_07110 73366 73845 gene locus_tag LOCUS_07120 73366 73845 CDS product Tfx family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496415.1 protein_id gnl|my_center|LOCUS_07120 73916 74698 gene locus_tag LOCUS_07130 73916 74698 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903597.1 protein_id gnl|my_center|LOCUS_07130 75793 74726 gene locus_tag LOCUS_07140 75793 74726 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903598.1 protein_id gnl|my_center|LOCUS_07140 76323 75958 gene locus_tag LOCUS_07150 76323 75958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 76503 77450 gene locus_tag LOCUS_07160 76503 77450 CDS product replication protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289447.1 protein_id gnl|my_center|LOCUS_07160 77450 78049 gene locus_tag LOCUS_07170 77450 78049 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903600.1 protein_id gnl|my_center|LOCUS_07170 78248 78655 gene locus_tag LOCUS_07180 78248 78655 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903601.1 protein_id gnl|my_center|LOCUS_07180 78933 78652 gene locus_tag LOCUS_07190 78933 78652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 79591 79136 gene locus_tag LOCUS_07200 79591 79136 CDS product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289448.1 protein_id gnl|my_center|LOCUS_07200 79975 80048 gene locus_tag LOCUS_t00130 79975 80048 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 81252 80131 gene locus_tag LOCUS_07210 81252 80131 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903606.1 protein_id gnl|my_center|LOCUS_07210 81365 81805 gene locus_tag LOCUS_07220 81365 81805 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289449.1 protein_id gnl|my_center|LOCUS_07220 82296 84524 gene locus_tag LOCUS_07230 82296 84524 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289450.1 protein_id gnl|my_center|LOCUS_07230 84928 85197 gene locus_tag LOCUS_07240 84928 85197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 85289 85361 gene locus_tag LOCUS_t00140 85289 85361 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 85413 86234 gene locus_tag LOCUS_07250 85413 86234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 86303 88417 gene locus_tag LOCUS_07260 86303 88417 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020726.1 protein_id gnl|my_center|LOCUS_07260 88418 88753 gene locus_tag LOCUS_07270 88418 88753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 88815 89153 gene locus_tag LOCUS_07280 88815 89153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903618.1 protein_id gnl|my_center|LOCUS_07280 89279 90085 gene locus_tag LOCUS_07290 89279 90085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 90160 90945 gene locus_tag LOCUS_07300 90160 90945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 90942 91604 gene locus_tag LOCUS_07310 90942 91604 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_07310 92477 91617 gene locus_tag LOCUS_07320 92477 91617 CDS product transcription initiation factor IIB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903620.1 protein_id gnl|my_center|LOCUS_07320 92645 93160 gene locus_tag LOCUS_07330 92645 93160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903621.1 protein_id gnl|my_center|LOCUS_07330 94036 93260 gene locus_tag LOCUS_07340 94036 93260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 94689 94117 gene locus_tag LOCUS_07350 94689 94117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 95171 94686 gene locus_tag LOCUS_07360 95171 94686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 95587 95357 gene locus_tag LOCUS_07370 95587 95357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 95669 95911 gene locus_tag LOCUS_07380 95669 95911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 97655 96105 gene locus_tag LOCUS_07390 97655 96105 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903916.1 protein_id gnl|my_center|LOCUS_07390 98409 97699 gene locus_tag LOCUS_07400 98409 97699 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902085.1 protein_id gnl|my_center|LOCUS_07400 99493 98642 gene locus_tag LOCUS_07410 99493 98642 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903634.1 protein_id gnl|my_center|LOCUS_07410 100547 99600 gene locus_tag LOCUS_07420 100547 99600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903635.1 protein_id gnl|my_center|LOCUS_07420 100658 101980 gene locus_tag LOCUS_07430 100658 101980 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_07430 101988 102935 gene locus_tag LOCUS_07440 101988 102935 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_07440 103022 104323 gene locus_tag LOCUS_07450 103022 104323 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391162.1 protein_id gnl|my_center|LOCUS_07450 104316 105137 gene locus_tag LOCUS_07460 104316 105137 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720081.1 protein_id gnl|my_center|LOCUS_07460 105134 105913 gene locus_tag LOCUS_07470 105134 105913 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_07470 106003 106269 gene locus_tag LOCUS_07480 106003 106269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289181.1 protein_id gnl|my_center|LOCUS_07480 107153 106287 gene locus_tag LOCUS_07490 107153 106287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07490 108568 107063 gene locus_tag LOCUS_07500 108568 107063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 108691 108969 gene locus_tag LOCUS_07510 108691 108969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 109184 110002 gene locus_tag LOCUS_07520 109184 110002 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903518.1 protein_id gnl|my_center|LOCUS_07520 109999 110565 gene locus_tag LOCUS_07530 109999 110565 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903519.1 protein_id gnl|my_center|LOCUS_07530 110640 110715 gene locus_tag LOCUS_t00150 110640 110715 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 110837 111286 gene locus_tag LOCUS_07540 110837 111286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 111621 111454 gene locus_tag LOCUS_07550 111621 111454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 111578 112513 gene locus_tag LOCUS_07560 111578 112513 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921803.1 protein_id gnl|my_center|LOCUS_07560 112523 113344 gene locus_tag LOCUS_07570 112523 113344 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893826.1 protein_id gnl|my_center|LOCUS_07570 113341 114135 gene locus_tag LOCUS_07580 113341 114135 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728355.1 protein_id gnl|my_center|LOCUS_07580 114132 114929 gene locus_tag LOCUS_07590 114132 114929 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665694.1 protein_id gnl|my_center|LOCUS_07590 115632 114985 gene locus_tag LOCUS_07600 115632 114985 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892625.1 protein_id gnl|my_center|LOCUS_07600 116824 115721 gene locus_tag LOCUS_07610 116824 115721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 117980 116826 gene locus_tag LOCUS_07620 117980 116826 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897714.1 protein_id gnl|my_center|LOCUS_07620 118600 118175 gene locus_tag LOCUS_07630 118600 118175 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902240.1 protein_id gnl|my_center|LOCUS_07630 119648 118635 gene locus_tag LOCUS_07640 119648 118635 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902239.1 protein_id gnl|my_center|LOCUS_07640 119889 119641 gene locus_tag LOCUS_07650 119889 119641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 120738 119977 gene locus_tag LOCUS_07660 120738 119977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 121685 120822 gene locus_tag LOCUS_07670 121685 120822 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902235.1 protein_id gnl|my_center|LOCUS_07670 121806 123131 gene locus_tag LOCUS_07680 121806 123131 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877762.1 protein_id gnl|my_center|LOCUS_07680 123204 124748 gene locus_tag LOCUS_07690 123204 124748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 124890 126074 gene locus_tag LOCUS_07700 gene ftsZ 124890 126074 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902232.1 protein_id gnl|my_center|LOCUS_07700 126193 126366 gene locus_tag LOCUS_07710 126193 126366 CDS product protein translocase SEC61 complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902231.1 protein_id gnl|my_center|LOCUS_07710 126368 126823 gene locus_tag LOCUS_07720 126368 126823 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902230.1 protein_id gnl|my_center|LOCUS_07720 127224 126928 gene locus_tag LOCUS_07730 127224 126928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289147.1 protein_id gnl|my_center|LOCUS_07730 127320 128081 gene locus_tag LOCUS_07740 127320 128081 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892483.1 protein_id gnl|my_center|LOCUS_07740 128661 128155 gene locus_tag LOCUS_07750 128661 128155 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289144.1 protein_id gnl|my_center|LOCUS_07750 129253 128735 gene locus_tag LOCUS_07760 129253 128735 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902226.1 protein_id gnl|my_center|LOCUS_07760 129329 130429 gene locus_tag LOCUS_07770 129329 130429 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902428.1 protein_id gnl|my_center|LOCUS_07770 130524 131723 gene locus_tag LOCUS_07780 130524 131723 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902224.1 protein_id gnl|my_center|LOCUS_07780 132623 131802 gene locus_tag LOCUS_07790 132623 131802 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902223.1 protein_id gnl|my_center|LOCUS_07790 133634 132765 gene locus_tag LOCUS_07800 133634 132765 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902222.1 protein_id gnl|my_center|LOCUS_07800 134573 133641 gene locus_tag LOCUS_07810 134573 133641 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902221.1 protein_id gnl|my_center|LOCUS_07810 134819 134682 gene locus_tag LOCUS_07820 134819 134682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 135483 134944 gene locus_tag LOCUS_07830 135483 134944 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902148.1 protein_id gnl|my_center|LOCUS_07830 135864 136229 gene locus_tag LOCUS_07840 135864 136229 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902147.1 protein_id gnl|my_center|LOCUS_07840 136900 136265 gene locus_tag LOCUS_07850 136900 136265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902146.1 protein_id gnl|my_center|LOCUS_07850 137493 136903 gene locus_tag LOCUS_07860 gene rnhA 137493 136903 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902145.1 protein_id gnl|my_center|LOCUS_07860 137579 138577 gene locus_tag LOCUS_07870 137579 138577 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902144.1 protein_id gnl|my_center|LOCUS_07870 138882 140156 gene locus_tag LOCUS_07880 gene nreA 138882 140156 CDS product DNA repair protein NreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289141.1 protein_id gnl|my_center|LOCUS_07880 140636 140187 gene locus_tag LOCUS_07890 140636 140187 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902059.1 protein_id gnl|my_center|LOCUS_07890 141101 140733 gene locus_tag LOCUS_07900 141101 140733 CDS product DUF5789 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289142.1 protein_id gnl|my_center|LOCUS_07900 141150 142166 gene locus_tag LOCUS_07910 141150 142166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902219.1 protein_id gnl|my_center|LOCUS_07910 142784 142215 gene locus_tag LOCUS_07920 142784 142215 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978170.1 protein_id gnl|my_center|LOCUS_07920 144591 142789 gene locus_tag LOCUS_07930 gene polX 144591 142789 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020772.1 protein_id gnl|my_center|LOCUS_07930 145170 144727 gene locus_tag LOCUS_07940 145170 144727 CDS product DUF5788 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289143.1 protein_id gnl|my_center|LOCUS_07940 145360 147063 gene locus_tag LOCUS_07950 145360 147063 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289204.1 protein_id gnl|my_center|LOCUS_07950 147132 147419 gene locus_tag LOCUS_07960 147132 147419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 147490 147792 gene locus_tag LOCUS_07970 147490 147792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 147938 149932 gene locus_tag LOCUS_07980 gene acs 147938 149932 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902710.1 protein_id gnl|my_center|LOCUS_07980 150223 151833 gene locus_tag LOCUS_07990 150223 151833 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289110.1 protein_id gnl|my_center|LOCUS_07990 151971 152279 gene locus_tag LOCUS_08000 151971 152279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 152554 152766 gene locus_tag LOCUS_08010 152554 152766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 153401 152649 gene locus_tag LOCUS_08020 153401 152649 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902448.1 protein_id gnl|my_center|LOCUS_08020 153554 154228 gene locus_tag LOCUS_08030 153554 154228 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204015.1 protein_id gnl|my_center|LOCUS_08030 154451 155761 gene locus_tag LOCUS_08040 154451 155761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 155887 156843 gene locus_tag LOCUS_08050 155887 156843 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966751.1 protein_id gnl|my_center|LOCUS_08050 156840 158033 gene locus_tag LOCUS_08060 156840 158033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 158030 158788 gene locus_tag LOCUS_08070 158030 158788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086608.1 protein_id gnl|my_center|LOCUS_08070 158785 159657 gene locus_tag LOCUS_08080 158785 159657 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887677.1 protein_id gnl|my_center|LOCUS_08080 159660 160379 gene locus_tag LOCUS_08090 159660 160379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 161297 160428 gene locus_tag LOCUS_08100 161297 160428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 163138 161294 gene locus_tag LOCUS_08110 163138 161294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence05 270 1151 gene locus_tag LOCUS_08120 270 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 1094 1927 gene locus_tag LOCUS_08130 1094 1927 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877743.1 protein_id gnl|my_center|LOCUS_08130 1927 2655 gene locus_tag LOCUS_08140 1927 2655 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973246.1 protein_id gnl|my_center|LOCUS_08140 2710 3150 gene locus_tag LOCUS_08150 2710 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 4305 3247 gene locus_tag LOCUS_08160 4305 3247 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531254.1 protein_id gnl|my_center|LOCUS_08160 5419 4451 gene locus_tag LOCUS_08170 5419 4451 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030964.1 protein_id gnl|my_center|LOCUS_08170 7076 5559 gene locus_tag LOCUS_08180 7076 5559 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289363.1 protein_id gnl|my_center|LOCUS_08180 7191 8048 gene locus_tag LOCUS_08190 7191 8048 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903172.1 protein_id gnl|my_center|LOCUS_08190 8249 8830 gene locus_tag LOCUS_08200 8249 8830 CDS product DUF2150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903173.1 protein_id gnl|my_center|LOCUS_08200 8924 10996 gene locus_tag LOCUS_08210 8924 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 11091 12428 gene locus_tag LOCUS_08220 gene hmgB 11091 12428 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_08220 13670 14119 gene locus_tag LOCUS_08230 13670 14119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 15455 14163 gene locus_tag LOCUS_08240 15455 14163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 16350 15457 gene locus_tag LOCUS_08250 16350 15457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 17049 16735 gene locus_tag LOCUS_08260 17049 16735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 17985 17155 gene locus_tag LOCUS_08270 17985 17155 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289362.1 protein_id gnl|my_center|LOCUS_08270 18045 18707 gene locus_tag LOCUS_08280 18045 18707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 18794 19333 gene locus_tag LOCUS_08290 18794 19333 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903178.1 protein_id gnl|my_center|LOCUS_08290 19470 19730 gene locus_tag LOCUS_08300 19470 19730 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903557.1 protein_id gnl|my_center|LOCUS_08300 20923 19934 gene locus_tag LOCUS_08310 20923 19934 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289434.1 protein_id gnl|my_center|LOCUS_08310 21079 22476 gene locus_tag LOCUS_08320 21079 22476 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903554.1 protein_id gnl|my_center|LOCUS_08320 23574 22489 gene locus_tag LOCUS_08330 23574 22489 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903552.1 protein_id gnl|my_center|LOCUS_08330 23928 23686 gene locus_tag LOCUS_08340 23928 23686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 25212 24256 gene locus_tag LOCUS_08350 25212 24256 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903551.1 protein_id gnl|my_center|LOCUS_08350 25702 26352 gene locus_tag LOCUS_08360 25702 26352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 26414 27733 gene locus_tag LOCUS_08370 26414 27733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 27882 30155 gene locus_tag LOCUS_08380 27882 30155 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903183.1 protein_id gnl|my_center|LOCUS_08380 30310 31929 gene locus_tag LOCUS_08390 30310 31929 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385601.1 protein_id gnl|my_center|LOCUS_08390 31955 32947 gene locus_tag LOCUS_08400 31955 32947 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836213.1 protein_id gnl|my_center|LOCUS_08400 32947 33963 gene locus_tag LOCUS_08410 32947 33963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 33964 35235 gene locus_tag LOCUS_08420 33964 35235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970065.1 protein_id gnl|my_center|LOCUS_08420 35228 36736 gene locus_tag LOCUS_08430 35228 36736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08430 36961 37230 gene locus_tag LOCUS_08440 36961 37230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 38393 37356 gene locus_tag LOCUS_08450 38393 37356 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902703.1 protein_id gnl|my_center|LOCUS_08450 39346 38390 gene locus_tag LOCUS_08460 39346 38390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 39506 39348 gene locus_tag LOCUS_08470 39506 39348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 39760 39530 gene locus_tag LOCUS_08480 39760 39530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 39885 39757 gene locus_tag LOCUS_08490 39885 39757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 40058 39885 gene locus_tag LOCUS_08500 40058 39885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 40272 40577 gene locus_tag LOCUS_08510 40272 40577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 40574 40912 gene locus_tag LOCUS_08520 40574 40912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 40998 41567 gene locus_tag LOCUS_08530 40998 41567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 42203 41814 gene locus_tag LOCUS_08540 42203 41814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 42400 42203 gene locus_tag LOCUS_08550 42400 42203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 43022 42444 gene locus_tag LOCUS_08560 43022 42444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 43471 43169 gene locus_tag LOCUS_08570 43471 43169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 43758 43468 gene locus_tag LOCUS_08580 43758 43468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 43890 44138 gene locus_tag LOCUS_08590 43890 44138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 44138 44371 gene locus_tag LOCUS_08600 44138 44371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 44377 44538 gene locus_tag LOCUS_08610 44377 44538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 44535 45566 gene locus_tag LOCUS_08620 44535 45566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 45563 46111 gene locus_tag LOCUS_08630 45563 46111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 46105 46755 gene locus_tag LOCUS_08640 46105 46755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 46755 47327 gene locus_tag LOCUS_08650 46755 47327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 47330 48157 gene locus_tag LOCUS_08660 47330 48157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 48159 48323 gene locus_tag LOCUS_08670 48159 48323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 48409 48765 gene locus_tag LOCUS_08680 48409 48765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 48768 49292 gene locus_tag LOCUS_08690 48768 49292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 49289 50014 gene locus_tag LOCUS_08700 49289 50014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 50030 50308 gene locus_tag LOCUS_08710 50030 50308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 50402 50785 gene locus_tag LOCUS_08720 50402 50785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 50782 51165 gene locus_tag LOCUS_08730 50782 51165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 51162 52229 gene locus_tag LOCUS_08740 51162 52229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 52226 52762 gene locus_tag LOCUS_08750 52226 52762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 52759 53355 gene locus_tag LOCUS_08760 52759 53355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 53358 53945 gene locus_tag LOCUS_08770 53358 53945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 53949 54188 gene locus_tag LOCUS_08780 53949 54188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 54185 54406 gene locus_tag LOCUS_08790 54185 54406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 55139 54417 gene locus_tag LOCUS_08800 55139 54417 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038090.1 protein_id gnl|my_center|LOCUS_08800 55641 55132 gene locus_tag LOCUS_08810 55641 55132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 56317 55835 gene locus_tag LOCUS_08820 56317 55835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 56919 56314 gene locus_tag LOCUS_08830 56919 56314 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096301.1 protein_id gnl|my_center|LOCUS_08830 57462 57388 gene locus_tag LOCUS_t00160 57462 57388 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 57833 57558 gene locus_tag LOCUS_08840 57833 57558 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289392.1 protein_id gnl|my_center|LOCUS_08840 59731 58115 gene locus_tag LOCUS_08850 59731 58115 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892520.1 protein_id gnl|my_center|LOCUS_08850 60538 59762 gene locus_tag LOCUS_08860 60538 59762 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903355.1 protein_id gnl|my_center|LOCUS_08860 60625 60798 gene locus_tag LOCUS_08870 60625 60798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 61048 61941 gene locus_tag LOCUS_08880 gene map 61048 61941 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903366.1 protein_id gnl|my_center|LOCUS_08880 62220 62020 gene locus_tag LOCUS_08890 62220 62020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903365.1 protein_id gnl|my_center|LOCUS_08890 62433 62981 gene locus_tag LOCUS_08900 62433 62981 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903364.1 protein_id gnl|my_center|LOCUS_08900 63159 64094 gene locus_tag LOCUS_08910 63159 64094 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902500.1 protein_id gnl|my_center|LOCUS_08910 64191 65102 gene locus_tag LOCUS_08920 64191 65102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 65929 65114 gene locus_tag LOCUS_08930 gene nadC 65929 65114 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903380.1 protein_id gnl|my_center|LOCUS_08930 67544 65910 gene locus_tag LOCUS_08940 67544 65910 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903379.1 protein_id gnl|my_center|LOCUS_08940 68671 67547 gene locus_tag LOCUS_08950 gene nadA 68671 67547 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903378.1 protein_id gnl|my_center|LOCUS_08950 70436 68874 gene locus_tag LOCUS_08960 70436 68874 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903377.1 protein_id gnl|my_center|LOCUS_08960 71085 72305 gene locus_tag LOCUS_08970 gene hmgA 71085 72305 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903374.1 protein_id gnl|my_center|LOCUS_08970 72780 72382 gene locus_tag LOCUS_08980 72780 72382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 73366 72842 gene locus_tag LOCUS_08990 73366 72842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 73556 73897 gene locus_tag LOCUS_09000 73556 73897 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_09000 74734 74120 gene locus_tag LOCUS_09010 74734 74120 CDS product DUF6149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903316.1 protein_id gnl|my_center|LOCUS_09010 75013 76257 gene locus_tag LOCUS_09020 75013 76257 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903320.1 protein_id gnl|my_center|LOCUS_09020 76339 76755 gene locus_tag LOCUS_09030 76339 76755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903322.1 protein_id gnl|my_center|LOCUS_09030 76843 77769 gene locus_tag LOCUS_09040 gene mptA 76843 77769 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903394.1 protein_id gnl|my_center|LOCUS_09040 78305 77922 gene locus_tag LOCUS_09050 78305 77922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 80302 78737 gene locus_tag LOCUS_09060 80302 78737 CDS product DUF255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289401.1 protein_id gnl|my_center|LOCUS_09060 80578 81156 gene locus_tag LOCUS_09070 80578 81156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 81265 81340 gene locus_tag LOCUS_t00170 81265 81340 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 81637 81509 gene locus_tag LOCUS_09080 81637 81509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 83030 81789 gene locus_tag LOCUS_09090 83030 81789 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706679.1 protein_id gnl|my_center|LOCUS_09090 83132 83461 gene locus_tag LOCUS_09100 83132 83461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 83514 84824 gene locus_tag LOCUS_09110 83514 84824 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258527.1 protein_id gnl|my_center|LOCUS_09110 84922 85170 gene locus_tag LOCUS_09120 84922 85170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903401.1 protein_id gnl|my_center|LOCUS_09120 85293 86171 gene locus_tag LOCUS_09130 85293 86171 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903313.1 protein_id gnl|my_center|LOCUS_09130 86741 86226 gene locus_tag LOCUS_09140 86741 86226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 87898 86990 gene locus_tag LOCUS_09150 gene pdxS 87898 86990 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903311.1 protein_id gnl|my_center|LOCUS_09150 88007 89914 gene locus_tag LOCUS_09160 88007 89914 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763797.1 protein_id gnl|my_center|LOCUS_09160 92247 89953 gene locus_tag LOCUS_09170 92247 89953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 92903 92256 gene locus_tag LOCUS_09180 92903 92256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 93085 94080 gene locus_tag LOCUS_09190 93085 94080 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289444.1 protein_id gnl|my_center|LOCUS_09190 94887 94264 gene locus_tag LOCUS_09200 94887 94264 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289360.1 protein_id gnl|my_center|LOCUS_09200 95070 96653 gene locus_tag LOCUS_09210 95070 96653 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903921.1 protein_id gnl|my_center|LOCUS_09210 96784 97233 gene locus_tag LOCUS_09220 96784 97233 CDS product DUF5799 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902746.1 protein_id gnl|my_center|LOCUS_09220 98413 97334 gene locus_tag LOCUS_09230 gene leuB 98413 97334 CDS product bifunctional 3-isopropylmalate/3-methylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870225.1 protein_id gnl|my_center|LOCUS_09230 99056 98406 gene locus_tag LOCUS_09240 gene leuD 99056 98406 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404878.1 protein_id gnl|my_center|LOCUS_09240 100504 99053 gene locus_tag LOCUS_09250 gene leuC 100504 99053 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404876.1 protein_id gnl|my_center|LOCUS_09250 100692 100501 gene locus_tag LOCUS_09260 100692 100501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 101737 100685 gene locus_tag LOCUS_09270 gene ilvC 101737 100685 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392863.1 protein_id gnl|my_center|LOCUS_09270 104307 101734 gene locus_tag LOCUS_09280 104307 101734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 102436 102560 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 105514 104624 gene locus_tag LOCUS_09290 105514 104624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 106084 106401 gene locus_tag LOCUS_09300 106084 106401 CDS product DUF5779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902748.1 protein_id gnl|my_center|LOCUS_09300 107001 106465 gene locus_tag LOCUS_09310 107001 106465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 107839 107090 gene locus_tag LOCUS_09320 107839 107090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 107903 108577 gene locus_tag LOCUS_09330 107903 108577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902751.1 protein_id gnl|my_center|LOCUS_09330 108588 109148 gene locus_tag LOCUS_09340 108588 109148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 109574 109224 gene locus_tag LOCUS_09350 109574 109224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 109584 109910 gene locus_tag LOCUS_09360 109584 109910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 110879 109872 gene locus_tag LOCUS_09370 gene aglJ 110879 109872 CDS product S-layer glycoprotein N-glycosyltransferase AglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902752.1 protein_id gnl|my_center|LOCUS_09370 111689 111907 gene locus_tag LOCUS_09380 111689 111907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 112374 113678 gene locus_tag LOCUS_09390 gene aglM 112374 113678 CDS product UDP-glucose 6-dehydrogenase AglM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901982.1 protein_id gnl|my_center|LOCUS_09390 113805 114956 gene locus_tag LOCUS_09400 113805 114956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 114984 116114 gene locus_tag LOCUS_09410 114984 116114 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_09410 116114 116785 gene locus_tag LOCUS_09420 116114 116785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 116789 118027 gene locus_tag LOCUS_09430 116789 118027 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902756.1 protein_id gnl|my_center|LOCUS_09430 118020 118931 gene locus_tag LOCUS_09440 118020 118931 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868277.1 protein_id gnl|my_center|LOCUS_09440 119222 120322 gene locus_tag LOCUS_09450 119222 120322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 120319 121224 gene locus_tag LOCUS_09460 120319 121224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 121221 122657 gene locus_tag LOCUS_09470 121221 122657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 123153 124184 gene locus_tag LOCUS_09480 123153 124184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09480 124589 126520 gene locus_tag LOCUS_09490 124589 126520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09490 126521 127591 gene locus_tag LOCUS_09500 126521 127591 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902767.1 protein_id gnl|my_center|LOCUS_09500 127694 128143 gene locus_tag LOCUS_09510 127694 128143 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902246.1 protein_id gnl|my_center|LOCUS_09510 128228 129067 gene locus_tag LOCUS_09520 128228 129067 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902247.1 protein_id gnl|my_center|LOCUS_09520 129322 129122 gene locus_tag LOCUS_09530 129322 129122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 131336 129390 gene locus_tag LOCUS_09540 131336 129390 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902249.1 protein_id gnl|my_center|LOCUS_09540 131518 132021 gene locus_tag LOCUS_09550 131518 132021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 132144 133643 gene locus_tag LOCUS_09560 gene proS 132144 133643 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902251.1 protein_id gnl|my_center|LOCUS_09560 133932 138473 gene locus_tag LOCUS_09570 gene gltB 133932 138473 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421590.1 protein_id gnl|my_center|LOCUS_09570 138667 139605 gene locus_tag LOCUS_09580 gene mch 138667 139605 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903231.1 protein_id gnl|my_center|LOCUS_09580 139619 140167 gene locus_tag LOCUS_09590 139619 140167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903226.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence06 472 1767 gene locus_tag LOCUS_09600 472 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1778 2506 gene locus_tag LOCUS_09610 1778 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 3469 2516 gene locus_tag LOCUS_09620 3469 2516 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902122.1 protein_id gnl|my_center|LOCUS_09620 4403 3531 gene locus_tag LOCUS_09630 4403 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 5935 4400 gene locus_tag LOCUS_09640 5935 4400 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530900.1 protein_id gnl|my_center|LOCUS_09640 6257 6442 gene locus_tag LOCUS_09650 6257 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 7888 6515 gene locus_tag LOCUS_09660 7888 6515 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903984.1 protein_id gnl|my_center|LOCUS_09660 8568 8236 gene locus_tag LOCUS_09670 8568 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 8736 9227 gene locus_tag LOCUS_09680 8736 9227 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903982.1 protein_id gnl|my_center|LOCUS_09680 10086 9238 gene locus_tag LOCUS_09690 10086 9238 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903981.1 protein_id gnl|my_center|LOCUS_09690 10269 10637 gene locus_tag LOCUS_09700 gene sepF 10269 10637 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903980.1 protein_id gnl|my_center|LOCUS_09700 11735 10719 gene locus_tag LOCUS_09710 11735 10719 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289530.1 protein_id gnl|my_center|LOCUS_09710 11938 12312 gene locus_tag LOCUS_09720 11938 12312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 12309 13769 gene locus_tag LOCUS_09730 12309 13769 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903965.1 protein_id gnl|my_center|LOCUS_09730 14106 13786 gene locus_tag LOCUS_09740 14106 13786 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903966.1 protein_id gnl|my_center|LOCUS_09740 15734 14274 gene locus_tag LOCUS_09750 15734 14274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 16811 15849 gene locus_tag LOCUS_09760 16811 15849 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903967.1 protein_id gnl|my_center|LOCUS_09760 17313 16870 gene locus_tag LOCUS_09770 17313 16870 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289215.1 protein_id gnl|my_center|LOCUS_09770 17930 17547 gene locus_tag LOCUS_09780 17930 17547 CDS product DUF5611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903979.1 protein_id gnl|my_center|LOCUS_09780 18788 18045 gene locus_tag LOCUS_09790 18788 18045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 19308 19607 gene locus_tag LOCUS_09800 19308 19607 CDS product DUF6432 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903977.1 protein_id gnl|my_center|LOCUS_09800 19690 20793 gene locus_tag LOCUS_09810 19690 20793 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903976.1 protein_id gnl|my_center|LOCUS_09810 21957 20878 gene locus_tag LOCUS_09820 21957 20878 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289531.1 protein_id gnl|my_center|LOCUS_09820 22411 24042 gene locus_tag LOCUS_09830 22411 24042 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 protein_id gnl|my_center|LOCUS_09830 25086 24070 gene locus_tag LOCUS_09840 25086 24070 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825317.1 protein_id gnl|my_center|LOCUS_09840 28275 25288 gene locus_tag LOCUS_09850 gene uvrA 28275 25288 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903972.1 protein_id gnl|my_center|LOCUS_09850 28518 28691 gene locus_tag LOCUS_09860 28518 28691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 29171 30817 gene locus_tag LOCUS_09870 gene thsB 29171 30817 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361694.1 protein_id gnl|my_center|LOCUS_09870 31363 31061 gene locus_tag LOCUS_09880 31363 31061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 31673 32665 gene locus_tag LOCUS_09890 31673 32665 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289464.1 protein_id gnl|my_center|LOCUS_09890 32739 35450 gene locus_tag LOCUS_09900 gene leuS 32739 35450 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903650.1 protein_id gnl|my_center|LOCUS_09900 35695 35486 gene locus_tag LOCUS_09910 35695 35486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 35978 36487 gene locus_tag LOCUS_09920 35978 36487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 36638 37282 gene locus_tag LOCUS_09930 gene hisH 36638 37282 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903536.1 protein_id gnl|my_center|LOCUS_09930 37742 37305 gene locus_tag LOCUS_09940 37742 37305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 38838 37990 gene locus_tag LOCUS_09950 gene pheA 38838 37990 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903649.1 protein_id gnl|my_center|LOCUS_09950 39236 38916 gene locus_tag LOCUS_09960 gene hisE 39236 38916 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903939.1 protein_id gnl|my_center|LOCUS_09960 39856 39233 gene locus_tag LOCUS_09970 gene pdxT 39856 39233 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903941.1 protein_id gnl|my_center|LOCUS_09970 40080 39949 gene locus_tag LOCUS_09980 40080 39949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 40217 40513 gene locus_tag LOCUS_09990 gene trxA 40217 40513 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903943.1 protein_id gnl|my_center|LOCUS_09990 40581 40730 gene locus_tag LOCUS_10000 40581 40730 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870213.1 protein_id gnl|my_center|LOCUS_10000 41448 40822 gene locus_tag LOCUS_10010 41448 40822 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903529.1 protein_id gnl|my_center|LOCUS_10010 41574 41744 gene locus_tag LOCUS_10020 41574 41744 CDS product DUF5786 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903530.1 protein_id gnl|my_center|LOCUS_10020 41838 42488 gene locus_tag LOCUS_10030 41838 42488 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903531.1 protein_id gnl|my_center|LOCUS_10030 42519 43127 gene locus_tag LOCUS_10040 42519 43127 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903532.1 protein_id gnl|my_center|LOCUS_10040 43819 43121 gene locus_tag LOCUS_10050 43819 43121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 44528 43938 gene locus_tag LOCUS_10060 44528 43938 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902087.1 protein_id gnl|my_center|LOCUS_10060 45625 44708 gene locus_tag LOCUS_10070 45625 44708 CDS product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902089.1 protein_id gnl|my_center|LOCUS_10070 45978 46814 gene locus_tag LOCUS_10080 45978 46814 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902091.1 protein_id gnl|my_center|LOCUS_10080 47509 46961 gene locus_tag LOCUS_10090 47509 46961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 47610 48464 gene locus_tag LOCUS_10100 47610 48464 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902092.1 protein_id gnl|my_center|LOCUS_10100 48596 48877 gene locus_tag LOCUS_10110 48596 48877 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901977.1 protein_id gnl|my_center|LOCUS_10110 48903 49334 gene locus_tag LOCUS_10120 48903 49334 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289078.1 protein_id gnl|my_center|LOCUS_10120 50013 49387 gene locus_tag LOCUS_10130 50013 49387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 50199 51728 gene locus_tag LOCUS_10140 50199 51728 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903957.1 protein_id gnl|my_center|LOCUS_10140 51938 52126 gene locus_tag LOCUS_10150 51938 52126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 52265 54124 gene locus_tag LOCUS_10160 52265 54124 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903960.1 protein_id gnl|my_center|LOCUS_10160 54125 55393 gene locus_tag LOCUS_10170 54125 55393 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902891.1 protein_id gnl|my_center|LOCUS_10170 55720 55421 gene locus_tag LOCUS_10180 55720 55421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 55992 55717 gene locus_tag LOCUS_10190 55992 55717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 55885 56547 gene locus_tag LOCUS_10200 55885 56547 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289529.1 protein_id gnl|my_center|LOCUS_10200 56962 56881 gene locus_tag LOCUS_t00180 56962 56881 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 57194 56991 gene locus_tag LOCUS_10210 57194 56991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 57576 57196 gene locus_tag LOCUS_10220 57576 57196 CDS product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903545.1 protein_id gnl|my_center|LOCUS_10220 57662 58099 gene locus_tag LOCUS_10230 57662 58099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 58699 58103 gene locus_tag LOCUS_10240 58699 58103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 58949 59224 gene locus_tag LOCUS_10250 58949 59224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 59211 59612 gene locus_tag LOCUS_10260 59211 59612 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878976.1 protein_id gnl|my_center|LOCUS_10260 61572 60361 gene locus_tag LOCUS_10270 gene ilvA 61572 60361 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903546.1 protein_id gnl|my_center|LOCUS_10270 62290 61793 gene locus_tag LOCUS_10280 62290 61793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 62412 63782 gene locus_tag LOCUS_10290 62412 63782 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903796.1 protein_id gnl|my_center|LOCUS_10290 64178 64041 gene locus_tag LOCUS_10300 64178 64041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 64973 64311 gene locus_tag LOCUS_10310 64973 64311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 65522 65262 gene locus_tag LOCUS_10320 65522 65262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 66701 65658 gene locus_tag LOCUS_10330 gene citZ 66701 65658 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903548.1 protein_id gnl|my_center|LOCUS_10330 66360 66444 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 67626 66811 gene locus_tag LOCUS_10340 gene moeB 67626 66811 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902012.1 protein_id gnl|my_center|LOCUS_10340 67843 68853 gene locus_tag LOCUS_10350 67843 68853 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289230.1 protein_id gnl|my_center|LOCUS_10350 69685 69017 gene locus_tag LOCUS_10360 gene npdG 69685 69017 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903948.1 protein_id gnl|my_center|LOCUS_10360 70080 69850 gene locus_tag LOCUS_10370 70080 69850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 70953 70087 gene locus_tag LOCUS_10380 70953 70087 CDS product TIGR01548 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903949.1 protein_id gnl|my_center|LOCUS_10380 71433 71071 gene locus_tag LOCUS_10390 71433 71071 CDS product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903950.1 protein_id gnl|my_center|LOCUS_10390 71539 72060 gene locus_tag LOCUS_10400 71539 72060 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903951.1 protein_id gnl|my_center|LOCUS_10400 72348 72788 gene locus_tag LOCUS_10410 72348 72788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 73739 73149 gene locus_tag LOCUS_10420 73739 73149 CDS product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973222.1 protein_id gnl|my_center|LOCUS_10420 75644 73815 gene locus_tag LOCUS_10430 75644 73815 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903953.1 protein_id gnl|my_center|LOCUS_10430 75957 75646 gene locus_tag LOCUS_10440 75957 75646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903954.1 protein_id gnl|my_center|LOCUS_10440 76070 76408 gene locus_tag LOCUS_10450 76070 76408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 77398 76544 gene locus_tag LOCUS_10460 77398 76544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 79524 77659 gene locus_tag LOCUS_10470 79524 77659 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903956.1 protein_id gnl|my_center|LOCUS_10470 79686 80810 gene locus_tag LOCUS_10480 gene argE 79686 80810 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247175.1 protein_id gnl|my_center|LOCUS_10480 80909 82435 gene locus_tag LOCUS_10490 80909 82435 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903957.1 protein_id gnl|my_center|LOCUS_10490 83713 83622 gene locus_tag LOCUS_t00190 83713 83622 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 84564 83917 gene locus_tag LOCUS_10500 84564 83917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289115.1 protein_id gnl|my_center|LOCUS_10500 84715 84849 gene locus_tag LOCUS_10510 84715 84849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 84913 85881 gene locus_tag LOCUS_10520 84913 85881 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902098.1 protein_id gnl|my_center|LOCUS_10520 87219 86014 gene locus_tag LOCUS_10530 gene ftsZ 87219 86014 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289116.1 protein_id gnl|my_center|LOCUS_10530 87413 87225 gene locus_tag LOCUS_10540 87413 87225 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902100.1 protein_id gnl|my_center|LOCUS_10540 88245 87622 gene locus_tag LOCUS_10550 88245 87622 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289117.1 protein_id gnl|my_center|LOCUS_10550 88402 89388 gene locus_tag LOCUS_10560 88402 89388 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 protein_id gnl|my_center|LOCUS_10560 89705 89511 gene locus_tag LOCUS_10570 89705 89511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 90104 91240 gene locus_tag LOCUS_10580 90104 91240 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476154.1 protein_id gnl|my_center|LOCUS_10580 91507 91289 gene locus_tag LOCUS_10590 91507 91289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 91516 92148 gene locus_tag LOCUS_10600 91516 92148 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892512.1 protein_id gnl|my_center|LOCUS_10600 94185 92200 gene locus_tag LOCUS_10610 94185 92200 CDS product DUF2070 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902126.1 protein_id gnl|my_center|LOCUS_10610 94801 94247 gene locus_tag LOCUS_10620 94801 94247 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902125.1 protein_id gnl|my_center|LOCUS_10620 95456 94887 gene locus_tag LOCUS_10630 95456 94887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 95592 95963 gene locus_tag LOCUS_10640 95592 95963 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289124.1 protein_id gnl|my_center|LOCUS_10640 96137 96466 gene locus_tag LOCUS_10650 96137 96466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 96579 97052 gene locus_tag LOCUS_10660 96579 97052 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 protein_id gnl|my_center|LOCUS_10660 97310 97225 gene locus_tag LOCUS_t00200 97310 97225 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 97424 98392 gene locus_tag LOCUS_10670 97424 98392 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902122.1 protein_id gnl|my_center|LOCUS_10670 98944 98450 gene locus_tag LOCUS_10680 98944 98450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 100332 98941 gene locus_tag LOCUS_10690 100332 98941 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902121.1 protein_id gnl|my_center|LOCUS_10690 100868 100329 gene locus_tag LOCUS_10700 100868 100329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902120.1 protein_id gnl|my_center|LOCUS_10700 103180 100865 gene locus_tag LOCUS_10710 103180 100865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 104208 103654 gene locus_tag LOCUS_10720 104208 103654 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289247.1 protein_id gnl|my_center|LOCUS_10720 105256 104342 gene locus_tag LOCUS_10730 105256 104342 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142276.1 protein_id gnl|my_center|LOCUS_10730 106633 105521 gene locus_tag LOCUS_10740 106633 105521 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206889.1 protein_id gnl|my_center|LOCUS_10740 107005 106817 gene locus_tag LOCUS_10750 107005 106817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 107609 107328 gene locus_tag LOCUS_10760 107609 107328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 107697 108356 gene locus_tag LOCUS_10770 107697 108356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 108626 108360 gene locus_tag LOCUS_10780 108626 108360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 108846 110126 gene locus_tag LOCUS_10790 108846 110126 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_10790 110219 110779 gene locus_tag LOCUS_10800 110219 110779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 112032 110785 gene locus_tag LOCUS_10810 112032 110785 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289325.1 protein_id gnl|my_center|LOCUS_10810 112215 113507 gene locus_tag LOCUS_10820 gene basB 112215 113507 CDS product chemotactic signal transduction system substrate-binding protein BasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903360.1 protein_id gnl|my_center|LOCUS_10820 113583 114785 gene locus_tag LOCUS_10830 113583 114785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 115522 114815 gene locus_tag LOCUS_10840 115522 114815 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_10840 116492 115524 gene locus_tag LOCUS_10850 116492 115524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 118249 116489 gene locus_tag LOCUS_10860 118249 116489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 119679 118249 gene locus_tag LOCUS_10870 119679 118249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 120633 119779 gene locus_tag LOCUS_10880 120633 119779 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775992.1 protein_id gnl|my_center|LOCUS_10880 121707 120694 gene locus_tag LOCUS_10890 121707 120694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 122074 121814 gene locus_tag LOCUS_10900 122074 121814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 122338 124677 gene locus_tag LOCUS_10910 122338 124677 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229304.1 protein_id gnl|my_center|LOCUS_10910 124640 124843 gene locus_tag LOCUS_10920 124640 124843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 126012 125323 gene locus_tag LOCUS_10930 126012 125323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 126737 129289 gene locus_tag LOCUS_10940 126737 129289 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229304.1 protein_id gnl|my_center|LOCUS_10940 129286 130533 gene locus_tag LOCUS_10950 gene ilvA 129286 130533 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839699.1 protein_id gnl|my_center|LOCUS_10950 131018 131461 gene locus_tag LOCUS_10960 131018 131461 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_10960 131703 131542 gene locus_tag LOCUS_10970 131703 131542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 132084 133847 gene locus_tag LOCUS_10980 132084 133847 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 protein_id gnl|my_center|LOCUS_10980 134182 133967 gene locus_tag LOCUS_10990 134182 133967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 134780 134214 gene locus_tag LOCUS_11000 134780 134214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 134905 135312 gene locus_tag LOCUS_11010 134905 135312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 <137070 135328 gene locus_tag LOCUS_11020 <137070 135328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902259.1:dihydropteroate synthase >Feature sequence07 226 301 gene locus_tag LOCUS_t00210 226 301 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 380 1255 gene locus_tag LOCUS_11030 380 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1707 2270 gene locus_tag LOCUS_11040 1707 2270 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903833.1 protein_id gnl|my_center|LOCUS_11040 2267 2689 gene locus_tag LOCUS_11050 2267 2689 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903834.1 protein_id gnl|my_center|LOCUS_11050 3153 2710 gene locus_tag LOCUS_11060 3153 2710 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903065.1 protein_id gnl|my_center|LOCUS_11060 3658 3194 gene locus_tag LOCUS_11070 3658 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 3657 4457 gene locus_tag LOCUS_11080 3657 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 5031 4474 gene locus_tag LOCUS_11090 5031 4474 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903836.1 protein_id gnl|my_center|LOCUS_11090 5625 5032 gene locus_tag LOCUS_11100 5625 5032 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903837.1 protein_id gnl|my_center|LOCUS_11100 5793 6785 gene locus_tag LOCUS_11110 gene surE 5793 6785 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902899.1 protein_id gnl|my_center|LOCUS_11110 7667 6828 gene locus_tag LOCUS_11120 7667 6828 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338407.1 protein_id gnl|my_center|LOCUS_11120 9034 7760 gene locus_tag LOCUS_11130 9034 7760 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404011.1 protein_id gnl|my_center|LOCUS_11130 10525 9137 gene locus_tag LOCUS_11140 10525 9137 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903838.1 protein_id gnl|my_center|LOCUS_11140 10964 11113 gene locus_tag LOCUS_11150 10964 11113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 11110 11550 gene locus_tag LOCUS_11160 11110 11550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 12042 11575 gene locus_tag LOCUS_11170 12042 11575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 13243 12215 gene locus_tag LOCUS_11180 13243 12215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 13593 13240 gene locus_tag LOCUS_11190 13593 13240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 14155 13595 gene locus_tag LOCUS_11200 14155 13595 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903666.1 protein_id gnl|my_center|LOCUS_11200 14394 15374 gene locus_tag LOCUS_11210 14394 15374 CDS product TIGR01177 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289469.1 protein_id gnl|my_center|LOCUS_11210 16541 15429 gene locus_tag LOCUS_11220 gene ftsY 16541 15429 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903840.1 protein_id gnl|my_center|LOCUS_11220 17022 16546 gene locus_tag LOCUS_11230 17022 16546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 17195 17019 gene locus_tag LOCUS_11240 17195 17019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 18185 17520 gene locus_tag LOCUS_11250 18185 17520 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903842.1 protein_id gnl|my_center|LOCUS_11250 18466 18191 gene locus_tag LOCUS_11260 18466 18191 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903843.1 protein_id gnl|my_center|LOCUS_11260 18619 18467 gene locus_tag LOCUS_11270 18619 18467 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903844.1 protein_id gnl|my_center|LOCUS_11270 18892 19962 gene locus_tag LOCUS_11280 18892 19962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289510.1 protein_id gnl|my_center|LOCUS_11280 20086 21387 gene locus_tag LOCUS_11290 20086 21387 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903671.1 protein_id gnl|my_center|LOCUS_11290 21614 22903 gene locus_tag LOCUS_11300 21614 22903 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903672.1 protein_id gnl|my_center|LOCUS_11300 23803 23201 gene locus_tag LOCUS_11310 gene thpR 23803 23201 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404315.1 protein_id gnl|my_center|LOCUS_11310 23900 24742 gene locus_tag LOCUS_11320 23900 24742 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903845.1 protein_id gnl|my_center|LOCUS_11320 24743 25102 gene locus_tag LOCUS_11330 24743 25102 CDS product DUF424 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903846.1 protein_id gnl|my_center|LOCUS_11330 25206 26489 gene locus_tag LOCUS_11340 25206 26489 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903847.1 protein_id gnl|my_center|LOCUS_11340 26550 26978 gene locus_tag LOCUS_11350 26550 26978 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903848.1 protein_id gnl|my_center|LOCUS_11350 27914 26991 gene locus_tag LOCUS_11360 27914 26991 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902732.1 protein_id gnl|my_center|LOCUS_11360 28314 27904 gene locus_tag LOCUS_11370 28314 27904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 28954 28529 gene locus_tag LOCUS_11380 28954 28529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 29393 28947 gene locus_tag LOCUS_11390 29393 28947 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902731.1 protein_id gnl|my_center|LOCUS_11390 30112 29558 gene locus_tag LOCUS_11400 30112 29558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902733.1 protein_id gnl|my_center|LOCUS_11400 30458 30123 gene locus_tag LOCUS_11410 30458 30123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 31616 30585 gene locus_tag LOCUS_11420 gene radA 31616 30585 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289511.1 protein_id gnl|my_center|LOCUS_11420 32483 31821 gene locus_tag LOCUS_11430 32483 31821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022099.1 protein_id gnl|my_center|LOCUS_11430 33213 32635 gene locus_tag LOCUS_11440 33213 32635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903971.1 protein_id gnl|my_center|LOCUS_11440 34194 33319 gene locus_tag LOCUS_11450 gene htpX 34194 33319 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_11450 34301 35479 gene locus_tag LOCUS_11460 34301 35479 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902524.1 protein_id gnl|my_center|LOCUS_11460 35635 36024 gene locus_tag LOCUS_11470 gene fer2 35635 36024 CDS product ferredoxin Fer2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903707.1 protein_id gnl|my_center|LOCUS_11470 36472 36176 gene locus_tag LOCUS_11480 36472 36176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 37419 36469 gene locus_tag LOCUS_11490 gene gvpL 37419 36469 CDS product gas vesicle protein GvpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890528.1 protein_id gnl|my_center|LOCUS_11490 37724 37416 gene locus_tag LOCUS_11500 gene gvpK 37724 37416 CDS product gas vesicle protein GvpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890527.1 protein_id gnl|my_center|LOCUS_11500 38362 37721 gene locus_tag LOCUS_11510 38362 37721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 39420 38359 gene locus_tag LOCUS_11520 39420 38359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 39911 39417 gene locus_tag LOCUS_11530 gene gvpH 39911 39417 CDS product gas vesicle protein GvpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890524.1 protein_id gnl|my_center|LOCUS_11530 40162 39908 gene locus_tag LOCUS_11540 gene gvpG 40162 39908 CDS product gas vesicle protein GvpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890523.1 protein_id gnl|my_center|LOCUS_11540 40788 40159 gene locus_tag LOCUS_11550 gene gvpF 40788 40159 CDS product gas vesicle protein GvpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890522.1 protein_id gnl|my_center|LOCUS_11550 41040 41270 gene locus_tag LOCUS_11560 41040 41270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 41375 41662 gene locus_tag LOCUS_11570 41375 41662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 41694 42029 gene locus_tag LOCUS_11580 41694 42029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 42086 43120 gene locus_tag LOCUS_11590 42086 43120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 43142 43609 gene locus_tag LOCUS_11600 43142 43609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 43640 44236 gene locus_tag LOCUS_11610 43640 44236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 44347 44736 gene locus_tag LOCUS_11620 44347 44736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 44724 45419 gene locus_tag LOCUS_11630 44724 45419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11630 45491 45904 gene locus_tag LOCUS_11640 45491 45904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 45983 46384 gene locus_tag LOCUS_11650 gene hisI 45983 46384 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903699.1 protein_id gnl|my_center|LOCUS_11650 47072 47482 gene locus_tag LOCUS_11660 47072 47482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11660 48163 47639 gene locus_tag LOCUS_11670 48163 47639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 49685 48309 gene locus_tag LOCUS_11680 gene glmM 49685 48309 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903637.1 protein_id gnl|my_center|LOCUS_11680 49899 51137 gene locus_tag LOCUS_11690 49899 51137 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903876.1 protein_id gnl|my_center|LOCUS_11690 51179 51598 gene locus_tag LOCUS_11700 51179 51598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 51807 52226 gene locus_tag LOCUS_11710 51807 52226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 52571 52239 gene locus_tag LOCUS_11720 52571 52239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 54352 52700 gene locus_tag LOCUS_11730 54352 52700 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903505.1 protein_id gnl|my_center|LOCUS_11730 54667 54359 gene locus_tag LOCUS_11740 54667 54359 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903507.1 protein_id gnl|my_center|LOCUS_11740 56026 54752 gene locus_tag LOCUS_11750 56026 54752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 56628 56098 gene locus_tag LOCUS_11760 56628 56098 CDS product DUF359 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289421.1 protein_id gnl|my_center|LOCUS_11760 56848 56651 gene locus_tag LOCUS_11770 56848 56651 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903509.1 protein_id gnl|my_center|LOCUS_11770 57433 56852 gene locus_tag LOCUS_11780 57433 56852 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903510.1 protein_id gnl|my_center|LOCUS_11780 57821 57435 gene locus_tag LOCUS_11790 57821 57435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903511.1 protein_id gnl|my_center|LOCUS_11790 58968 57829 gene locus_tag LOCUS_11800 58968 57829 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903512.1 protein_id gnl|my_center|LOCUS_11800 59324 60346 gene locus_tag LOCUS_11810 59324 60346 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903937.1 protein_id gnl|my_center|LOCUS_11810 60836 60351 gene locus_tag LOCUS_11820 60836 60351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 62334 61006 gene locus_tag LOCUS_11830 62334 61006 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289527.1 protein_id gnl|my_center|LOCUS_11830 63149 62394 gene locus_tag LOCUS_11840 63149 62394 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903333.1 protein_id gnl|my_center|LOCUS_11840 63349 63981 gene locus_tag LOCUS_11850 gene engB 63349 63981 CDS product GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903933.1 protein_id gnl|my_center|LOCUS_11850 64396 65964 gene locus_tag LOCUS_11860 64396 65964 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903741.1 protein_id gnl|my_center|LOCUS_11860 66605 66036 gene locus_tag LOCUS_11870 66605 66036 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902509.1 protein_id gnl|my_center|LOCUS_11870 66817 67548 gene locus_tag LOCUS_11880 66817 67548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 67933 67592 gene locus_tag LOCUS_11890 67933 67592 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902668.1 protein_id gnl|my_center|LOCUS_11890 68146 68376 gene locus_tag LOCUS_11900 68146 68376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 70402 68519 gene locus_tag LOCUS_11910 70402 68519 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 protein_id gnl|my_center|LOCUS_11910 71573 70608 gene locus_tag LOCUS_11920 71573 70608 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870653.1 protein_id gnl|my_center|LOCUS_11920 71915 71580 gene locus_tag LOCUS_11930 71915 71580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 71857 72027 gene locus_tag LOCUS_11940 71857 72027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 72024 73373 gene locus_tag LOCUS_11950 72024 73373 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021002.1 protein_id gnl|my_center|LOCUS_11950 73598 73374 gene locus_tag LOCUS_11960 73598 73374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 74108 73704 gene locus_tag LOCUS_11970 74108 73704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 74483 74160 gene locus_tag LOCUS_11980 74483 74160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 74535 74714 gene locus_tag LOCUS_11990 74535 74714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 75407 74775 gene locus_tag LOCUS_12000 75407 74775 CDS product dolichol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289491.1 protein_id gnl|my_center|LOCUS_12000 77261 75414 gene locus_tag LOCUS_12010 gene glyS 77261 75414 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903756.1 protein_id gnl|my_center|LOCUS_12010 78117 77263 gene locus_tag LOCUS_12020 78117 77263 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903755.1 protein_id gnl|my_center|LOCUS_12020 81004 78191 gene locus_tag LOCUS_12030 81004 78191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 81143 81322 gene locus_tag LOCUS_12040 81143 81322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 81668 81417 gene locus_tag LOCUS_12050 81668 81417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 81954 83687 gene locus_tag LOCUS_12060 81954 83687 CDS product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903778.1 protein_id gnl|my_center|LOCUS_12060 84547 83870 gene locus_tag LOCUS_12070 gene upp 84547 83870 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903718.1 protein_id gnl|my_center|LOCUS_12070 84737 85651 gene locus_tag LOCUS_12080 gene mdh 84737 85651 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903765.1 protein_id gnl|my_center|LOCUS_12080 85943 86146 gene locus_tag LOCUS_12090 85943 86146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903717.1 protein_id gnl|my_center|LOCUS_12090 86350 86171 gene locus_tag LOCUS_12100 86350 86171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 88501 86420 gene locus_tag LOCUS_12110 88501 86420 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903716.1 protein_id gnl|my_center|LOCUS_12110 89244 88591 gene locus_tag LOCUS_12120 89244 88591 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903713.1 protein_id gnl|my_center|LOCUS_12120 89775 89275 gene locus_tag LOCUS_12130 89775 89275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 90347 89847 gene locus_tag LOCUS_12140 90347 89847 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289478.1 protein_id gnl|my_center|LOCUS_12140 90487 90984 gene locus_tag LOCUS_12150 90487 90984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 90984 91148 gene locus_tag LOCUS_12160 90984 91148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 91815 91225 gene locus_tag LOCUS_12170 gene hisB 91815 91225 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903709.1 protein_id gnl|my_center|LOCUS_12170 91954 92106 gene locus_tag LOCUS_12180 91954 92106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 92890 92165 gene locus_tag LOCUS_12190 gene hisA 92890 92165 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903708.1 protein_id gnl|my_center|LOCUS_12190 92889 93242 gene locus_tag LOCUS_12200 92889 93242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 93343 94470 gene locus_tag LOCUS_12210 93343 94470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 95009 95344 gene locus_tag LOCUS_12220 95009 95344 CDS product DUF5783 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289487.1 protein_id gnl|my_center|LOCUS_12220 95425 95814 gene locus_tag LOCUS_12230 95425 95814 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903744.1 protein_id gnl|my_center|LOCUS_12230 96289 97854 gene locus_tag LOCUS_12240 96289 97854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 98794 97892 gene locus_tag LOCUS_12250 98794 97892 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902504.1 protein_id gnl|my_center|LOCUS_12250 98696 98893 gene locus_tag LOCUS_12260 98696 98893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 99245 98916 gene locus_tag LOCUS_12270 99245 98916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 104490 99418 gene locus_tag LOCUS_12280 104490 99418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 105160 104741 gene locus_tag LOCUS_12290 105160 104741 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903746.1 protein_id gnl|my_center|LOCUS_12290 106741 105416 gene locus_tag LOCUS_12300 gene metX 106741 105416 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289504.1 protein_id gnl|my_center|LOCUS_12300 108105 106738 gene locus_tag LOCUS_12310 108105 106738 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903810.1 protein_id gnl|my_center|LOCUS_12310 108219 109178 gene locus_tag LOCUS_12320 108219 109178 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903775.1 protein_id gnl|my_center|LOCUS_12320 109175 110014 gene locus_tag LOCUS_12330 109175 110014 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903774.1 protein_id gnl|my_center|LOCUS_12330 112438 110222 gene locus_tag LOCUS_12340 gene ligA 112438 110222 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403650.1 protein_id gnl|my_center|LOCUS_12340 113160 112510 gene locus_tag LOCUS_12350 gene serB 113160 112510 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136360913.1 protein_id gnl|my_center|LOCUS_12350 113459 115057 gene locus_tag LOCUS_12360 gene serA 113459 115057 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903813.1 protein_id gnl|my_center|LOCUS_12360 115443 115105 gene locus_tag LOCUS_12370 115443 115105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 116836 115574 gene locus_tag LOCUS_12380 gene thrC 116836 115574 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903816.1 protein_id gnl|my_center|LOCUS_12380 117338 116967 gene locus_tag LOCUS_12390 117338 116967 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871026.1 protein_id gnl|my_center|LOCUS_12390 117713 117411 gene locus_tag LOCUS_12400 117713 117411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 117772 118176 gene locus_tag LOCUS_12410 117772 118176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 118991 118272 gene locus_tag LOCUS_12420 118991 118272 CDS product DUF5828 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903719.1 protein_id gnl|my_center|LOCUS_12420 119363 119737 gene locus_tag LOCUS_12430 119363 119737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 119739 120548 gene locus_tag LOCUS_12440 119739 120548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 120573 120896 gene locus_tag LOCUS_12450 120573 120896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 121484 121047 gene locus_tag LOCUS_12460 121484 121047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 121783 121481 gene locus_tag LOCUS_12470 121783 121481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 123260 121917 gene locus_tag LOCUS_12480 123260 121917 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903735.1 protein_id gnl|my_center|LOCUS_12480 123988 123293 gene locus_tag LOCUS_12490 123988 123293 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903733.1 protein_id gnl|my_center|LOCUS_12490 124728 124357 gene locus_tag LOCUS_12500 124728 124357 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064662.1 protein_id gnl|my_center|LOCUS_12500 126115 124721 gene locus_tag LOCUS_12510 gene amt 126115 124721 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922808.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence08 <1 915 gene locus_tag LOCUS_12520 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902780.1:cell division protein ZapB 1450 1145 gene locus_tag LOCUS_12530 1450 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289276.1 protein_id gnl|my_center|LOCUS_12530 1709 3037 gene locus_tag LOCUS_12540 1709 3037 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902782.1 protein_id gnl|my_center|LOCUS_12540 3119 3310 gene locus_tag LOCUS_12550 3119 3310 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902783.1 protein_id gnl|my_center|LOCUS_12550 3423 4088 gene locus_tag LOCUS_12560 3423 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 5421 4135 gene locus_tag LOCUS_12570 5421 4135 CDS product DR2241 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902784.1 protein_id gnl|my_center|LOCUS_12570 6303 5422 gene locus_tag LOCUS_12580 6303 5422 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902785.1 protein_id gnl|my_center|LOCUS_12580 6655 6404 gene locus_tag LOCUS_12590 6655 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 6809 7330 gene locus_tag LOCUS_12600 6809 7330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 7422 8924 gene locus_tag LOCUS_12610 gene cysS 7422 8924 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902789.1 protein_id gnl|my_center|LOCUS_12610 9236 8949 gene locus_tag LOCUS_12620 9236 8949 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902913.1 protein_id gnl|my_center|LOCUS_12620 9839 9336 gene locus_tag LOCUS_12630 9839 9336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 10126 10458 gene locus_tag LOCUS_12640 10126 10458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 10455 12638 gene locus_tag LOCUS_12650 10455 12638 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902898.1 protein_id gnl|my_center|LOCUS_12650 12750 13802 gene locus_tag LOCUS_12660 12750 13802 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902912.1 protein_id gnl|my_center|LOCUS_12660 14007 14291 gene locus_tag LOCUS_12670 14007 14291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902911.1 protein_id gnl|my_center|LOCUS_12670 15618 14377 gene locus_tag LOCUS_12680 15618 14377 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902498.1 protein_id gnl|my_center|LOCUS_12680 17292 15715 gene locus_tag LOCUS_12690 17292 15715 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869171.1 protein_id gnl|my_center|LOCUS_12690 18369 17422 gene locus_tag LOCUS_12700 18369 17422 CDS product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096549.1 protein_id gnl|my_center|LOCUS_12700 19166 18366 gene locus_tag LOCUS_12710 19166 18366 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024526.1 protein_id gnl|my_center|LOCUS_12710 19238 19615 gene locus_tag LOCUS_12720 19238 19615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 21165 20023 gene locus_tag LOCUS_12730 21165 20023 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902541.1 protein_id gnl|my_center|LOCUS_12730 21735 21232 gene locus_tag LOCUS_12740 21735 21232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 21866 23395 gene locus_tag LOCUS_12750 21866 23395 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902539.1 protein_id gnl|my_center|LOCUS_12750 23439 23726 gene locus_tag LOCUS_12760 23439 23726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 23926 24987 gene locus_tag LOCUS_12770 23926 24987 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479977.1 protein_id gnl|my_center|LOCUS_12770 25597 25412 gene locus_tag LOCUS_12780 25597 25412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 26415 25597 gene locus_tag LOCUS_12790 26415 25597 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_12790 26851 26423 gene locus_tag LOCUS_12800 26851 26423 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902538.1 protein_id gnl|my_center|LOCUS_12800 27383 27159 gene locus_tag LOCUS_12810 27383 27159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902537.1 protein_id gnl|my_center|LOCUS_12810 27640 27455 gene locus_tag LOCUS_12820 27640 27455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 27812 28915 gene locus_tag LOCUS_12830 27812 28915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 29956 28925 gene locus_tag LOCUS_12840 29956 28925 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902535.1 protein_id gnl|my_center|LOCUS_12840 31153 30080 gene locus_tag LOCUS_12850 31153 30080 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902533.1 protein_id gnl|my_center|LOCUS_12850 31707 31255 gene locus_tag LOCUS_12860 31707 31255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 31937 32377 gene locus_tag LOCUS_12870 31937 32377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903208.1 protein_id gnl|my_center|LOCUS_12870 32424 33143 gene locus_tag LOCUS_12880 32424 33143 CDS product DICT sensory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902515.1 protein_id gnl|my_center|LOCUS_12880 33222 34781 gene locus_tag LOCUS_12890 33222 34781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 34778 37309 gene locus_tag LOCUS_12900 34778 37309 CDS product hydrophobe/amphiphile efflux-3 (HAE3) family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878724.1 protein_id gnl|my_center|LOCUS_12900 37674 37318 gene locus_tag LOCUS_12910 37674 37318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 37963 39330 gene locus_tag LOCUS_12920 37963 39330 CDS product phosphopentomutase/phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902636.1 protein_id gnl|my_center|LOCUS_12920 39388 40560 gene locus_tag LOCUS_12930 39388 40560 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902635.1 protein_id gnl|my_center|LOCUS_12930 40750 42414 gene locus_tag LOCUS_12940 40750 42414 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902634.1 protein_id gnl|my_center|LOCUS_12940 42407 43645 gene locus_tag LOCUS_12950 42407 43645 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902633.1 protein_id gnl|my_center|LOCUS_12950 43642 44766 gene locus_tag LOCUS_12960 43642 44766 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902632.1 protein_id gnl|my_center|LOCUS_12960 44941 46311 gene locus_tag LOCUS_12970 44941 46311 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902279.1 protein_id gnl|my_center|LOCUS_12970 47961 46681 gene locus_tag LOCUS_12980 47961 46681 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902278.1 protein_id gnl|my_center|LOCUS_12980 48467 48036 gene locus_tag LOCUS_12990 48467 48036 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903106.1 protein_id gnl|my_center|LOCUS_12990 48835 48530 gene locus_tag LOCUS_13000 48835 48530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 48953 50515 gene locus_tag LOCUS_13010 48953 50515 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902430.1 protein_id gnl|my_center|LOCUS_13010 51573 50617 gene locus_tag LOCUS_13020 51573 50617 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902144.1 protein_id gnl|my_center|LOCUS_13020 51845 52258 gene locus_tag LOCUS_13030 51845 52258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 52282 53061 gene locus_tag LOCUS_13040 52282 53061 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902599.1 protein_id gnl|my_center|LOCUS_13040 54806 53079 gene locus_tag LOCUS_13050 54806 53079 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902600.1 protein_id gnl|my_center|LOCUS_13050 56293 54899 gene locus_tag LOCUS_13060 56293 54899 CDS product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902776.1 protein_id gnl|my_center|LOCUS_13060 57136 56534 gene locus_tag LOCUS_13070 57136 56534 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902777.1 protein_id gnl|my_center|LOCUS_13070 57327 57542 gene locus_tag LOCUS_13080 57327 57542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902778.1 protein_id gnl|my_center|LOCUS_13080 57719 57997 gene locus_tag LOCUS_13090 57719 57997 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902779.1 protein_id gnl|my_center|LOCUS_13090 59215 58235 gene locus_tag LOCUS_13100 59215 58235 CDS product O-acetylserine dependent cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103859.1 protein_id gnl|my_center|LOCUS_13100 59681 59334 gene locus_tag LOCUS_13110 59681 59334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 59828 61012 gene locus_tag LOCUS_13120 59828 61012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 61106 61234 gene locus_tag LOCUS_13130 61106 61234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 62086 61367 gene locus_tag LOCUS_13140 62086 61367 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902530.1 protein_id gnl|my_center|LOCUS_13140 63859 62327 gene locus_tag LOCUS_13150 gene glpK 63859 62327 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903446.1 protein_id gnl|my_center|LOCUS_13150 63945 64160 gene locus_tag LOCUS_13160 63945 64160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 65392 64226 gene locus_tag LOCUS_13170 gene arsB 65392 64226 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876533.1 protein_id gnl|my_center|LOCUS_13170 65930 65385 gene locus_tag LOCUS_13180 65930 65385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 66325 65927 gene locus_tag LOCUS_13190 66325 65927 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008444919.1 protein_id gnl|my_center|LOCUS_13190 66531 66736 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 70021 66824 gene locus_tag LOCUS_13200 gene ileS 70021 66824 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903625.1 protein_id gnl|my_center|LOCUS_13200 70305 72506 gene locus_tag LOCUS_13210 70305 72506 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903073.1 protein_id gnl|my_center|LOCUS_13210 73250 72537 gene locus_tag LOCUS_13220 73250 72537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 73374 73763 gene locus_tag LOCUS_13230 73374 73763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 74174 73887 gene locus_tag LOCUS_13240 74174 73887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 74671 74276 gene locus_tag LOCUS_13250 74671 74276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 75169 74744 gene locus_tag LOCUS_13260 75169 74744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 78246 75436 gene locus_tag LOCUS_13270 78246 75436 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902906.1 protein_id gnl|my_center|LOCUS_13270 79823 78681 gene locus_tag LOCUS_13280 79823 78681 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902627.1 protein_id gnl|my_center|LOCUS_13280 81096 80095 gene locus_tag LOCUS_13290 gene mvaD 81096 80095 CDS product phosphomevalonate decarboxylase MvaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289187.1 protein_id gnl|my_center|LOCUS_13290 82013 81156 gene locus_tag LOCUS_13300 82013 81156 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902470.1 protein_id gnl|my_center|LOCUS_13300 82144 82752 gene locus_tag LOCUS_13310 82144 82752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361096.1 protein_id gnl|my_center|LOCUS_13310 82829 83644 gene locus_tag LOCUS_13320 gene fba1 82829 83644 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902472.1 protein_id gnl|my_center|LOCUS_13320 83644 84498 gene locus_tag LOCUS_13330 83644 84498 CDS product class 1 fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902473.1 protein_id gnl|my_center|LOCUS_13330 84546 84773 gene locus_tag LOCUS_13340 84546 84773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 86961 85075 gene locus_tag LOCUS_13350 86961 85075 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095687.1 protein_id gnl|my_center|LOCUS_13350 87088 88893 gene locus_tag LOCUS_13360 87088 88893 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892595.1 protein_id gnl|my_center|LOCUS_13360 89533 89114 gene locus_tag LOCUS_13370 89533 89114 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081422747.1 protein_id gnl|my_center|LOCUS_13370 90367 89897 gene locus_tag LOCUS_13380 90367 89897 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902425.1 protein_id gnl|my_center|LOCUS_13380 90528 91415 gene locus_tag LOCUS_13390 90528 91415 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289197.1 protein_id gnl|my_center|LOCUS_13390 92308 91463 gene locus_tag LOCUS_13400 92308 91463 CDS product spondin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 protein_id gnl|my_center|LOCUS_13400 92610 93869 gene locus_tag LOCUS_13410 gene gdhA1 92610 93869 CDS product NADP-specific glutamate dehydrogenase GdhA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289198.1 protein_id gnl|my_center|LOCUS_13410 93958 94494 gene locus_tag LOCUS_13420 93958 94494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 95701 94523 gene locus_tag LOCUS_13430 95701 94523 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289408.1 protein_id gnl|my_center|LOCUS_13430 97143 96142 gene locus_tag LOCUS_13440 97143 96142 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978088.1 protein_id gnl|my_center|LOCUS_13440 97420 98082 gene locus_tag LOCUS_13450 97420 98082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 99574 98336 gene locus_tag LOCUS_13460 99574 98336 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902283.1 protein_id gnl|my_center|LOCUS_13460 99861 99637 gene locus_tag LOCUS_13470 99861 99637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 100254 99922 gene locus_tag LOCUS_13480 100254 99922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 100550 100858 gene locus_tag LOCUS_13490 100550 100858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 101368 102096 gene locus_tag LOCUS_13500 gene aglF 101368 102096 CDS product UTP--glucose-1-phosphate uridylyltransferase AglF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901983.1 protein_id gnl|my_center|LOCUS_13500 102170 103156 gene locus_tag LOCUS_13510 102170 103156 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901996.1 protein_id gnl|my_center|LOCUS_13510 104372 103188 gene locus_tag LOCUS_13520 104372 103188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 104894 106852 gene locus_tag LOCUS_13530 104894 106852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 107017 107802 gene locus_tag LOCUS_13540 107017 107802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 109384 107885 gene locus_tag LOCUS_13550 109384 107885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 110246 109401 gene locus_tag LOCUS_13560 110246 109401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 110473 111765 gene locus_tag LOCUS_13570 110473 111765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 112084 111881 gene locus_tag LOCUS_13580 112084 111881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 111996 113465 gene locus_tag LOCUS_13590 111996 113465 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148882924.1 protein_id gnl|my_center|LOCUS_13590 113801 114946 gene locus_tag LOCUS_13600 113801 114946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 116569 115244 gene locus_tag LOCUS_13610 116569 115244 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229166.1 protein_id gnl|my_center|LOCUS_13610 118576 117371 gene locus_tag LOCUS_13620 118576 117371 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957839.1 protein_id gnl|my_center|LOCUS_13620 119573 118599 gene locus_tag LOCUS_13630 119573 118599 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_13630 120192 120809 gene locus_tag LOCUS_13640 120192 120809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence09 788 48 gene locus_tag LOCUS_13650 788 48 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892488.1 protein_id gnl|my_center|LOCUS_13650 1407 829 gene locus_tag LOCUS_13660 1407 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1503 2495 gene locus_tag LOCUS_13670 1503 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 2725 4863 gene locus_tag LOCUS_13680 gene katG 2725 4863 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840174.1 protein_id gnl|my_center|LOCUS_13680 5284 5211 gene locus_tag LOCUS_t00220 5284 5211 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5419 6885 gene locus_tag LOCUS_13690 gene cca 5419 6885 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902052.1 protein_id gnl|my_center|LOCUS_13690 7921 6926 gene locus_tag LOCUS_13700 7921 6926 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902051.1 protein_id gnl|my_center|LOCUS_13700 8364 7924 gene locus_tag LOCUS_13710 8364 7924 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902050.1 protein_id gnl|my_center|LOCUS_13710 10063 8495 gene locus_tag LOCUS_13720 10063 8495 CDS product single-stranded DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902049.1 protein_id gnl|my_center|LOCUS_13720 10627 10121 gene locus_tag LOCUS_13730 10627 10121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 10758 10830 gene locus_tag LOCUS_t00230 10758 10830 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11394 12098 gene locus_tag LOCUS_13740 11394 12098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902048.1 protein_id gnl|my_center|LOCUS_13740 12168 12686 gene locus_tag LOCUS_13750 12168 12686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 13365 12715 gene locus_tag LOCUS_13760 13365 12715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13760 13676 14032 gene locus_tag LOCUS_13770 13676 14032 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902044.1 protein_id gnl|my_center|LOCUS_13770 14198 14635 gene locus_tag LOCUS_13780 14198 14635 CDS product DUF5790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902043.1 protein_id gnl|my_center|LOCUS_13780 15509 14691 gene locus_tag LOCUS_13790 15509 14691 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289098.1 protein_id gnl|my_center|LOCUS_13790 15715 16407 gene locus_tag LOCUS_13800 15715 16407 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289442.1 protein_id gnl|my_center|LOCUS_13800 17052 16585 gene locus_tag LOCUS_13810 17052 16585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289443.1 protein_id gnl|my_center|LOCUS_13810 18356 17049 gene locus_tag LOCUS_13820 18356 17049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903587.1 protein_id gnl|my_center|LOCUS_13820 18494 19795 gene locus_tag LOCUS_13830 18494 19795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903588.1 protein_id gnl|my_center|LOCUS_13830 19919 20710 gene locus_tag LOCUS_13840 19919 20710 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903589.1 protein_id gnl|my_center|LOCUS_13840 20707 21660 gene locus_tag LOCUS_13850 20707 21660 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903590.1 protein_id gnl|my_center|LOCUS_13850 22062 21685 gene locus_tag LOCUS_13860 22062 21685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 22334 23176 gene locus_tag LOCUS_13870 22334 23176 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903592.1 protein_id gnl|my_center|LOCUS_13870 24060 23401 gene locus_tag LOCUS_13880 24060 23401 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904091.1 protein_id gnl|my_center|LOCUS_13880 25305 24439 gene locus_tag LOCUS_13890 25305 24439 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902307.1 protein_id gnl|my_center|LOCUS_13890 27071 25302 gene locus_tag LOCUS_13900 27071 25302 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902308.1 protein_id gnl|my_center|LOCUS_13900 27371 27997 gene locus_tag LOCUS_13910 27371 27997 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902309.1 protein_id gnl|my_center|LOCUS_13910 29473 28127 gene locus_tag LOCUS_13920 29473 28127 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902151.1 protein_id gnl|my_center|LOCUS_13920 29663 30097 gene locus_tag LOCUS_13930 29663 30097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 30234 30662 gene locus_tag LOCUS_13940 30234 30662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 32038 30674 gene locus_tag LOCUS_13950 32038 30674 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903549.1 protein_id gnl|my_center|LOCUS_13950 33227 32541 gene locus_tag LOCUS_13960 33227 32541 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903563.1 protein_id gnl|my_center|LOCUS_13960 34205 33366 gene locus_tag LOCUS_13970 34205 33366 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903562.1 protein_id gnl|my_center|LOCUS_13970 34448 34996 gene locus_tag LOCUS_13980 34448 34996 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289436.1 protein_id gnl|my_center|LOCUS_13980 35214 35768 gene locus_tag LOCUS_13990 gene pyrE 35214 35768 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903560.1 protein_id gnl|my_center|LOCUS_13990 35883 36596 gene locus_tag LOCUS_14000 35883 36596 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903559.1 protein_id gnl|my_center|LOCUS_14000 36780 38204 gene locus_tag LOCUS_14010 36780 38204 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903558.1 protein_id gnl|my_center|LOCUS_14010 38311 39723 gene locus_tag LOCUS_14020 38311 39723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 40061 40366 gene locus_tag LOCUS_14030 40061 40366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 40353 42512 gene locus_tag LOCUS_14040 40353 42512 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903584.1 protein_id gnl|my_center|LOCUS_14040 42653 42970 gene locus_tag LOCUS_14050 42653 42970 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289441.1 protein_id gnl|my_center|LOCUS_14050 42992 43576 gene locus_tag LOCUS_14060 42992 43576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 43569 44621 gene locus_tag LOCUS_14070 43569 44621 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903581.1 protein_id gnl|my_center|LOCUS_14070 44618 44941 gene locus_tag LOCUS_14080 44618 44941 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903580.1 protein_id gnl|my_center|LOCUS_14080 44946 46709 gene locus_tag LOCUS_14090 44946 46709 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903579.1 protein_id gnl|my_center|LOCUS_14090 46713 48140 gene locus_tag LOCUS_14100 46713 48140 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903578.1 protein_id gnl|my_center|LOCUS_14100 48516 49232 gene locus_tag LOCUS_14110 48516 49232 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903575.1 protein_id gnl|my_center|LOCUS_14110 49580 49777 gene locus_tag LOCUS_14120 49580 49777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 51097 49841 gene locus_tag LOCUS_14130 gene prf1 51097 49841 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289438.1 protein_id gnl|my_center|LOCUS_14130 51275 52489 gene locus_tag LOCUS_14140 51275 52489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 52184 52195 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 54559 52679 gene locus_tag LOCUS_14150 gene argS 54559 52679 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064797.1 protein_id gnl|my_center|LOCUS_14150 54739 55512 gene locus_tag LOCUS_14160 54739 55512 CDS product DUF120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289437.1 protein_id gnl|my_center|LOCUS_14160 55509 56183 gene locus_tag LOCUS_14170 gene ribB 55509 56183 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903567.1 protein_id gnl|my_center|LOCUS_14170 57933 56491 gene locus_tag LOCUS_14180 57933 56491 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903565.1 protein_id gnl|my_center|LOCUS_14180 58195 59127 gene locus_tag LOCUS_14190 58195 59127 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903564.1 protein_id gnl|my_center|LOCUS_14190 60495 59419 gene locus_tag LOCUS_14200 gene meaB 60495 59419 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902463.1 protein_id gnl|my_center|LOCUS_14200 60917 60495 gene locus_tag LOCUS_14210 60917 60495 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902462.1 protein_id gnl|my_center|LOCUS_14210 62210 61056 gene locus_tag LOCUS_14220 62210 61056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 62476 62691 gene locus_tag LOCUS_14230 62476 62691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 62688 63083 gene locus_tag LOCUS_14240 62688 63083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 65305 63455 gene locus_tag LOCUS_14250 65305 63455 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_14250 65430 66491 gene locus_tag LOCUS_14260 65430 66491 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902258.1 protein_id gnl|my_center|LOCUS_14260 66831 67397 gene locus_tag LOCUS_14270 66831 67397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 68828 67770 gene locus_tag LOCUS_14280 68828 67770 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249732.1 protein_id gnl|my_center|LOCUS_14280 69042 69305 gene locus_tag LOCUS_14290 69042 69305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 69500 70018 gene locus_tag LOCUS_14300 69500 70018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14300 71120 70140 gene locus_tag LOCUS_14310 gene kdgK1 71120 70140 CDS product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902071.1 protein_id gnl|my_center|LOCUS_14310 73675 71255 gene locus_tag LOCUS_14320 73675 71255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 74810 73857 gene locus_tag LOCUS_14330 74810 73857 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902019.1 protein_id gnl|my_center|LOCUS_14330 74987 76057 gene locus_tag LOCUS_14340 74987 76057 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902020.1 protein_id gnl|my_center|LOCUS_14340 76648 76130 gene locus_tag LOCUS_14350 76648 76130 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084126250.1 protein_id gnl|my_center|LOCUS_14350 77899 76667 gene locus_tag LOCUS_14360 gene pgk 77899 76667 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064339.1 protein_id gnl|my_center|LOCUS_14360 80277 78346 gene locus_tag LOCUS_14370 80277 78346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902041.1 protein_id gnl|my_center|LOCUS_14370 80849 80388 gene locus_tag LOCUS_14380 80849 80388 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902040.1 protein_id gnl|my_center|LOCUS_14380 80965 81038 gene locus_tag LOCUS_t00240 80965 81038 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 81365 81940 gene locus_tag LOCUS_14390 81365 81940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 82001 82074 gene locus_tag LOCUS_t00250 82001 82074 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 83305 82931 gene locus_tag LOCUS_14400 83305 82931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 83520 83302 gene locus_tag LOCUS_14410 83520 83302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 84024 83521 gene locus_tag LOCUS_14420 84024 83521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 84623 85018 gene locus_tag LOCUS_14430 84623 85018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 85018 86520 gene locus_tag LOCUS_14440 85018 86520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 86680 87000 gene locus_tag LOCUS_14450 86680 87000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 87173 87493 gene locus_tag LOCUS_14460 87173 87493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 87808 88317 gene locus_tag LOCUS_14470 87808 88317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 88761 88567 gene locus_tag LOCUS_14480 88761 88567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 89987 88971 gene locus_tag LOCUS_14490 89987 88971 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902703.1 protein_id gnl|my_center|LOCUS_14490 90586 90855 gene locus_tag LOCUS_14500 90586 90855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 91426 91851 gene locus_tag LOCUS_14510 91426 91851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530034.1 protein_id gnl|my_center|LOCUS_14510 92220 92414 gene locus_tag LOCUS_14520 92220 92414 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289092.1 protein_id gnl|my_center|LOCUS_14520 92642 93451 gene locus_tag LOCUS_14530 gene nucS 92642 93451 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250849.1 protein_id gnl|my_center|LOCUS_14530 93659 94168 gene locus_tag LOCUS_14540 93659 94168 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902023.1 protein_id gnl|my_center|LOCUS_14540 94375 95526 gene locus_tag LOCUS_14550 94375 95526 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902466.1 protein_id gnl|my_center|LOCUS_14550 95523 95918 gene locus_tag LOCUS_14560 95523 95918 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902465.1 protein_id gnl|my_center|LOCUS_14560 96536 95973 gene locus_tag LOCUS_14570 96536 95973 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289387.1 protein_id gnl|my_center|LOCUS_14570 97621 96650 gene locus_tag LOCUS_14580 97621 96650 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289638.1 protein_id gnl|my_center|LOCUS_14580 97995 97849 gene locus_tag LOCUS_14590 97995 97849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 98083 98493 gene locus_tag LOCUS_14600 98083 98493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 98582 99442 gene locus_tag LOCUS_14610 98582 99442 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124123.1 protein_id gnl|my_center|LOCUS_14610 100129 99659 gene locus_tag LOCUS_14620 100129 99659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14620 101241 100546 gene locus_tag LOCUS_14630 101241 100546 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361074.1 protein_id gnl|my_center|LOCUS_14630 101413 101922 gene locus_tag LOCUS_14640 101413 101922 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289138.1 protein_id gnl|my_center|LOCUS_14640 102044 102409 gene locus_tag LOCUS_14650 102044 102409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 102701 105433 gene locus_tag LOCUS_14660 gene mutS 102701 105433 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902076.1 protein_id gnl|my_center|LOCUS_14660 105636 105475 gene locus_tag LOCUS_14670 105636 105475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 105765 107120 gene locus_tag LOCUS_14680 105765 107120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 107123 107320 gene locus_tag LOCUS_14690 107123 107320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 107324 107632 gene locus_tag LOCUS_14700 107324 107632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 108339 107659 gene locus_tag LOCUS_14710 108339 107659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 109031 108336 gene locus_tag LOCUS_14720 109031 108336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 109280 110545 gene locus_tag LOCUS_14730 109280 110545 CDS product Single-stranded DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289299.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence10 634 170 gene locus_tag LOCUS_14740 634 170 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902552.1 protein_id gnl|my_center|LOCUS_14740 918 989 gene locus_tag LOCUS_t00260 918 989 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1236 1658 gene locus_tag LOCUS_14750 1236 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1788 3524 gene locus_tag LOCUS_14760 1788 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 4313 3561 gene locus_tag LOCUS_14770 4313 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 4756 4310 gene locus_tag LOCUS_14780 4756 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 5387 4749 gene locus_tag LOCUS_14790 5387 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 5311 5823 gene locus_tag LOCUS_14800 5311 5823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 6338 5748 gene locus_tag LOCUS_14810 6338 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 6877 6332 gene locus_tag LOCUS_14820 6877 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 8919 6874 gene locus_tag LOCUS_14830 8919 6874 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878495.1 protein_id gnl|my_center|LOCUS_14830 11934 8920 gene locus_tag LOCUS_14840 11934 8920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 12497 12424 gene locus_tag LOCUS_t00270 12497 12424 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12878 12546 gene locus_tag LOCUS_14850 12878 12546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 13124 14005 gene locus_tag LOCUS_14860 13124 14005 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289227.1 protein_id gnl|my_center|LOCUS_14860 14122 15537 gene locus_tag LOCUS_14870 14122 15537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 15499 15428 gene locus_tag LOCUS_t00280 15499 15428 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 16551 15586 gene locus_tag LOCUS_14880 16551 15586 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063174092.1 protein_id gnl|my_center|LOCUS_14880 19471 16673 gene locus_tag LOCUS_14890 19471 16673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 21142 19475 gene locus_tag LOCUS_14900 21142 19475 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289232.1 protein_id gnl|my_center|LOCUS_14900 21757 21224 gene locus_tag LOCUS_14910 21757 21224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 21911 22384 gene locus_tag LOCUS_14920 21911 22384 CDS product DUF5793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902637.1 protein_id gnl|my_center|LOCUS_14920 22891 22397 gene locus_tag LOCUS_14930 22891 22397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 23012 23737 gene locus_tag LOCUS_14940 23012 23737 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289213.1 protein_id gnl|my_center|LOCUS_14940 24605 23925 gene locus_tag LOCUS_14950 24605 23925 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892481.1 protein_id gnl|my_center|LOCUS_14950 24759 25775 gene locus_tag LOCUS_14960 24759 25775 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902489.1 protein_id gnl|my_center|LOCUS_14960 25831 26139 gene locus_tag LOCUS_14970 25831 26139 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902601.1 protein_id gnl|my_center|LOCUS_14970 27002 26175 gene locus_tag LOCUS_14980 gene hisF 27002 26175 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902602.1 protein_id gnl|my_center|LOCUS_14980 27096 27254 gene locus_tag LOCUS_14990 27096 27254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 28604 27282 gene locus_tag LOCUS_15000 28604 27282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 30933 28684 gene locus_tag LOCUS_15010 gene purL 30933 28684 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902605.1 protein_id gnl|my_center|LOCUS_15010 31783 32604 gene locus_tag LOCUS_15020 gene cas6 31783 32604 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870746.1 protein_id gnl|my_center|LOCUS_15020 32601 34799 gene locus_tag LOCUS_15030 32601 34799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 34796 35926 gene locus_tag LOCUS_15040 gene cas7b 34796 35926 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_15040 35926 36744 gene locus_tag LOCUS_15050 35926 36744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 36761 39436 gene locus_tag LOCUS_15060 36761 39436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 39433 40002 gene locus_tag LOCUS_15070 gene cas4 39433 40002 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023578.1 protein_id gnl|my_center|LOCUS_15070 40006 40998 gene locus_tag LOCUS_15080 gene cas1b 40006 40998 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545291.1 protein_id gnl|my_center|LOCUS_15080 40999 41259 gene locus_tag LOCUS_15090 gene cas2 40999 41259 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202914.1 protein_id gnl|my_center|LOCUS_15090 41357 50475 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gattcagacgaacccttgtggggttgaagt 50599 51288 gene locus_tag LOCUS_15100 50599 51288 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289241.1 protein_id gnl|my_center|LOCUS_15100 51288 52412 gene locus_tag LOCUS_15110 51288 52412 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902607.1 protein_id gnl|my_center|LOCUS_15110 53101 52601 gene locus_tag LOCUS_15120 53101 52601 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902608.1 protein_id gnl|my_center|LOCUS_15120 54196 53210 gene locus_tag LOCUS_15130 54196 53210 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_15130 54789 54436 gene locus_tag LOCUS_15140 54789 54436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 54776 56038 gene locus_tag LOCUS_15150 gene gatA 54776 56038 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902611.1 protein_id gnl|my_center|LOCUS_15150 56196 56519 gene locus_tag LOCUS_15160 56196 56519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 56516 57034 gene locus_tag LOCUS_15170 56516 57034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 57129 58454 gene locus_tag LOCUS_15180 57129 58454 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902557.1 protein_id gnl|my_center|LOCUS_15180 58845 58552 gene locus_tag LOCUS_15190 58845 58552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 59214 60311 gene locus_tag LOCUS_15200 59214 60311 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902643.1 protein_id gnl|my_center|LOCUS_15200 61565 61023 gene locus_tag LOCUS_15210 61565 61023 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289184.1 protein_id gnl|my_center|LOCUS_15210 61701 62852 gene locus_tag LOCUS_15220 61701 62852 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903905.1 protein_id gnl|my_center|LOCUS_15220 62932 64080 gene locus_tag LOCUS_15230 62932 64080 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903913.1 protein_id gnl|my_center|LOCUS_15230 64077 65009 gene locus_tag LOCUS_15240 64077 65009 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903907.1 protein_id gnl|my_center|LOCUS_15240 65103 66017 gene locus_tag LOCUS_15250 65103 66017 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207504.1 protein_id gnl|my_center|LOCUS_15250 66259 65909 gene locus_tag LOCUS_15260 66259 65909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 66458 68518 gene locus_tag LOCUS_15270 66458 68518 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902041.1 protein_id gnl|my_center|LOCUS_15270 68822 69997 gene locus_tag LOCUS_15280 gene coaBC 68822 69997 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902383.1 protein_id gnl|my_center|LOCUS_15280 70126 71214 gene locus_tag LOCUS_15290 70126 71214 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902382.1 protein_id gnl|my_center|LOCUS_15290 71211 71486 gene locus_tag LOCUS_15300 71211 71486 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902381.1 protein_id gnl|my_center|LOCUS_15300 71486 71890 gene locus_tag LOCUS_15310 gene mnhG 71486 71890 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902380.1 protein_id gnl|my_center|LOCUS_15310 71887 72420 gene locus_tag LOCUS_15320 71887 72420 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902379.1 protein_id gnl|my_center|LOCUS_15320 72417 72932 gene locus_tag LOCUS_15330 72417 72932 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902378.1 protein_id gnl|my_center|LOCUS_15330 72929 73285 gene locus_tag LOCUS_15340 72929 73285 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902377.1 protein_id gnl|my_center|LOCUS_15340 73278 74804 gene locus_tag LOCUS_15350 73278 74804 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289183.1 protein_id gnl|my_center|LOCUS_15350 74837 76516 gene locus_tag LOCUS_15360 74837 76516 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902375.1 protein_id gnl|my_center|LOCUS_15360 76516 78276 gene locus_tag LOCUS_15370 76516 78276 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902374.1 protein_id gnl|my_center|LOCUS_15370 78357 78923 gene locus_tag LOCUS_15380 gene hpt 78357 78923 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902373.1 protein_id gnl|my_center|LOCUS_15380 79005 79403 gene locus_tag LOCUS_15390 79005 79403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 79537 79782 gene locus_tag LOCUS_15400 79537 79782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 79784 80323 gene locus_tag LOCUS_15410 79784 80323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 80658 80398 gene locus_tag LOCUS_15420 80658 80398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 81236 80772 gene locus_tag LOCUS_15430 81236 80772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 81708 81229 gene locus_tag LOCUS_15440 81708 81229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 83100 81712 gene locus_tag LOCUS_15450 83100 81712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15450 84227 83070 gene locus_tag LOCUS_15460 84227 83070 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230097.1 protein_id gnl|my_center|LOCUS_15460 85197 84235 gene locus_tag LOCUS_15470 85197 84235 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385788.1 protein_id gnl|my_center|LOCUS_15470 86186 85197 gene locus_tag LOCUS_15480 86186 85197 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385787.1 protein_id gnl|my_center|LOCUS_15480 88387 86327 gene locus_tag LOCUS_15490 88387 86327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 88896 88621 gene locus_tag LOCUS_15500 88896 88621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 89049 89744 gene locus_tag LOCUS_15510 89049 89744 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902372.1 protein_id gnl|my_center|LOCUS_15510 90077 89787 gene locus_tag LOCUS_15520 90077 89787 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902241.1 protein_id gnl|my_center|LOCUS_15520 90200 91168 gene locus_tag LOCUS_15530 90200 91168 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289150.1 protein_id gnl|my_center|LOCUS_15530 91987 91232 gene locus_tag LOCUS_15540 91987 91232 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902243.1 protein_id gnl|my_center|LOCUS_15540 93071 92088 gene locus_tag LOCUS_15550 93071 92088 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902295.1 protein_id gnl|my_center|LOCUS_15550 93746 93186 gene locus_tag LOCUS_15560 93746 93186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 94259 93915 gene locus_tag LOCUS_15570 94259 93915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 94966 94322 gene locus_tag LOCUS_15580 94966 94322 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902287.1 protein_id gnl|my_center|LOCUS_15580 96027 94963 gene locus_tag LOCUS_15590 96027 94963 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902286.1 protein_id gnl|my_center|LOCUS_15590 97065 96304 gene locus_tag LOCUS_15600 gene psmA 97065 96304 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902078.1 protein_id gnl|my_center|LOCUS_15600 97614 97072 gene locus_tag LOCUS_15610 97614 97072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 98292 97630 gene locus_tag LOCUS_15620 98292 97630 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902927.1 protein_id gnl|my_center|LOCUS_15620 99022 98273 gene locus_tag LOCUS_15630 99022 98273 CDS product RNase P subunit p30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289302.1 protein_id gnl|my_center|LOCUS_15630 101601 99019 gene locus_tag LOCUS_15640 gene folP 101601 99019 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902259.1 protein_id gnl|my_center|LOCUS_15640 102938 101790 gene locus_tag LOCUS_15650 102938 101790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 104654 103065 gene locus_tag LOCUS_15660 104654 103065 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289152.1 protein_id gnl|my_center|LOCUS_15660 104832 106226 gene locus_tag LOCUS_15670 gene purB 104832 106226 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289153.1 protein_id gnl|my_center|LOCUS_15670 106775 106230 gene locus_tag LOCUS_15680 106775 106230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 107271 106864 gene locus_tag LOCUS_15690 107271 106864 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902769.1 protein_id gnl|my_center|LOCUS_15690 108012 107281 gene locus_tag LOCUS_15700 108012 107281 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328055.1 protein_id gnl|my_center|LOCUS_15700 109306 108080 gene locus_tag LOCUS_15710 109306 108080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 110268 109303 gene locus_tag LOCUS_15720 gene dapF 110268 109303 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878250.1 protein_id gnl|my_center|LOCUS_15720 <111105 110265 gene locus_tag LOCUS_15730 <111105 110265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876948.1:diaminopimelate decarboxylase >Feature sequence11 <1 888 gene locus_tag LOCUS_15740 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902632.1:ABC transporter permease 1055 1417 gene locus_tag LOCUS_15750 1055 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1368 3086 gene locus_tag LOCUS_15760 1368 3086 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867667.1 protein_id gnl|my_center|LOCUS_15760 3153 4121 gene locus_tag LOCUS_15770 3153 4121 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970281.1 protein_id gnl|my_center|LOCUS_15770 4459 4097 gene locus_tag LOCUS_15780 4459 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 4718 7030 gene locus_tag LOCUS_15790 4718 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 7023 8954 gene locus_tag LOCUS_15800 7023 8954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 8951 9694 gene locus_tag LOCUS_15810 8951 9694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 9691 10173 gene locus_tag LOCUS_15820 9691 10173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 10170 10766 gene locus_tag LOCUS_15830 10170 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 10759 11223 gene locus_tag LOCUS_15840 10759 11223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 11220 11768 gene locus_tag LOCUS_15850 11220 11768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 12018 12338 gene locus_tag LOCUS_15860 12018 12338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 14145 12412 gene locus_tag LOCUS_15870 14145 12412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 15000 14350 gene locus_tag LOCUS_15880 15000 14350 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904091.1 protein_id gnl|my_center|LOCUS_15880 16447 15002 gene locus_tag LOCUS_15890 16447 15002 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904092.1 protein_id gnl|my_center|LOCUS_15890 16703 17380 gene locus_tag LOCUS_15900 16703 17380 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904091.1 protein_id gnl|my_center|LOCUS_15900 17710 17420 gene locus_tag LOCUS_15910 17710 17420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 17752 18054 gene locus_tag LOCUS_15920 17752 18054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 18562 19155 gene locus_tag LOCUS_15930 18562 19155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 19152 20171 gene locus_tag LOCUS_15940 19152 20171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 20150 20374 gene locus_tag LOCUS_15950 20150 20374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 20371 22407 gene locus_tag LOCUS_15960 20371 22407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 22404 23855 gene locus_tag LOCUS_15970 22404 23855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 23979 26792 gene locus_tag LOCUS_15980 23979 26792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 26789 28675 gene locus_tag LOCUS_15990 26789 28675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229290.1 protein_id gnl|my_center|LOCUS_15990 29245 29033 gene locus_tag LOCUS_16000 29245 29033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 30012 29713 gene locus_tag LOCUS_16010 30012 29713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 30398 30015 gene locus_tag LOCUS_16020 30398 30015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 30790 30506 gene locus_tag LOCUS_16030 30790 30506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 31867 31037 gene locus_tag LOCUS_16040 gene hop 31867 31037 CDS product halorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902090.1 protein_id gnl|my_center|LOCUS_16040 32366 32722 gene locus_tag LOCUS_16050 32366 32722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 33245 32712 gene locus_tag LOCUS_16060 33245 32712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 33882 33340 gene locus_tag LOCUS_16070 33882 33340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 34203 34057 gene locus_tag LOCUS_16080 34203 34057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 35095 34358 gene locus_tag LOCUS_16090 35095 34358 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902346.1 protein_id gnl|my_center|LOCUS_16090 35489 35797 gene locus_tag LOCUS_16100 35489 35797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 36618 35824 gene locus_tag LOCUS_16110 36618 35824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 37299 36697 gene locus_tag LOCUS_16120 37299 36697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 38003 37296 gene locus_tag LOCUS_16130 38003 37296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 37356 37403 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38114 38233 gene locus_tag LOCUS_16140 38114 38233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 39714 38269 gene locus_tag LOCUS_16150 39714 38269 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_16150 40255 39995 gene locus_tag LOCUS_16160 40255 39995 CDS product DUF3194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902128.1 protein_id gnl|my_center|LOCUS_16160 40699 40259 gene locus_tag LOCUS_16170 40699 40259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 41079 40696 gene locus_tag LOCUS_16180 41079 40696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 41224 41090 gene locus_tag LOCUS_16190 41224 41090 CDS product DNA-directed RNA polymerase subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902130.1 protein_id gnl|my_center|LOCUS_16190 41539 41243 gene locus_tag LOCUS_16200 41539 41243 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289127.1 protein_id gnl|my_center|LOCUS_16200 42437 41667 gene locus_tag LOCUS_16210 42437 41667 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902133.1 protein_id gnl|my_center|LOCUS_16210 43710 42592 gene locus_tag LOCUS_16220 43710 42592 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_16220 45252 43864 gene locus_tag LOCUS_16230 gene truD 45252 43864 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902134.1 protein_id gnl|my_center|LOCUS_16230 45596 45252 gene locus_tag LOCUS_16240 gene pth2 45596 45252 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902135.1 protein_id gnl|my_center|LOCUS_16240 45799 46176 gene locus_tag LOCUS_16250 45799 46176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 46235 46951 gene locus_tag LOCUS_16260 46235 46951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 47014 49107 gene locus_tag LOCUS_16270 47014 49107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 49104 50210 gene locus_tag LOCUS_16280 49104 50210 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902138.1 protein_id gnl|my_center|LOCUS_16280 50213 50581 gene locus_tag LOCUS_16290 50213 50581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 51088 50930 gene locus_tag LOCUS_16300 51088 50930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177170774.1 protein_id gnl|my_center|LOCUS_16300 51253 52284 gene locus_tag LOCUS_16310 51253 52284 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903696.1 protein_id gnl|my_center|LOCUS_16310 53303 52347 gene locus_tag LOCUS_16320 53303 52347 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904143.1 protein_id gnl|my_center|LOCUS_16320 53518 54453 gene locus_tag LOCUS_16330 53518 54453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 54484 55635 gene locus_tag LOCUS_16340 54484 55635 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403699.1 protein_id gnl|my_center|LOCUS_16340 56397 55663 gene locus_tag LOCUS_16350 gene fabG 56397 55663 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888576.1 protein_id gnl|my_center|LOCUS_16350 56514 57209 gene locus_tag LOCUS_16360 56514 57209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 57140 57562 gene locus_tag LOCUS_16370 57140 57562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 58223 57672 gene locus_tag LOCUS_16380 58223 57672 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630611.1 protein_id gnl|my_center|LOCUS_16380 59294 58428 gene locus_tag LOCUS_16390 59294 58428 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902141.1 protein_id gnl|my_center|LOCUS_16390 60275 59364 gene locus_tag LOCUS_16400 60275 59364 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902142.1 protein_id gnl|my_center|LOCUS_16400 62021 60717 gene locus_tag LOCUS_16410 gene aspS 62021 60717 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_16410 62379 62113 gene locus_tag LOCUS_16420 62379 62113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 63272 62544 gene locus_tag LOCUS_16430 63272 62544 CDS product putative phosphoglycerol geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902143.1 protein_id gnl|my_center|LOCUS_16430 63716 63528 gene locus_tag LOCUS_16440 63716 63528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 65751 63931 gene locus_tag LOCUS_16450 65751 63931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16450 68135 66657 gene locus_tag LOCUS_16460 68135 66657 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867262.1 protein_id gnl|my_center|LOCUS_16460 68291 69061 gene locus_tag LOCUS_16470 68291 69061 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289098.1 protein_id gnl|my_center|LOCUS_16470 69278 69586 gene locus_tag LOCUS_16480 69278 69586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 71524 69626 gene locus_tag LOCUS_16490 71524 69626 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_16490 73231 71765 gene locus_tag LOCUS_16500 gene gatB 73231 71765 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902210.1 protein_id gnl|my_center|LOCUS_16500 73380 73742 gene locus_tag LOCUS_16510 73380 73742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 74034 73804 gene locus_tag LOCUS_16520 74034 73804 CDS product H/ACA ribonucleoprotein complex subunit GAR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902991.1 protein_id gnl|my_center|LOCUS_16520 74319 74038 gene locus_tag LOCUS_16530 gene srp19 74319 74038 CDS product signal recognition particle subunit SRP19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902992.1 protein_id gnl|my_center|LOCUS_16530 75672 74467 gene locus_tag LOCUS_16540 75672 74467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 75731 76864 gene locus_tag LOCUS_16550 gene btuC 75731 76864 CDS product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902994.1 protein_id gnl|my_center|LOCUS_16550 76861 77802 gene locus_tag LOCUS_16560 76861 77802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 77833 78762 gene locus_tag LOCUS_16570 77833 78762 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902803.1 protein_id gnl|my_center|LOCUS_16570 78838 78911 gene locus_tag LOCUS_t00290 78838 78911 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 79823 79254 gene locus_tag LOCUS_16580 79823 79254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 80497 79988 gene locus_tag LOCUS_16590 80497 79988 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902895.1 protein_id gnl|my_center|LOCUS_16590 80862 81674 gene locus_tag LOCUS_16600 gene dph5 80862 81674 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289280.1 protein_id gnl|my_center|LOCUS_16600 82164 81745 gene locus_tag LOCUS_16610 82164 81745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 82436 82161 gene locus_tag LOCUS_16620 82436 82161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289087.1 protein_id gnl|my_center|LOCUS_16620 83497 82487 gene locus_tag LOCUS_16630 gene artA 83497 82487 CDS product archaeosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904000.1 protein_id gnl|my_center|LOCUS_16630 83995 83564 gene locus_tag LOCUS_16640 83995 83564 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289742.1 protein_id gnl|my_center|LOCUS_16640 84267 83995 gene locus_tag LOCUS_16650 84267 83995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 84878 84423 gene locus_tag LOCUS_16660 84878 84423 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902004.1 protein_id gnl|my_center|LOCUS_16660 85237 84875 gene locus_tag LOCUS_16670 85237 84875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 85978 85676 gene locus_tag LOCUS_16680 85978 85676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 86352 86110 gene locus_tag LOCUS_16690 86352 86110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 89221 86585 gene locus_tag LOCUS_16700 89221 86585 CDS product type I secretion C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205886.1 protein_id gnl|my_center|LOCUS_16700 89704 89985 gene locus_tag LOCUS_16710 89704 89985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 90124 90393 gene locus_tag LOCUS_16720 90124 90393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 92672 90561 gene locus_tag LOCUS_16730 92672 90561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 93096 93431 gene locus_tag LOCUS_16740 93096 93431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 93503 94387 gene locus_tag LOCUS_16750 93503 94387 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403067.1 protein_id gnl|my_center|LOCUS_16750 94705 94520 gene locus_tag LOCUS_16760 94705 94520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 95712 94960 gene locus_tag LOCUS_16770 95712 94960 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902800.1 protein_id gnl|my_center|LOCUS_16770 96553 95783 gene locus_tag LOCUS_16780 gene azf 96553 95783 CDS product NAD-dependent glucose-6-phosphate dehydrogenase Azf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289099.1 protein_id gnl|my_center|LOCUS_16780 98042 96633 gene locus_tag LOCUS_16790 98042 96633 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223941.1 protein_id gnl|my_center|LOCUS_16790 98202 100058 gene locus_tag LOCUS_16800 98202 100058 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027969.1 protein_id gnl|my_center|LOCUS_16800 100318 100620 gene locus_tag LOCUS_16810 100318 100620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 101032 100628 gene locus_tag LOCUS_16820 101032 100628 CDS product TIGR04206 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902799.1 protein_id gnl|my_center|LOCUS_16820 102210 101101 gene locus_tag LOCUS_16830 102210 101101 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902798.1 protein_id gnl|my_center|LOCUS_16830 102431 102631 gene locus_tag LOCUS_16840 102431 102631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902797.1 protein_id gnl|my_center|LOCUS_16840 102840 104111 gene locus_tag LOCUS_16850 102840 104111 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421552.1 protein_id gnl|my_center|LOCUS_16850 104253 104630 gene locus_tag LOCUS_16860 104253 104630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070807656.1 protein_id gnl|my_center|LOCUS_16860 104717 105214 gene locus_tag LOCUS_16870 104717 105214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 105309 107081 gene locus_tag LOCUS_16880 gene ctaD 105309 107081 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902450.1 protein_id gnl|my_center|LOCUS_16880 107456 107854 gene locus_tag LOCUS_16890 107456 107854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 108009 108410 gene locus_tag LOCUS_16900 108009 108410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 108512 109654 gene locus_tag LOCUS_16910 108512 109654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence12 730 107 gene locus_tag LOCUS_16920 730 107 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929042.1 protein_id gnl|my_center|LOCUS_16920 1614 922 gene locus_tag LOCUS_16930 1614 922 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942652.1 protein_id gnl|my_center|LOCUS_16930 2336 1611 gene locus_tag LOCUS_16940 2336 1611 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_16940 2596 3450 gene locus_tag LOCUS_16950 2596 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 3581 4399 gene locus_tag LOCUS_16960 3581 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 4723 4439 gene locus_tag LOCUS_16970 gene petF1 4723 4439 CDS product ferredoxin PetF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056851.1 protein_id gnl|my_center|LOCUS_16970 5208 4723 gene locus_tag LOCUS_16980 5208 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 5485 5264 gene locus_tag LOCUS_16990 5485 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 6243 5482 gene locus_tag LOCUS_17000 6243 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 6452 6240 gene locus_tag LOCUS_17010 6452 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 6820 6449 gene locus_tag LOCUS_17020 6820 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 7799 6846 gene locus_tag LOCUS_17030 gene paaA 7799 6846 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969774.1 protein_id gnl|my_center|LOCUS_17030 8695 7922 gene locus_tag LOCUS_17040 8695 7922 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 protein_id gnl|my_center|LOCUS_17040 9297 10058 gene locus_tag LOCUS_17050 9297 10058 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976206.1 protein_id gnl|my_center|LOCUS_17050 10137 11360 gene locus_tag LOCUS_17060 10137 11360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 11840 12607 gene locus_tag LOCUS_17070 11840 12607 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226844.1 protein_id gnl|my_center|LOCUS_17070 12729 14282 gene locus_tag LOCUS_17080 12729 14282 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282029.1 protein_id gnl|my_center|LOCUS_17080 15751 14342 gene locus_tag LOCUS_17090 15751 14342 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814037.1 protein_id gnl|my_center|LOCUS_17090 15945 17345 gene locus_tag LOCUS_17100 15945 17345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17100 17342 18070 gene locus_tag LOCUS_17110 17342 18070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 18063 18464 gene locus_tag LOCUS_17120 18063 18464 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086198.1 protein_id gnl|my_center|LOCUS_17120 18540 18716 gene locus_tag LOCUS_17130 18540 18716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 18816 19901 gene locus_tag LOCUS_17140 gene gtdA 18816 19901 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131688.1 protein_id gnl|my_center|LOCUS_17140 20067 21218 gene locus_tag LOCUS_17150 gene pdhA 20067 21218 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535910.1 protein_id gnl|my_center|LOCUS_17150 21221 22186 gene locus_tag LOCUS_17160 21221 22186 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289463.1 protein_id gnl|my_center|LOCUS_17160 22942 23250 gene locus_tag LOCUS_17170 22942 23250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 23326 24072 gene locus_tag LOCUS_17180 23326 24072 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727461.1 protein_id gnl|my_center|LOCUS_17180 24073 24867 gene locus_tag LOCUS_17190 24073 24867 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886451.1 protein_id gnl|my_center|LOCUS_17190 24858 25406 gene locus_tag LOCUS_17200 24858 25406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17200 25403 25588 gene locus_tag LOCUS_17210 25403 25588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 26608 25733 gene locus_tag LOCUS_17220 26608 25733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 26788 28281 gene locus_tag LOCUS_17230 26788 28281 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903877.1 protein_id gnl|my_center|LOCUS_17230 28699 28373 gene locus_tag LOCUS_17240 28699 28373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 28963 29592 gene locus_tag LOCUS_17250 28963 29592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904053.1 protein_id gnl|my_center|LOCUS_17250 29667 31607 gene locus_tag LOCUS_17260 29667 31607 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135662706.1 protein_id gnl|my_center|LOCUS_17260 31696 32253 gene locus_tag LOCUS_17270 31696 32253 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902741.1 protein_id gnl|my_center|LOCUS_17270 32250 33869 gene locus_tag LOCUS_17280 32250 33869 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902740.1 protein_id gnl|my_center|LOCUS_17280 33967 35145 gene locus_tag LOCUS_17290 33967 35145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289248.1 protein_id gnl|my_center|LOCUS_17290 35138 36355 gene locus_tag LOCUS_17300 35138 36355 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902651.1 protein_id gnl|my_center|LOCUS_17300 36486 37946 gene locus_tag LOCUS_17310 36486 37946 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902650.1 protein_id gnl|my_center|LOCUS_17310 37939 39183 gene locus_tag LOCUS_17320 37939 39183 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902649.1 protein_id gnl|my_center|LOCUS_17320 39184 41574 gene locus_tag LOCUS_17330 39184 41574 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902648.1 protein_id gnl|my_center|LOCUS_17330 42322 41624 gene locus_tag LOCUS_17340 42322 41624 CDS product dolichyl-phosphate hexose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902647.1 protein_id gnl|my_center|LOCUS_17340 43556 42375 gene locus_tag LOCUS_17350 43556 42375 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902524.1 protein_id gnl|my_center|LOCUS_17350 44379 43582 gene locus_tag LOCUS_17360 44379 43582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 46209 45124 gene locus_tag LOCUS_17370 gene trmB 46209 45124 CDS product transcriptional regulator TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892507.1 protein_id gnl|my_center|LOCUS_17370 46300 47757 gene locus_tag LOCUS_17380 46300 47757 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_17380 48065 49423 gene locus_tag LOCUS_17390 48065 49423 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972955.1 protein_id gnl|my_center|LOCUS_17390 49443 50405 gene locus_tag LOCUS_17400 49443 50405 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013848.1 protein_id gnl|my_center|LOCUS_17400 50406 51332 gene locus_tag LOCUS_17410 50406 51332 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314872.1 protein_id gnl|my_center|LOCUS_17410 55202 51714 gene locus_tag LOCUS_17420 55202 51714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 55433 55747 gene locus_tag LOCUS_17430 55433 55747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 56199 56029 gene locus_tag LOCUS_17440 56199 56029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 56986 56426 gene locus_tag LOCUS_17450 56986 56426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 57215 58081 gene locus_tag LOCUS_17460 57215 58081 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_17460 58189 59010 gene locus_tag LOCUS_17470 58189 59010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 61807 59069 gene locus_tag LOCUS_17480 61807 59069 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902357.1 protein_id gnl|my_center|LOCUS_17480 62247 61804 gene locus_tag LOCUS_17490 62247 61804 CDS product DUF1850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902358.1 protein_id gnl|my_center|LOCUS_17490 63426 62401 gene locus_tag LOCUS_17500 63426 62401 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902359.1 protein_id gnl|my_center|LOCUS_17500 64564 64025 gene locus_tag LOCUS_17510 64564 64025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 65072 65383 gene locus_tag LOCUS_17520 65072 65383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 65971 67239 gene locus_tag LOCUS_17530 65971 67239 CDS product orc1/cdc6 family replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289079.1 protein_id gnl|my_center|LOCUS_17530 67559 67882 gene locus_tag LOCUS_17540 67559 67882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 68148 68600 gene locus_tag LOCUS_17550 68148 68600 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023176053.1 protein_id gnl|my_center|LOCUS_17550 68981 68640 gene locus_tag LOCUS_17560 68981 68640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 69410 70090 gene locus_tag LOCUS_17570 gene cbiM 69410 70090 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 protein_id gnl|my_center|LOCUS_17570 70090 70413 gene locus_tag LOCUS_17580 70090 70413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 70416 71228 gene locus_tag LOCUS_17590 70416 71228 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733033.1 protein_id gnl|my_center|LOCUS_17590 71225 72100 gene locus_tag LOCUS_17600 71225 72100 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870600.1 protein_id gnl|my_center|LOCUS_17600 72445 72789 gene locus_tag LOCUS_17610 72445 72789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 73385 74284 gene locus_tag LOCUS_17620 73385 74284 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289610.1 protein_id gnl|my_center|LOCUS_17620 74284 74733 gene locus_tag LOCUS_17630 74284 74733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 75022 76938 gene locus_tag LOCUS_17640 75022 76938 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902249.1 protein_id gnl|my_center|LOCUS_17640 77201 77800 gene locus_tag LOCUS_17650 77201 77800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 77893 78597 gene locus_tag LOCUS_17660 77893 78597 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_17660 78889 79122 gene locus_tag LOCUS_17670 78889 79122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 79369 81483 gene locus_tag LOCUS_17680 79369 81483 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902665.1 protein_id gnl|my_center|LOCUS_17680 81480 82550 gene locus_tag LOCUS_17690 81480 82550 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902666.1 protein_id gnl|my_center|LOCUS_17690 83151 82753 gene locus_tag LOCUS_17700 83151 82753 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890426.1 protein_id gnl|my_center|LOCUS_17700 83295 83480 gene locus_tag LOCUS_17710 83295 83480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 83482 84252 gene locus_tag LOCUS_17720 83482 84252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 84249 84593 gene locus_tag LOCUS_17730 84249 84593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 84701 85246 gene locus_tag LOCUS_17740 gene cbiT 84701 85246 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903131.1 protein_id gnl|my_center|LOCUS_17740 85475 85876 gene locus_tag LOCUS_17750 85475 85876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 85873 86778 gene locus_tag LOCUS_17760 85873 86778 CDS product cobalt-precorrin-4/precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903133.1 protein_id gnl|my_center|LOCUS_17760 86806 87822 gene locus_tag LOCUS_17770 gene cbiG 86806 87822 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903134.1 protein_id gnl|my_center|LOCUS_17770 87819 88709 gene locus_tag LOCUS_17780 87819 88709 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903135.1 protein_id gnl|my_center|LOCUS_17780 88725 89759 gene locus_tag LOCUS_17790 gene cobJ 88725 89759 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903136.1 protein_id gnl|my_center|LOCUS_17790 89761 90027 gene locus_tag LOCUS_17800 89761 90027 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903137.1 protein_id gnl|my_center|LOCUS_17800 90364 90672 gene locus_tag LOCUS_17810 90364 90672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17810 90669 91898 gene locus_tag LOCUS_17820 90669 91898 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289353.1 protein_id gnl|my_center|LOCUS_17820 91895 92263 gene locus_tag LOCUS_17830 91895 92263 CDS product DUF3209 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903140.1 protein_id gnl|my_center|LOCUS_17830 92244 93659 gene locus_tag LOCUS_17840 92244 93659 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903141.1 protein_id gnl|my_center|LOCUS_17840 <94432 93808 gene locus_tag LOCUS_17850 <94432 93808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903142.1:VWA domain-containing protein >Feature sequence13 161 850 gene locus_tag LOCUS_17860 161 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 1318 878 gene locus_tag LOCUS_17870 1318 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 2150 1380 gene locus_tag LOCUS_17880 2150 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2711 2196 gene locus_tag LOCUS_17890 2711 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 4643 2877 gene locus_tag LOCUS_17900 gene arcS 4643 2877 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903438.1 protein_id gnl|my_center|LOCUS_17900 6321 4840 gene locus_tag LOCUS_17910 gene tgtA 6321 4840 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903439.1 protein_id gnl|my_center|LOCUS_17910 7394 6561 gene locus_tag LOCUS_17920 7394 6561 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902216.1 protein_id gnl|my_center|LOCUS_17920 8110 7502 gene locus_tag LOCUS_17930 8110 7502 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903441.1 protein_id gnl|my_center|LOCUS_17930 9529 8162 gene locus_tag LOCUS_17940 9529 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 10082 9585 gene locus_tag LOCUS_17950 10082 9585 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903443.1 protein_id gnl|my_center|LOCUS_17950 10233 11171 gene locus_tag LOCUS_17960 10233 11171 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942615.1 protein_id gnl|my_center|LOCUS_17960 11468 11193 gene locus_tag LOCUS_17970 11468 11193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 11769 12119 gene locus_tag LOCUS_17980 11769 12119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 12364 13431 gene locus_tag LOCUS_17990 12364 13431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 13749 13676 gene locus_tag LOCUS_t00300 13749 13676 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 14430 13840 gene locus_tag LOCUS_18000 gene trmY 14430 13840 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903455.1 protein_id gnl|my_center|LOCUS_18000 14643 16331 gene locus_tag LOCUS_18010 14643 16331 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_18010 16416 17414 gene locus_tag LOCUS_18020 16416 17414 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810095.1 protein_id gnl|my_center|LOCUS_18020 17416 18456 gene locus_tag LOCUS_18030 17416 18456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 18456 19652 gene locus_tag LOCUS_18040 18456 19652 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_18040 19645 20925 gene locus_tag LOCUS_18050 19645 20925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 21487 21008 gene locus_tag LOCUS_18060 21487 21008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 23080 21590 gene locus_tag LOCUS_18070 23080 21590 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189272.1 protein_id gnl|my_center|LOCUS_18070 23425 24159 gene locus_tag LOCUS_18080 23425 24159 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902069.1 protein_id gnl|my_center|LOCUS_18080 25535 24186 gene locus_tag LOCUS_18090 25535 24186 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902386.1 protein_id gnl|my_center|LOCUS_18090 25682 25972 gene locus_tag LOCUS_18100 25682 25972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 27619 26390 gene locus_tag LOCUS_18110 27619 26390 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817351.1 protein_id gnl|my_center|LOCUS_18110 27998 28162 gene locus_tag LOCUS_18120 27998 28162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 28311 28655 gene locus_tag LOCUS_18130 28311 28655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 28853 30325 gene locus_tag LOCUS_18140 28853 30325 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903457.1 protein_id gnl|my_center|LOCUS_18140 30329 31012 gene locus_tag LOCUS_18150 gene rnhB 30329 31012 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903458.1 protein_id gnl|my_center|LOCUS_18150 31433 31041 gene locus_tag LOCUS_18160 31433 31041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 31663 31430 gene locus_tag LOCUS_18170 31663 31430 CDS product antitoxin VapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878975.1 protein_id gnl|my_center|LOCUS_18170 33359 31797 gene locus_tag LOCUS_18180 33359 31797 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903461.1 protein_id gnl|my_center|LOCUS_18180 34234 33356 gene locus_tag LOCUS_18190 gene secF 34234 33356 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903462.1 protein_id gnl|my_center|LOCUS_18190 34366 34677 gene locus_tag LOCUS_18200 34366 34677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 35439 34873 gene locus_tag LOCUS_18210 35439 34873 CDS product DUF5812 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903463.1 protein_id gnl|my_center|LOCUS_18210 36192 35662 gene locus_tag LOCUS_18220 36192 35662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903464.1 protein_id gnl|my_center|LOCUS_18220 36320 37603 gene locus_tag LOCUS_18230 36320 37603 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903465.1 protein_id gnl|my_center|LOCUS_18230 37605 38348 gene locus_tag LOCUS_18240 37605 38348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 38906 38448 gene locus_tag LOCUS_18250 38906 38448 CDS product NOB1 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289414.1 protein_id gnl|my_center|LOCUS_18250 39151 38906 gene locus_tag LOCUS_18260 39151 38906 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903468.1 protein_id gnl|my_center|LOCUS_18260 39393 41207 gene locus_tag LOCUS_18270 gene infB 39393 41207 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903469.1 protein_id gnl|my_center|LOCUS_18270 41376 41636 gene locus_tag LOCUS_18280 41376 41636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 42159 41698 gene locus_tag LOCUS_18290 42159 41698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 42720 42238 gene locus_tag LOCUS_18300 42720 42238 CDS product pyruvoyl-dependent arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903471.1 protein_id gnl|my_center|LOCUS_18300 44381 43200 gene locus_tag LOCUS_18310 44381 43200 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903472.1 protein_id gnl|my_center|LOCUS_18310 46451 44649 gene locus_tag LOCUS_18320 gene pepF 46451 44649 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289415.1 protein_id gnl|my_center|LOCUS_18320 46619 47887 gene locus_tag LOCUS_18330 46619 47887 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103627.1 protein_id gnl|my_center|LOCUS_18330 48021 48569 gene locus_tag LOCUS_18340 48021 48569 CDS product DUF2243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878720.1 protein_id gnl|my_center|LOCUS_18340 48653 49981 gene locus_tag LOCUS_18350 48653 49981 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903474.1 protein_id gnl|my_center|LOCUS_18350 51052 50018 gene locus_tag LOCUS_18360 gene truA 51052 50018 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903475.1 protein_id gnl|my_center|LOCUS_18360 52648 51332 gene locus_tag LOCUS_18370 gene hisS 52648 51332 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_18370 53297 52707 gene locus_tag LOCUS_18380 53297 52707 CDS product alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903477.1 protein_id gnl|my_center|LOCUS_18380 53658 53305 gene locus_tag LOCUS_18390 53658 53305 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903478.1 protein_id gnl|my_center|LOCUS_18390 54245 53790 gene locus_tag LOCUS_18400 54245 53790 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903479.1 protein_id gnl|my_center|LOCUS_18400 56046 54592 gene locus_tag LOCUS_18410 56046 54592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 57777 56803 gene locus_tag LOCUS_18420 57777 56803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 58104 59009 gene locus_tag LOCUS_18430 gene thiL 58104 59009 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903480.1 protein_id gnl|my_center|LOCUS_18430 60191 59058 gene locus_tag LOCUS_18440 60191 59058 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903481.1 protein_id gnl|my_center|LOCUS_18440 60659 60399 gene locus_tag LOCUS_18450 60659 60399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903482.1 protein_id gnl|my_center|LOCUS_18450 61758 60949 gene locus_tag LOCUS_18460 61758 60949 CDS product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289090.1 protein_id gnl|my_center|LOCUS_18460 62532 61822 gene locus_tag LOCUS_18470 62532 61822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907663.1 protein_id gnl|my_center|LOCUS_18470 62692 63396 gene locus_tag LOCUS_18480 gene pyrH 62692 63396 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903483.1 protein_id gnl|my_center|LOCUS_18480 63393 65093 gene locus_tag LOCUS_18490 gene lysS 63393 65093 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903484.1 protein_id gnl|my_center|LOCUS_18490 65324 65944 gene locus_tag LOCUS_18500 65324 65944 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903486.1 protein_id gnl|my_center|LOCUS_18500 67763 66024 gene locus_tag LOCUS_18510 67763 66024 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903485.1 protein_id gnl|my_center|LOCUS_18510 68137 69492 gene locus_tag LOCUS_18520 68137 69492 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903487.1 protein_id gnl|my_center|LOCUS_18520 69609 71195 gene locus_tag LOCUS_18530 69609 71195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 71501 71307 gene locus_tag LOCUS_18540 71501 71307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 72572 71508 gene locus_tag LOCUS_18550 72572 71508 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903488.1 protein_id gnl|my_center|LOCUS_18550 72721 77596 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcagacgaacccttgtggggttgaagc 77868 78239 gene locus_tag LOCUS_18560 77868 78239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 78220 78651 gene locus_tag LOCUS_18570 78220 78651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 78989 79564 gene locus_tag LOCUS_18580 78989 79564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 80086 79889 gene locus_tag LOCUS_18590 80086 79889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 80807 80832 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence14 1070 1279 gene locus_tag LOCUS_18600 1070 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 2145 1384 gene locus_tag LOCUS_18610 2145 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289326.1 protein_id gnl|my_center|LOCUS_18610 2307 2981 gene locus_tag LOCUS_18620 2307 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 3033 3944 gene locus_tag LOCUS_18630 3033 3944 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903034.1 protein_id gnl|my_center|LOCUS_18630 4665 4135 gene locus_tag LOCUS_18640 4665 4135 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902542.1 protein_id gnl|my_center|LOCUS_18640 5146 4658 gene locus_tag LOCUS_18650 5146 4658 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902543.1 protein_id gnl|my_center|LOCUS_18650 5266 7182 gene locus_tag LOCUS_18660 5266 7182 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064996.1 protein_id gnl|my_center|LOCUS_18660 7846 7226 gene locus_tag LOCUS_18670 7846 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 8001 8221 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8875 9114 gene locus_tag LOCUS_18680 8875 9114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 10569 9199 gene locus_tag LOCUS_18690 10569 9199 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902546.1 protein_id gnl|my_center|LOCUS_18690 10671 11522 gene locus_tag LOCUS_18700 10671 11522 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289249.1 protein_id gnl|my_center|LOCUS_18700 11609 12196 gene locus_tag LOCUS_18710 gene dpsA 11609 12196 CDS product DNA starvation/stationary phase protection protein DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903826.1 protein_id gnl|my_center|LOCUS_18710 13426 12590 gene locus_tag LOCUS_18720 13426 12590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545019.1 protein_id gnl|my_center|LOCUS_18720 13559 14656 gene locus_tag LOCUS_18730 13559 14656 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902659.1 protein_id gnl|my_center|LOCUS_18730 14852 15814 gene locus_tag LOCUS_18740 14852 15814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 16207 15815 gene locus_tag LOCUS_18750 16207 15815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 16648 16214 gene locus_tag LOCUS_18760 16648 16214 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902658.1 protein_id gnl|my_center|LOCUS_18760 17802 16645 gene locus_tag LOCUS_18770 17802 16645 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902657.1 protein_id gnl|my_center|LOCUS_18770 17953 18366 gene locus_tag LOCUS_18780 17953 18366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 18856 19125 gene locus_tag LOCUS_18790 18856 19125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902467.1 protein_id gnl|my_center|LOCUS_18790 20572 19178 gene locus_tag LOCUS_18800 20572 19178 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902866.1 protein_id gnl|my_center|LOCUS_18800 20702 21691 gene locus_tag LOCUS_18810 20702 21691 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903094.1 protein_id gnl|my_center|LOCUS_18810 21961 21740 gene locus_tag LOCUS_18820 21961 21740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 22341 21961 gene locus_tag LOCUS_18830 22341 21961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 22472 22858 gene locus_tag LOCUS_18840 22472 22858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289331.1 protein_id gnl|my_center|LOCUS_18840 25974 23017 gene locus_tag LOCUS_18850 25974 23017 CDS product intein-containing RctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870187.1 protein_id gnl|my_center|LOCUS_18850 27143 26010 gene locus_tag LOCUS_18860 27143 26010 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903058.1 protein_id gnl|my_center|LOCUS_18860 27684 27223 gene locus_tag LOCUS_18870 27684 27223 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289332.1 protein_id gnl|my_center|LOCUS_18870 27946 28419 gene locus_tag LOCUS_18880 27946 28419 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892508.1 protein_id gnl|my_center|LOCUS_18880 30095 28986 gene locus_tag LOCUS_18890 30095 28986 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963343.1 protein_id gnl|my_center|LOCUS_18890 30240 31412 gene locus_tag LOCUS_18900 30240 31412 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902843.1 protein_id gnl|my_center|LOCUS_18900 31590 32630 gene locus_tag LOCUS_18910 gene asd 31590 32630 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903044.1 protein_id gnl|my_center|LOCUS_18910 32858 32679 gene locus_tag LOCUS_18920 32858 32679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 33363 33040 gene locus_tag LOCUS_18930 33363 33040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 33510 34220 gene locus_tag LOCUS_18940 33510 34220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 34796 34245 gene locus_tag LOCUS_18950 34796 34245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 35251 34793 gene locus_tag LOCUS_18960 35251 34793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 37123 35345 gene locus_tag LOCUS_18970 37123 35345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 40320 37288 gene locus_tag LOCUS_18980 40320 37288 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903811.1 protein_id gnl|my_center|LOCUS_18980 40560 40985 gene locus_tag LOCUS_18990 40560 40985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 41368 41739 gene locus_tag LOCUS_19000 41368 41739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 41841 43145 gene locus_tag LOCUS_19010 41841 43145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 43233 43949 gene locus_tag LOCUS_19020 43233 43949 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162828730.1 protein_id gnl|my_center|LOCUS_19020 44105 44968 gene locus_tag LOCUS_19030 44105 44968 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289328.1 protein_id gnl|my_center|LOCUS_19030 45106 45636 gene locus_tag LOCUS_19040 45106 45636 CDS product multiprotein-bridging factor 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903083.1 protein_id gnl|my_center|LOCUS_19040 45933 47141 gene locus_tag LOCUS_19050 45933 47141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 48483 47170 gene locus_tag LOCUS_19060 48483 47170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 48622 49785 gene locus_tag LOCUS_19070 48622 49785 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903082.1 protein_id gnl|my_center|LOCUS_19070 49782 50339 gene locus_tag LOCUS_19080 49782 50339 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289340.1 protein_id gnl|my_center|LOCUS_19080 50597 50364 gene locus_tag LOCUS_19090 50597 50364 CDS product DUF5822 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289339.1 protein_id gnl|my_center|LOCUS_19090 50739 51551 gene locus_tag LOCUS_19100 gene panB 50739 51551 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903078.1 protein_id gnl|my_center|LOCUS_19100 52311 51706 gene locus_tag LOCUS_19110 52311 51706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 52560 52808 gene locus_tag LOCUS_19120 52560 52808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 52805 55063 gene locus_tag LOCUS_19130 52805 55063 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903073.1 protein_id gnl|my_center|LOCUS_19130 55556 55269 gene locus_tag LOCUS_19140 55556 55269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 55720 55938 gene locus_tag LOCUS_19150 55720 55938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 57121 56051 gene locus_tag LOCUS_19160 57121 56051 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902811.1 protein_id gnl|my_center|LOCUS_19160 57291 58277 gene locus_tag LOCUS_19170 gene moaA 57291 58277 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289091.1 protein_id gnl|my_center|LOCUS_19170 58496 59065 gene locus_tag LOCUS_19180 58496 59065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 59179 59472 gene locus_tag LOCUS_19190 59179 59472 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902842.1 protein_id gnl|my_center|LOCUS_19190 59588 59782 gene locus_tag LOCUS_19200 59588 59782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 59784 60068 gene locus_tag LOCUS_19210 59784 60068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 61529 60507 gene locus_tag LOCUS_19220 61529 60507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 63367 62036 gene locus_tag LOCUS_19230 63367 62036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 63432 63788 gene locus_tag LOCUS_19240 63432 63788 CDS product RNA polymerase Rpb4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902841.1 protein_id gnl|my_center|LOCUS_19240 63881 64537 gene locus_tag LOCUS_19250 63881 64537 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902840.1 protein_id gnl|my_center|LOCUS_19250 65921 64614 gene locus_tag LOCUS_19260 65921 64614 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289074.1 protein_id gnl|my_center|LOCUS_19260 66174 67034 gene locus_tag LOCUS_19270 66174 67034 CDS product 16S ribosomal RNA methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902839.1 protein_id gnl|my_center|LOCUS_19270 67031 68284 gene locus_tag LOCUS_19280 67031 68284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 68277 68921 gene locus_tag LOCUS_19290 68277 68921 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902837.1 protein_id gnl|my_center|LOCUS_19290 68983 69996 gene locus_tag LOCUS_19300 68983 69996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902836.1 protein_id gnl|my_center|LOCUS_19300 69993 71075 gene locus_tag LOCUS_19310 69993 71075 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_19310 71227 71607 gene locus_tag LOCUS_19320 71227 71607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 71700 72437 gene locus_tag LOCUS_19330 71700 72437 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229505.1 protein_id gnl|my_center|LOCUS_19330 >Feature sequence15 1111 2628 gene locus_tag LOCUS_19340 1111 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 2688 3329 gene locus_tag LOCUS_19350 2688 3329 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809593.1 protein_id gnl|my_center|LOCUS_19350 4355 3459 gene locus_tag LOCUS_19360 gene larE 4355 3459 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_19360 4692 6653 gene locus_tag LOCUS_19370 4692 6653 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903687.1 protein_id gnl|my_center|LOCUS_19370 7341 6724 gene locus_tag LOCUS_19380 7341 6724 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902509.1 protein_id gnl|my_center|LOCUS_19380 7630 8757 gene locus_tag LOCUS_19390 7630 8757 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903688.1 protein_id gnl|my_center|LOCUS_19390 9234 8905 gene locus_tag LOCUS_19400 9234 8905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 9427 10443 gene locus_tag LOCUS_19410 9427 10443 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903660.1 protein_id gnl|my_center|LOCUS_19410 10709 10530 gene locus_tag LOCUS_19420 10709 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 10963 11253 gene locus_tag LOCUS_19430 gene eif1A 10963 11253 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903658.1 protein_id gnl|my_center|LOCUS_19430 11377 12333 gene locus_tag LOCUS_19440 gene rio1 11377 12333 CDS product serine/threonine-protein kinase Rio1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289466.1 protein_id gnl|my_center|LOCUS_19440 12460 13023 gene locus_tag LOCUS_19450 12460 13023 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903653.1 protein_id gnl|my_center|LOCUS_19450 13225 14913 gene locus_tag LOCUS_19460 gene thsA 13225 14913 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892611.1 protein_id gnl|my_center|LOCUS_19460 15486 15091 gene locus_tag LOCUS_19470 15486 15091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 15561 15695 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15770 17134 gene locus_tag LOCUS_19480 15770 17134 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525361.1 protein_id gnl|my_center|LOCUS_19480 17437 18480 gene locus_tag LOCUS_19490 17437 18480 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903958.1 protein_id gnl|my_center|LOCUS_19490 18979 19854 gene locus_tag LOCUS_19500 18979 19854 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227916.1 protein_id gnl|my_center|LOCUS_19500 19918 20892 gene locus_tag LOCUS_19510 19918 20892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 21148 21074 gene locus_tag LOCUS_t00310 21148 21074 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21953 21372 gene locus_tag LOCUS_19520 21953 21372 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903910.1 protein_id gnl|my_center|LOCUS_19520 23013 22060 gene locus_tag LOCUS_19530 23013 22060 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903908.1 protein_id gnl|my_center|LOCUS_19530 23169 24263 gene locus_tag LOCUS_19540 23169 24263 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903903.1 protein_id gnl|my_center|LOCUS_19540 24267 24734 gene locus_tag LOCUS_19550 24267 24734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 24909 25073 gene locus_tag LOCUS_19560 24909 25073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 25211 26308 gene locus_tag LOCUS_19570 gene priL 25211 26308 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903675.1 protein_id gnl|my_center|LOCUS_19570 26658 26455 gene locus_tag LOCUS_19580 26658 26455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 26795 27568 gene locus_tag LOCUS_19590 26795 27568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 27602 28447 gene locus_tag LOCUS_19600 27602 28447 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043780833.1 protein_id gnl|my_center|LOCUS_19600 28942 28454 gene locus_tag LOCUS_19610 gene hjc 28942 28454 CDS product Holliday junction resolvase Hjc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903673.1 protein_id gnl|my_center|LOCUS_19610 30702 29719 gene locus_tag LOCUS_19620 30702 29719 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903663.1 protein_id gnl|my_center|LOCUS_19620 31947 30802 gene locus_tag LOCUS_19630 31947 30802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 32082 33014 gene locus_tag LOCUS_19640 gene rnz 32082 33014 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903662.1 protein_id gnl|my_center|LOCUS_19640 33119 35092 gene locus_tag LOCUS_19650 33119 35092 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903661.1 protein_id gnl|my_center|LOCUS_19650 35941 35783 gene locus_tag LOCUS_19660 35941 35783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19660 37763 36150 gene locus_tag LOCUS_19670 37763 36150 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903647.1 protein_id gnl|my_center|LOCUS_19670 38764 37766 gene locus_tag LOCUS_19680 38764 37766 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289463.1 protein_id gnl|my_center|LOCUS_19680 39879 38761 gene locus_tag LOCUS_19690 gene pdhA 39879 38761 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535910.1 protein_id gnl|my_center|LOCUS_19690 41164 40172 gene locus_tag LOCUS_19700 gene lipA 41164 40172 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903644.1 protein_id gnl|my_center|LOCUS_19700 42160 42561 gene locus_tag LOCUS_19710 42160 42561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19710 44771 42684 gene locus_tag LOCUS_19720 gene uvrB 44771 42684 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903784.1 protein_id gnl|my_center|LOCUS_19720 45034 45306 gene locus_tag LOCUS_19730 45034 45306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 46088 45459 gene locus_tag LOCUS_19740 46088 45459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903785.1 protein_id gnl|my_center|LOCUS_19740 46954 46085 gene locus_tag LOCUS_19750 46954 46085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 46923 47270 gene locus_tag LOCUS_19760 46923 47270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 47577 47299 gene locus_tag LOCUS_19770 47577 47299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 47485 47751 gene locus_tag LOCUS_19780 47485 47751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 47886 47902 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48811 47942 gene locus_tag LOCUS_19790 48811 47942 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289496.1 protein_id gnl|my_center|LOCUS_19790 49063 49845 gene locus_tag LOCUS_19800 49063 49845 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903787.1 protein_id gnl|my_center|LOCUS_19800 49927 51099 gene locus_tag LOCUS_19810 49927 51099 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903788.1 protein_id gnl|my_center|LOCUS_19810 51096 52817 gene locus_tag LOCUS_19820 51096 52817 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903789.1 protein_id gnl|my_center|LOCUS_19820 53310 53467 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 53630 53935 gene locus_tag LOCUS_19830 53630 53935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 54062 55603 gene locus_tag LOCUS_19840 54062 55603 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048142299.1 protein_id gnl|my_center|LOCUS_19840 56350 55658 gene locus_tag LOCUS_19850 56350 55658 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289497.1 protein_id gnl|my_center|LOCUS_19850 56564 56992 gene locus_tag LOCUS_19860 56564 56992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 58744 57146 gene locus_tag LOCUS_19870 58744 57146 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289503.1 protein_id gnl|my_center|LOCUS_19870 59029 59874 gene locus_tag LOCUS_19880 59029 59874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 61711 60053 gene locus_tag LOCUS_19890 gene orc7 61711 60053 CDS product DNA replication protein Orc7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903800.1 protein_id gnl|my_center|LOCUS_19890 63175 63816 gene locus_tag LOCUS_19900 63175 63816 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289501.1 protein_id gnl|my_center|LOCUS_19900 63816 64202 gene locus_tag LOCUS_19910 63816 64202 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289500.1 protein_id gnl|my_center|LOCUS_19910 64361 64765 gene locus_tag LOCUS_19920 64361 64765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19920 65170 66681 gene locus_tag LOCUS_19930 65170 66681 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903796.1 protein_id gnl|my_center|LOCUS_19930 66911 67831 gene locus_tag LOCUS_19940 66911 67831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903794.1 protein_id gnl|my_center|LOCUS_19940 68485 67901 gene locus_tag LOCUS_19950 68485 67901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289498.1 protein_id gnl|my_center|LOCUS_19950 69749 68568 gene locus_tag LOCUS_19960 69749 68568 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903772.1 protein_id gnl|my_center|LOCUS_19960 70639 69926 gene locus_tag LOCUS_19970 70639 69926 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903770.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence16 622 17 gene locus_tag LOCUS_19980 622 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 621 1298 gene locus_tag LOCUS_19990 621 1298 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289219.1 protein_id gnl|my_center|LOCUS_19990 1299 1970 gene locus_tag LOCUS_20000 1299 1970 CDS product DUF2110 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902528.1 protein_id gnl|my_center|LOCUS_20000 1978 2796 gene locus_tag LOCUS_20010 1978 2796 CDS product DUF5803 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902529.1 protein_id gnl|my_center|LOCUS_20010 2846 3577 gene locus_tag LOCUS_20020 2846 3577 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902495.1 protein_id gnl|my_center|LOCUS_20020 3898 3596 gene locus_tag LOCUS_20030 3898 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 3964 4518 gene locus_tag LOCUS_20040 3964 4518 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722834.1 protein_id gnl|my_center|LOCUS_20040 4768 4941 gene locus_tag LOCUS_20050 4768 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 6174 5512 gene locus_tag LOCUS_20060 6174 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 8919 6475 gene locus_tag LOCUS_20070 8919 6475 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903005.1 protein_id gnl|my_center|LOCUS_20070 10360 8945 gene locus_tag LOCUS_20080 10360 8945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 11099 10365 gene locus_tag LOCUS_20090 11099 10365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 12480 11143 gene locus_tag LOCUS_20100 12480 11143 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289129.1 protein_id gnl|my_center|LOCUS_20100 12636 13700 gene locus_tag LOCUS_20110 12636 13700 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902406.1 protein_id gnl|my_center|LOCUS_20110 13791 14912 gene locus_tag LOCUS_20120 13791 14912 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289190.1 protein_id gnl|my_center|LOCUS_20120 15161 14955 gene locus_tag LOCUS_20130 15161 14955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 16181 15246 gene locus_tag LOCUS_20140 16181 15246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 16450 16938 gene locus_tag LOCUS_20150 gene folA 16450 16938 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368294.1 protein_id gnl|my_center|LOCUS_20150 17024 17497 gene locus_tag LOCUS_20160 17024 17497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 17548 17907 gene locus_tag LOCUS_20170 17548 17907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 18059 17969 gene locus_tag LOCUS_t00320 18059 17969 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19610 18186 gene locus_tag LOCUS_20180 19610 18186 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421525.1 protein_id gnl|my_center|LOCUS_20180 19292 19219 gene locus_tag LOCUS_t00330 19292 19219 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 19915 19679 gene locus_tag LOCUS_20190 19915 19679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 20532 21440 gene locus_tag LOCUS_20200 gene yegS 20532 21440 CDS product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091230.1 protein_id gnl|my_center|LOCUS_20200 21539 21736 gene locus_tag LOCUS_20210 21539 21736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 21924 22391 gene locus_tag LOCUS_20220 21924 22391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 23047 27780 gene locus_tag LOCUS_20230 23047 27780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 29205 27850 gene locus_tag LOCUS_20240 gene kynU 29205 27850 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276276.1 protein_id gnl|my_center|LOCUS_20240 30682 29339 gene locus_tag LOCUS_20250 30682 29339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 30864 31877 gene locus_tag LOCUS_20260 30864 31877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 33012 31954 gene locus_tag LOCUS_20270 33012 31954 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289639.1 protein_id gnl|my_center|LOCUS_20270 34557 33049 gene locus_tag LOCUS_20280 34557 33049 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218083104.1 protein_id gnl|my_center|LOCUS_20280 34647 35048 gene locus_tag LOCUS_20290 34647 35048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 35223 36137 gene locus_tag LOCUS_20300 35223 36137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 36219 36566 gene locus_tag LOCUS_20310 36219 36566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 37068 36994 gene locus_tag LOCUS_t00340 37068 36994 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 37195 38040 gene locus_tag LOCUS_20320 37195 38040 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902414.1 protein_id gnl|my_center|LOCUS_20320 38195 38803 gene locus_tag LOCUS_20330 38195 38803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902413.1 protein_id gnl|my_center|LOCUS_20330 38922 39344 gene locus_tag LOCUS_20340 38922 39344 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902412.1 protein_id gnl|my_center|LOCUS_20340 39713 39423 gene locus_tag LOCUS_20350 39713 39423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 39947 41092 gene locus_tag LOCUS_20360 39947 41092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 40981 41568 gene locus_tag LOCUS_20370 40981 41568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 41728 42660 gene locus_tag LOCUS_20380 41728 42660 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902774.1 protein_id gnl|my_center|LOCUS_20380 43380 42835 gene locus_tag LOCUS_20390 43380 42835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 43737 44684 gene locus_tag LOCUS_20400 43737 44684 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902772.1 protein_id gnl|my_center|LOCUS_20400 45306 45635 gene locus_tag LOCUS_20410 45306 45635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 46222 45683 gene locus_tag LOCUS_20420 46222 45683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 46351 47940 gene locus_tag LOCUS_20430 46351 47940 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902970.1 protein_id gnl|my_center|LOCUS_20430 48067 48408 gene locus_tag LOCUS_20440 48067 48408 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902280.1 protein_id gnl|my_center|LOCUS_20440 48816 48502 gene locus_tag LOCUS_20450 48816 48502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 48878 49519 gene locus_tag LOCUS_20460 48878 49519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902282.1 protein_id gnl|my_center|LOCUS_20460 50273 49602 gene locus_tag LOCUS_20470 50273 49602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 50617 51570 gene locus_tag LOCUS_20480 gene pyrB 50617 51570 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289640.1 protein_id gnl|my_center|LOCUS_20480 51567 52037 gene locus_tag LOCUS_20490 gene pyrI 51567 52037 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289641.1 protein_id gnl|my_center|LOCUS_20490 52287 53495 gene locus_tag LOCUS_20500 52287 53495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 53499 54335 gene locus_tag LOCUS_20510 gene phnC 53499 54335 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939222.1 protein_id gnl|my_center|LOCUS_20510 54339 55157 gene locus_tag LOCUS_20520 gene phnE 54339 55157 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524368.1 protein_id gnl|my_center|LOCUS_20520 55157 55945 gene locus_tag LOCUS_20530 gene phnE 55157 55945 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104070585.1 protein_id gnl|my_center|LOCUS_20530 55947 56687 gene locus_tag LOCUS_20540 55947 56687 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902025.1 protein_id gnl|my_center|LOCUS_20540 57197 58099 gene locus_tag LOCUS_20550 57197 58099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902935.1 protein_id gnl|my_center|LOCUS_20550 58532 58287 gene locus_tag LOCUS_20560 58532 58287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 58510 58962 gene locus_tag LOCUS_20570 58510 58962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 59004 59918 gene locus_tag LOCUS_20580 59004 59918 CDS product translation initiation factor eIF-2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903055.1 protein_id gnl|my_center|LOCUS_20580 59971 61218 gene locus_tag LOCUS_20590 59971 61218 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902285.1 protein_id gnl|my_center|LOCUS_20590 61324 61980 gene locus_tag LOCUS_20600 61324 61980 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024026199.1 protein_id gnl|my_center|LOCUS_20600 62082 63089 gene locus_tag LOCUS_20610 62082 63089 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392274.1 protein_id gnl|my_center|LOCUS_20610 63806 63174 gene locus_tag LOCUS_20620 63806 63174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence17 1009 185 gene locus_tag LOCUS_20630 1009 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 1308 1237 gene locus_tag LOCUS_t00350 1308 1237 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1851 1372 gene locus_tag LOCUS_20640 1851 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2269 1955 gene locus_tag LOCUS_20650 gene rpsJ 2269 1955 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903985.1 protein_id gnl|my_center|LOCUS_20650 3535 2270 gene locus_tag LOCUS_20660 gene tuf 3535 2270 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903986.1 protein_id gnl|my_center|LOCUS_20660 4683 3709 gene locus_tag LOCUS_20670 4683 3709 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903987.1 protein_id gnl|my_center|LOCUS_20670 5303 4680 gene locus_tag LOCUS_20680 5303 4680 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361009.1 protein_id gnl|my_center|LOCUS_20680 7911 5719 gene locus_tag LOCUS_20690 7911 5719 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903990.1 protein_id gnl|my_center|LOCUS_20690 8205 8972 gene locus_tag LOCUS_20700 8205 8972 CDS product DUF5781 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903991.1 protein_id gnl|my_center|LOCUS_20700 9450 9121 gene locus_tag LOCUS_20710 9450 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 9547 10278 gene locus_tag LOCUS_20720 9547 10278 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902869.1 protein_id gnl|my_center|LOCUS_20720 10275 10949 gene locus_tag LOCUS_20730 10275 10949 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902868.1 protein_id gnl|my_center|LOCUS_20730 11003 11152 gene locus_tag LOCUS_20740 11003 11152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 11861 11244 gene locus_tag LOCUS_20750 11861 11244 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903992.1 protein_id gnl|my_center|LOCUS_20750 12289 11861 gene locus_tag LOCUS_20760 12289 11861 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903993.1 protein_id gnl|my_center|LOCUS_20760 12955 12530 gene locus_tag LOCUS_20770 12955 12530 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903994.1 protein_id gnl|my_center|LOCUS_20770 15681 12958 gene locus_tag LOCUS_20780 15681 12958 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870556.1 protein_id gnl|my_center|LOCUS_20780 18607 15674 gene locus_tag LOCUS_20790 18607 15674 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903996.1 protein_id gnl|my_center|LOCUS_20790 20441 18612 gene locus_tag LOCUS_20800 gene rpoB 20441 18612 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903997.1 protein_id gnl|my_center|LOCUS_20800 22008 20443 gene locus_tag LOCUS_20810 22008 20443 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755883.1 protein_id gnl|my_center|LOCUS_20810 22235 22005 gene locus_tag LOCUS_20820 22235 22005 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846238.1 protein_id gnl|my_center|LOCUS_20820 22526 22599 gene locus_tag LOCUS_t00360 22526 22599 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 23151 22792 gene locus_tag LOCUS_20830 23151 22792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 23878 23234 gene locus_tag LOCUS_20840 23878 23234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 24362 24087 gene locus_tag LOCUS_20850 24362 24087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 24636 24499 gene locus_tag LOCUS_20860 24636 24499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 25412 24678 gene locus_tag LOCUS_20870 25412 24678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 25454 26359 gene locus_tag LOCUS_20880 25454 26359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 26573 26397 gene locus_tag LOCUS_20890 26573 26397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 26818 28254 gene locus_tag LOCUS_20900 26818 28254 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228947.1 protein_id gnl|my_center|LOCUS_20900 28391 28170 gene locus_tag LOCUS_20910 28391 28170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 29043 28426 gene locus_tag LOCUS_20920 29043 28426 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894347.1 protein_id gnl|my_center|LOCUS_20920 29621 31057 gene locus_tag LOCUS_20930 29621 31057 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256148.1 protein_id gnl|my_center|LOCUS_20930 31050 33092 gene locus_tag LOCUS_20940 31050 33092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 33839 33063 gene locus_tag LOCUS_20950 33839 33063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 33733 33972 gene locus_tag LOCUS_20960 33733 33972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 34641 33982 gene locus_tag LOCUS_20970 34641 33982 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879811.1 protein_id gnl|my_center|LOCUS_20970 35400 34747 gene locus_tag LOCUS_20980 35400 34747 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902018.1 protein_id gnl|my_center|LOCUS_20980 35575 36513 gene locus_tag LOCUS_20990 35575 36513 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902022.1 protein_id gnl|my_center|LOCUS_20990 36911 36540 gene locus_tag LOCUS_21000 36911 36540 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902021.1 protein_id gnl|my_center|LOCUS_21000 37114 38169 gene locus_tag LOCUS_21010 gene gap 37114 38169 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 protein_id gnl|my_center|LOCUS_21010 38338 39483 gene locus_tag LOCUS_21020 gene gcvT 38338 39483 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903168.1 protein_id gnl|my_center|LOCUS_21020 39641 40015 gene locus_tag LOCUS_21030 gene gcvH 39641 40015 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903167.1 protein_id gnl|my_center|LOCUS_21030 40103 41122 gene locus_tag LOCUS_21040 40103 41122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 41327 41097 gene locus_tag LOCUS_21050 41327 41097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 41516 42856 gene locus_tag LOCUS_21060 gene gcvPA 41516 42856 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903166.1 protein_id gnl|my_center|LOCUS_21060 42935 44482 gene locus_tag LOCUS_21070 gene gcvPB 42935 44482 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903165.1 protein_id gnl|my_center|LOCUS_21070 44725 44955 gene locus_tag LOCUS_21080 44725 44955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 46484 44988 gene locus_tag LOCUS_21090 46484 44988 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837937.1 protein_id gnl|my_center|LOCUS_21090 46974 46591 gene locus_tag LOCUS_21100 46974 46591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 47387 46971 gene locus_tag LOCUS_21110 47387 46971 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903409.1 protein_id gnl|my_center|LOCUS_21110 47725 48117 gene locus_tag LOCUS_21120 47725 48117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 48359 48189 gene locus_tag LOCUS_21130 48359 48189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 48534 48920 gene locus_tag LOCUS_21140 48534 48920 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903023.1 protein_id gnl|my_center|LOCUS_21140 49089 49283 gene locus_tag LOCUS_21150 49089 49283 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289092.1 protein_id gnl|my_center|LOCUS_21150 49572 49342 gene locus_tag LOCUS_21160 49572 49342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 49755 50171 gene locus_tag LOCUS_21170 49755 50171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 50178 50714 gene locus_tag LOCUS_21180 50178 50714 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289350.1 protein_id gnl|my_center|LOCUS_21180 51148 50900 gene locus_tag LOCUS_21190 51148 50900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 51264 51338 gene locus_tag LOCUS_t00370 51264 51338 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 52579 51443 gene locus_tag LOCUS_21200 52579 51443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 53034 53453 gene locus_tag LOCUS_21210 53034 53453 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289104.1 protein_id gnl|my_center|LOCUS_21210 53633 54775 gene locus_tag LOCUS_21220 53633 54775 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903212.1 protein_id gnl|my_center|LOCUS_21220 54982 54863 gene locus_tag LOCUS_21230 54982 54863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 55759 54989 gene locus_tag LOCUS_21240 55759 54989 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838608.1 protein_id gnl|my_center|LOCUS_21240 55940 56638 gene locus_tag LOCUS_21250 55940 56638 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289173.1 protein_id gnl|my_center|LOCUS_21250 57688 56696 gene locus_tag LOCUS_21260 57688 56696 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902253.1 protein_id gnl|my_center|LOCUS_21260 58243 57791 gene locus_tag LOCUS_21270 58243 57791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 59083 58388 gene locus_tag LOCUS_21280 59083 58388 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157849919.1 protein_id gnl|my_center|LOCUS_21280 59633 59148 gene locus_tag LOCUS_21290 59633 59148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 <60195 59525 gene locus_tag LOCUS_21300 <60195 59525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902386.1:M28 family metallopeptidase >Feature sequence18 <1 920 gene locus_tag LOCUS_21310 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042144000.1:bile acid:sodium symporter family protein 1613 933 gene locus_tag LOCUS_21320 1613 933 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903909.1 protein_id gnl|my_center|LOCUS_21320 3217 1772 gene locus_tag LOCUS_21330 3217 1772 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289312.1 protein_id gnl|my_center|LOCUS_21330 3979 3305 gene locus_tag LOCUS_21340 3979 3305 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902974.1 protein_id gnl|my_center|LOCUS_21340 5248 4106 gene locus_tag LOCUS_21350 5248 4106 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289314.1 protein_id gnl|my_center|LOCUS_21350 5479 6120 gene locus_tag LOCUS_21360 5479 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902976.1 protein_id gnl|my_center|LOCUS_21360 6117 6914 gene locus_tag LOCUS_21370 6117 6914 CDS product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289315.1 protein_id gnl|my_center|LOCUS_21370 7155 8942 gene locus_tag LOCUS_21380 7155 8942 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902829.1 protein_id gnl|my_center|LOCUS_21380 9063 10532 gene locus_tag LOCUS_21390 gene mmsA 9063 10532 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 protein_id gnl|my_center|LOCUS_21390 10608 12146 gene locus_tag LOCUS_21400 10608 12146 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089670226.1 protein_id gnl|my_center|LOCUS_21400 12372 12456 gene locus_tag LOCUS_t00380 12372 12456 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12475 13011 gene locus_tag LOCUS_21410 12475 13011 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902812.1 protein_id gnl|my_center|LOCUS_21410 13008 13532 gene locus_tag LOCUS_21420 13008 13532 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902813.1 protein_id gnl|my_center|LOCUS_21420 13533 13928 gene locus_tag LOCUS_21430 13533 13928 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902814.1 protein_id gnl|my_center|LOCUS_21430 13932 14681 gene locus_tag LOCUS_21440 13932 14681 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902815.1 protein_id gnl|my_center|LOCUS_21440 14826 14911 gene locus_tag LOCUS_t00390 14826 14911 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14946 15302 gene locus_tag LOCUS_21450 14946 15302 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902816.1 protein_id gnl|my_center|LOCUS_21450 15299 15766 gene locus_tag LOCUS_21460 15299 15766 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902817.1 protein_id gnl|my_center|LOCUS_21460 15760 16158 gene locus_tag LOCUS_21470 15760 16158 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902818.1 protein_id gnl|my_center|LOCUS_21470 16171 16365 gene locus_tag LOCUS_21480 16171 16365 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902819.1 protein_id gnl|my_center|LOCUS_21480 16362 16544 gene locus_tag LOCUS_21490 16362 16544 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902820.1 protein_id gnl|my_center|LOCUS_21490 16545 17756 gene locus_tag LOCUS_21500 16545 17756 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902821.1 protein_id gnl|my_center|LOCUS_21500 17753 18502 gene locus_tag LOCUS_21510 gene rpsB 17753 18502 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902822.1 protein_id gnl|my_center|LOCUS_21510 18982 18749 gene locus_tag LOCUS_21520 18982 18749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 19386 20402 gene locus_tag LOCUS_21530 gene mvk 19386 20402 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902824.1 protein_id gnl|my_center|LOCUS_21530 20533 21051 gene locus_tag LOCUS_21540 20533 21051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21540 21901 21089 gene locus_tag LOCUS_21550 21901 21089 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903097.1 protein_id gnl|my_center|LOCUS_21550 22020 24845 gene locus_tag LOCUS_21560 22020 24845 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146858.1 protein_id gnl|my_center|LOCUS_21560 24979 25437 gene locus_tag LOCUS_21570 24979 25437 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902983.1 protein_id gnl|my_center|LOCUS_21570 25437 26678 gene locus_tag LOCUS_21580 25437 26678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21580 26678 27316 gene locus_tag LOCUS_21590 26678 27316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 30318 27397 gene locus_tag LOCUS_21600 30318 27397 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289343.1 protein_id gnl|my_center|LOCUS_21600 30430 36032 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaaccccacaagggttcgtctgaaac 36228 36926 gene locus_tag LOCUS_21610 36228 36926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 37506 36988 gene locus_tag LOCUS_21620 37506 36988 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903018.1 protein_id gnl|my_center|LOCUS_21620 38092 37649 gene locus_tag LOCUS_21630 38092 37649 CDS product DUF5820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903019.1 protein_id gnl|my_center|LOCUS_21630 38448 40574 gene locus_tag LOCUS_21640 38448 40574 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902520.1 protein_id gnl|my_center|LOCUS_21640 40576 42867 gene locus_tag LOCUS_21650 40576 42867 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902519.1 protein_id gnl|my_center|LOCUS_21650 42858 44189 gene locus_tag LOCUS_21660 42858 44189 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902518.1 protein_id gnl|my_center|LOCUS_21660 44191 46182 gene locus_tag LOCUS_21670 44191 46182 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902517.1 protein_id gnl|my_center|LOCUS_21670 46366 47820 gene locus_tag LOCUS_21680 46366 47820 CDS product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140837.1 protein_id gnl|my_center|LOCUS_21680 48655 47837 gene locus_tag LOCUS_21690 48655 47837 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902475.1 protein_id gnl|my_center|LOCUS_21690 49692 48733 gene locus_tag LOCUS_21700 49692 48733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 49845 50795 gene locus_tag LOCUS_21710 49845 50795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 51206 51132 gene locus_tag LOCUS_t00400 51206 51132 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 52268 51291 gene locus_tag LOCUS_21720 gene fen 52268 51291 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902986.1 protein_id gnl|my_center|LOCUS_21720 52469 52888 gene locus_tag LOCUS_21730 52469 52888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 53889 53308 gene locus_tag LOCUS_21740 53889 53308 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902318.1 protein_id gnl|my_center|LOCUS_21740 54556 53954 gene locus_tag LOCUS_21750 54556 53954 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289316.1 protein_id gnl|my_center|LOCUS_21750 54622 55269 gene locus_tag LOCUS_21760 54622 55269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 55294 55728 gene locus_tag LOCUS_21770 55294 55728 CDS product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902988.1 protein_id gnl|my_center|LOCUS_21770 55736 56314 gene locus_tag LOCUS_21780 55736 56314 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081422754.1 protein_id gnl|my_center|LOCUS_21780 56517 56434 gene locus_tag LOCUS_t00410 56517 56434 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 57263 56550 gene locus_tag LOCUS_21790 57263 56550 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902885.1 protein_id gnl|my_center|LOCUS_21790 57372 57590 gene locus_tag LOCUS_21800 57372 57590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 58256 57624 gene locus_tag LOCUS_21810 58256 57624 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902887.1 protein_id gnl|my_center|LOCUS_21810 >Feature sequence19 <1 579 gene locus_tag LOCUS_21820 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902790.1:YqcI/YcgG family protein 914 474 gene locus_tag LOCUS_21830 914 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 2094 1210 gene locus_tag LOCUS_21840 2094 1210 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903030.1 protein_id gnl|my_center|LOCUS_21840 3455 2208 gene locus_tag LOCUS_21850 3455 2208 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289325.1 protein_id gnl|my_center|LOCUS_21850 3554 5626 gene locus_tag LOCUS_21860 3554 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289324.1 protein_id gnl|my_center|LOCUS_21860 5866 5627 gene locus_tag LOCUS_21870 5866 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 5962 6780 gene locus_tag LOCUS_21880 5962 6780 CDS product DUF5821 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289323.1 protein_id gnl|my_center|LOCUS_21880 6823 8541 gene locus_tag LOCUS_21890 6823 8541 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892506.1 protein_id gnl|my_center|LOCUS_21890 8628 10091 gene locus_tag LOCUS_21900 8628 10091 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289330.1 protein_id gnl|my_center|LOCUS_21900 10088 10381 gene locus_tag LOCUS_21910 10088 10381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 10378 11346 gene locus_tag LOCUS_21920 10378 11346 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289348.1 protein_id gnl|my_center|LOCUS_21920 11869 11387 gene locus_tag LOCUS_21930 11869 11387 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_21930 12310 12044 gene locus_tag LOCUS_21940 12310 12044 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289285.1 protein_id gnl|my_center|LOCUS_21940 12498 12313 gene locus_tag LOCUS_21950 12498 12313 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902845.1 protein_id gnl|my_center|LOCUS_21950 13110 12658 gene locus_tag LOCUS_21960 13110 12658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21960 13704 14231 gene locus_tag LOCUS_21970 13704 14231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 15310 14261 gene locus_tag LOCUS_21980 15310 14261 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902794.1 protein_id gnl|my_center|LOCUS_21980 15945 15307 gene locus_tag LOCUS_21990 15945 15307 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902795.1 protein_id gnl|my_center|LOCUS_21990 16871 16083 gene locus_tag LOCUS_22000 16871 16083 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_22000 17597 17100 gene locus_tag LOCUS_22010 17597 17100 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902796.1 protein_id gnl|my_center|LOCUS_22010 17816 18793 gene locus_tag LOCUS_22020 17816 18793 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028671.1 protein_id gnl|my_center|LOCUS_22020 18957 20021 gene locus_tag LOCUS_22030 18957 20021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 20266 21657 gene locus_tag LOCUS_22040 20266 21657 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972955.1 protein_id gnl|my_center|LOCUS_22040 21705 22712 gene locus_tag LOCUS_22050 21705 22712 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013848.1 protein_id gnl|my_center|LOCUS_22050 22709 23644 gene locus_tag LOCUS_22060 22709 23644 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266611.1 protein_id gnl|my_center|LOCUS_22060 23649 24827 gene locus_tag LOCUS_22070 gene ugpC 23649 24827 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_22070 24829 25023 gene locus_tag LOCUS_22080 24829 25023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 25088 26170 gene locus_tag LOCUS_22090 25088 26170 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100168880.1 protein_id gnl|my_center|LOCUS_22090 26229 27329 gene locus_tag LOCUS_22100 26229 27329 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902333.1 protein_id gnl|my_center|LOCUS_22100 27425 28393 gene locus_tag LOCUS_22110 27425 28393 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 protein_id gnl|my_center|LOCUS_22110 28513 29679 gene locus_tag LOCUS_22120 28513 29679 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050459751.1 protein_id gnl|my_center|LOCUS_22120 30565 29711 gene locus_tag LOCUS_22130 30565 29711 CDS product translation initiation factor eIF-2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903055.1 protein_id gnl|my_center|LOCUS_22130 32787 30691 gene locus_tag LOCUS_22140 32787 30691 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289344.1 protein_id gnl|my_center|LOCUS_22140 33569 32967 gene locus_tag LOCUS_22150 33569 32967 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903104.1 protein_id gnl|my_center|LOCUS_22150 34256 33669 gene locus_tag LOCUS_22160 34256 33669 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903105.1 protein_id gnl|my_center|LOCUS_22160 34598 34510 gene locus_tag LOCUS_t00420 34598 34510 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 34739 35332 gene locus_tag LOCUS_22170 34739 35332 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903089.1 protein_id gnl|my_center|LOCUS_22170 37083 35545 gene locus_tag LOCUS_22180 gene purF 37083 35545 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903090.1 protein_id gnl|my_center|LOCUS_22180 37458 37282 gene locus_tag LOCUS_22190 37458 37282 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903091.1 protein_id gnl|my_center|LOCUS_22190 37670 37455 gene locus_tag LOCUS_22200 37670 37455 CDS product small nuclear ribonucleoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289341.1 protein_id gnl|my_center|LOCUS_22200 37862 39340 gene locus_tag LOCUS_22210 37862 39340 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902826.1 protein_id gnl|my_center|LOCUS_22210 39343 40392 gene locus_tag LOCUS_22220 39343 40392 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902827.1 protein_id gnl|my_center|LOCUS_22220 40579 41490 gene locus_tag LOCUS_22230 40579 41490 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289364.1 protein_id gnl|my_center|LOCUS_22230 42087 41614 gene locus_tag LOCUS_22240 42087 41614 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902865.1 protein_id gnl|my_center|LOCUS_22240 43268 42168 gene locus_tag LOCUS_22250 43268 42168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 44437 43271 gene locus_tag LOCUS_22260 gene priS 44437 43271 CDS product DNA primase small subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289337.1 protein_id gnl|my_center|LOCUS_22260 44561 46294 gene locus_tag LOCUS_22270 44561 46294 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903101.1 protein_id gnl|my_center|LOCUS_22270 46413 47252 gene locus_tag LOCUS_22280 46413 47252 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937390.1 protein_id gnl|my_center|LOCUS_22280 48908 47556 gene locus_tag LOCUS_22290 48908 47556 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922632.1 protein_id gnl|my_center|LOCUS_22290 48979 50913 gene locus_tag LOCUS_22300 gene thrS 48979 50913 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289388.1 protein_id gnl|my_center|LOCUS_22300 51134 51493 gene locus_tag LOCUS_22310 51134 51493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 51695 51501 gene locus_tag LOCUS_22320 51695 51501 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289092.1 protein_id gnl|my_center|LOCUS_22320 52522 52031 gene locus_tag LOCUS_22330 52522 52031 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530428.1 protein_id gnl|my_center|LOCUS_22330 52923 53102 gene locus_tag LOCUS_22340 52923 53102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902914.1 protein_id gnl|my_center|LOCUS_22340 53546 53142 gene locus_tag LOCUS_22350 53546 53142 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902915.1 protein_id gnl|my_center|LOCUS_22350 53835 54083 gene locus_tag LOCUS_22360 53835 54083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 54685 54203 gene locus_tag LOCUS_22370 54685 54203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 54775 55707 gene locus_tag LOCUS_22380 54775 55707 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903946.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence20 <1 923 gene locus_tag LOCUS_22390 <1 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903685.1:Sec-independent protein translocase TatC 997 1224 gene locus_tag LOCUS_22400 997 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 1221 1940 gene locus_tag LOCUS_22410 1221 1940 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903683.1 protein_id gnl|my_center|LOCUS_22410 2766 1963 gene locus_tag LOCUS_22420 2766 1963 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903682.1 protein_id gnl|my_center|LOCUS_22420 3040 3783 gene locus_tag LOCUS_22430 3040 3783 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903677.1 protein_id gnl|my_center|LOCUS_22430 3844 4587 gene locus_tag LOCUS_22440 3844 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 4656 5315 gene locus_tag LOCUS_22450 4656 5315 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903223.1 protein_id gnl|my_center|LOCUS_22450 8937 5593 gene locus_tag LOCUS_22460 8937 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 9063 9521 gene locus_tag LOCUS_22470 9063 9521 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289521.1 protein_id gnl|my_center|LOCUS_22470 9710 11068 gene locus_tag LOCUS_22480 9710 11068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903882.1 protein_id gnl|my_center|LOCUS_22480 11174 12190 gene locus_tag LOCUS_22490 11174 12190 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421550.1 protein_id gnl|my_center|LOCUS_22490 12868 12368 gene locus_tag LOCUS_22500 12868 12368 CDS product DUF5807 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289520.1 protein_id gnl|my_center|LOCUS_22500 12992 14416 gene locus_tag LOCUS_22510 12992 14416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 14891 14445 gene locus_tag LOCUS_22520 14891 14445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 15334 14909 gene locus_tag LOCUS_22530 15334 14909 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903878.1 protein_id gnl|my_center|LOCUS_22530 15658 16593 gene locus_tag LOCUS_22540 15658 16593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 17584 16625 gene locus_tag LOCUS_22550 17584 16625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903896.1 protein_id gnl|my_center|LOCUS_22550 17637 18482 gene locus_tag LOCUS_22560 17637 18482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 18713 20011 gene locus_tag LOCUS_22570 18713 20011 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903894.1 protein_id gnl|my_center|LOCUS_22570 20525 20172 gene locus_tag LOCUS_22580 20525 20172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 21473 20532 gene locus_tag LOCUS_22590 21473 20532 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903892.1 protein_id gnl|my_center|LOCUS_22590 22518 21475 gene locus_tag LOCUS_22600 22518 21475 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903891.1 protein_id gnl|my_center|LOCUS_22600 22536 22865 gene locus_tag LOCUS_22610 22536 22865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 24521 22842 gene locus_tag LOCUS_22620 24521 22842 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289523.1 protein_id gnl|my_center|LOCUS_22620 25343 24603 gene locus_tag LOCUS_22630 25343 24603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 27313 25325 gene locus_tag LOCUS_22640 27313 25325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 27409 27939 gene locus_tag LOCUS_22650 27409 27939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903888.1 protein_id gnl|my_center|LOCUS_22650 28574 27987 gene locus_tag LOCUS_22660 28574 27987 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903898.1 protein_id gnl|my_center|LOCUS_22660 28704 30404 gene locus_tag LOCUS_22670 28704 30404 CDS product Hvo_1808 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903899.1 protein_id gnl|my_center|LOCUS_22670 30523 31854 gene locus_tag LOCUS_22680 30523 31854 CDS product Hvo_1808 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903899.1 protein_id gnl|my_center|LOCUS_22680 31998 33161 gene locus_tag LOCUS_22690 31998 33161 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903900.1 protein_id gnl|my_center|LOCUS_22690 33650 33201 gene locus_tag LOCUS_22700 33650 33201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 34368 33766 gene locus_tag LOCUS_22710 34368 33766 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903901.1 protein_id gnl|my_center|LOCUS_22710 35161 35454 gene locus_tag LOCUS_22720 35161 35454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 35645 36571 gene locus_tag LOCUS_22730 35645 36571 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903522.1 protein_id gnl|my_center|LOCUS_22730 36670 38406 gene locus_tag LOCUS_22740 36670 38406 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903521.1 protein_id gnl|my_center|LOCUS_22740 38437 38571 gene locus_tag LOCUS_22750 38437 38571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22750 38699 40567 gene locus_tag LOCUS_22760 38699 40567 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289426.1 protein_id gnl|my_center|LOCUS_22760 40912 40700 gene locus_tag LOCUS_22770 40912 40700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 41072 42496 gene locus_tag LOCUS_22780 gene lpdA 41072 42496 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903648.1 protein_id gnl|my_center|LOCUS_22780 42562 42753 gene locus_tag LOCUS_22790 42562 42753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 43013 44998 gene locus_tag LOCUS_22800 43013 44998 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902041.1 protein_id gnl|my_center|LOCUS_22800 45338 46654 gene locus_tag LOCUS_22810 45338 46654 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289154.1 protein_id gnl|my_center|LOCUS_22810 48580 46667 gene locus_tag LOCUS_22820 48580 46667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 49024 48593 gene locus_tag LOCUS_22830 49024 48593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence21 1621 311 gene locus_tag LOCUS_22840 1621 311 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289356.1 protein_id gnl|my_center|LOCUS_22840 2628 1618 gene locus_tag LOCUS_22850 2628 1618 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289355.1 protein_id gnl|my_center|LOCUS_22850 3523 2801 gene locus_tag LOCUS_22860 3523 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 3853 3626 gene locus_tag LOCUS_22870 3853 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 4699 4187 gene locus_tag LOCUS_22880 4699 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 4990 4700 gene locus_tag LOCUS_22890 4990 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 6533 5424 gene locus_tag LOCUS_22900 6533 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 7000 7287 gene locus_tag LOCUS_22910 7000 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 8461 7424 gene locus_tag LOCUS_22920 8461 7424 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530745.1 protein_id gnl|my_center|LOCUS_22920 8572 8997 gene locus_tag LOCUS_22930 8572 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 9132 10553 gene locus_tag LOCUS_22940 gene gatA 9132 10553 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902611.1 protein_id gnl|my_center|LOCUS_22940 10694 11419 gene locus_tag LOCUS_22950 10694 11419 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085655.1 protein_id gnl|my_center|LOCUS_22950 11429 13117 gene locus_tag LOCUS_22960 11429 13117 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975336.1 protein_id gnl|my_center|LOCUS_22960 13128 14087 gene locus_tag LOCUS_22970 13128 14087 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729760.1 protein_id gnl|my_center|LOCUS_22970 14087 14995 gene locus_tag LOCUS_22980 14087 14995 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_22980 14988 17183 gene locus_tag LOCUS_22990 14988 17183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 17204 17416 gene locus_tag LOCUS_23000 17204 17416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 18428 17466 gene locus_tag LOCUS_23010 18428 17466 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813011.1 protein_id gnl|my_center|LOCUS_23010 18535 18705 gene locus_tag LOCUS_23020 18535 18705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 19055 18711 gene locus_tag LOCUS_23030 19055 18711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 19279 19683 gene locus_tag LOCUS_23040 19279 19683 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404838.1 protein_id gnl|my_center|LOCUS_23040 19868 20998 gene locus_tag LOCUS_23050 19868 20998 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878153.1 protein_id gnl|my_center|LOCUS_23050 21014 21385 gene locus_tag LOCUS_23060 21014 21385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 21700 22080 gene locus_tag LOCUS_23070 21700 22080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 22150 23304 gene locus_tag LOCUS_23080 gene dgoD 22150 23304 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528179.1 protein_id gnl|my_center|LOCUS_23080 23616 23744 gene locus_tag LOCUS_23090 23616 23744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 24163 23900 gene locus_tag LOCUS_23100 24163 23900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 24540 24199 gene locus_tag LOCUS_23110 24540 24199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 25002 24664 gene locus_tag LOCUS_23120 25002 24664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23120 26194 25049 gene locus_tag LOCUS_23130 26194 25049 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890429.1 protein_id gnl|my_center|LOCUS_23130 27162 26392 gene locus_tag LOCUS_23140 27162 26392 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_23140 27980 27159 gene locus_tag LOCUS_23150 27980 27159 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020123.1 protein_id gnl|my_center|LOCUS_23150 29015 28005 gene locus_tag LOCUS_23160 29015 28005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 30118 29246 gene locus_tag LOCUS_23170 30118 29246 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194474.1 protein_id gnl|my_center|LOCUS_23170 30361 30909 gene locus_tag LOCUS_23180 30361 30909 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879241.1 protein_id gnl|my_center|LOCUS_23180 31078 31716 gene locus_tag LOCUS_23190 31078 31716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 33018 33896 gene locus_tag LOCUS_23200 33018 33896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23200 33896 35590 gene locus_tag LOCUS_23210 33896 35590 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402899.1 protein_id gnl|my_center|LOCUS_23210 35587 36855 gene locus_tag LOCUS_23220 35587 36855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 36901 37401 gene locus_tag LOCUS_23230 36901 37401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 37402 37608 gene locus_tag LOCUS_23240 37402 37608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 38706 37678 gene locus_tag LOCUS_23250 38706 37678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 39518 39177 gene locus_tag LOCUS_23260 39518 39177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 42013 41807 gene locus_tag LOCUS_23270 42013 41807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 43860 44900 gene locus_tag LOCUS_23280 43860 44900 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135662722.1 protein_id gnl|my_center|LOCUS_23280 45617 45117 gene locus_tag LOCUS_23290 45617 45117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 46991 46173 gene locus_tag LOCUS_23300 46991 46173 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904059.1 protein_id gnl|my_center|LOCUS_23300 <47631 46988 gene locus_tag LOCUS_23310 <47631 46988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010904058.1:potassium-transporting ATPase subunit KdpC >Feature sequence22 1724 462 gene locus_tag LOCUS_23320 gene cofH 1724 462 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903422.1 protein_id gnl|my_center|LOCUS_23320 1816 3243 gene locus_tag LOCUS_23330 1816 3243 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029761399.1 protein_id gnl|my_center|LOCUS_23330 4179 3310 gene locus_tag LOCUS_23340 4179 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 4437 5456 gene locus_tag LOCUS_23350 4437 5456 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289411.1 protein_id gnl|my_center|LOCUS_23350 7326 5761 gene locus_tag LOCUS_23360 7326 5761 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867411.1 protein_id gnl|my_center|LOCUS_23360 7648 7403 gene locus_tag LOCUS_23370 7648 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 7927 8181 gene locus_tag LOCUS_23380 gene purS 7927 8181 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903429.1 protein_id gnl|my_center|LOCUS_23380 8337 9023 gene locus_tag LOCUS_23390 gene purQ 8337 9023 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903428.1 protein_id gnl|my_center|LOCUS_23390 10683 9121 gene locus_tag LOCUS_23400 10683 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 10824 12752 gene locus_tag LOCUS_23410 10824 12752 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227739.1 protein_id gnl|my_center|LOCUS_23410 13461 13126 gene locus_tag LOCUS_23420 13461 13126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 14183 13458 gene locus_tag LOCUS_23430 14183 13458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 14673 14245 gene locus_tag LOCUS_23440 14673 14245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 15326 14565 gene locus_tag LOCUS_23450 15326 14565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 15673 16071 gene locus_tag LOCUS_23460 15673 16071 CDS product DUF5778 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903299.1 protein_id gnl|my_center|LOCUS_23460 16300 17178 gene locus_tag LOCUS_23470 16300 17178 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903298.1 protein_id gnl|my_center|LOCUS_23470 17291 17929 gene locus_tag LOCUS_23480 17291 17929 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903297.1 protein_id gnl|my_center|LOCUS_23480 17922 19118 gene locus_tag LOCUS_23490 gene hemA 17922 19118 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903296.1 protein_id gnl|my_center|LOCUS_23490 19183 20064 gene locus_tag LOCUS_23500 19183 20064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 20135 20419 gene locus_tag LOCUS_23510 20135 20419 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903295.1 protein_id gnl|my_center|LOCUS_23510 20424 20828 gene locus_tag LOCUS_23520 20424 20828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 20942 21664 gene locus_tag LOCUS_23530 20942 21664 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903294.1 protein_id gnl|my_center|LOCUS_23530 23920 22091 gene locus_tag LOCUS_23540 23920 22091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 25147 24080 gene locus_tag LOCUS_23550 gene carA 25147 24080 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903326.1 protein_id gnl|my_center|LOCUS_23550 25245 25658 gene locus_tag LOCUS_23560 25245 25658 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903327.1 protein_id gnl|my_center|LOCUS_23560 26462 25788 gene locus_tag LOCUS_23570 26462 25788 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_23570 26515 27483 gene locus_tag LOCUS_23580 26515 27483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 27581 28168 gene locus_tag LOCUS_23590 27581 28168 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289385.1 protein_id gnl|my_center|LOCUS_23590 28205 28645 gene locus_tag LOCUS_23600 28205 28645 CDS product desampylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903329.1 protein_id gnl|my_center|LOCUS_23600 29310 29404 gene locus_tag LOCUS_t00430 29310 29404 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 29671 30045 gene locus_tag LOCUS_23610 29671 30045 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903290.1 protein_id gnl|my_center|LOCUS_23610 30052 30936 gene locus_tag LOCUS_23620 gene speB 30052 30936 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903289.1 protein_id gnl|my_center|LOCUS_23620 30997 31884 gene locus_tag LOCUS_23630 30997 31884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 31860 32420 gene locus_tag LOCUS_23640 31860 32420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 32500 33567 gene locus_tag LOCUS_23650 32500 33567 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021005.1 protein_id gnl|my_center|LOCUS_23650 35037 33784 gene locus_tag LOCUS_23660 35037 33784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 35589 35101 gene locus_tag LOCUS_23670 35589 35101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 36104 35517 gene locus_tag LOCUS_23680 36104 35517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 37161 37313 gene locus_tag LOCUS_23690 37161 37313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 37600 38499 gene locus_tag LOCUS_23700 37600 38499 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079927.1 protein_id gnl|my_center|LOCUS_23700 38629 39246 gene locus_tag LOCUS_23710 38629 39246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 39539 41071 gene locus_tag LOCUS_23720 39539 41071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 41365 41682 gene locus_tag LOCUS_23730 41365 41682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 42821 42000 gene locus_tag LOCUS_23740 42821 42000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 43120 42818 gene locus_tag LOCUS_23750 43120 42818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 45162 43369 gene locus_tag LOCUS_23760 45162 43369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 45651 45454 gene locus_tag LOCUS_23770 45651 45454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 45702 46316 gene locus_tag LOCUS_23780 45702 46316 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020240.1 protein_id gnl|my_center|LOCUS_23780 46420 46752 gene locus_tag LOCUS_23790 46420 46752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 47137 46715 gene locus_tag LOCUS_23800 gene msrB 47137 46715 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903021.1 protein_id gnl|my_center|LOCUS_23800 >Feature sequence23 1020 265 gene locus_tag LOCUS_23810 1020 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 1439 2440 gene locus_tag LOCUS_23820 1439 2440 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742066.1 protein_id gnl|my_center|LOCUS_23820 2437 3246 gene locus_tag LOCUS_23830 2437 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 3243 3404 gene locus_tag LOCUS_23840 3243 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 4066 5685 gene locus_tag LOCUS_23850 4066 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 5908 6201 gene locus_tag LOCUS_23860 gene yciH 5908 6201 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903930.1 protein_id gnl|my_center|LOCUS_23860 6361 6466 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6789 8714 gene locus_tag LOCUS_23870 6789 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 9084 8719 gene locus_tag LOCUS_23880 9084 8719 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903929.1 protein_id gnl|my_center|LOCUS_23880 9836 9177 gene locus_tag LOCUS_23890 9836 9177 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903927.1 protein_id gnl|my_center|LOCUS_23890 10234 9833 gene locus_tag LOCUS_23900 10234 9833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 10733 10266 gene locus_tag LOCUS_23910 10733 10266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 10881 11156 gene locus_tag LOCUS_23920 10881 11156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 11688 11236 gene locus_tag LOCUS_23930 11688 11236 CDS product DUF5810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903924.1 protein_id gnl|my_center|LOCUS_23930 12333 11758 gene locus_tag LOCUS_23940 gene rimI 12333 11758 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289526.1 protein_id gnl|my_center|LOCUS_23940 14559 12574 gene locus_tag LOCUS_23950 14559 12574 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903922.1 protein_id gnl|my_center|LOCUS_23950 14789 15265 gene locus_tag LOCUS_23960 14789 15265 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903920.1 protein_id gnl|my_center|LOCUS_23960 15352 16836 gene locus_tag LOCUS_23970 15352 16836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 17342 17269 gene locus_tag LOCUS_t00440 17342 17269 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 18104 17412 gene locus_tag LOCUS_23980 18104 17412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 18234 18875 gene locus_tag LOCUS_23990 gene rdgB 18234 18875 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903503.1 protein_id gnl|my_center|LOCUS_23990 19058 19321 gene locus_tag LOCUS_24000 19058 19321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 19318 20085 gene locus_tag LOCUS_24010 19318 20085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892529.1 protein_id gnl|my_center|LOCUS_24010 20257 20721 gene locus_tag LOCUS_24020 20257 20721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 20882 20811 gene locus_tag LOCUS_t00450 20882 20811 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 21144 21977 gene locus_tag LOCUS_24030 21144 21977 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903494.1 protein_id gnl|my_center|LOCUS_24030 22075 23475 gene locus_tag LOCUS_24040 22075 23475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 24072 23485 gene locus_tag LOCUS_24050 24072 23485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 24235 24321 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24786 25466 gene locus_tag LOCUS_24060 24786 25466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289417.1 protein_id gnl|my_center|LOCUS_24060 25558 25629 gene locus_tag LOCUS_t00460 25558 25629 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 27423 25684 gene locus_tag LOCUS_24070 27423 25684 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256698.1 protein_id gnl|my_center|LOCUS_24070 28480 27545 gene locus_tag LOCUS_24080 28480 27545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 29321 28671 gene locus_tag LOCUS_24090 29321 28671 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902402.1 protein_id gnl|my_center|LOCUS_24090 29802 29398 gene locus_tag LOCUS_24100 29802 29398 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392702.1 protein_id gnl|my_center|LOCUS_24100 29919 30068 gene locus_tag LOCUS_24110 29919 30068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 30478 31137 gene locus_tag LOCUS_24120 30478 31137 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289405.1 protein_id gnl|my_center|LOCUS_24120 31201 32082 gene locus_tag LOCUS_24130 31201 32082 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289156.1 protein_id gnl|my_center|LOCUS_24130 32208 33386 gene locus_tag LOCUS_24140 32208 33386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 34203 33424 gene locus_tag LOCUS_24150 34203 33424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 34375 35301 gene locus_tag LOCUS_24160 34375 35301 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970367.1 protein_id gnl|my_center|LOCUS_24160 35304 36041 gene locus_tag LOCUS_24170 35304 36041 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546597.1 protein_id gnl|my_center|LOCUS_24170 36038 36802 gene locus_tag LOCUS_24180 36038 36802 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701149.1 protein_id gnl|my_center|LOCUS_24180 37464 37916 gene locus_tag LOCUS_24190 37464 37916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 37964 38722 gene locus_tag LOCUS_24200 37964 38722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 39683 38757 gene locus_tag LOCUS_24210 39683 38757 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903490.1 protein_id gnl|my_center|LOCUS_24210 39792 41234 gene locus_tag LOCUS_24220 39792 41234 CDS product glycoside hydrolase family 68 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965080.1 protein_id gnl|my_center|LOCUS_24220 <43085 41243 gene locus_tag LOCUS_24230 <43085 41243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258585.1:glycoside hydrolase family 32 protein >Feature sequence24 830 1906 gene locus_tag LOCUS_24240 830 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 1954 3111 gene locus_tag LOCUS_24250 1954 3111 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902193.1 protein_id gnl|my_center|LOCUS_24250 3196 4374 gene locus_tag LOCUS_24260 3196 4374 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903850.1 protein_id gnl|my_center|LOCUS_24260 6339 4393 gene locus_tag LOCUS_24270 6339 4393 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289512.1 protein_id gnl|my_center|LOCUS_24270 6646 6428 gene locus_tag LOCUS_24280 6646 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 6812 10174 gene locus_tag LOCUS_24290 6812 10174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 10273 11151 gene locus_tag LOCUS_24300 10273 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 11195 12223 gene locus_tag LOCUS_24310 11195 12223 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903859.1 protein_id gnl|my_center|LOCUS_24310 12220 13089 gene locus_tag LOCUS_24320 12220 13089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903860.1 protein_id gnl|my_center|LOCUS_24320 13329 13159 gene locus_tag LOCUS_24330 13329 13159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 13457 14497 gene locus_tag LOCUS_24340 13457 14497 CDS product DUF5784 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289319.1 protein_id gnl|my_center|LOCUS_24340 14901 14617 gene locus_tag LOCUS_24350 14901 14617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 15064 15870 gene locus_tag LOCUS_24360 15064 15870 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903861.1 protein_id gnl|my_center|LOCUS_24360 15897 16070 gene locus_tag LOCUS_24370 15897 16070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 16684 16187 gene locus_tag LOCUS_24380 16684 16187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 16820 17857 gene locus_tag LOCUS_24390 gene hemB 16820 17857 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903732.1 protein_id gnl|my_center|LOCUS_24390 18450 19214 gene locus_tag LOCUS_24400 18450 19214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 19308 19676 gene locus_tag LOCUS_24410 19308 19676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 20487 19993 gene locus_tag LOCUS_24420 20487 19993 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289427.1 protein_id gnl|my_center|LOCUS_24420 20588 20950 gene locus_tag LOCUS_24430 20588 20950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 22372 20993 gene locus_tag LOCUS_24440 gene serS 22372 20993 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903523.1 protein_id gnl|my_center|LOCUS_24440 24064 22931 gene locus_tag LOCUS_24450 24064 22931 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289424.1 protein_id gnl|my_center|LOCUS_24450 24246 25619 gene locus_tag LOCUS_24460 24246 25619 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289423.1 protein_id gnl|my_center|LOCUS_24460 25760 26584 gene locus_tag LOCUS_24470 25760 26584 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903514.1 protein_id gnl|my_center|LOCUS_24470 26689 28287 gene locus_tag LOCUS_24480 26689 28287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 28284 28961 gene locus_tag LOCUS_24490 28284 28961 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901944.1 protein_id gnl|my_center|LOCUS_24490 28954 30114 gene locus_tag LOCUS_24500 28954 30114 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064319.1 protein_id gnl|my_center|LOCUS_24500 30385 31530 gene locus_tag LOCUS_24510 30385 31530 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228032.1 protein_id gnl|my_center|LOCUS_24510 31617 33029 gene locus_tag LOCUS_24520 31617 33029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 33920 33111 gene locus_tag LOCUS_24530 33920 33111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 34138 35352 gene locus_tag LOCUS_24540 34138 35352 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902360.1 protein_id gnl|my_center|LOCUS_24540 35842 36597 gene locus_tag LOCUS_24550 35842 36597 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903932.1 protein_id gnl|my_center|LOCUS_24550 36590 37627 gene locus_tag LOCUS_24560 gene mer 36590 37627 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_24560 37998 37750 gene locus_tag LOCUS_24570 37998 37750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 38086 38424 gene locus_tag LOCUS_24580 38086 38424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 40275 38488 gene locus_tag LOCUS_24590 gene mutL 40275 38488 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888331.1 protein_id gnl|my_center|LOCUS_24590 <42416 40272 gene locus_tag LOCUS_24600 <42416 40272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902083.1:DNA mismatch repair protein MutS >Feature sequence25 1219 5136 gene locus_tag LOCUS_24610 gene cobN 1219 5136 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289354.1 protein_id gnl|my_center|LOCUS_24610 5242 6024 gene locus_tag LOCUS_24620 5242 6024 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903144.1 protein_id gnl|my_center|LOCUS_24620 6021 6797 gene locus_tag LOCUS_24630 6021 6797 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903145.1 protein_id gnl|my_center|LOCUS_24630 6890 8203 gene locus_tag LOCUS_24640 6890 8203 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289527.1 protein_id gnl|my_center|LOCUS_24640 8325 9710 gene locus_tag LOCUS_24650 8325 9710 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063670.1 protein_id gnl|my_center|LOCUS_24650 9739 10953 gene locus_tag LOCUS_24660 9739 10953 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809196.1 protein_id gnl|my_center|LOCUS_24660 10988 11575 gene locus_tag LOCUS_24670 10988 11575 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903704.1 protein_id gnl|my_center|LOCUS_24670 11572 13095 gene locus_tag LOCUS_24680 11572 13095 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903705.1 protein_id gnl|my_center|LOCUS_24680 13191 13625 gene locus_tag LOCUS_24690 13191 13625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 14314 13700 gene locus_tag LOCUS_24700 14314 13700 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056621.1 protein_id gnl|my_center|LOCUS_24700 15194 14418 gene locus_tag LOCUS_24710 15194 14418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 15339 15373 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15742 16869 gene locus_tag LOCUS_24720 15742 16869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 16866 17987 gene locus_tag LOCUS_24730 16866 17987 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728946.1 protein_id gnl|my_center|LOCUS_24730 17984 18871 gene locus_tag LOCUS_24740 17984 18871 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530250.1 protein_id gnl|my_center|LOCUS_24740 18864 19664 gene locus_tag LOCUS_24750 18864 19664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 19734 20060 gene locus_tag LOCUS_24760 19734 20060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 22249 20126 gene locus_tag LOCUS_24770 22249 20126 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_24770 23492 22377 gene locus_tag LOCUS_24780 23492 22377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 24188 23748 gene locus_tag LOCUS_24790 24188 23748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 25456 24263 gene locus_tag LOCUS_24800 25456 24263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 27102 25537 gene locus_tag LOCUS_24810 27102 25537 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256609.1 protein_id gnl|my_center|LOCUS_24810 27382 27894 gene locus_tag LOCUS_24820 27382 27894 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902626.1 protein_id gnl|my_center|LOCUS_24820 28864 27992 gene locus_tag LOCUS_24830 28864 27992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 29796 28861 gene locus_tag LOCUS_24840 29796 28861 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250976.1 protein_id gnl|my_center|LOCUS_24840 30205 29996 gene locus_tag LOCUS_24850 30205 29996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 30463 31008 gene locus_tag LOCUS_24860 30463 31008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 30972 32375 gene locus_tag LOCUS_24870 30972 32375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 33405 32467 gene locus_tag LOCUS_24880 33405 32467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902755.1 protein_id gnl|my_center|LOCUS_24880 34953 33487 gene locus_tag LOCUS_24890 34953 33487 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938066.1 protein_id gnl|my_center|LOCUS_24890 35056 36066 gene locus_tag LOCUS_24900 35056 36066 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902711.1 protein_id gnl|my_center|LOCUS_24900 37813 36176 gene locus_tag LOCUS_24910 37813 36176 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903150.1 protein_id gnl|my_center|LOCUS_24910 39411 37813 gene locus_tag LOCUS_24920 39411 37813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 38667 38738 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40414 39404 gene locus_tag LOCUS_24930 gene cobD 40414 39404 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903155.1 protein_id gnl|my_center|LOCUS_24930 >Feature sequence26 792 130 gene locus_tag LOCUS_24940 792 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 2864 990 gene locus_tag LOCUS_24950 gene gatE 2864 990 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902981.1 protein_id gnl|my_center|LOCUS_24950 3186 3019 gene locus_tag LOCUS_24960 3186 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 3458 4051 gene locus_tag LOCUS_24970 3458 4051 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289287.1 protein_id gnl|my_center|LOCUS_24970 5501 4083 gene locus_tag LOCUS_24980 5501 4083 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902984.1 protein_id gnl|my_center|LOCUS_24980 5599 6084 gene locus_tag LOCUS_24990 5599 6084 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902805.1 protein_id gnl|my_center|LOCUS_24990 7040 6111 gene locus_tag LOCUS_25000 7040 6111 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944001.1 protein_id gnl|my_center|LOCUS_25000 8170 7349 gene locus_tag LOCUS_25010 gene queC 8170 7349 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904151.1 protein_id gnl|my_center|LOCUS_25010 8982 8176 gene locus_tag LOCUS_25020 8982 8176 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904152.1 protein_id gnl|my_center|LOCUS_25020 9467 8982 gene locus_tag LOCUS_25030 9467 8982 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904153.1 protein_id gnl|my_center|LOCUS_25030 9536 10021 gene locus_tag LOCUS_25040 9536 10021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 10855 10106 gene locus_tag LOCUS_25050 10855 10106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 11039 11380 gene locus_tag LOCUS_25060 11039 11380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 11377 11781 gene locus_tag LOCUS_25070 11377 11781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 11768 12052 gene locus_tag LOCUS_25080 11768 12052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 12148 12675 gene locus_tag LOCUS_25090 12148 12675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 13587 12724 gene locus_tag LOCUS_25100 13587 12724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 13930 13856 gene locus_tag LOCUS_t00470 13930 13856 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 14048 14884 gene locus_tag LOCUS_25110 14048 14884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 14881 15438 gene locus_tag LOCUS_25120 14881 15438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 17556 15466 gene locus_tag LOCUS_25130 17556 15466 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289321.1 protein_id gnl|my_center|LOCUS_25130 17662 18684 gene locus_tag LOCUS_25140 17662 18684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 19329 18706 gene locus_tag LOCUS_25150 19329 18706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 20019 19459 gene locus_tag LOCUS_25160 20019 19459 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903666.1 protein_id gnl|my_center|LOCUS_25160 20468 20076 gene locus_tag LOCUS_25170 20468 20076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 20566 21435 gene locus_tag LOCUS_25180 20566 21435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 21834 21463 gene locus_tag LOCUS_25190 21834 21463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 23391 21916 gene locus_tag LOCUS_25200 23391 21916 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_25200 24092 23391 gene locus_tag LOCUS_25210 24092 23391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 24323 25183 gene locus_tag LOCUS_25220 24323 25183 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907735.1 protein_id gnl|my_center|LOCUS_25220 25414 25220 gene locus_tag LOCUS_25230 25414 25220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 26946 25492 gene locus_tag LOCUS_25240 26946 25492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 26269 26337 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27538 26957 gene locus_tag LOCUS_25250 27538 26957 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903728.1 protein_id gnl|my_center|LOCUS_25250 27667 28662 gene locus_tag LOCUS_25260 27667 28662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 29432 28716 gene locus_tag LOCUS_25270 29432 28716 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222607811.1 protein_id gnl|my_center|LOCUS_25270 29712 30359 gene locus_tag LOCUS_25280 29712 30359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 30533 32476 gene locus_tag LOCUS_25290 30533 32476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 32758 32498 gene locus_tag LOCUS_25300 32758 32498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 34014 32917 gene locus_tag LOCUS_25310 34014 32917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 34721 34011 gene locus_tag LOCUS_25320 34721 34011 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403295.1 protein_id gnl|my_center|LOCUS_25320 35822 37111 gene locus_tag LOCUS_25330 35822 37111 CDS product orc1/cdc6 family replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289079.1 protein_id gnl|my_center|LOCUS_25330 38800 37232 gene locus_tag LOCUS_25340 38800 37232 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902592.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence27 205 579 gene locus_tag LOCUS_25350 205 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 576 1217 gene locus_tag LOCUS_25360 576 1217 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902549.1 protein_id gnl|my_center|LOCUS_25360 1724 1554 gene locus_tag LOCUS_25370 1724 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 2271 1852 gene locus_tag LOCUS_25380 2271 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 2816 3202 gene locus_tag LOCUS_25390 2816 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 3178 3393 gene locus_tag LOCUS_25400 3178 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 3709 4410 gene locus_tag LOCUS_25410 3709 4410 CDS product protein sorting system archaetidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902547.1 protein_id gnl|my_center|LOCUS_25410 4493 5770 gene locus_tag LOCUS_25420 gene hisD 4493 5770 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903049.1 protein_id gnl|my_center|LOCUS_25420 5835 6224 gene locus_tag LOCUS_25430 5835 6224 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244166.1 protein_id gnl|my_center|LOCUS_25430 6296 6538 gene locus_tag LOCUS_25440 6296 6538 CDS product DUF5816 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903052.1 protein_id gnl|my_center|LOCUS_25440 6656 7234 gene locus_tag LOCUS_25450 6656 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 7443 7952 gene locus_tag LOCUS_25460 7443 7952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25460 7898 8380 gene locus_tag LOCUS_25470 7898 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25470 8465 9103 gene locus_tag LOCUS_25480 8465 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903726.1 protein_id gnl|my_center|LOCUS_25480 9100 9771 gene locus_tag LOCUS_25490 9100 9771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903725.1 protein_id gnl|my_center|LOCUS_25490 9848 10048 gene locus_tag LOCUS_25500 9848 10048 CDS product dodecin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289329.1 protein_id gnl|my_center|LOCUS_25500 10292 11329 gene locus_tag LOCUS_25510 gene trmB 10292 11329 CDS product transcriptional regulator TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892507.1 protein_id gnl|my_center|LOCUS_25510 11919 12185 gene locus_tag LOCUS_25520 11919 12185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 13002 12199 gene locus_tag LOCUS_25530 13002 12199 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405419.1 protein_id gnl|my_center|LOCUS_25530 12943 13095 gene locus_tag LOCUS_25540 12943 13095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 13132 13650 gene locus_tag LOCUS_25550 13132 13650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 14402 14001 gene locus_tag LOCUS_25560 14402 14001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 14860 15225 gene locus_tag LOCUS_25570 14860 15225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 16038 15613 gene locus_tag LOCUS_25580 16038 15613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 16660 16175 gene locus_tag LOCUS_25590 16660 16175 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903017.1 protein_id gnl|my_center|LOCUS_25590 16803 17084 gene locus_tag LOCUS_25600 16803 17084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 17136 17222 gene locus_tag LOCUS_t00480 17136 17222 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17629 17378 gene locus_tag LOCUS_25610 17629 17378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 18212 17754 gene locus_tag LOCUS_25620 18212 17754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 18316 19134 gene locus_tag LOCUS_25630 18316 19134 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903001.1 protein_id gnl|my_center|LOCUS_25630 19290 19739 gene locus_tag LOCUS_25640 19290 19739 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903000.1 protein_id gnl|my_center|LOCUS_25640 19935 21110 gene locus_tag LOCUS_25650 19935 21110 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903868.1 protein_id gnl|my_center|LOCUS_25650 22266 21130 gene locus_tag LOCUS_25660 22266 21130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 22393 23652 gene locus_tag LOCUS_25670 22393 23652 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903121.1 protein_id gnl|my_center|LOCUS_25670 23714 24745 gene locus_tag LOCUS_25680 23714 24745 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289630.1 protein_id gnl|my_center|LOCUS_25680 24865 25059 gene locus_tag LOCUS_25690 24865 25059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 25056 25901 gene locus_tag LOCUS_25700 25056 25901 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_25700 26457 25966 gene locus_tag LOCUS_25710 26457 25966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 28214 26622 gene locus_tag LOCUS_25720 28214 26622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25720 28394 28819 gene locus_tag LOCUS_25730 28394 28819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 29034 29768 gene locus_tag LOCUS_25740 29034 29768 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902086.1 protein_id gnl|my_center|LOCUS_25740 29842 30507 gene locus_tag LOCUS_25750 29842 30507 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902513.1 protein_id gnl|my_center|LOCUS_25750 30821 31183 gene locus_tag LOCUS_25760 gene rpl7ae 30821 31183 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902832.1 protein_id gnl|my_center|LOCUS_25760 31190 31414 gene locus_tag LOCUS_25770 31190 31414 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902833.1 protein_id gnl|my_center|LOCUS_25770 31417 31593 gene locus_tag LOCUS_25780 31417 31593 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902834.1 protein_id gnl|my_center|LOCUS_25780 31664 32134 gene locus_tag LOCUS_25790 gene ndk 31664 32134 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902835.1 protein_id gnl|my_center|LOCUS_25790 32932 32354 gene locus_tag LOCUS_25800 32932 32354 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776788.1 protein_id gnl|my_center|LOCUS_25800 >Feature sequence28 81 782 gene locus_tag LOCUS_25810 81 782 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902203.1 protein_id gnl|my_center|LOCUS_25810 872 1828 gene locus_tag LOCUS_25820 872 1828 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257625.1 protein_id gnl|my_center|LOCUS_25820 2028 2372 gene locus_tag LOCUS_25830 2028 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 3686 2382 gene locus_tag LOCUS_25840 3686 2382 CDS product 5'-deoxyadenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902871.1 protein_id gnl|my_center|LOCUS_25840 3842 4720 gene locus_tag LOCUS_25850 3842 4720 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142419.1 protein_id gnl|my_center|LOCUS_25850 5614 4799 gene locus_tag LOCUS_25860 5614 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 5794 6612 gene locus_tag LOCUS_25870 5794 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 6686 6883 gene locus_tag LOCUS_25880 6686 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 7764 6901 gene locus_tag LOCUS_25890 7764 6901 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902207.1 protein_id gnl|my_center|LOCUS_25890 11275 7757 gene locus_tag LOCUS_25900 gene smc 11275 7757 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902208.1 protein_id gnl|my_center|LOCUS_25900 11661 11341 gene locus_tag LOCUS_25910 11661 11341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 11896 12819 gene locus_tag LOCUS_25920 11896 12819 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902990.1 protein_id gnl|my_center|LOCUS_25920 12816 13742 gene locus_tag LOCUS_25930 12816 13742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 14267 13800 gene locus_tag LOCUS_25940 14267 13800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902265.1 protein_id gnl|my_center|LOCUS_25940 14761 14264 gene locus_tag LOCUS_25950 14761 14264 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902263.1 protein_id gnl|my_center|LOCUS_25950 14991 15506 gene locus_tag LOCUS_25960 14991 15506 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971886.1 protein_id gnl|my_center|LOCUS_25960 15598 16560 gene locus_tag LOCUS_25970 15598 16560 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902202.1 protein_id gnl|my_center|LOCUS_25970 17144 16596 gene locus_tag LOCUS_25980 17144 16596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 17250 19604 gene locus_tag LOCUS_25990 gene ppsA 17250 19604 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902200.1 protein_id gnl|my_center|LOCUS_25990 19704 20309 gene locus_tag LOCUS_26000 19704 20309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 21449 20361 gene locus_tag LOCUS_26010 21449 20361 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903126.1 protein_id gnl|my_center|LOCUS_26010 22000 21653 gene locus_tag LOCUS_26020 22000 21653 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903020.1 protein_id gnl|my_center|LOCUS_26020 22539 22096 gene locus_tag LOCUS_26030 22539 22096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 22671 24014 gene locus_tag LOCUS_26040 22671 24014 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902096.1 protein_id gnl|my_center|LOCUS_26040 25684 24884 gene locus_tag LOCUS_26050 25684 24884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 26463 26104 gene locus_tag LOCUS_26060 26463 26104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 27189 26509 gene locus_tag LOCUS_26070 27189 26509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 27546 28352 gene locus_tag LOCUS_26080 27546 28352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 28873 28550 gene locus_tag LOCUS_26090 28873 28550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 >Feature sequence29 402 1082 gene locus_tag LOCUS_26100 402 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 1248 1700 gene locus_tag LOCUS_26110 1248 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 1884 1957 gene locus_tag LOCUS_t00490 1884 1957 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2715 2155 gene locus_tag LOCUS_26120 gene cgi121 2715 2155 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903768.1 protein_id gnl|my_center|LOCUS_26120 5243 2712 gene locus_tag LOCUS_26130 5243 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 6078 5353 gene locus_tag LOCUS_26140 6078 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 6215 6583 gene locus_tag LOCUS_26150 6215 6583 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289522.1 protein_id gnl|my_center|LOCUS_26150 6580 7128 gene locus_tag LOCUS_26160 6580 7128 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903885.1 protein_id gnl|my_center|LOCUS_26160 7629 7183 gene locus_tag LOCUS_26170 7629 7183 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903884.1 protein_id gnl|my_center|LOCUS_26170 9547 7706 gene locus_tag LOCUS_26180 gene pheT 9547 7706 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903870.1 protein_id gnl|my_center|LOCUS_26180 11049 9547 gene locus_tag LOCUS_26190 11049 9547 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903869.1 protein_id gnl|my_center|LOCUS_26190 11951 12967 gene locus_tag LOCUS_26200 11951 12967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 14886 13096 gene locus_tag LOCUS_26210 14886 13096 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903639.1 protein_id gnl|my_center|LOCUS_26210 13171 13247 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15968 14883 gene locus_tag LOCUS_26220 gene endA 15968 14883 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903640.1 protein_id gnl|my_center|LOCUS_26220 16792 16025 gene locus_tag LOCUS_26230 16792 16025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 16936 17781 gene locus_tag LOCUS_26240 16936 17781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 20066 17724 gene locus_tag LOCUS_26250 20066 17724 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903642.1 protein_id gnl|my_center|LOCUS_26250 21163 20462 gene locus_tag LOCUS_26260 21163 20462 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_26260 21272 21766 gene locus_tag LOCUS_26270 21272 21766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 21847 24498 gene locus_tag LOCUS_26280 gene valS 21847 24498 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060895.1 protein_id gnl|my_center|LOCUS_26280 24564 24836 gene locus_tag LOCUS_26290 24564 24836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 25913 24858 gene locus_tag LOCUS_26300 25913 24858 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903871.1 protein_id gnl|my_center|LOCUS_26300 26171 25974 gene locus_tag LOCUS_26310 26171 25974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 26367 26705 gene locus_tag LOCUS_26320 26367 26705 CDS product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903872.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence30 611 964 gene locus_tag LOCUS_26330 611 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 2019 1087 gene locus_tag LOCUS_26340 2019 1087 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902918.1 protein_id gnl|my_center|LOCUS_26340 3710 2031 gene locus_tag LOCUS_26350 3710 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 3992 4996 gene locus_tag LOCUS_26360 3992 4996 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902989.1 protein_id gnl|my_center|LOCUS_26360 6415 5138 gene locus_tag LOCUS_26370 6415 5138 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270475.1 protein_id gnl|my_center|LOCUS_26370 7207 6575 gene locus_tag LOCUS_26380 7207 6575 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903016.1 protein_id gnl|my_center|LOCUS_26380 8274 7207 gene locus_tag LOCUS_26390 8274 7207 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903099.1 protein_id gnl|my_center|LOCUS_26390 8970 8296 gene locus_tag LOCUS_26400 8970 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 9625 8996 gene locus_tag LOCUS_26410 9625 8996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 11734 9629 gene locus_tag LOCUS_26420 gene rqcH 11734 9629 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903100.1 protein_id gnl|my_center|LOCUS_26420 13489 12176 gene locus_tag LOCUS_26430 13489 12176 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403144.1 protein_id gnl|my_center|LOCUS_26430 13653 13982 gene locus_tag LOCUS_26440 13653 13982 CDS product DUF5785 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902883.1 protein_id gnl|my_center|LOCUS_26440 13992 14681 gene locus_tag LOCUS_26450 13992 14681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 15494 14730 gene locus_tag LOCUS_26460 gene udk 15494 14730 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289294.1 protein_id gnl|my_center|LOCUS_26460 15662 16990 gene locus_tag LOCUS_26470 15662 16990 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537683.1 protein_id gnl|my_center|LOCUS_26470 17191 18339 gene locus_tag LOCUS_26480 17191 18339 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436463.1 protein_id gnl|my_center|LOCUS_26480 18412 18567 gene locus_tag LOCUS_26490 18412 18567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 19329 18595 gene locus_tag LOCUS_26500 19329 18595 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868772.1 protein_id gnl|my_center|LOCUS_26500 19610 19685 gene locus_tag LOCUS_t00500 19610 19685 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 19815 20060 gene locus_tag LOCUS_26510 19815 20060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 20183 21397 gene locus_tag LOCUS_26520 20183 21397 CDS product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978098.1 protein_id gnl|my_center|LOCUS_26520 >Feature sequence31 537 187 gene locus_tag LOCUS_26530 537 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404526.1 protein_id gnl|my_center|LOCUS_26530 652 1452 gene locus_tag LOCUS_26540 652 1452 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903358.1 protein_id gnl|my_center|LOCUS_26540 1449 2393 gene locus_tag LOCUS_26550 1449 2393 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903356.1 protein_id gnl|my_center|LOCUS_26550 2489 4039 gene locus_tag LOCUS_26560 2489 4039 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 protein_id gnl|my_center|LOCUS_26560 4041 4385 gene locus_tag LOCUS_26570 4041 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903115.1 protein_id gnl|my_center|LOCUS_26570 4499 6133 gene locus_tag LOCUS_26580 4499 6133 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903116.1 protein_id gnl|my_center|LOCUS_26580 6109 6240 gene locus_tag LOCUS_26590 6109 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26590 6391 6726 gene locus_tag LOCUS_26600 6391 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 7847 6744 gene locus_tag LOCUS_26610 7847 6744 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903025.1 protein_id gnl|my_center|LOCUS_26610 8245 8051 gene locus_tag LOCUS_26620 8245 8051 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903043.1 protein_id gnl|my_center|LOCUS_26620 9264 8563 gene locus_tag LOCUS_26630 9264 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 10124 9261 gene locus_tag LOCUS_26640 10124 9261 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020739.1 protein_id gnl|my_center|LOCUS_26640 <10956 10121 gene locus_tag LOCUS_26650 <10956 10121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289327.1:tRNA-dihydrouridine synthase >Feature sequence32 955 251 gene locus_tag LOCUS_26660 955 251 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421609.1 protein_id gnl|my_center|LOCUS_26660 1662 952 gene locus_tag LOCUS_26670 1662 952 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289175.1 protein_id gnl|my_center|LOCUS_26670 2926 1730 gene locus_tag LOCUS_26680 2926 1730 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902360.1 protein_id gnl|my_center|LOCUS_26680 3056 4360 gene locus_tag LOCUS_26690 3056 4360 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289176.1 protein_id gnl|my_center|LOCUS_26690 5611 4451 gene locus_tag LOCUS_26700 gene pdhA 5611 4451 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535910.1 protein_id gnl|my_center|LOCUS_26700 6053 5745 gene locus_tag LOCUS_26710 6053 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26710 6067 6738 gene locus_tag LOCUS_26720 6067 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 6892 7962 gene locus_tag LOCUS_26730 6892 7962 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086462.1 protein_id gnl|my_center|LOCUS_26730 7962 8900 gene locus_tag LOCUS_26740 7962 8900 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086463.1 protein_id gnl|my_center|LOCUS_26740