>Feature sequence001 3020 948 gene locus_tag LOCUS_00010 3020 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3060 3680 gene locus_tag LOCUS_00020 3060 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3721 4704 gene locus_tag LOCUS_00030 3721 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4701 6407 gene locus_tag LOCUS_00040 4701 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7163 6456 gene locus_tag LOCUS_00050 7163 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7105 7521 gene locus_tag LOCUS_00060 7105 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9043 7562 gene locus_tag LOCUS_00070 9043 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10317 9040 gene locus_tag LOCUS_00080 10317 9040 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258489.1 protein_id gnl|my_center|LOCUS_00080 11805 10432 gene locus_tag LOCUS_00090 11805 10432 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804962.1 protein_id gnl|my_center|LOCUS_00090 12401 11970 gene locus_tag LOCUS_00100 12401 11970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12563 13432 gene locus_tag LOCUS_00110 12563 13432 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_00110 13429 14796 gene locus_tag LOCUS_00120 gene coaBC 13429 14796 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_00120 14796 15719 gene locus_tag LOCUS_00130 gene panB 14796 15719 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258071.1 protein_id gnl|my_center|LOCUS_00130 15724 16572 gene locus_tag LOCUS_00140 gene panC 15724 16572 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258070.1 protein_id gnl|my_center|LOCUS_00140 16719 17849 gene locus_tag LOCUS_00150 16719 17849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18159 19247 gene locus_tag LOCUS_00160 18159 19247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19969 19364 gene locus_tag LOCUS_00170 19969 19364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 20394 21815 gene locus_tag LOCUS_00180 20394 21815 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_00180 23568 22219 gene locus_tag LOCUS_00190 23568 22219 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257569.1 protein_id gnl|my_center|LOCUS_00190 24628 23783 gene locus_tag LOCUS_00200 24628 23783 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459812.1 protein_id gnl|my_center|LOCUS_00200 26035 24707 gene locus_tag LOCUS_00210 26035 24707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 26259 26528 gene locus_tag LOCUS_00220 26259 26528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 26748 27821 gene locus_tag LOCUS_00230 26748 27821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 28241 27882 gene locus_tag LOCUS_00240 28241 27882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 28294 29463 gene locus_tag LOCUS_00250 28294 29463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 34281 29551 gene locus_tag LOCUS_00260 34281 29551 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109508967.1 protein_id gnl|my_center|LOCUS_00260 35368 34856 gene locus_tag LOCUS_00270 35368 34856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 37554 35770 gene locus_tag LOCUS_00280 37554 35770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 37731 38258 gene locus_tag LOCUS_00290 37731 38258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 39642 38302 gene locus_tag LOCUS_00300 39642 38302 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_00300 40399 39776 gene locus_tag LOCUS_00310 40399 39776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 40511 41374 gene locus_tag LOCUS_00320 40511 41374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 41399 42100 gene locus_tag LOCUS_00330 41399 42100 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653302.1 protein_id gnl|my_center|LOCUS_00330 44406 42166 gene locus_tag LOCUS_00340 44406 42166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 45046 44708 gene locus_tag LOCUS_00350 45046 44708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00350 45006 45215 gene locus_tag LOCUS_00360 45006 45215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 45379 46644 gene locus_tag LOCUS_00370 45379 46644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 46776 47687 gene locus_tag LOCUS_00380 46776 47687 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227088.1 protein_id gnl|my_center|LOCUS_00380 47783 48454 gene locus_tag LOCUS_00390 47783 48454 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404111.1 protein_id gnl|my_center|LOCUS_00390 49453 48788 gene locus_tag LOCUS_00400 49453 48788 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469637.1 protein_id gnl|my_center|LOCUS_00400 52188 49585 gene locus_tag LOCUS_00410 52188 49585 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255972.1 protein_id gnl|my_center|LOCUS_00410 52836 52192 gene locus_tag LOCUS_00420 52836 52192 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029799.1 protein_id gnl|my_center|LOCUS_00420 52723 52965 gene locus_tag LOCUS_00430 52723 52965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 53936 53091 gene locus_tag LOCUS_00440 53936 53091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 54333 54408 gene locus_tag LOCUS_t00010 54333 54408 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 55043 54702 gene locus_tag LOCUS_00450 55043 54702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 55340 56149 gene locus_tag LOCUS_00460 55340 56149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 56462 58099 gene locus_tag LOCUS_00470 56462 58099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 58831 58127 gene locus_tag LOCUS_00480 58831 58127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 58988 59737 gene locus_tag LOCUS_00490 58988 59737 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222221.1 protein_id gnl|my_center|LOCUS_00490 61235 59691 gene locus_tag LOCUS_00500 61235 59691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 61925 61254 gene locus_tag LOCUS_00510 61925 61254 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226904.1 protein_id gnl|my_center|LOCUS_00510 62487 61936 gene locus_tag LOCUS_00520 62487 61936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 63718 62516 gene locus_tag LOCUS_00530 63718 62516 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530116.1 protein_id gnl|my_center|LOCUS_00530 64413 63715 gene locus_tag LOCUS_00540 64413 63715 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839105.1 protein_id gnl|my_center|LOCUS_00540 65930 64410 gene locus_tag LOCUS_00550 65930 64410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 67294 66149 gene locus_tag LOCUS_00560 67294 66149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 >Feature sequence002 1641 595 gene locus_tag LOCUS_00570 1641 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 2531 1641 gene locus_tag LOCUS_00580 2531 1641 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391801.1 protein_id gnl|my_center|LOCUS_00580 3454 2531 gene locus_tag LOCUS_00590 gene prmC 3454 2531 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393873.1 protein_id gnl|my_center|LOCUS_00590 4578 3496 gene locus_tag LOCUS_00600 gene prfA 4578 3496 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947982.1 protein_id gnl|my_center|LOCUS_00600 5738 4575 gene locus_tag LOCUS_00610 5738 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 6067 5855 gene locus_tag LOCUS_00620 gene rpmE 6067 5855 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933240.1 protein_id gnl|my_center|LOCUS_00620 6427 6164 gene locus_tag LOCUS_00630 gene rpmA 6427 6164 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816541.1 protein_id gnl|my_center|LOCUS_00630 7152 6430 gene locus_tag LOCUS_00640 7152 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 7997 7215 gene locus_tag LOCUS_00650 7997 7215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 9520 8114 gene locus_tag LOCUS_00660 9520 8114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 11544 9517 gene locus_tag LOCUS_00670 11544 9517 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542452.1 protein_id gnl|my_center|LOCUS_00670 13011 11851 gene locus_tag LOCUS_00680 13011 11851 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256594.1 protein_id gnl|my_center|LOCUS_00680 15111 13027 gene locus_tag LOCUS_00690 gene mrdA 15111 13027 CDS product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776197.1 protein_id gnl|my_center|LOCUS_00690 15619 15116 gene locus_tag LOCUS_00700 15619 15116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 16766 17611 gene locus_tag LOCUS_00710 16766 17611 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_00710 17608 18471 gene locus_tag LOCUS_00720 17608 18471 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806881.1 protein_id gnl|my_center|LOCUS_00720 18468 20690 gene locus_tag LOCUS_00730 gene gyrB 18468 20690 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947898.1 protein_id gnl|my_center|LOCUS_00730 20683 21318 gene locus_tag LOCUS_00740 20683 21318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 21569 24127 gene locus_tag LOCUS_00750 gene gyrA 21569 24127 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_00750 24124 25323 gene locus_tag LOCUS_00760 24124 25323 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259441.1 protein_id gnl|my_center|LOCUS_00760 25320 25562 gene locus_tag LOCUS_00770 25320 25562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 25726 28671 gene locus_tag LOCUS_00780 gene secA 25726 28671 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_00780 28775 29509 gene locus_tag LOCUS_00790 28775 29509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 29725 29949 gene locus_tag LOCUS_00800 29725 29949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 30133 31080 gene locus_tag LOCUS_00810 gene prfB 30133 31080 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018379.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00810 31082 32050 gene locus_tag LOCUS_00820 31082 32050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 32223 32909 gene locus_tag LOCUS_00830 gene ftsE 32223 32909 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263537.1 protein_id gnl|my_center|LOCUS_00830 32910 33791 gene locus_tag LOCUS_00840 gene ftsX 32910 33791 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391789.1 protein_id gnl|my_center|LOCUS_00840 33837 35264 gene locus_tag LOCUS_00850 33837 35264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 35606 36085 gene locus_tag LOCUS_00860 gene smpB 35606 36085 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583706.1 protein_id gnl|my_center|LOCUS_00860 36290 38443 gene locus_tag LOCUS_00870 36290 38443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 39607 38999 gene locus_tag LOCUS_00880 39607 38999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 39949 41169 gene locus_tag LOCUS_00890 39949 41169 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028234.1 protein_id gnl|my_center|LOCUS_00890 43384 41264 gene locus_tag LOCUS_00900 43384 41264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 44732 43623 gene locus_tag LOCUS_00910 44732 43623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 46020 44734 gene locus_tag LOCUS_00920 46020 44734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 46536 46201 gene locus_tag LOCUS_00930 46536 46201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 46706 46572 gene locus_tag LOCUS_00940 gene rpmH 46706 46572 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012547104.1 protein_id gnl|my_center|LOCUS_00940 47152 48528 gene locus_tag LOCUS_00950 gene dnaA 47152 48528 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255915.1 protein_id gnl|my_center|LOCUS_00950 49022 50140 gene locus_tag LOCUS_00960 gene dnaN 49022 50140 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_00960 50324 51376 gene locus_tag LOCUS_00970 gene recF 50324 51376 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641631.1 protein_id gnl|my_center|LOCUS_00970 51373 51750 gene locus_tag LOCUS_00980 51373 51750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 51835 54141 gene locus_tag LOCUS_00990 51835 54141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 54184 54717 gene locus_tag LOCUS_01000 54184 54717 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257304.1 protein_id gnl|my_center|LOCUS_01000 55640 54837 gene locus_tag LOCUS_01010 55640 54837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 57574 55769 gene locus_tag LOCUS_01020 57574 55769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 59357 57564 gene locus_tag LOCUS_01030 59357 57564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 >Feature sequence003 40 765 gene locus_tag LOCUS_01040 40 765 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730268.1 protein_id gnl|my_center|LOCUS_01040 811 1536 gene locus_tag LOCUS_01050 811 1536 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256823.1 protein_id gnl|my_center|LOCUS_01050 1783 2400 gene locus_tag LOCUS_01060 1783 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 2400 2990 gene locus_tag LOCUS_01070 2400 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 3007 4647 gene locus_tag LOCUS_01080 3007 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 4887 5399 gene locus_tag LOCUS_01090 4887 5399 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_01090 5389 6816 gene locus_tag LOCUS_01100 5389 6816 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_01100 6839 8260 gene locus_tag LOCUS_01110 6839 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 8261 9271 gene locus_tag LOCUS_01120 gene galE 8261 9271 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224287.1 protein_id gnl|my_center|LOCUS_01120 9299 9985 gene locus_tag LOCUS_01130 9299 9985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 10038 11492 gene locus_tag LOCUS_01140 10038 11492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 11489 13540 gene locus_tag LOCUS_01150 11489 13540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 13537 14751 gene locus_tag LOCUS_01160 13537 14751 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039287.1 protein_id gnl|my_center|LOCUS_01160 14748 15644 gene locus_tag LOCUS_01170 14748 15644 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889063.1 protein_id gnl|my_center|LOCUS_01170 15686 16099 gene locus_tag LOCUS_01180 15686 16099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 16260 16778 gene locus_tag LOCUS_01190 16260 16778 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403827.1 protein_id gnl|my_center|LOCUS_01190 17043 17765 gene locus_tag LOCUS_01200 17043 17765 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_01200 17758 19218 gene locus_tag LOCUS_01210 17758 19218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 20109 19294 gene locus_tag LOCUS_01220 20109 19294 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142937.1 protein_id gnl|my_center|LOCUS_01220 20191 20757 gene locus_tag LOCUS_01230 20191 20757 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_01230 21315 20800 gene locus_tag LOCUS_01240 21315 20800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 22391 21468 gene locus_tag LOCUS_01250 22391 21468 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228684.1 protein_id gnl|my_center|LOCUS_01250 23335 22388 gene locus_tag LOCUS_01260 23335 22388 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_01260 22842 22775 gene locus_tag LOCUS_t00020 22842 22775 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 24866 23457 gene locus_tag LOCUS_01270 24866 23457 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228682.1 protein_id gnl|my_center|LOCUS_01270 26753 24999 gene locus_tag LOCUS_01280 26753 24999 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972134.1 protein_id gnl|my_center|LOCUS_01280 27949 26969 gene locus_tag LOCUS_01290 27949 26969 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031380.1 protein_id gnl|my_center|LOCUS_01290 28144 30678 gene locus_tag LOCUS_01300 28144 30678 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229028.1 protein_id gnl|my_center|LOCUS_01300 31385 31855 gene locus_tag LOCUS_01310 31385 31855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 31883 32110 gene locus_tag LOCUS_01320 31883 32110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 32323 32832 gene locus_tag LOCUS_01330 32323 32832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 33388 33167 gene locus_tag LOCUS_01340 33388 33167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 33387 33731 gene locus_tag LOCUS_01350 33387 33731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 33728 35893 gene locus_tag LOCUS_01360 33728 35893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 35872 37512 gene locus_tag LOCUS_01370 35872 37512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 37590 38831 gene locus_tag LOCUS_01380 37590 38831 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139561.1 protein_id gnl|my_center|LOCUS_01380 38828 39130 gene locus_tag LOCUS_01390 38828 39130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 39253 39879 gene locus_tag LOCUS_01400 39253 39879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 39983 40804 gene locus_tag LOCUS_01410 39983 40804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 40917 42179 gene locus_tag LOCUS_01420 40917 42179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 42190 43833 gene locus_tag LOCUS_01430 42190 43833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 43835 44845 gene locus_tag LOCUS_01440 43835 44845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 44845 46755 gene locus_tag LOCUS_01450 gene asnB 44845 46755 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868273.1 protein_id gnl|my_center|LOCUS_01450 46674 46991 gene locus_tag LOCUS_01460 46674 46991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 46984 48141 gene locus_tag LOCUS_01470 46984 48141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 48446 48147 gene locus_tag LOCUS_01480 48446 48147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 48878 48522 gene locus_tag LOCUS_01490 48878 48522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 48810 49454 gene locus_tag LOCUS_01500 48810 49454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 49933 50124 gene locus_tag LOCUS_01510 49933 50124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 50164 50511 gene locus_tag LOCUS_01520 50164 50511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 51281 50436 gene locus_tag LOCUS_01530 51281 50436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 51690 51851 gene locus_tag LOCUS_01540 51690 51851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 53337 52009 gene locus_tag LOCUS_01550 gene rkpK 53337 52009 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974890.1 protein_id gnl|my_center|LOCUS_01550 54387 53347 gene locus_tag LOCUS_01560 54387 53347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 54821 56137 gene locus_tag LOCUS_01570 54821 56137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 55348 55456 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 56256 57677 gene locus_tag LOCUS_01580 56256 57677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 57782 58621 gene locus_tag LOCUS_01590 57782 58621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 59195 58731 gene locus_tag LOCUS_01600 59195 58731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 59477 60193 gene locus_tag LOCUS_01610 59477 60193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 >Feature sequence004 677 1033 gene locus_tag LOCUS_01620 677 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 1030 1356 gene locus_tag LOCUS_01630 1030 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 1483 1983 gene locus_tag LOCUS_01640 1483 1983 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_01640 1980 2747 gene locus_tag LOCUS_01650 gene ubiE 1980 2747 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392794.1 protein_id gnl|my_center|LOCUS_01650 3110 2790 gene locus_tag LOCUS_01660 3110 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 3265 4176 gene locus_tag LOCUS_01670 gene lgt 3265 4176 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257228.1 protein_id gnl|my_center|LOCUS_01670 4657 4253 gene locus_tag LOCUS_01680 4657 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 4975 6426 gene locus_tag LOCUS_01690 4975 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 6234 6291 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6371 6703 gene locus_tag LOCUS_01700 6371 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 6909 7853 gene locus_tag LOCUS_01710 gene mdh 6909 7853 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_01710 8247 9371 gene locus_tag LOCUS_01720 8247 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 9555 10877 gene locus_tag LOCUS_01730 9555 10877 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227687.1 protein_id gnl|my_center|LOCUS_01730 10930 12456 gene locus_tag LOCUS_01740 gene gltX 10930 12456 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583633.1 protein_id gnl|my_center|LOCUS_01740 12471 13169 gene locus_tag LOCUS_01750 12471 13169 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_01750 14241 13228 gene locus_tag LOCUS_01760 14241 13228 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939581.1 protein_id gnl|my_center|LOCUS_01760 14575 15795 gene locus_tag LOCUS_01770 14575 15795 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388259.1 protein_id gnl|my_center|LOCUS_01770 15842 16723 gene locus_tag LOCUS_01780 15842 16723 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529194.1 protein_id gnl|my_center|LOCUS_01780 16734 17630 gene locus_tag LOCUS_01790 16734 17630 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529687.1 protein_id gnl|my_center|LOCUS_01790 17654 18829 gene locus_tag LOCUS_01800 17654 18829 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972096.1 protein_id gnl|my_center|LOCUS_01800 18884 19828 gene locus_tag LOCUS_01810 18884 19828 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140222.1 protein_id gnl|my_center|LOCUS_01810 19961 20299 gene locus_tag LOCUS_01820 19961 20299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 20377 20583 gene locus_tag LOCUS_01830 20377 20583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 20931 21362 gene locus_tag LOCUS_01840 20931 21362 CDS product DUF4260 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088113.1 protein_id gnl|my_center|LOCUS_01840 21449 21982 gene locus_tag LOCUS_01850 21449 21982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01850 22314 22051 gene locus_tag LOCUS_01860 22314 22051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 23232 22339 gene locus_tag LOCUS_01870 23232 22339 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206428.1 protein_id gnl|my_center|LOCUS_01870 24512 23229 gene locus_tag LOCUS_01880 24512 23229 CDS product 2-aminoethylphosphonate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525538.1 protein_id gnl|my_center|LOCUS_01880 24862 24497 gene locus_tag LOCUS_01890 24862 24497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 25016 26134 gene locus_tag LOCUS_01900 25016 26134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 27048 26347 gene locus_tag LOCUS_01910 gene phoU 27048 26347 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965016.1 protein_id gnl|my_center|LOCUS_01910 28037 27168 gene locus_tag LOCUS_01920 gene pstB 28037 27168 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_01920 28934 28050 gene locus_tag LOCUS_01930 gene pstA 28934 28050 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889419.1 protein_id gnl|my_center|LOCUS_01930 29910 28924 gene locus_tag LOCUS_01940 gene pstC 29910 28924 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140449.1 protein_id gnl|my_center|LOCUS_01940 31220 29991 gene locus_tag LOCUS_01950 gene pstS 31220 29991 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036712.1 protein_id gnl|my_center|LOCUS_01950 32111 31296 gene locus_tag LOCUS_01960 32111 31296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 32856 32236 gene locus_tag LOCUS_01970 32856 32236 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_01970 33036 34364 gene locus_tag LOCUS_01980 33036 34364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 34930 34385 gene locus_tag LOCUS_01990 34930 34385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 35536 35036 gene locus_tag LOCUS_02000 35536 35036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 36393 35617 gene locus_tag LOCUS_02010 gene phoU 36393 35617 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722627.1 protein_id gnl|my_center|LOCUS_02010 36926 36651 gene locus_tag LOCUS_02020 36926 36651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 38916 37156 gene locus_tag LOCUS_02030 38916 37156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 41104 38939 gene locus_tag LOCUS_02040 gene ppk1 41104 38939 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141500.1 protein_id gnl|my_center|LOCUS_02040 41634 41287 gene locus_tag LOCUS_02050 41634 41287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 41921 41640 gene locus_tag LOCUS_02060 41921 41640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 42311 41964 gene locus_tag LOCUS_02070 42311 41964 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979093.1 protein_id gnl|my_center|LOCUS_02070 42832 42488 gene locus_tag LOCUS_02080 42832 42488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 42916 45501 gene locus_tag LOCUS_02090 42916 45501 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139455818.1 protein_id gnl|my_center|LOCUS_02090 45604 45813 gene locus_tag LOCUS_02100 45604 45813 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111744.1 protein_id gnl|my_center|LOCUS_02100 45785 46195 gene locus_tag LOCUS_02110 45785 46195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 46315 47259 gene locus_tag LOCUS_02120 46315 47259 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233262.1 protein_id gnl|my_center|LOCUS_02120 47256 48560 gene locus_tag LOCUS_02130 47256 48560 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230150.1 protein_id gnl|my_center|LOCUS_02130 49417 48683 gene locus_tag LOCUS_02140 49417 48683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 50622 49471 gene locus_tag LOCUS_02150 50622 49471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 51558 50686 gene locus_tag LOCUS_02160 51558 50686 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226734.1 protein_id gnl|my_center|LOCUS_02160 51521 51682 gene locus_tag LOCUS_02170 51521 51682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 51762 52988 gene locus_tag LOCUS_02180 51762 52988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 53070 54479 gene locus_tag LOCUS_02190 gene argH 53070 54479 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388156.1 protein_id gnl|my_center|LOCUS_02190 54567 54827 gene locus_tag LOCUS_02200 54567 54827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 55358 54837 gene locus_tag LOCUS_02210 55358 54837 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974845.1 protein_id gnl|my_center|LOCUS_02210 55624 56154 gene locus_tag LOCUS_02220 55624 56154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02220 56090 56926 gene locus_tag LOCUS_02230 56090 56926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02230 >Feature sequence005 <1 1350 gene locus_tag LOCUS_02240 <1 1350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392586.1:DNA translocase FtsK 1347 2828 gene locus_tag LOCUS_02250 1347 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 2885 3343 gene locus_tag LOCUS_02260 2885 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 3340 4860 gene locus_tag LOCUS_02270 gene murC 3340 4860 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729655.1 protein_id gnl|my_center|LOCUS_02270 5028 5519 gene locus_tag LOCUS_02280 5028 5519 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056636.1 protein_id gnl|my_center|LOCUS_02280 5570 7507 gene locus_tag LOCUS_02290 5570 7507 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113513.1 protein_id gnl|my_center|LOCUS_02290 9008 7524 gene locus_tag LOCUS_02300 9008 7524 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_02300 10625 9192 gene locus_tag LOCUS_02310 10625 9192 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860163.1 protein_id gnl|my_center|LOCUS_02310 13012 10811 gene locus_tag LOCUS_02320 13012 10811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 13288 13572 gene locus_tag LOCUS_02330 13288 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 15099 13648 gene locus_tag LOCUS_02340 15099 13648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 15561 15205 gene locus_tag LOCUS_02350 15561 15205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 16051 15578 gene locus_tag LOCUS_02360 16051 15578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 16305 16769 gene locus_tag LOCUS_02370 16305 16769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 16370 16391 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17279 16932 gene locus_tag LOCUS_02380 17279 16932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 17726 17340 gene locus_tag LOCUS_02390 17726 17340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 17902 20877 gene locus_tag LOCUS_02400 17902 20877 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387995.1 protein_id gnl|my_center|LOCUS_02400 20874 21413 gene locus_tag LOCUS_02410 20874 21413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 21400 21813 gene locus_tag LOCUS_02420 21400 21813 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227979.1 protein_id gnl|my_center|LOCUS_02420 21889 25224 gene locus_tag LOCUS_02430 21889 25224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 25248 25691 gene locus_tag LOCUS_02440 25248 25691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 25862 25698 gene locus_tag LOCUS_02450 25862 25698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552967.1 protein_id gnl|my_center|LOCUS_02450 26049 29540 gene locus_tag LOCUS_02460 26049 29540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 30711 29620 gene locus_tag LOCUS_02470 30711 29620 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_02470 31057 30701 gene locus_tag LOCUS_02480 31057 30701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 31088 32374 gene locus_tag LOCUS_02490 31088 32374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 32952 32560 gene locus_tag LOCUS_02500 32952 32560 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392211.1 protein_id gnl|my_center|LOCUS_02500 33194 32949 gene locus_tag LOCUS_02510 33194 32949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 34309 33551 gene locus_tag LOCUS_02520 34309 33551 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226565.1 protein_id gnl|my_center|LOCUS_02520 34278 34496 gene locus_tag LOCUS_02530 34278 34496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 36248 34929 gene locus_tag LOCUS_02540 gene hflX 36248 34929 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_02540 37279 36320 gene locus_tag LOCUS_02550 gene miaA 37279 36320 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228033.1 protein_id gnl|my_center|LOCUS_02550 38981 37290 gene locus_tag LOCUS_02560 gene miaB 38981 37290 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125530.1 protein_id gnl|my_center|LOCUS_02560 39997 38978 gene locus_tag LOCUS_02570 39997 38978 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_02570 40841 39999 gene locus_tag LOCUS_02580 40841 39999 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881166.1 protein_id gnl|my_center|LOCUS_02580 42377 40848 gene locus_tag LOCUS_02590 gene rny 42377 40848 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_02590 42811 43410 gene locus_tag LOCUS_02600 42811 43410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 44250 43648 gene locus_tag LOCUS_02610 44250 43648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 45326 44256 gene locus_tag LOCUS_02620 gene recA 45326 44256 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_02620 45545 45393 gene locus_tag LOCUS_02630 45545 45393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 46788 45586 gene locus_tag LOCUS_02640 gene tgt 46788 45586 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_02640 47045 46788 gene locus_tag LOCUS_02650 47045 46788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02650 47529 47017 gene locus_tag LOCUS_02660 47529 47017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02660 47557 47630 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48044 48532 gene locus_tag LOCUS_02670 48044 48532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 49118 48522 gene locus_tag LOCUS_02680 gene ruvA 49118 48522 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460360.1 protein_id gnl|my_center|LOCUS_02680 49767 49129 gene locus_tag LOCUS_02690 gene ruvC 49767 49129 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_02690 50510 49767 gene locus_tag LOCUS_02700 50510 49767 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460362.1 protein_id gnl|my_center|LOCUS_02700 >Feature sequence006 1469 477 gene locus_tag LOCUS_02710 1469 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 1530 1790 gene locus_tag LOCUS_02720 1530 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 1803 2105 gene locus_tag LOCUS_02730 1803 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 2181 2675 gene locus_tag LOCUS_02740 2181 2675 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771208.1 protein_id gnl|my_center|LOCUS_02740 2753 3013 gene locus_tag LOCUS_02750 2753 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 4169 3027 gene locus_tag LOCUS_02760 4169 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 4630 4250 gene locus_tag LOCUS_02770 4630 4250 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388650.1 protein_id gnl|my_center|LOCUS_02770 4841 4632 gene locus_tag LOCUS_02780 4841 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 5043 6107 gene locus_tag LOCUS_02790 5043 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 6559 6131 gene locus_tag LOCUS_02800 6559 6131 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403386.1 protein_id gnl|my_center|LOCUS_02800 7748 6903 gene locus_tag LOCUS_02810 7748 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 7891 9594 gene locus_tag LOCUS_02820 7891 9594 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727568.1 protein_id gnl|my_center|LOCUS_02820 9696 10088 gene locus_tag LOCUS_02830 9696 10088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 10732 10115 gene locus_tag LOCUS_02840 10732 10115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 10986 10912 gene locus_tag LOCUS_t00030 10986 10912 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 11246 11599 gene locus_tag LOCUS_02850 11246 11599 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461672.1 protein_id gnl|my_center|LOCUS_02850 11770 12084 gene locus_tag LOCUS_02860 11770 12084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 12450 12088 gene locus_tag LOCUS_02870 12450 12088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 13720 12671 gene locus_tag LOCUS_02880 13720 12671 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921016.1 protein_id gnl|my_center|LOCUS_02880 13634 13831 gene locus_tag LOCUS_02890 13634 13831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 14113 14712 gene locus_tag LOCUS_02900 14113 14712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 14840 15133 gene locus_tag LOCUS_02910 14840 15133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 15096 15464 gene locus_tag LOCUS_02920 15096 15464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 15591 16940 gene locus_tag LOCUS_02930 15591 16940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 17143 18804 gene locus_tag LOCUS_02940 gene glpD 17143 18804 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226258.1 protein_id gnl|my_center|LOCUS_02940 19020 18832 gene locus_tag LOCUS_02950 19020 18832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 20374 18998 gene locus_tag LOCUS_02960 20374 18998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 21862 20651 gene locus_tag LOCUS_02970 21862 20651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 22461 21892 gene locus_tag LOCUS_02980 22461 21892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 22957 22574 gene locus_tag LOCUS_02990 22957 22574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 24207 23122 gene locus_tag LOCUS_03000 24207 23122 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545026.1 protein_id gnl|my_center|LOCUS_03000 25750 24290 gene locus_tag LOCUS_03010 25750 24290 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787371.1 protein_id gnl|my_center|LOCUS_03010 26050 26391 gene locus_tag LOCUS_03020 26050 26391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 26419 27186 gene locus_tag LOCUS_03030 26419 27186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 29672 27273 gene locus_tag LOCUS_03040 29672 27273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 30169 29669 gene locus_tag LOCUS_03050 30169 29669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 30418 31377 gene locus_tag LOCUS_03060 30418 31377 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461600.1 protein_id gnl|my_center|LOCUS_03060 31374 32051 gene locus_tag LOCUS_03070 31374 32051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 33136 32048 gene locus_tag LOCUS_03080 33136 32048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 33617 34387 gene locus_tag LOCUS_03090 33617 34387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 34448 34993 gene locus_tag LOCUS_03100 34448 34993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 36166 35198 gene locus_tag LOCUS_03110 gene arcC 36166 35198 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_03110 37104 36163 gene locus_tag LOCUS_03120 gene argF 37104 36163 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_03120 38475 37120 gene locus_tag LOCUS_03130 38475 37120 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_03130 39962 38700 gene locus_tag LOCUS_03140 39962 38700 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979972.1 protein_id gnl|my_center|LOCUS_03140 41189 40224 gene locus_tag LOCUS_03150 41189 40224 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080075.1 protein_id gnl|my_center|LOCUS_03150 42144 41182 gene locus_tag LOCUS_03160 42144 41182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080073.1 protein_id gnl|my_center|LOCUS_03160 43089 42148 gene locus_tag LOCUS_03170 43089 42148 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080070.1 protein_id gnl|my_center|LOCUS_03170 44087 43086 gene locus_tag LOCUS_03180 44087 43086 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080068.1 protein_id gnl|my_center|LOCUS_03180 45992 44175 gene locus_tag LOCUS_03190 45992 44175 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080066.1 protein_id gnl|my_center|LOCUS_03190 46347 47441 gene locus_tag LOCUS_03200 46347 47441 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_03200 47455 48465 gene locus_tag LOCUS_03210 47455 48465 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584146.1 protein_id gnl|my_center|LOCUS_03210 <49110 48496 gene locus_tag LOCUS_03220 <49110 48496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041323885.1:2-isopropylmalate synthase 48967 48985 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence007 30 1289 gene locus_tag LOCUS_03230 30 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 1677 1405 gene locus_tag LOCUS_03240 1677 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 1588 3273 gene locus_tag LOCUS_03250 1588 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 3273 4265 gene locus_tag LOCUS_03260 3273 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 4312 5538 gene locus_tag LOCUS_03270 4312 5538 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_03270 5695 7083 gene locus_tag LOCUS_03280 5695 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 7289 7080 gene locus_tag LOCUS_03290 7289 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 7531 7944 gene locus_tag LOCUS_03300 7531 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 8200 9552 gene locus_tag LOCUS_03310 8200 9552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 9947 9711 gene locus_tag LOCUS_03320 9947 9711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 10673 10137 gene locus_tag LOCUS_03330 10673 10137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 11297 10770 gene locus_tag LOCUS_03340 11297 10770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 11566 14637 gene locus_tag LOCUS_03350 11566 14637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 14657 15523 gene locus_tag LOCUS_03360 14657 15523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 15959 16276 gene locus_tag LOCUS_03370 15959 16276 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461672.1 protein_id gnl|my_center|LOCUS_03370 16327 17943 gene locus_tag LOCUS_03380 gene lpdA 16327 17943 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051291.1 protein_id gnl|my_center|LOCUS_03380 18141 19625 gene locus_tag LOCUS_03390 18141 19625 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766153.1 protein_id gnl|my_center|LOCUS_03390 19660 20778 gene locus_tag LOCUS_03400 gene lipA 19660 20778 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166375.1 protein_id gnl|my_center|LOCUS_03400 21703 20873 gene locus_tag LOCUS_03410 21703 20873 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 protein_id gnl|my_center|LOCUS_03410 22605 21703 gene locus_tag LOCUS_03420 22605 21703 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727772.1 protein_id gnl|my_center|LOCUS_03420 23606 22626 gene locus_tag LOCUS_03430 23606 22626 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230916.1 protein_id gnl|my_center|LOCUS_03430 23876 24943 gene locus_tag LOCUS_03440 gene add 23876 24943 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368573.1 protein_id gnl|my_center|LOCUS_03440 25887 25030 gene locus_tag LOCUS_03450 25887 25030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 26108 27427 gene locus_tag LOCUS_03460 26108 27427 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_03460 27483 28364 gene locus_tag LOCUS_03470 27483 28364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 28471 28310 gene locus_tag LOCUS_03480 28471 28310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 28526 28602 gene locus_tag LOCUS_t00040 28526 28602 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 28826 30328 gene locus_tag LOCUS_03490 28826 30328 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256966.1 protein_id gnl|my_center|LOCUS_03490 30452 31198 gene locus_tag LOCUS_03500 30452 31198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 31680 32042 gene locus_tag LOCUS_03510 31680 32042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 32280 32053 gene locus_tag LOCUS_03520 32280 32053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 33824 32277 gene locus_tag LOCUS_03530 33824 32277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 34053 34128 gene locus_tag LOCUS_t00050 34053 34128 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 34319 35125 gene locus_tag LOCUS_03540 gene xerC 34319 35125 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392542.1 protein_id gnl|my_center|LOCUS_03540 36538 35171 gene locus_tag LOCUS_03550 36538 35171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 36797 38032 gene locus_tag LOCUS_03560 36797 38032 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733138.1 protein_id gnl|my_center|LOCUS_03560 38172 39500 gene locus_tag LOCUS_03570 38172 39500 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564318.1 protein_id gnl|my_center|LOCUS_03570 39623 40534 gene locus_tag LOCUS_03580 39623 40534 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080851.1 protein_id gnl|my_center|LOCUS_03580 40537 41421 gene locus_tag LOCUS_03590 40537 41421 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_03590 41455 43167 gene locus_tag LOCUS_03600 41455 43167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 43164 44339 gene locus_tag LOCUS_03610 43164 44339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 44336 46609 gene locus_tag LOCUS_03620 44336 46609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 46771 47034 gene locus_tag LOCUS_03630 46771 47034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 47027 47218 gene locus_tag LOCUS_03640 47027 47218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 >Feature sequence008 2316 1090 gene locus_tag LOCUS_03650 2316 1090 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392821.1 protein_id gnl|my_center|LOCUS_03650 3660 2329 gene locus_tag LOCUS_03660 3660 2329 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259308.1 protein_id gnl|my_center|LOCUS_03660 3610 3993 gene locus_tag LOCUS_03670 3610 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 6088 4070 gene locus_tag LOCUS_03680 6088 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 6270 6551 gene locus_tag LOCUS_03690 6270 6551 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870279.1 protein_id gnl|my_center|LOCUS_03690 6553 8277 gene locus_tag LOCUS_03700 6553 8277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03700 8864 8358 gene locus_tag LOCUS_03710 8864 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 9770 9093 gene locus_tag LOCUS_03720 gene plsY 9770 9093 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256563.1 protein_id gnl|my_center|LOCUS_03720 10961 9867 gene locus_tag LOCUS_03730 10961 9867 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089136.1 protein_id gnl|my_center|LOCUS_03730 11715 10996 gene locus_tag LOCUS_03740 11715 10996 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939943.1 protein_id gnl|my_center|LOCUS_03740 13013 11712 gene locus_tag LOCUS_03750 13013 11712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 14557 13040 gene locus_tag LOCUS_03760 gene glpK 14557 13040 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259133.1 protein_id gnl|my_center|LOCUS_03760 14771 15307 gene locus_tag LOCUS_03770 14771 15307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 16543 15554 gene locus_tag LOCUS_03780 16543 15554 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456725.1 protein_id gnl|my_center|LOCUS_03780 18054 16837 gene locus_tag LOCUS_03790 18054 16837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 19380 18214 gene locus_tag LOCUS_03800 19380 18214 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_03800 20354 19431 gene locus_tag LOCUS_03810 20354 19431 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728397.1 protein_id gnl|my_center|LOCUS_03810 22478 20364 gene locus_tag LOCUS_03820 22478 20364 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_03820 24205 22475 gene locus_tag LOCUS_03830 24205 22475 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_03830 24896 24324 gene locus_tag LOCUS_03840 24896 24324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 25111 25662 gene locus_tag LOCUS_03850 25111 25662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 25659 27677 gene locus_tag LOCUS_03860 25659 27677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 27975 28643 gene locus_tag LOCUS_03870 27975 28643 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812947.1 protein_id gnl|my_center|LOCUS_03870 28640 29947 gene locus_tag LOCUS_03880 28640 29947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 30176 30952 gene locus_tag LOCUS_03890 30176 30952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 32156 31071 gene locus_tag LOCUS_03900 32156 31071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 32357 32761 gene locus_tag LOCUS_03910 gene mscL 32357 32761 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_03910 32819 33955 gene locus_tag LOCUS_03920 32819 33955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 34780 33995 gene locus_tag LOCUS_03930 34780 33995 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020646525.1 protein_id gnl|my_center|LOCUS_03930 35849 34956 gene locus_tag LOCUS_03940 35849 34956 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231012.1 protein_id gnl|my_center|LOCUS_03940 36123 35842 gene locus_tag LOCUS_03950 36123 35842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 36344 36024 gene locus_tag LOCUS_03960 36344 36024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 36600 36616 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36617 36964 gene locus_tag LOCUS_03970 36617 36964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 37301 36933 gene locus_tag LOCUS_03980 37301 36933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 38716 37385 gene locus_tag LOCUS_03990 38716 37385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 39034 38885 gene locus_tag LOCUS_04000 39034 38885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 39508 39077 gene locus_tag LOCUS_04010 39508 39077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 40353 39505 gene locus_tag LOCUS_04020 40353 39505 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222671.1 protein_id gnl|my_center|LOCUS_04020 40533 40363 gene locus_tag LOCUS_04030 40533 40363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 40847 40662 gene locus_tag LOCUS_04040 40847 40662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 40931 41329 gene locus_tag LOCUS_04050 40931 41329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 41388 41846 gene locus_tag LOCUS_04060 41388 41846 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_04060 42101 41859 gene locus_tag LOCUS_04070 42101 41859 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057724.1 protein_id gnl|my_center|LOCUS_04070 43177 42128 gene locus_tag LOCUS_04080 43177 42128 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660365.1 protein_id gnl|my_center|LOCUS_04080 43569 43174 gene locus_tag LOCUS_04090 43569 43174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 44974 43697 gene locus_tag LOCUS_04100 44974 43697 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479620.1 protein_id gnl|my_center|LOCUS_04100 45137 45210 gene locus_tag LOCUS_t00060 45137 45210 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 45281 45832 gene locus_tag LOCUS_04110 45281 45832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 >Feature sequence009 378 572 gene locus_tag LOCUS_04120 378 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 602 1540 gene locus_tag LOCUS_04130 602 1540 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803876.1 protein_id gnl|my_center|LOCUS_04130 1917 1555 gene locus_tag LOCUS_04140 1917 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 2709 1939 gene locus_tag LOCUS_04150 2709 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 2745 3107 gene locus_tag LOCUS_04160 2745 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 3107 5206 gene locus_tag LOCUS_04170 3107 5206 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_04170 5203 5868 gene locus_tag LOCUS_04180 gene coaE 5203 5868 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257771.1 protein_id gnl|my_center|LOCUS_04180 5946 7271 gene locus_tag LOCUS_04190 5946 7271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 7316 8587 gene locus_tag LOCUS_04200 7316 8587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 9176 8790 gene locus_tag LOCUS_04210 9176 8790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 9073 9435 gene locus_tag LOCUS_04220 9073 9435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 9601 11997 gene locus_tag LOCUS_04230 gene uvrB 9601 11997 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_04230 11605 11681 gene locus_tag LOCUS_t00070 11605 11681 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12022 12516 gene locus_tag LOCUS_04240 12022 12516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 13702 12542 gene locus_tag LOCUS_04250 13702 12542 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104266.1 protein_id gnl|my_center|LOCUS_04250 14028 13699 gene locus_tag LOCUS_04260 14028 13699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 14807 14025 gene locus_tag LOCUS_04270 14807 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 14891 15799 gene locus_tag LOCUS_04280 14891 15799 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803754.1 protein_id gnl|my_center|LOCUS_04280 15866 16498 gene locus_tag LOCUS_04290 15866 16498 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206063.1 protein_id gnl|my_center|LOCUS_04290 16911 19571 gene locus_tag LOCUS_04300 gene uvrA 16911 19571 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04300 19631 20068 gene locus_tag LOCUS_04310 19631 20068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 20070 20393 gene locus_tag LOCUS_04320 20070 20393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 20503 21420 gene locus_tag LOCUS_04330 20503 21420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 21417 22865 gene locus_tag LOCUS_04340 21417 22865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 24710 22878 gene locus_tag LOCUS_04350 gene uvrD 24710 22878 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815343.1 protein_id gnl|my_center|LOCUS_04350 24691 25878 gene locus_tag LOCUS_04360 24691 25878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 28179 25921 gene locus_tag LOCUS_04370 28179 25921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 29484 28366 gene locus_tag LOCUS_04380 29484 28366 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_04380 30149 29481 gene locus_tag LOCUS_04390 30149 29481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04390 30922 30146 gene locus_tag LOCUS_04400 30922 30146 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233792.1 protein_id gnl|my_center|LOCUS_04400 31781 30906 gene locus_tag LOCUS_04410 31781 30906 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244211.1 protein_id gnl|my_center|LOCUS_04410 32800 31778 gene locus_tag LOCUS_04420 32800 31778 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728056.1 protein_id gnl|my_center|LOCUS_04420 33102 33869 gene locus_tag LOCUS_04430 33102 33869 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_04430 34257 35684 gene locus_tag LOCUS_04440 34257 35684 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726997.1 protein_id gnl|my_center|LOCUS_04440 35904 36830 gene locus_tag LOCUS_04450 35904 36830 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_04450 36922 37773 gene locus_tag LOCUS_04460 36922 37773 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233792.1 protein_id gnl|my_center|LOCUS_04460 37884 38717 gene locus_tag LOCUS_04470 37884 38717 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803743.1 protein_id gnl|my_center|LOCUS_04470 38721 39551 gene locus_tag LOCUS_04480 38721 39551 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726998.1 protein_id gnl|my_center|LOCUS_04480 39660 40724 gene locus_tag LOCUS_04490 39660 40724 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_04490 40866 42032 gene locus_tag LOCUS_04500 40866 42032 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254072.1 protein_id gnl|my_center|LOCUS_04500 42326 42072 gene locus_tag LOCUS_04510 42326 42072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 42694 44541 gene locus_tag LOCUS_04520 gene uvrC 42694 44541 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_04520 44644 46059 gene locus_tag LOCUS_04530 gene secD 44644 46059 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258879.1 protein_id gnl|my_center|LOCUS_04530 >Feature sequence010 1473 76 gene locus_tag LOCUS_04540 1473 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 2642 1482 gene locus_tag LOCUS_04550 2642 1482 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926925.1 protein_id gnl|my_center|LOCUS_04550 3379 2822 gene locus_tag LOCUS_04560 3379 2822 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813217.1 protein_id gnl|my_center|LOCUS_04560 4126 3383 gene locus_tag LOCUS_04570 4126 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 4473 4117 gene locus_tag LOCUS_04580 4473 4117 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775585.1 protein_id gnl|my_center|LOCUS_04580 6322 5033 gene locus_tag LOCUS_04590 6322 5033 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142380.1 protein_id gnl|my_center|LOCUS_04590 6966 6319 gene locus_tag LOCUS_04600 6966 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 7037 7441 gene locus_tag LOCUS_04610 7037 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 7451 8077 gene locus_tag LOCUS_04620 gene folK 7451 8077 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036940.1 protein_id gnl|my_center|LOCUS_04620 8251 8072 gene locus_tag LOCUS_04630 8251 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 9877 8942 gene locus_tag LOCUS_04640 9877 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 11673 10111 gene locus_tag LOCUS_04650 gene purH 11673 10111 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393540.1 protein_id gnl|my_center|LOCUS_04650 11954 12397 gene locus_tag LOCUS_04660 11954 12397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 12499 13002 gene locus_tag LOCUS_04670 12499 13002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 13806 13042 gene locus_tag LOCUS_04680 13806 13042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 15160 13958 gene locus_tag LOCUS_04690 15160 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 15708 15193 gene locus_tag LOCUS_04700 15708 15193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04700 17899 15641 gene locus_tag LOCUS_04710 gene clpB 17899 15641 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04710 19079 17973 gene locus_tag LOCUS_04720 19079 17973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 21690 19180 gene locus_tag LOCUS_04730 gene lon 21690 19180 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_04730 22220 21690 gene locus_tag LOCUS_04740 22220 21690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 22704 22228 gene locus_tag LOCUS_04750 22704 22228 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582602.1 protein_id gnl|my_center|LOCUS_04750 24184 22940 gene locus_tag LOCUS_04760 24184 22940 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970459.1 protein_id gnl|my_center|LOCUS_04760 24622 24185 gene locus_tag LOCUS_04770 24622 24185 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201060.1 protein_id gnl|my_center|LOCUS_04770 24806 25267 gene locus_tag LOCUS_04780 24806 25267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 25292 27055 gene locus_tag LOCUS_04790 25292 27055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 27735 27061 gene locus_tag LOCUS_04800 27735 27061 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393295.1 protein_id gnl|my_center|LOCUS_04800 28364 27753 gene locus_tag LOCUS_04810 28364 27753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 28819 28364 gene locus_tag LOCUS_04820 28819 28364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 31090 28958 gene locus_tag LOCUS_04830 31090 28958 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_04830 32000 31272 gene locus_tag LOCUS_04840 32000 31272 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_04840 32697 32008 gene locus_tag LOCUS_04850 gene rsmG 32697 32008 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886662.1 protein_id gnl|my_center|LOCUS_04850 33461 33084 gene locus_tag LOCUS_04860 33461 33084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 33665 34273 gene locus_tag LOCUS_04870 33665 34273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 34288 34848 gene locus_tag LOCUS_04880 gene hpt 34288 34848 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_04880 34860 35294 gene locus_tag LOCUS_04890 34860 35294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 35682 36143 gene locus_tag LOCUS_04900 35682 36143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 36243 38090 gene locus_tag LOCUS_04910 36243 38090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 38106 39443 gene locus_tag LOCUS_04920 38106 39443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 39443 39748 gene locus_tag LOCUS_04930 39443 39748 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973419.1 protein_id gnl|my_center|LOCUS_04930 40604 39759 gene locus_tag LOCUS_04940 40604 39759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 41544 40753 gene locus_tag LOCUS_04950 41544 40753 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727458.1 protein_id gnl|my_center|LOCUS_04950 41578 42018 gene locus_tag LOCUS_04960 41578 42018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 42015 42692 gene locus_tag LOCUS_04970 42015 42692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 >Feature sequence011 692 363 gene locus_tag LOCUS_04980 692 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 573 3191 gene locus_tag LOCUS_04990 573 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 3361 4809 gene locus_tag LOCUS_05000 3361 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 5414 6616 gene locus_tag LOCUS_05010 5414 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 7372 6764 gene locus_tag LOCUS_05020 7372 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 7332 10115 gene locus_tag LOCUS_05030 7332 10115 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528450.1 protein_id gnl|my_center|LOCUS_05030 10167 10397 gene locus_tag LOCUS_05040 10167 10397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 10582 11772 gene locus_tag LOCUS_05050 10582 11772 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_05050 11822 12736 gene locus_tag LOCUS_05060 11822 12736 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_05060 12742 13479 gene locus_tag LOCUS_05070 gene deoC 12742 13479 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228457.1 protein_id gnl|my_center|LOCUS_05070 13520 14389 gene locus_tag LOCUS_05080 13520 14389 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143210.1 protein_id gnl|my_center|LOCUS_05080 15838 14420 gene locus_tag LOCUS_05090 15838 14420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 17005 15851 gene locus_tag LOCUS_05100 gene nagA 17005 15851 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271133.1 protein_id gnl|my_center|LOCUS_05100 18056 17067 gene locus_tag LOCUS_05110 18056 17067 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066869295.1 protein_id gnl|my_center|LOCUS_05110 19048 18053 gene locus_tag LOCUS_05120 19048 18053 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530865.1 protein_id gnl|my_center|LOCUS_05120 20631 19045 gene locus_tag LOCUS_05130 20631 19045 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530864.1 protein_id gnl|my_center|LOCUS_05130 21794 20706 gene locus_tag LOCUS_05140 21794 20706 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527931.1 protein_id gnl|my_center|LOCUS_05140 22823 21939 gene locus_tag LOCUS_05150 22823 21939 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764904.1 protein_id gnl|my_center|LOCUS_05150 23041 25377 gene locus_tag LOCUS_05160 23041 25377 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_05160 25440 26492 gene locus_tag LOCUS_05170 25440 26492 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_05170 26489 27505 gene locus_tag LOCUS_05180 26489 27505 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_05180 27543 28445 gene locus_tag LOCUS_05190 27543 28445 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 protein_id gnl|my_center|LOCUS_05190 29820 28447 gene locus_tag LOCUS_05200 29820 28447 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393752.1 protein_id gnl|my_center|LOCUS_05200 30093 31250 gene locus_tag LOCUS_05210 30093 31250 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_05210 31250 31855 gene locus_tag LOCUS_05220 31250 31855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 31941 32855 gene locus_tag LOCUS_05230 31941 32855 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437792.1 protein_id gnl|my_center|LOCUS_05230 34131 33064 gene locus_tag LOCUS_05240 34131 33064 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393751.1 protein_id gnl|my_center|LOCUS_05240 35035 34145 gene locus_tag LOCUS_05250 35035 34145 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 protein_id gnl|my_center|LOCUS_05250 37302 35032 gene locus_tag LOCUS_05260 37302 35032 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969633.1 protein_id gnl|my_center|LOCUS_05260 37784 37299 gene locus_tag LOCUS_05270 37784 37299 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_05270 38656 37781 gene locus_tag LOCUS_05280 38656 37781 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869168.1 protein_id gnl|my_center|LOCUS_05280 39564 38677 gene locus_tag LOCUS_05290 39564 38677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 40518 39739 gene locus_tag LOCUS_05300 40518 39739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 <41797 40541 gene locus_tag LOCUS_05310 <41797 40541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243243.1:PEP/pyruvate-binding domain-containing protein >Feature sequence012 1564 1250 gene locus_tag LOCUS_05320 gene groES 1564 1250 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_05320 1844 2152 gene locus_tag LOCUS_05330 1844 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 2351 2196 gene locus_tag LOCUS_05340 2351 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 2513 2370 gene locus_tag LOCUS_05350 2513 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 3632 2661 gene locus_tag LOCUS_05360 3632 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 4570 3677 gene locus_tag LOCUS_05370 4570 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 6229 4592 gene locus_tag LOCUS_05380 gene metG 6229 4592 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080396.1 protein_id gnl|my_center|LOCUS_05380 7131 6493 gene locus_tag LOCUS_05390 7131 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 9412 7145 gene locus_tag LOCUS_05400 9412 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 10334 9450 gene locus_tag LOCUS_05410 10334 9450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05410 12077 10596 gene locus_tag LOCUS_05420 gene purF 12077 10596 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_05420 14236 12080 gene locus_tag LOCUS_05430 gene purL 14236 12080 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_05430 14513 14247 gene locus_tag LOCUS_05440 14513 14247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 15265 14510 gene locus_tag LOCUS_05450 gene purQ 15265 14510 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141325.1 protein_id gnl|my_center|LOCUS_05450 15552 15262 gene locus_tag LOCUS_05460 gene purS 15552 15262 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140445.1 protein_id gnl|my_center|LOCUS_05460 16508 15549 gene locus_tag LOCUS_05470 16508 15549 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_05470 17844 16495 gene locus_tag LOCUS_05480 gene purB 17844 16495 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393548.1 protein_id gnl|my_center|LOCUS_05480 19289 17841 gene locus_tag LOCUS_05490 gene purD 19289 17841 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_05490 20632 19286 gene locus_tag LOCUS_05500 20632 19286 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_05500 21714 20929 gene locus_tag LOCUS_05510 gene deoC 21714 20929 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389958.1 protein_id gnl|my_center|LOCUS_05510 22801 21722 gene locus_tag LOCUS_05520 22801 21722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 23749 23393 gene locus_tag LOCUS_05530 23749 23393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 25415 23952 gene locus_tag LOCUS_05540 25415 23952 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388669.1 protein_id gnl|my_center|LOCUS_05540 25715 25428 gene locus_tag LOCUS_05550 25715 25428 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736331.1 protein_id gnl|my_center|LOCUS_05550 26084 25776 gene locus_tag LOCUS_05560 26084 25776 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705244.1 protein_id gnl|my_center|LOCUS_05560 26769 26140 gene locus_tag LOCUS_05570 26769 26140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_05570 27649 26756 gene locus_tag LOCUS_05580 27649 26756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 28278 27646 gene locus_tag LOCUS_05590 28278 27646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 29278 28271 gene locus_tag LOCUS_05600 29278 28271 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894480.1 protein_id gnl|my_center|LOCUS_05600 30055 29711 gene locus_tag LOCUS_05610 30055 29711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 30741 30469 gene locus_tag LOCUS_05620 30741 30469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 31109 30954 gene locus_tag LOCUS_05630 31109 30954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 31770 31093 gene locus_tag LOCUS_05640 31770 31093 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095521776.1 protein_id gnl|my_center|LOCUS_05640 32272 32078 gene locus_tag LOCUS_05650 32272 32078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 38038 32330 gene locus_tag LOCUS_05660 38038 32330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 38730 38533 gene locus_tag LOCUS_05670 38730 38533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 41022 38809 gene locus_tag LOCUS_05680 41022 38809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 >Feature sequence013 849 870 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1934 2494 gene locus_tag LOCUS_05690 1934 2494 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_05690 2558 3547 gene locus_tag LOCUS_05700 gene htpX 2558 3547 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836621.1 protein_id gnl|my_center|LOCUS_05700 3660 3735 gene locus_tag LOCUS_t00080 3660 3735 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3760 3835 gene locus_tag LOCUS_t00090 3760 3835 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3886 3959 gene locus_tag LOCUS_t00100 3886 3959 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4024 4099 gene locus_tag LOCUS_t00110 4024 4099 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4453 5508 gene locus_tag LOCUS_05710 4453 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 5620 5706 gene locus_tag LOCUS_t00120 5620 5706 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6256 5786 gene locus_tag LOCUS_05720 6256 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 6672 6523 gene locus_tag LOCUS_05730 6672 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 7007 7432 gene locus_tag LOCUS_05740 7007 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 7466 7921 gene locus_tag LOCUS_05750 7466 7921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 7997 8278 gene locus_tag LOCUS_05760 7997 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 8445 9488 gene locus_tag LOCUS_05770 8445 9488 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392337.1 protein_id gnl|my_center|LOCUS_05770 9585 10562 gene locus_tag LOCUS_05780 9585 10562 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_05780 10555 12270 gene locus_tag LOCUS_05790 10555 12270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 12477 15821 gene locus_tag LOCUS_05800 gene ileS 12477 15821 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_05800 15942 16469 gene locus_tag LOCUS_05810 gene lspA 15942 16469 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256792.1 protein_id gnl|my_center|LOCUS_05810 16482 17474 gene locus_tag LOCUS_05820 16482 17474 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_05820 17471 18163 gene locus_tag LOCUS_05830 17471 18163 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257428.1 protein_id gnl|my_center|LOCUS_05830 18210 20798 gene locus_tag LOCUS_05840 gene priA 18210 20798 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259672.1 protein_id gnl|my_center|LOCUS_05840 20848 21411 gene locus_tag LOCUS_05850 gene def 20848 21411 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948295.1 protein_id gnl|my_center|LOCUS_05850 21408 22385 gene locus_tag LOCUS_05860 gene fmt 21408 22385 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227858.1 protein_id gnl|my_center|LOCUS_05860 22435 23757 gene locus_tag LOCUS_05870 gene rlmN 22435 23757 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092553592.1 protein_id gnl|my_center|LOCUS_05870 23757 24503 gene locus_tag LOCUS_05880 gene rpe 23757 24503 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240407.1 protein_id gnl|my_center|LOCUS_05880 24500 25675 gene locus_tag LOCUS_05890 24500 25675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 25685 26155 gene locus_tag LOCUS_05900 gene dtd 25685 26155 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_05900 26454 26257 gene locus_tag LOCUS_05910 26454 26257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 26563 27033 gene locus_tag LOCUS_05920 26563 27033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 27080 28822 gene locus_tag LOCUS_05930 27080 28822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 28827 31166 gene locus_tag LOCUS_05940 gene recG 28827 31166 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392440.1 protein_id gnl|my_center|LOCUS_05940 31159 31794 gene locus_tag LOCUS_05950 gene rsmD 31159 31794 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266978.1 protein_id gnl|my_center|LOCUS_05950 31808 32311 gene locus_tag LOCUS_05960 gene coaD 31808 32311 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140849.1 protein_id gnl|my_center|LOCUS_05960 32399 32917 gene locus_tag LOCUS_05970 32399 32917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 32946 33452 gene locus_tag LOCUS_05980 32946 33452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 33670 33930 gene locus_tag LOCUS_05990 33670 33930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 33942 34937 gene locus_tag LOCUS_06000 gene plsX 33942 34937 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_06000 34942 35295 gene locus_tag LOCUS_06010 34942 35295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 35292 35792 gene locus_tag LOCUS_06020 35292 35792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 35831 36067 gene locus_tag LOCUS_06030 gene acpP 35831 36067 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_06030 36083 37021 gene locus_tag LOCUS_06040 36083 37021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 >Feature sequence014 311 976 gene locus_tag LOCUS_06050 311 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 1267 2130 gene locus_tag LOCUS_06060 1267 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 2685 2206 gene locus_tag LOCUS_06070 2685 2206 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_06070 2790 4073 gene locus_tag LOCUS_06080 2790 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 4070 4966 gene locus_tag LOCUS_06090 gene cbiQ 4070 4966 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393362.1 protein_id gnl|my_center|LOCUS_06090 4963 5880 gene locus_tag LOCUS_06100 4963 5880 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542058.1 protein_id gnl|my_center|LOCUS_06100 6020 7630 gene locus_tag LOCUS_06110 6020 7630 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583496.1 protein_id gnl|my_center|LOCUS_06110 7627 8988 gene locus_tag LOCUS_06120 7627 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 9114 9392 gene locus_tag LOCUS_06130 9114 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 9389 10936 gene locus_tag LOCUS_06140 9389 10936 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140087.1 protein_id gnl|my_center|LOCUS_06140 10936 12378 gene locus_tag LOCUS_06150 10936 12378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 12592 13353 gene locus_tag LOCUS_06160 12592 13353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 13353 14294 gene locus_tag LOCUS_06170 13353 14294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 14534 14307 gene locus_tag LOCUS_06180 14534 14307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 14584 15402 gene locus_tag LOCUS_06190 14584 15402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 16465 15422 gene locus_tag LOCUS_06200 16465 15422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 16574 16650 gene locus_tag LOCUS_t00130 16574 16650 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 16929 18854 gene locus_tag LOCUS_06210 gene thrS 16929 18854 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393260.1 protein_id gnl|my_center|LOCUS_06210 19053 19709 gene locus_tag LOCUS_06220 19053 19709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 19714 19917 gene locus_tag LOCUS_06230 gene rpmI 19714 19917 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393258.1 protein_id gnl|my_center|LOCUS_06230 19924 20274 gene locus_tag LOCUS_06240 gene rplT 19924 20274 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124857.1 protein_id gnl|my_center|LOCUS_06240 20324 21376 gene locus_tag LOCUS_06250 gene pheS 20324 21376 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_06250 21801 21445 gene locus_tag LOCUS_06260 21801 21445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 21816 24305 gene locus_tag LOCUS_06270 gene pheT 21816 24305 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_06270 24433 25008 gene locus_tag LOCUS_06280 24433 25008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 25051 25755 gene locus_tag LOCUS_06290 25051 25755 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148816.1 protein_id gnl|my_center|LOCUS_06290 25752 28229 gene locus_tag LOCUS_06300 25752 28229 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660626.1 protein_id gnl|my_center|LOCUS_06300 28338 29450 gene locus_tag LOCUS_06310 28338 29450 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393885.1 protein_id gnl|my_center|LOCUS_06310 29447 31327 gene locus_tag LOCUS_06320 gene murJ 29447 31327 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_06320 34218 31351 gene locus_tag LOCUS_06330 34218 31351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 34328 35653 gene locus_tag LOCUS_06340 gene tyrS 34328 35653 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762838.1 protein_id gnl|my_center|LOCUS_06340 36017 35679 gene locus_tag LOCUS_06350 36017 35679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 36803 36120 gene locus_tag LOCUS_06360 gene hisIE 36803 36120 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257923.1 protein_id gnl|my_center|LOCUS_06360 37591 36800 gene locus_tag LOCUS_06370 gene hisF 37591 36800 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728898.1 protein_id gnl|my_center|LOCUS_06370 38241 37591 gene locus_tag LOCUS_06380 gene hisH 38241 37591 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_06380 38855 38238 gene locus_tag LOCUS_06390 gene hisB 38855 38238 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257804.1 protein_id gnl|my_center|LOCUS_06390 39820 38852 gene locus_tag LOCUS_06400 gene hisC 39820 38852 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036980.1 protein_id gnl|my_center|LOCUS_06400 40160 39951 gene locus_tag LOCUS_06410 40160 39951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 >Feature sequence015 <1 1066 gene locus_tag LOCUS_06420 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256963.1:glycoside hydrolase family 3 N-terminal domain-containing protein 1462 1881 gene locus_tag LOCUS_06430 1462 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 4298 2475 gene locus_tag LOCUS_06440 4298 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 4921 4295 gene locus_tag LOCUS_06450 4921 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 5483 5007 gene locus_tag LOCUS_06460 5483 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 6184 5792 gene locus_tag LOCUS_06470 6184 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 6084 7067 gene locus_tag LOCUS_06480 6084 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 8525 7260 gene locus_tag LOCUS_06490 8525 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 9231 10094 gene locus_tag LOCUS_06500 9231 10094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 10376 11170 gene locus_tag LOCUS_06510 10376 11170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 11676 11996 gene locus_tag LOCUS_06520 11676 11996 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256234.1 protein_id gnl|my_center|LOCUS_06520 12087 12863 gene locus_tag LOCUS_06530 12087 12863 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632942.1 protein_id gnl|my_center|LOCUS_06530 14128 13118 gene locus_tag LOCUS_06540 14128 13118 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_06540 14562 15863 gene locus_tag LOCUS_06550 14562 15863 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 protein_id gnl|my_center|LOCUS_06550 15967 16926 gene locus_tag LOCUS_06560 15967 16926 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103759610.1 protein_id gnl|my_center|LOCUS_06560 16991 17848 gene locus_tag LOCUS_06570 16991 17848 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206346349.1 protein_id gnl|my_center|LOCUS_06570 17992 18666 gene locus_tag LOCUS_06580 17992 18666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 18786 21329 gene locus_tag LOCUS_06590 18786 21329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 21967 21629 gene locus_tag LOCUS_06600 21967 21629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 23000 22032 gene locus_tag LOCUS_06610 23000 22032 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727630.1 protein_id gnl|my_center|LOCUS_06610 24170 23079 gene locus_tag LOCUS_06620 24170 23079 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223491.1 protein_id gnl|my_center|LOCUS_06620 24931 24167 gene locus_tag LOCUS_06630 24931 24167 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223492.1 protein_id gnl|my_center|LOCUS_06630 26525 25185 gene locus_tag LOCUS_06640 26525 25185 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584153.1 protein_id gnl|my_center|LOCUS_06640 26789 27262 gene locus_tag LOCUS_06650 26789 27262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 27941 27276 gene locus_tag LOCUS_06660 27941 27276 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 protein_id gnl|my_center|LOCUS_06660 29506 27938 gene locus_tag LOCUS_06670 29506 27938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 30133 29585 gene locus_tag LOCUS_06680 30133 29585 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583077.1 protein_id gnl|my_center|LOCUS_06680 33181 30638 gene locus_tag LOCUS_06690 33181 30638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 33707 33462 gene locus_tag LOCUS_06700 33707 33462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06700 34383 33694 gene locus_tag LOCUS_06710 34383 33694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06710 35524 34514 gene locus_tag LOCUS_06720 35524 34514 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729196.1 protein_id gnl|my_center|LOCUS_06720 35975 35553 gene locus_tag LOCUS_06730 35975 35553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 36706 36077 gene locus_tag LOCUS_06740 36706 36077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 37000 37010 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37017 37745 gene locus_tag LOCUS_06750 37017 37745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 37828 38208 gene locus_tag LOCUS_06760 37828 38208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06760 38648 39307 gene locus_tag LOCUS_06770 38648 39307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 >Feature sequence016 3840 3517 gene locus_tag LOCUS_06780 3840 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 3846 4352 gene locus_tag LOCUS_06790 3846 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 4453 4528 gene locus_tag LOCUS_t00140 4453 4528 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4591 4872 gene locus_tag LOCUS_06800 4591 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4869 5303 gene locus_tag LOCUS_06810 4869 5303 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391721.1 protein_id gnl|my_center|LOCUS_06810 5326 5520 gene locus_tag LOCUS_06820 5326 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 5562 6239 gene locus_tag LOCUS_06830 5562 6239 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990073.1 protein_id gnl|my_center|LOCUS_06830 7242 7856 gene locus_tag LOCUS_06840 7242 7856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06840 8696 7869 gene locus_tag LOCUS_06850 8696 7869 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705555.1 protein_id gnl|my_center|LOCUS_06850 8939 10228 gene locus_tag LOCUS_06860 8939 10228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 10240 10419 gene locus_tag LOCUS_06870 10240 10419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 10416 11168 gene locus_tag LOCUS_06880 10416 11168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06880 11218 12189 gene locus_tag LOCUS_06890 11218 12189 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888939.1 protein_id gnl|my_center|LOCUS_06890 12247 13332 gene locus_tag LOCUS_06900 12247 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 13503 14204 gene locus_tag LOCUS_06910 13503 14204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 14626 14300 gene locus_tag LOCUS_06920 14626 14300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 14937 14797 gene locus_tag LOCUS_06930 14937 14797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 15097 14957 gene locus_tag LOCUS_06940 15097 14957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 15767 15153 gene locus_tag LOCUS_06950 15767 15153 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890715.1 protein_id gnl|my_center|LOCUS_06950 18656 15900 gene locus_tag LOCUS_06960 gene mgtA 18656 15900 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089790.1 protein_id gnl|my_center|LOCUS_06960 18740 19621 gene locus_tag LOCUS_06970 18740 19621 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085687.1 protein_id gnl|my_center|LOCUS_06970 20389 19703 gene locus_tag LOCUS_06980 20389 19703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013597.1 protein_id gnl|my_center|LOCUS_06980 22110 20494 gene locus_tag LOCUS_06990 22110 20494 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979023.1 protein_id gnl|my_center|LOCUS_06990 22355 23212 gene locus_tag LOCUS_07000 22355 23212 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877583.1 protein_id gnl|my_center|LOCUS_07000 23220 24038 gene locus_tag LOCUS_07010 23220 24038 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384441.1 protein_id gnl|my_center|LOCUS_07010 24049 25002 gene locus_tag LOCUS_07020 24049 25002 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978653.1 protein_id gnl|my_center|LOCUS_07020 25005 26579 gene locus_tag LOCUS_07030 gene xylB 25005 26579 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_07030 26590 27510 gene locus_tag LOCUS_07040 26590 27510 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389116.1 protein_id gnl|my_center|LOCUS_07040 27713 28054 gene locus_tag LOCUS_07050 27713 28054 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032497467.1 protein_id gnl|my_center|LOCUS_07050 28234 29604 gene locus_tag LOCUS_07060 28234 29604 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972735.1 protein_id gnl|my_center|LOCUS_07060 30368 29694 gene locus_tag LOCUS_07070 gene upp 30368 29694 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257403.1 protein_id gnl|my_center|LOCUS_07070 31395 30511 gene locus_tag LOCUS_07080 31395 30511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 33180 31555 gene locus_tag LOCUS_07090 33180 31555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 33929 33333 gene locus_tag LOCUS_07100 33929 33333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 35276 34374 gene locus_tag LOCUS_07110 gene pheA 35276 34374 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_07110 36970 35294 gene locus_tag LOCUS_07120 gene cimA 36970 35294 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_07120 38187 36967 gene locus_tag LOCUS_07130 gene leuB 38187 36967 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880105.1 protein_id gnl|my_center|LOCUS_07130 38348 38184 gene locus_tag LOCUS_07140 38348 38184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 <39161 38372 gene locus_tag LOCUS_07150 <39161 38372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001151741.1:ketol-acid reductoisomerase >Feature sequence017 1166 852 gene locus_tag LOCUS_07160 1166 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 1056 2708 gene locus_tag LOCUS_07170 1056 2708 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258102.1 protein_id gnl|my_center|LOCUS_07170 2705 3817 gene locus_tag LOCUS_07180 2705 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 4229 3855 gene locus_tag LOCUS_07190 4229 3855 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742210.1 protein_id gnl|my_center|LOCUS_07190 4437 4958 gene locus_tag LOCUS_07200 4437 4958 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892873.1 protein_id gnl|my_center|LOCUS_07200 4955 6973 gene locus_tag LOCUS_07210 4955 6973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 7436 6984 gene locus_tag LOCUS_07220 7436 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 8359 7589 gene locus_tag LOCUS_07230 8359 7589 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673992.1 protein_id gnl|my_center|LOCUS_07230 9642 8356 gene locus_tag LOCUS_07240 9642 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 10312 9713 gene locus_tag LOCUS_07250 10312 9713 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926900.1 protein_id gnl|my_center|LOCUS_07250 10892 10380 gene locus_tag LOCUS_07260 gene purE 10892 10380 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073383.1 protein_id gnl|my_center|LOCUS_07260 11790 10972 gene locus_tag LOCUS_07270 gene tatC 11790 10972 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545000.1 protein_id gnl|my_center|LOCUS_07270 13138 11918 gene locus_tag LOCUS_07280 gene galK 13138 11918 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 protein_id gnl|my_center|LOCUS_07280 13092 13304 gene locus_tag LOCUS_07290 13092 13304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 13715 13275 gene locus_tag LOCUS_07300 13715 13275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 14795 13737 gene locus_tag LOCUS_07310 gene galT 14795 13737 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097520.1 protein_id gnl|my_center|LOCUS_07310 15715 14792 gene locus_tag LOCUS_07320 15715 14792 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230059.1 protein_id gnl|my_center|LOCUS_07320 15939 17387 gene locus_tag LOCUS_07330 15939 17387 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975833.1 protein_id gnl|my_center|LOCUS_07330 17423 18400 gene locus_tag LOCUS_07340 17423 18400 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226352.1 protein_id gnl|my_center|LOCUS_07340 18397 19308 gene locus_tag LOCUS_07350 18397 19308 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524829.1 protein_id gnl|my_center|LOCUS_07350 19347 21569 gene locus_tag LOCUS_07360 19347 21569 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836501.1 protein_id gnl|my_center|LOCUS_07360 21597 24665 gene locus_tag LOCUS_07370 21597 24665 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084830245.1 protein_id gnl|my_center|LOCUS_07370 24715 25668 gene locus_tag LOCUS_07380 24715 25668 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110924.1 protein_id gnl|my_center|LOCUS_07380 26136 25723 gene locus_tag LOCUS_07390 26136 25723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 26265 28097 gene locus_tag LOCUS_07400 26265 28097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 28070 28279 gene locus_tag LOCUS_07410 28070 28279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 28429 28968 gene locus_tag LOCUS_07420 28429 28968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 29065 29217 gene locus_tag LOCUS_07430 29065 29217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 29377 30459 gene locus_tag LOCUS_07440 29377 30459 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727779.1 protein_id gnl|my_center|LOCUS_07440 30598 31431 gene locus_tag LOCUS_07450 30598 31431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 31438 32244 gene locus_tag LOCUS_07460 31438 32244 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014635952.1 protein_id gnl|my_center|LOCUS_07460 32248 33063 gene locus_tag LOCUS_07470 32248 33063 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867495.1 protein_id gnl|my_center|LOCUS_07470 33060 33908 gene locus_tag LOCUS_07480 33060 33908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07480 34048 35334 gene locus_tag LOCUS_07490 34048 35334 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994395.1 protein_id gnl|my_center|LOCUS_07490 35331 37082 gene locus_tag LOCUS_07500 35331 37082 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349591.1 protein_id gnl|my_center|LOCUS_07500 >Feature sequence018 1125 346 gene locus_tag LOCUS_07510 1125 346 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_07510 1874 1122 gene locus_tag LOCUS_07520 1874 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 4727 1950 gene locus_tag LOCUS_07530 gene ligD 4727 1950 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337655.1 protein_id gnl|my_center|LOCUS_07530 4938 5174 gene locus_tag LOCUS_07540 4938 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 5515 5186 gene locus_tag LOCUS_07550 5515 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 5655 6971 gene locus_tag LOCUS_07560 5655 6971 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255920.1 protein_id gnl|my_center|LOCUS_07560 6968 7225 gene locus_tag LOCUS_07570 6968 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 8364 7222 gene locus_tag LOCUS_07580 8364 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 9514 8432 gene locus_tag LOCUS_07590 gene cax 9514 8432 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395855.1 protein_id gnl|my_center|LOCUS_07590 10510 9602 gene locus_tag LOCUS_07600 10510 9602 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270002.1 protein_id gnl|my_center|LOCUS_07600 11085 10516 gene locus_tag LOCUS_07610 11085 10516 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_07610 11497 11910 gene locus_tag LOCUS_07620 11497 11910 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966283.1 protein_id gnl|my_center|LOCUS_07620 11914 13083 gene locus_tag LOCUS_07630 11914 13083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 13088 13501 gene locus_tag LOCUS_07640 13088 13501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 13643 14602 gene locus_tag LOCUS_07650 13643 14602 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777026.1 protein_id gnl|my_center|LOCUS_07650 14586 15320 gene locus_tag LOCUS_07660 14586 15320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 15373 16092 gene locus_tag LOCUS_07670 15373 16092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 16198 16680 gene locus_tag LOCUS_07680 16198 16680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 16677 18371 gene locus_tag LOCUS_07690 16677 18371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 19134 18388 gene locus_tag LOCUS_07700 19134 18388 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223631.1 protein_id gnl|my_center|LOCUS_07700 19300 19542 gene locus_tag LOCUS_07710 19300 19542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 20289 19774 gene locus_tag LOCUS_07720 20289 19774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 21528 20944 gene locus_tag LOCUS_07730 21528 20944 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_07730 21689 21525 gene locus_tag LOCUS_07740 21689 21525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 22072 21686 gene locus_tag LOCUS_07750 22072 21686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 22884 22069 gene locus_tag LOCUS_07760 22884 22069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 23150 23956 gene locus_tag LOCUS_07770 23150 23956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 24088 24453 gene locus_tag LOCUS_07780 24088 24453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 24599 25318 gene locus_tag LOCUS_07790 24599 25318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 26399 25377 gene locus_tag LOCUS_07800 26399 25377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 27159 26392 gene locus_tag LOCUS_07810 27159 26392 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_07810 28287 28063 gene locus_tag LOCUS_07820 28287 28063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 28301 29248 gene locus_tag LOCUS_07830 28301 29248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 29548 30012 gene locus_tag LOCUS_07840 gene mce 29548 30012 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_07840 30611 30210 gene locus_tag LOCUS_07850 30611 30210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 31528 30701 gene locus_tag LOCUS_07860 gene sucD 31528 30701 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256597.1 protein_id gnl|my_center|LOCUS_07860 32703 31525 gene locus_tag LOCUS_07870 gene sucC 32703 31525 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_07870 33428 32847 gene locus_tag LOCUS_07880 33428 32847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 33488 34510 gene locus_tag LOCUS_07890 33488 34510 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_07890 34590 34952 gene locus_tag LOCUS_07900 gene sdhC 34590 34952 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222765.1 protein_id gnl|my_center|LOCUS_07900 34966 35358 gene locus_tag LOCUS_07910 34966 35358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 35363 37111 gene locus_tag LOCUS_07920 gene sdhA 35363 37111 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228694.1 protein_id gnl|my_center|LOCUS_07920 >Feature sequence019 381 19 gene locus_tag LOCUS_07930 381 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 382 732 gene locus_tag LOCUS_07940 382 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 745 1164 gene locus_tag LOCUS_07950 745 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07950 1242 1523 gene locus_tag LOCUS_07960 1242 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07960 1831 1571 gene locus_tag LOCUS_07970 1831 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 1970 3676 gene locus_tag LOCUS_07980 1970 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 3938 4240 gene locus_tag LOCUS_07990 3938 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 4237 5745 gene locus_tag LOCUS_08000 4237 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 6305 7381 gene locus_tag LOCUS_08010 6305 7381 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035860.1 protein_id gnl|my_center|LOCUS_08010 7378 8325 gene locus_tag LOCUS_08020 7378 8325 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771391.1 protein_id gnl|my_center|LOCUS_08020 8342 8722 gene locus_tag LOCUS_08030 8342 8722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 8719 9690 gene locus_tag LOCUS_08040 8719 9690 CDS product WxcM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035858.1 protein_id gnl|my_center|LOCUS_08040 9864 10079 gene locus_tag LOCUS_08050 9864 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 10331 10131 gene locus_tag LOCUS_08060 10331 10131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08060 11472 10447 gene locus_tag LOCUS_08070 11472 10447 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024667998.1 protein_id gnl|my_center|LOCUS_08070 12229 11504 gene locus_tag LOCUS_08080 12229 11504 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339011.1 protein_id gnl|my_center|LOCUS_08080 12528 12229 gene locus_tag LOCUS_08090 12528 12229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 13117 12515 gene locus_tag LOCUS_08100 13117 12515 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679998.1 protein_id gnl|my_center|LOCUS_08100 13538 13203 gene locus_tag LOCUS_08110 13538 13203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 14061 13531 gene locus_tag LOCUS_08120 14061 13531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08120 15151 14219 gene locus_tag LOCUS_08130 15151 14219 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031897.1 protein_id gnl|my_center|LOCUS_08130 17207 15144 gene locus_tag LOCUS_08140 17207 15144 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836245.1 protein_id gnl|my_center|LOCUS_08140 18054 17248 gene locus_tag LOCUS_08150 18054 17248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 19301 18090 gene locus_tag LOCUS_08160 19301 18090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 20562 19291 gene locus_tag LOCUS_08170 20562 19291 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_08170 21395 20559 gene locus_tag LOCUS_08180 21395 20559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 22273 21392 gene locus_tag LOCUS_08190 22273 21392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 22594 22283 gene locus_tag LOCUS_08200 22594 22283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 23019 22645 gene locus_tag LOCUS_08210 23019 22645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 23494 23090 gene locus_tag LOCUS_08220 23494 23090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 24179 23442 gene locus_tag LOCUS_08230 24179 23442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 25158 24187 gene locus_tag LOCUS_08240 25158 24187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 25289 26761 gene locus_tag LOCUS_08250 25289 26761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 27382 26792 gene locus_tag LOCUS_08260 27382 26792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 28440 27385 gene locus_tag LOCUS_08270 28440 27385 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 protein_id gnl|my_center|LOCUS_08270 28757 28437 gene locus_tag LOCUS_08280 28757 28437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 28708 29838 gene locus_tag LOCUS_08290 28708 29838 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258677.1 protein_id gnl|my_center|LOCUS_08290 30678 30109 gene locus_tag LOCUS_08300 30678 30109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 30949 30710 gene locus_tag LOCUS_08310 30949 30710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 31909 31058 gene locus_tag LOCUS_08320 31909 31058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 31940 32287 gene locus_tag LOCUS_08330 31940 32287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 32499 32891 gene locus_tag LOCUS_08340 32499 32891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 36176 33711 gene locus_tag LOCUS_08350 36176 33711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence020 747 839 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1688 2227 gene locus_tag LOCUS_08360 1688 2227 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_08360 2224 2982 gene locus_tag LOCUS_08370 2224 2982 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973942.1 protein_id gnl|my_center|LOCUS_08370 2979 5276 gene locus_tag LOCUS_08380 2979 5276 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230975.1 protein_id gnl|my_center|LOCUS_08380 5711 7882 gene locus_tag LOCUS_08390 5711 7882 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_08390 8439 9410 gene locus_tag LOCUS_08400 8439 9410 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 protein_id gnl|my_center|LOCUS_08400 9407 11272 gene locus_tag LOCUS_08410 9407 11272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 11315 12676 gene locus_tag LOCUS_08420 11315 12676 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975844.1 protein_id gnl|my_center|LOCUS_08420 12752 13678 gene locus_tag LOCUS_08430 12752 13678 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027842956.1 protein_id gnl|my_center|LOCUS_08430 13683 14528 gene locus_tag LOCUS_08440 13683 14528 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_08440 14909 14553 gene locus_tag LOCUS_08450 14909 14553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 14790 15797 gene locus_tag LOCUS_08460 14790 15797 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731604.1 protein_id gnl|my_center|LOCUS_08460 15787 16728 gene locus_tag LOCUS_08470 gene murQ 15787 16728 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815759.1 protein_id gnl|my_center|LOCUS_08470 16738 19737 gene locus_tag LOCUS_08480 16738 19737 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228347.1 protein_id gnl|my_center|LOCUS_08480 20129 21028 gene locus_tag LOCUS_08490 gene yedA 20129 21028 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268946.1 protein_id gnl|my_center|LOCUS_08490 22854 21664 gene locus_tag LOCUS_08500 22854 21664 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066908.1 protein_id gnl|my_center|LOCUS_08500 23317 22835 gene locus_tag LOCUS_08510 gene rpiB 23317 22835 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187340.1 protein_id gnl|my_center|LOCUS_08510 23595 24707 gene locus_tag LOCUS_08520 23595 24707 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907710.1 protein_id gnl|my_center|LOCUS_08520 24847 26328 gene locus_tag LOCUS_08530 24847 26328 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028557.1 protein_id gnl|my_center|LOCUS_08530 26358 27350 gene locus_tag LOCUS_08540 26358 27350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 27375 28163 gene locus_tag LOCUS_08550 27375 28163 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399223.1 protein_id gnl|my_center|LOCUS_08550 28163 29167 gene locus_tag LOCUS_08560 28163 29167 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389095.1 protein_id gnl|my_center|LOCUS_08560 29160 29879 gene locus_tag LOCUS_08570 gene dhaL 29160 29879 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389096.1 protein_id gnl|my_center|LOCUS_08570 29876 31081 gene locus_tag LOCUS_08580 29876 31081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_08580 31198 32082 gene locus_tag LOCUS_08590 31198 32082 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393168.1 protein_id gnl|my_center|LOCUS_08590 33766 32240 gene locus_tag LOCUS_08600 33766 32240 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164830003.1 protein_id gnl|my_center|LOCUS_08600 35264 34218 gene locus_tag LOCUS_08610 35264 34218 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226051.1 protein_id gnl|my_center|LOCUS_08610 >Feature sequence021 119 1231 gene locus_tag LOCUS_08620 gene amrS 119 1231 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942373.1 protein_id gnl|my_center|LOCUS_08620 1228 2100 gene locus_tag LOCUS_08630 gene amrB 1228 2100 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942474.1 protein_id gnl|my_center|LOCUS_08630 2110 2769 gene locus_tag LOCUS_08640 2110 2769 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946184.1 protein_id gnl|my_center|LOCUS_08640 3064 4722 gene locus_tag LOCUS_08650 3064 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 4859 5860 gene locus_tag LOCUS_08660 gene sapM 4859 5860 CDS product phosphatidylinositol-3-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417249.1 protein_id gnl|my_center|LOCUS_08660 6073 6651 gene locus_tag LOCUS_08670 6073 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 6792 8390 gene locus_tag LOCUS_08680 gene pgm 6792 8390 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_08680 8444 9181 gene locus_tag LOCUS_08690 8444 9181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 10165 9446 gene locus_tag LOCUS_08700 10165 9446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 11429 10170 gene locus_tag LOCUS_08710 gene ald 11429 10170 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704256.1 protein_id gnl|my_center|LOCUS_08710 12157 11507 gene locus_tag LOCUS_08720 12157 11507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 14223 12460 gene locus_tag LOCUS_08730 gene malS 14223 12460 CDS product oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195357.1 protein_id gnl|my_center|LOCUS_08730 15448 14540 gene locus_tag LOCUS_08740 15448 14540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 16731 15526 gene locus_tag LOCUS_08750 16731 15526 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211303.1 protein_id gnl|my_center|LOCUS_08750 17073 18338 gene locus_tag LOCUS_08760 17073 18338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 18332 20110 gene locus_tag LOCUS_08770 18332 20110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 20888 20118 gene locus_tag LOCUS_08780 20888 20118 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256891.1 protein_id gnl|my_center|LOCUS_08780 22282 20885 gene locus_tag LOCUS_08790 22282 20885 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257530.1 protein_id gnl|my_center|LOCUS_08790 23042 22284 gene locus_tag LOCUS_08800 23042 22284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 24040 23210 gene locus_tag LOCUS_08810 24040 23210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 25434 24040 gene locus_tag LOCUS_08820 25434 24040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 25857 26807 gene locus_tag LOCUS_08830 25857 26807 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640552.1 protein_id gnl|my_center|LOCUS_08830 28192 26861 gene locus_tag LOCUS_08840 28192 26861 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926962.1 protein_id gnl|my_center|LOCUS_08840 28867 28208 gene locus_tag LOCUS_08850 28867 28208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 29552 29028 gene locus_tag LOCUS_08860 29552 29028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 30045 29578 gene locus_tag LOCUS_08870 30045 29578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 30058 31095 gene locus_tag LOCUS_08880 30058 31095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 32009 31152 gene locus_tag LOCUS_08890 32009 31152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 32656 32006 gene locus_tag LOCUS_08900 32656 32006 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_08900 33019 33780 gene locus_tag LOCUS_08910 33019 33780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 35782 33938 gene locus_tag LOCUS_08920 35782 33938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence022 155 811 gene locus_tag LOCUS_08930 155 811 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545748.1 protein_id gnl|my_center|LOCUS_08930 2097 874 gene locus_tag LOCUS_08940 2097 874 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_08940 3244 2099 gene locus_tag LOCUS_08950 3244 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 4305 3481 gene locus_tag LOCUS_08960 4305 3481 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_08960 4479 6173 gene locus_tag LOCUS_08970 4479 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 6170 7852 gene locus_tag LOCUS_08980 6170 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 7849 8961 gene locus_tag LOCUS_08990 7849 8961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 8958 9701 gene locus_tag LOCUS_09000 8958 9701 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258485.1 protein_id gnl|my_center|LOCUS_09000 9710 10885 gene locus_tag LOCUS_09010 9710 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 10882 11103 gene locus_tag LOCUS_09020 10882 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 11235 11378 gene locus_tag LOCUS_09030 11235 11378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 11580 12563 gene locus_tag LOCUS_09040 11580 12563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 12640 13872 gene locus_tag LOCUS_09050 12640 13872 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_09050 13908 15305 gene locus_tag LOCUS_09060 13908 15305 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_09060 15327 16343 gene locus_tag LOCUS_09070 15327 16343 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256415.1 protein_id gnl|my_center|LOCUS_09070 16347 17276 gene locus_tag LOCUS_09080 16347 17276 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_09080 17273 17659 gene locus_tag LOCUS_09090 17273 17659 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660457.1 protein_id gnl|my_center|LOCUS_09090 17821 18468 gene locus_tag LOCUS_09100 17821 18468 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480036.1 protein_id gnl|my_center|LOCUS_09100 18555 19289 gene locus_tag LOCUS_09110 gene raiA 18555 19289 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_09110 19330 20331 gene locus_tag LOCUS_09120 19330 20331 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_09120 20862 20335 gene locus_tag LOCUS_09130 20862 20335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 22276 21134 gene locus_tag LOCUS_09140 22276 21134 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259095.1 protein_id gnl|my_center|LOCUS_09140 23091 22273 gene locus_tag LOCUS_09150 23091 22273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 24092 23091 gene locus_tag LOCUS_09160 24092 23091 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258891.1 protein_id gnl|my_center|LOCUS_09160 25429 24101 gene locus_tag LOCUS_09170 gene murA 25429 24101 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393852.1 protein_id gnl|my_center|LOCUS_09170 25912 25433 gene locus_tag LOCUS_09180 25912 25433 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258892.1 protein_id gnl|my_center|LOCUS_09180 26894 26040 gene locus_tag LOCUS_09190 26894 26040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09190 27061 27492 gene locus_tag LOCUS_09200 27061 27492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 28340 27489 gene locus_tag LOCUS_09210 gene atpG 28340 27489 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_09210 29306 28359 gene locus_tag LOCUS_09220 29306 28359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09220 30442 29900 gene locus_tag LOCUS_09230 gene atpH 30442 29900 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403676.1 protein_id gnl|my_center|LOCUS_09230 30993 30442 gene locus_tag LOCUS_09240 30993 30442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 31045 31082 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32263 31187 gene locus_tag LOCUS_09250 32263 31187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 32536 32300 gene locus_tag LOCUS_09260 32536 32300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 33830 32661 gene locus_tag LOCUS_09270 33830 32661 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378318.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence023 <1 882 gene locus_tag LOCUS_09280 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887356.1:NAD-dependent 4,6-dehydratase LegB 890 1612 gene locus_tag LOCUS_09290 890 1612 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480005.1 protein_id gnl|my_center|LOCUS_09290 1613 2527 gene locus_tag LOCUS_09300 1613 2527 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177698.1 protein_id gnl|my_center|LOCUS_09300 2600 3646 gene locus_tag LOCUS_09310 gene gmd 2600 3646 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_09310 3643 4590 gene locus_tag LOCUS_09320 3643 4590 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_09320 5610 4639 gene locus_tag LOCUS_09330 5610 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 6695 5694 gene locus_tag LOCUS_09340 gene gmd 6695 5694 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_09340 6813 7871 gene locus_tag LOCUS_09350 6813 7871 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_09350 8815 7868 gene locus_tag LOCUS_09360 8815 7868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 9789 9262 gene locus_tag LOCUS_09370 gene gmhB 9789 9262 CDS product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950343.1 protein_id gnl|my_center|LOCUS_09370 10442 9801 gene locus_tag LOCUS_09380 10442 9801 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_09380 11449 10439 gene locus_tag LOCUS_09390 11449 10439 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_09390 12146 11496 gene locus_tag LOCUS_09400 12146 11496 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966337.1 protein_id gnl|my_center|LOCUS_09400 12383 13480 gene locus_tag LOCUS_09410 12383 13480 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037589.1 protein_id gnl|my_center|LOCUS_09410 15375 13477 gene locus_tag LOCUS_09420 15375 13477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 15581 16543 gene locus_tag LOCUS_09430 15581 16543 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_09430 16545 17849 gene locus_tag LOCUS_09440 16545 17849 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_09440 17842 18633 gene locus_tag LOCUS_09450 17842 18633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 18633 19613 gene locus_tag LOCUS_09460 18633 19613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 19621 20568 gene locus_tag LOCUS_09470 19621 20568 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331295.1 protein_id gnl|my_center|LOCUS_09470 20581 21867 gene locus_tag LOCUS_09480 20581 21867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 21864 22595 gene locus_tag LOCUS_09490 21864 22595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 24261 22600 gene locus_tag LOCUS_09500 24261 22600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 25193 24258 gene locus_tag LOCUS_09510 25193 24258 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_09510 25409 27028 gene locus_tag LOCUS_09520 25409 27028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 28193 27036 gene locus_tag LOCUS_09530 28193 27036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 29056 28193 gene locus_tag LOCUS_09540 29056 28193 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941296.1 protein_id gnl|my_center|LOCUS_09540 29271 30776 gene locus_tag LOCUS_09550 29271 30776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 31918 30785 gene locus_tag LOCUS_09560 31918 30785 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_09560 32877 31948 gene locus_tag LOCUS_09570 32877 31948 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893217.1 protein_id gnl|my_center|LOCUS_09570 32993 33283 gene locus_tag LOCUS_09580 32993 33283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 >Feature sequence024 <1 2363 gene locus_tag LOCUS_09590 <1 2363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392708.1:FAD-dependent oxidoreductase note possible pseudo, frameshifted 2360 4069 gene locus_tag LOCUS_09600 2360 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09600 4087 4296 gene locus_tag LOCUS_09610 4087 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 4334 4390 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4549 5562 gene locus_tag LOCUS_09620 4549 5562 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763084.1 protein_id gnl|my_center|LOCUS_09620 5566 6069 gene locus_tag LOCUS_09630 5566 6069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 6393 6737 gene locus_tag LOCUS_09640 6393 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 6739 7041 gene locus_tag LOCUS_09650 6739 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 7151 7546 gene locus_tag LOCUS_09660 7151 7546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 7759 8601 gene locus_tag LOCUS_09670 7759 8601 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727947.1 protein_id gnl|my_center|LOCUS_09670 8622 8957 gene locus_tag LOCUS_09680 8622 8957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 9003 9500 gene locus_tag LOCUS_09690 9003 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 9018 9050 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9696 9514 gene locus_tag LOCUS_09700 9696 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 9949 10554 gene locus_tag LOCUS_09710 9949 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 11262 10654 gene locus_tag LOCUS_09720 11262 10654 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946184.1 protein_id gnl|my_center|LOCUS_09720 11337 11633 gene locus_tag LOCUS_09730 11337 11633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 11638 12477 gene locus_tag LOCUS_09740 11638 12477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 12910 12368 gene locus_tag LOCUS_09750 12910 12368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 14156 13047 gene locus_tag LOCUS_09760 14156 13047 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728588.1 protein_id gnl|my_center|LOCUS_09760 14480 14244 gene locus_tag LOCUS_09770 14480 14244 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255927.1 protein_id gnl|my_center|LOCUS_09770 15551 14499 gene locus_tag LOCUS_09780 15551 14499 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660365.1 protein_id gnl|my_center|LOCUS_09780 15889 15548 gene locus_tag LOCUS_09790 15889 15548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 16766 16449 gene locus_tag LOCUS_09800 16766 16449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 17121 16774 gene locus_tag LOCUS_09810 17121 16774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 18892 17606 gene locus_tag LOCUS_09820 18892 17606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 19028 19267 gene locus_tag LOCUS_09830 19028 19267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 19264 20259 gene locus_tag LOCUS_09840 19264 20259 CDS product permease prefix domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804079.1 protein_id gnl|my_center|LOCUS_09840 20313 20693 gene locus_tag LOCUS_09850 20313 20693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 20725 21252 gene locus_tag LOCUS_09860 20725 21252 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229654.1 protein_id gnl|my_center|LOCUS_09860 22006 21383 gene locus_tag LOCUS_09870 22006 21383 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257323.1 protein_id gnl|my_center|LOCUS_09870 24330 22162 gene locus_tag LOCUS_09880 24330 22162 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257888.1 protein_id gnl|my_center|LOCUS_09880 27371 24327 gene locus_tag LOCUS_09890 27371 24327 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804565.1 protein_id gnl|my_center|LOCUS_09890 27836 28906 gene locus_tag LOCUS_09900 27836 28906 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009927050.1 protein_id gnl|my_center|LOCUS_09900 28972 30336 gene locus_tag LOCUS_09910 28972 30336 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227644.1 protein_id gnl|my_center|LOCUS_09910 30456 31433 gene locus_tag LOCUS_09920 30456 31433 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529835.1 protein_id gnl|my_center|LOCUS_09920 31430 32320 gene locus_tag LOCUS_09930 31430 32320 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258586.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence025 162 286 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1067 2233 gene locus_tag LOCUS_09940 gene trxB 1067 2233 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031219.1 protein_id gnl|my_center|LOCUS_09940 2989 2240 gene locus_tag LOCUS_09950 2989 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 3213 3037 gene locus_tag LOCUS_09960 3213 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 3523 4695 gene locus_tag LOCUS_09970 3523 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 4873 5328 gene locus_tag LOCUS_09980 4873 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 5742 5419 gene locus_tag LOCUS_09990 5742 5419 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391912.1 protein_id gnl|my_center|LOCUS_09990 6123 7298 gene locus_tag LOCUS_10000 6123 7298 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870412.1 protein_id gnl|my_center|LOCUS_10000 7315 9558 gene locus_tag LOCUS_10010 7315 9558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 9567 9893 gene locus_tag LOCUS_10020 9567 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 10967 10062 gene locus_tag LOCUS_10030 10967 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 11237 12511 gene locus_tag LOCUS_10040 11237 12511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 13722 12538 gene locus_tag LOCUS_10050 13722 12538 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973189.1 protein_id gnl|my_center|LOCUS_10050 14192 13908 gene locus_tag LOCUS_10060 14192 13908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 14457 15878 gene locus_tag LOCUS_10070 14457 15878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 15883 16578 gene locus_tag LOCUS_10080 15883 16578 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_10080 16731 18743 gene locus_tag LOCUS_10090 16731 18743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 18743 19375 gene locus_tag LOCUS_10100 18743 19375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 19741 19974 gene locus_tag LOCUS_10110 19741 19974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 20925 20056 gene locus_tag LOCUS_10120 20925 20056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 22231 20918 gene locus_tag LOCUS_10130 22231 20918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 23844 22216 gene locus_tag LOCUS_10140 gene zwf 23844 22216 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_10140 24737 23841 gene locus_tag LOCUS_10150 gene gnd 24737 23841 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256404.1 protein_id gnl|my_center|LOCUS_10150 26489 24741 gene locus_tag LOCUS_10160 26489 24741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 27033 26545 gene locus_tag LOCUS_10170 27033 26545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 29107 27044 gene locus_tag LOCUS_10180 gene tkt 29107 27044 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_10180 29524 30039 gene locus_tag LOCUS_10190 29524 30039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 30077 30232 gene locus_tag LOCUS_10200 30077 30232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence026 223 1413 gene locus_tag LOCUS_10210 223 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1410 2198 gene locus_tag LOCUS_10220 gene fabG 1410 2198 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_10220 2329 3522 gene locus_tag LOCUS_10230 2329 3522 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228417.1 protein_id gnl|my_center|LOCUS_10230 3608 4906 gene locus_tag LOCUS_10240 3608 4906 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396179.1 protein_id gnl|my_center|LOCUS_10240 4969 5901 gene locus_tag LOCUS_10250 4969 5901 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975588.1 protein_id gnl|my_center|LOCUS_10250 5898 6857 gene locus_tag LOCUS_10260 5898 6857 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888075.1 protein_id gnl|my_center|LOCUS_10260 6958 7857 gene locus_tag LOCUS_10270 6958 7857 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_10270 7927 8925 gene locus_tag LOCUS_10280 7927 8925 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533065.1 protein_id gnl|my_center|LOCUS_10280 8922 9575 gene locus_tag LOCUS_10290 8922 9575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 9960 9724 gene locus_tag LOCUS_10300 9960 9724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 10066 10347 gene locus_tag LOCUS_10310 10066 10347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 10828 11553 gene locus_tag LOCUS_10320 10828 11553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 11614 12885 gene locus_tag LOCUS_10330 11614 12885 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249483.1 protein_id gnl|my_center|LOCUS_10330 13196 14167 gene locus_tag LOCUS_10340 13196 14167 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255411.1 protein_id gnl|my_center|LOCUS_10340 15041 14310 gene locus_tag LOCUS_10350 15041 14310 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227619.1 protein_id gnl|my_center|LOCUS_10350 15132 15374 gene locus_tag LOCUS_10360 15132 15374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 15427 15735 gene locus_tag LOCUS_10370 15427 15735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 17179 15845 gene locus_tag LOCUS_10380 17179 15845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 17617 17312 gene locus_tag LOCUS_10390 17617 17312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 18446 18030 gene locus_tag LOCUS_10400 18446 18030 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_10400 18675 18427 gene locus_tag LOCUS_10410 18675 18427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 18900 20939 gene locus_tag LOCUS_10420 18900 20939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 21290 21808 gene locus_tag LOCUS_10430 21290 21808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 21805 23247 gene locus_tag LOCUS_10440 21805 23247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 24892 23756 gene locus_tag LOCUS_10450 24892 23756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 25088 25477 gene locus_tag LOCUS_10460 25088 25477 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223509.1 protein_id gnl|my_center|LOCUS_10460 25474 26043 gene locus_tag LOCUS_10470 25474 26043 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880118.1 protein_id gnl|my_center|LOCUS_10470 26406 26056 gene locus_tag LOCUS_10480 26406 26056 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070692.1 protein_id gnl|my_center|LOCUS_10480 28542 26479 gene locus_tag LOCUS_10490 28542 26479 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082373898.1 protein_id gnl|my_center|LOCUS_10490 28823 28545 gene locus_tag LOCUS_10500 28823 28545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 29686 28826 gene locus_tag LOCUS_10510 29686 28826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 30118 29690 gene locus_tag LOCUS_10520 30118 29690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 30862 30263 gene locus_tag LOCUS_10530 30862 30263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence027 <1 1352 gene locus_tag LOCUS_10540 <1 1352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942384.1:indolepyruvate ferredoxin oxidoreductase subunit alpha 1349 1879 gene locus_tag LOCUS_10550 1349 1879 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_10550 2263 3585 gene locus_tag LOCUS_10560 2263 3585 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_10560 3687 4121 gene locus_tag LOCUS_10570 3687 4121 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877456.1 protein_id gnl|my_center|LOCUS_10570 5152 4163 gene locus_tag LOCUS_10580 5152 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 5739 5149 gene locus_tag LOCUS_10590 5739 5149 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257373.1 protein_id gnl|my_center|LOCUS_10590 6525 5953 gene locus_tag LOCUS_10600 6525 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 7009 6707 gene locus_tag LOCUS_10610 7009 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 7128 8099 gene locus_tag LOCUS_10620 7128 8099 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_10620 10868 8166 gene locus_tag LOCUS_10630 gene acnA 10868 8166 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_10630 11459 12316 gene locus_tag LOCUS_10640 11459 12316 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391687.1 protein_id gnl|my_center|LOCUS_10640 12630 13076 gene locus_tag LOCUS_10650 12630 13076 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284381.1 protein_id gnl|my_center|LOCUS_10650 13146 14258 gene locus_tag LOCUS_10660 gene gcvT 13146 14258 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973526.1 protein_id gnl|my_center|LOCUS_10660 14413 14793 gene locus_tag LOCUS_10670 gene gcvH 14413 14793 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765165.1 protein_id gnl|my_center|LOCUS_10670 14838 16211 gene locus_tag LOCUS_10680 gene gcvPA 14838 16211 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_10680 16208 17707 gene locus_tag LOCUS_10690 gene gcvPB 16208 17707 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393440.1 protein_id gnl|my_center|LOCUS_10690 17888 19702 gene locus_tag LOCUS_10700 17888 19702 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256685.1 protein_id gnl|my_center|LOCUS_10700 20122 21957 gene locus_tag LOCUS_10710 20122 21957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 22053 23150 gene locus_tag LOCUS_10720 gene appB 22053 23150 CDS product oligopeptide ABC transporter permease AppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245828.1 protein_id gnl|my_center|LOCUS_10720 23143 24108 gene locus_tag LOCUS_10730 23143 24108 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_10730 24120 25208 gene locus_tag LOCUS_10740 24120 25208 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034325.1 protein_id gnl|my_center|LOCUS_10740 25218 26357 gene locus_tag LOCUS_10750 25218 26357 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 protein_id gnl|my_center|LOCUS_10750 26805 28364 gene locus_tag LOCUS_10760 26805 28364 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887933.1 protein_id gnl|my_center|LOCUS_10760 28467 29471 gene locus_tag LOCUS_10770 28467 29471 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887604.1 protein_id gnl|my_center|LOCUS_10770 29473 30363 gene locus_tag LOCUS_10780 29473 30363 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence028 2528 1503 gene locus_tag LOCUS_10790 2528 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 3592 2633 gene locus_tag LOCUS_10800 3592 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 4285 3620 gene locus_tag LOCUS_10810 4285 3620 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_10810 5057 4296 gene locus_tag LOCUS_10820 gene cmk 5057 4296 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303123.1 protein_id gnl|my_center|LOCUS_10820 5946 5065 gene locus_tag LOCUS_10830 5946 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 6593 5946 gene locus_tag LOCUS_10840 gene scpB 6593 5946 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259764.1 protein_id gnl|my_center|LOCUS_10840 7480 6590 gene locus_tag LOCUS_10850 7480 6590 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_10850 7974 7480 gene locus_tag LOCUS_10860 7974 7480 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812954.1 protein_id gnl|my_center|LOCUS_10860 8653 7985 gene locus_tag LOCUS_10870 8653 7985 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372445.1 protein_id gnl|my_center|LOCUS_10870 9379 8729 gene locus_tag LOCUS_10880 9379 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 10383 9427 gene locus_tag LOCUS_10890 gene xerD 10383 9427 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_10890 12172 10385 gene locus_tag LOCUS_10900 gene recN 12172 10385 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_10900 13014 12169 gene locus_tag LOCUS_10910 13014 12169 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_10910 13856 13011 gene locus_tag LOCUS_10920 13856 13011 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_10920 16092 13960 gene locus_tag LOCUS_10930 gene dxs 16092 13960 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_10930 16536 16258 gene locus_tag LOCUS_10940 16536 16258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 18279 16672 gene locus_tag LOCUS_10950 gene xseA 18279 16672 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_10950 18858 18301 gene locus_tag LOCUS_10960 gene efp 18858 18301 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_10960 20216 18987 gene locus_tag LOCUS_10970 20216 18987 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082355.1 protein_id gnl|my_center|LOCUS_10970 21686 20262 gene locus_tag LOCUS_10980 21686 20262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 22189 21686 gene locus_tag LOCUS_10990 gene ruvX 22189 21686 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_10990 23997 22189 gene locus_tag LOCUS_11000 23997 22189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 25262 24000 gene locus_tag LOCUS_11010 gene ftsA 25262 24000 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 protein_id gnl|my_center|LOCUS_11010 28040 25284 gene locus_tag LOCUS_11020 gene alaS 28040 25284 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810664.1 protein_id gnl|my_center|LOCUS_11020 28540 30216 gene locus_tag LOCUS_11030 28540 30216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence029 339 584 gene locus_tag LOCUS_11040 339 584 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097013212.1 protein_id gnl|my_center|LOCUS_11040 608 1657 gene locus_tag LOCUS_11050 608 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1617 2336 gene locus_tag LOCUS_11060 1617 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 2803 2333 gene locus_tag LOCUS_11070 2803 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 3915 2800 gene locus_tag LOCUS_11080 3915 2800 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182199.1 protein_id gnl|my_center|LOCUS_11080 4144 4722 gene locus_tag LOCUS_11090 4144 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 4691 4852 gene locus_tag LOCUS_11100 4691 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 4942 5388 gene locus_tag LOCUS_11110 4942 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 5878 5417 gene locus_tag LOCUS_11120 5878 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 6081 6419 gene locus_tag LOCUS_11130 6081 6419 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022005.1 protein_id gnl|my_center|LOCUS_11130 7268 6582 gene locus_tag LOCUS_11140 7268 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 7628 8122 gene locus_tag LOCUS_11150 7628 8122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 8300 8515 gene locus_tag LOCUS_11160 8300 8515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 8990 8556 gene locus_tag LOCUS_11170 8990 8556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 10349 9003 gene locus_tag LOCUS_11180 10349 9003 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082803.1 protein_id gnl|my_center|LOCUS_11180 10732 10346 gene locus_tag LOCUS_11190 10732 10346 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528640.1 protein_id gnl|my_center|LOCUS_11190 11284 11012 gene locus_tag LOCUS_11200 11284 11012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 12203 11277 gene locus_tag LOCUS_11210 12203 11277 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226530.1 protein_id gnl|my_center|LOCUS_11210 12928 12299 gene locus_tag LOCUS_11220 12928 12299 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 protein_id gnl|my_center|LOCUS_11220 13133 14641 gene locus_tag LOCUS_11230 13133 14641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 14877 14662 gene locus_tag LOCUS_11240 14877 14662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 15868 15044 gene locus_tag LOCUS_11250 gene pcaD 15868 15044 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223755.1 protein_id gnl|my_center|LOCUS_11250 15984 17894 gene locus_tag LOCUS_11260 15984 17894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 18062 18487 gene locus_tag LOCUS_11270 18062 18487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 18493 19008 gene locus_tag LOCUS_11280 18493 19008 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226004.1 protein_id gnl|my_center|LOCUS_11280 19796 19065 gene locus_tag LOCUS_11290 19796 19065 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969876.1 protein_id gnl|my_center|LOCUS_11290 19844 20284 gene locus_tag LOCUS_11300 19844 20284 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776496.1 protein_id gnl|my_center|LOCUS_11300 20583 20329 gene locus_tag LOCUS_11310 20583 20329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 20968 20684 gene locus_tag LOCUS_11320 20968 20684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 21282 21485 gene locus_tag LOCUS_11330 21282 21485 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288762.1 protein_id gnl|my_center|LOCUS_11330 21746 22819 gene locus_tag LOCUS_11340 21746 22819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 23009 24301 gene locus_tag LOCUS_11350 23009 24301 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194757.1 protein_id gnl|my_center|LOCUS_11350 24305 24649 gene locus_tag LOCUS_11360 24305 24649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 24825 25460 gene locus_tag LOCUS_11370 24825 25460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 27311 26085 gene locus_tag LOCUS_11380 27311 26085 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106275831.1 protein_id gnl|my_center|LOCUS_11380 28273 27413 gene locus_tag LOCUS_11390 28273 27413 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839268.1 protein_id gnl|my_center|LOCUS_11390 28808 28410 gene locus_tag LOCUS_11400 gene msrB 28808 28410 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404556.1 protein_id gnl|my_center|LOCUS_11400 29629 28805 gene locus_tag LOCUS_11410 29629 28805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence030 75 1055 gene locus_tag LOCUS_11420 gene nadA 75 1055 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257284.1 protein_id gnl|my_center|LOCUS_11420 1660 1082 gene locus_tag LOCUS_11430 1660 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 2042 1791 gene locus_tag LOCUS_11440 2042 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 2542 2617 gene locus_tag LOCUS_t00150 2542 2617 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3552 2806 gene locus_tag LOCUS_11450 3552 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 5255 3723 gene locus_tag LOCUS_11460 5255 3723 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522282.1 protein_id gnl|my_center|LOCUS_11460 6659 6228 gene locus_tag LOCUS_11470 6659 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 9496 7205 gene locus_tag LOCUS_11480 9496 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 10757 9822 gene locus_tag LOCUS_11490 gene metF 10757 9822 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_11490 10902 11387 gene locus_tag LOCUS_11500 10902 11387 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092949.1 protein_id gnl|my_center|LOCUS_11500 11860 11438 gene locus_tag LOCUS_11510 11860 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 12981 12127 gene locus_tag LOCUS_11520 12981 12127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 13945 13277 gene locus_tag LOCUS_11530 13945 13277 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921252.1 protein_id gnl|my_center|LOCUS_11530 18295 13988 gene locus_tag LOCUS_11540 18295 13988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 19044 18436 gene locus_tag LOCUS_11550 19044 18436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 19978 19121 gene locus_tag LOCUS_11560 19978 19121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 20933 20082 gene locus_tag LOCUS_11570 20933 20082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 23684 21600 gene locus_tag LOCUS_11580 23684 21600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 23774 23795 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24159 23869 gene locus_tag LOCUS_11590 24159 23869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 24068 24457 gene locus_tag LOCUS_11600 24068 24457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 24508 25365 gene locus_tag LOCUS_11610 gene sufC 24508 25365 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259318.1 protein_id gnl|my_center|LOCUS_11610 25368 26708 gene locus_tag LOCUS_11620 25368 26708 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_11620 26874 27287 gene locus_tag LOCUS_11630 26874 27287 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037032.1 protein_id gnl|my_center|LOCUS_11630 27304 28281 gene locus_tag LOCUS_11640 27304 28281 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_11640 28344 28754 gene locus_tag LOCUS_11650 28344 28754 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_11650 28775 29917 gene locus_tag LOCUS_11660 gene moeB 28775 29917 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057412.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence031 1177 2340 gene locus_tag LOCUS_11670 1177 2340 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027639.1 protein_id gnl|my_center|LOCUS_11670 2598 4661 gene locus_tag LOCUS_11680 2598 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 4933 4715 gene locus_tag LOCUS_11690 4933 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 5815 4982 gene locus_tag LOCUS_11700 5815 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 6674 5802 gene locus_tag LOCUS_11710 6674 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 7029 7313 gene locus_tag LOCUS_11720 7029 7313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 9097 7493 gene locus_tag LOCUS_11730 9097 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 9176 9763 gene locus_tag LOCUS_11740 9176 9763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 11603 10200 gene locus_tag LOCUS_11750 gene asnS 11603 10200 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211301.1 protein_id gnl|my_center|LOCUS_11750 11925 13847 gene locus_tag LOCUS_11760 gene acs 11925 13847 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255917.1 protein_id gnl|my_center|LOCUS_11760 14980 13970 gene locus_tag LOCUS_11770 gene mgrA 14980 13970 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_11770 16013 14985 gene locus_tag LOCUS_11780 16013 14985 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_11780 17199 16126 gene locus_tag LOCUS_11790 gene cytR 17199 16126 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481416.1 protein_id gnl|my_center|LOCUS_11790 19361 17340 gene locus_tag LOCUS_11800 19361 17340 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225268.1 protein_id gnl|my_center|LOCUS_11800 19600 20994 gene locus_tag LOCUS_11810 19600 20994 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225265.1 protein_id gnl|my_center|LOCUS_11810 21004 22032 gene locus_tag LOCUS_11820 21004 22032 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051555.1 protein_id gnl|my_center|LOCUS_11820 22033 22881 gene locus_tag LOCUS_11830 22033 22881 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051554.1 protein_id gnl|my_center|LOCUS_11830 23114 23908 gene locus_tag LOCUS_11840 23114 23908 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403012.1 protein_id gnl|my_center|LOCUS_11840 24052 24786 gene locus_tag LOCUS_11850 24052 24786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 25741 24758 gene locus_tag LOCUS_11860 25741 24758 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_11860 26796 25903 gene locus_tag LOCUS_11870 26796 25903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 27398 26964 gene locus_tag LOCUS_11880 27398 26964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 27638 28102 gene locus_tag LOCUS_11890 27638 28102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence032 3328 803 gene locus_tag LOCUS_11900 3328 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 3879 3325 gene locus_tag LOCUS_11910 3879 3325 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_11910 5317 4037 gene locus_tag LOCUS_11920 5317 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 6261 5314 gene locus_tag LOCUS_11930 6261 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 6827 6258 gene locus_tag LOCUS_11940 6827 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 6742 7683 gene locus_tag LOCUS_11950 6742 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 7699 8154 gene locus_tag LOCUS_11960 7699 8154 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170853.1 protein_id gnl|my_center|LOCUS_11960 10139 8475 gene locus_tag LOCUS_11970 10139 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 10478 10203 gene locus_tag LOCUS_11980 10478 10203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 12006 10501 gene locus_tag LOCUS_11990 gene gatB 12006 10501 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_11990 12320 12003 gene locus_tag LOCUS_12000 12320 12003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 13572 12313 gene locus_tag LOCUS_12010 13572 12313 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257780.1 protein_id gnl|my_center|LOCUS_12010 15196 13583 gene locus_tag LOCUS_12020 gene gatA 15196 13583 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257583.1 protein_id gnl|my_center|LOCUS_12020 15504 15199 gene locus_tag LOCUS_12030 gene gatC 15504 15199 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_12030 15631 16476 gene locus_tag LOCUS_12040 15631 16476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 18731 16542 gene locus_tag LOCUS_12050 gene ligA 18731 16542 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812372.1 protein_id gnl|my_center|LOCUS_12050 19546 18728 gene locus_tag LOCUS_12060 19546 18728 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898511.1 protein_id gnl|my_center|LOCUS_12060 19662 19835 gene locus_tag LOCUS_12070 19662 19835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 20473 19901 gene locus_tag LOCUS_12080 20473 19901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 23319 20536 gene locus_tag LOCUS_12090 23319 20536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 24032 23373 gene locus_tag LOCUS_12100 24032 23373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 23938 24357 gene locus_tag LOCUS_12110 23938 24357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 25572 24745 gene locus_tag LOCUS_12120 25572 24745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 26536 25697 gene locus_tag LOCUS_12130 26536 25697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 27209 26685 gene locus_tag LOCUS_12140 27209 26685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 27196 27378 gene locus_tag LOCUS_12150 27196 27378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence033 208 230 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 494 1345 gene locus_tag LOCUS_12160 494 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1404 2420 gene locus_tag LOCUS_12170 1404 2420 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_12170 2413 3366 gene locus_tag LOCUS_12180 2413 3366 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226780.1 protein_id gnl|my_center|LOCUS_12180 3370 4389 gene locus_tag LOCUS_12190 3370 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 4431 5528 gene locus_tag LOCUS_12200 4431 5528 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_12200 6085 5558 gene locus_tag LOCUS_12210 6085 5558 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226004.1 protein_id gnl|my_center|LOCUS_12210 7398 6625 gene locus_tag LOCUS_12220 7398 6625 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975420.1 protein_id gnl|my_center|LOCUS_12220 7826 7458 gene locus_tag LOCUS_12230 7826 7458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 9091 7958 gene locus_tag LOCUS_12240 9091 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 9446 10366 gene locus_tag LOCUS_12250 9446 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 10485 11402 gene locus_tag LOCUS_12260 10485 11402 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258911.1 protein_id gnl|my_center|LOCUS_12260 11402 13090 gene locus_tag LOCUS_12270 11402 13090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 14246 13170 gene locus_tag LOCUS_12280 14246 13170 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312892.1 protein_id gnl|my_center|LOCUS_12280 14389 14796 gene locus_tag LOCUS_12290 14389 14796 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590444.1 protein_id gnl|my_center|LOCUS_12290 14813 15295 gene locus_tag LOCUS_12300 14813 15295 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426364.1 protein_id gnl|my_center|LOCUS_12300 15325 17334 gene locus_tag LOCUS_12310 15325 17334 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057757224.1 protein_id gnl|my_center|LOCUS_12310 18699 17716 gene locus_tag LOCUS_12320 18699 17716 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976227.1 protein_id gnl|my_center|LOCUS_12320 18927 20120 gene locus_tag LOCUS_12330 18927 20120 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_12330 20117 22651 gene locus_tag LOCUS_12340 20117 22651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 22800 23288 gene locus_tag LOCUS_12350 22800 23288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 23351 23788 gene locus_tag LOCUS_12360 23351 23788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 24991 23819 gene locus_tag LOCUS_12370 24991 23819 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258677.1 protein_id gnl|my_center|LOCUS_12370 26104 25070 gene locus_tag LOCUS_12380 26104 25070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 26257 27798 gene locus_tag LOCUS_12390 26257 27798 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 protein_id gnl|my_center|LOCUS_12390 >Feature sequence034 668 36 gene locus_tag LOCUS_12400 668 36 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225120.1 protein_id gnl|my_center|LOCUS_12400 789 1295 gene locus_tag LOCUS_12410 789 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1292 3724 gene locus_tag LOCUS_12420 1292 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 5275 3794 gene locus_tag LOCUS_12430 5275 3794 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_12430 5631 5278 gene locus_tag LOCUS_12440 5631 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12440 6100 5522 gene locus_tag LOCUS_12450 6100 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12450 6797 6030 gene locus_tag LOCUS_12460 6797 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12460 9784 6794 gene locus_tag LOCUS_12470 9784 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 6840 6878 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10126 11025 gene locus_tag LOCUS_12480 10126 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 11171 11365 gene locus_tag LOCUS_12490 11171 11365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 12884 11484 gene locus_tag LOCUS_12500 12884 11484 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229620.1 protein_id gnl|my_center|LOCUS_12500 13065 13829 gene locus_tag LOCUS_12510 13065 13829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 13887 14744 gene locus_tag LOCUS_12520 13887 14744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 14904 15833 gene locus_tag LOCUS_12530 14904 15833 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_12530 15843 16949 gene locus_tag LOCUS_12540 15843 16949 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877096.1 protein_id gnl|my_center|LOCUS_12540 17128 18225 gene locus_tag LOCUS_12550 17128 18225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 18419 18907 gene locus_tag LOCUS_12560 18419 18907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 19101 19634 gene locus_tag LOCUS_12570 19101 19634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 19730 19987 gene locus_tag LOCUS_12580 19730 19987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 19987 20154 gene locus_tag LOCUS_12590 19987 20154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 20713 20192 gene locus_tag LOCUS_12600 20713 20192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 21971 20781 gene locus_tag LOCUS_12610 21971 20781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 21999 22754 gene locus_tag LOCUS_12620 21999 22754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 23215 23703 gene locus_tag LOCUS_12630 23215 23703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 23746 24111 gene locus_tag LOCUS_12640 23746 24111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 24559 24215 gene locus_tag LOCUS_12650 gene trxA 24559 24215 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_12650 24900 24607 gene locus_tag LOCUS_12660 24900 24607 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265860.1 protein_id gnl|my_center|LOCUS_12660 25122 26861 gene locus_tag LOCUS_12670 25122 26861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 26873 27313 gene locus_tag LOCUS_12680 26873 27313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence035 1725 403 gene locus_tag LOCUS_12690 gene ahcY 1725 403 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_12690 2582 1722 gene locus_tag LOCUS_12700 2582 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 3204 2683 gene locus_tag LOCUS_12710 3204 2683 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944687.1 protein_id gnl|my_center|LOCUS_12710 5609 3312 gene locus_tag LOCUS_12720 5609 3312 CDS product SGNH hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624217.1 protein_id gnl|my_center|LOCUS_12720 9799 5792 gene locus_tag LOCUS_12730 gene mfd 9799 5792 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258948.1 protein_id gnl|my_center|LOCUS_12730 10482 9796 gene locus_tag LOCUS_12740 gene pth 10482 9796 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888998.1 protein_id gnl|my_center|LOCUS_12740 11294 10650 gene locus_tag LOCUS_12750 11294 10650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 13535 11373 gene locus_tag LOCUS_12760 13535 11373 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392131.1 protein_id gnl|my_center|LOCUS_12760 14007 13546 gene locus_tag LOCUS_12770 14007 13546 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 protein_id gnl|my_center|LOCUS_12770 14264 14079 gene locus_tag LOCUS_12780 gene rpsU 14264 14079 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055893.1 protein_id gnl|my_center|LOCUS_12780 15917 14499 gene locus_tag LOCUS_12790 15917 14499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 16411 15914 gene locus_tag LOCUS_12800 16411 15914 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_12800 16608 18287 gene locus_tag LOCUS_12810 16608 18287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 18323 18637 gene locus_tag LOCUS_12820 18323 18637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 18986 18639 gene locus_tag LOCUS_12830 18986 18639 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_12830 20516 19065 gene locus_tag LOCUS_12840 gene mtaB 20516 19065 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392125.1 protein_id gnl|my_center|LOCUS_12840 20646 22142 gene locus_tag LOCUS_12850 20646 22142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 22249 22773 gene locus_tag LOCUS_12860 22249 22773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 22770 24218 gene locus_tag LOCUS_12870 22770 24218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 25294 24293 gene locus_tag LOCUS_12880 25294 24293 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257710.1 protein_id gnl|my_center|LOCUS_12880 26411 25287 gene locus_tag LOCUS_12890 gene dnaJ 26411 25287 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920758.1 protein_id gnl|my_center|LOCUS_12890 26714 26738 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence036 1343 72 gene locus_tag LOCUS_12900 1343 72 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256990.1 protein_id gnl|my_center|LOCUS_12900 1613 2638 gene locus_tag LOCUS_12910 1613 2638 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256998.1 protein_id gnl|my_center|LOCUS_12910 2635 4839 gene locus_tag LOCUS_12920 2635 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 4836 7316 gene locus_tag LOCUS_12930 4836 7316 CDS product N,N'-diacetylchitobiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262593.1 protein_id gnl|my_center|LOCUS_12930 7425 8438 gene locus_tag LOCUS_12940 7425 8438 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225254.1 protein_id gnl|my_center|LOCUS_12940 8483 9250 gene locus_tag LOCUS_12950 8483 9250 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530852.1 protein_id gnl|my_center|LOCUS_12950 9393 11027 gene locus_tag LOCUS_12960 9393 11027 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112402.1 protein_id gnl|my_center|LOCUS_12960 11231 11034 gene locus_tag LOCUS_12970 11231 11034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 11464 12822 gene locus_tag LOCUS_12980 gene moeA 11464 12822 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397348.1 protein_id gnl|my_center|LOCUS_12980 12807 13406 gene locus_tag LOCUS_12990 12807 13406 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_12990 13546 13926 gene locus_tag LOCUS_13000 13546 13926 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975235.1 protein_id gnl|my_center|LOCUS_13000 13923 14771 gene locus_tag LOCUS_13010 gene modA 13923 14771 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_13010 14783 15652 gene locus_tag LOCUS_13020 14783 15652 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889428.1 protein_id gnl|my_center|LOCUS_13020 16278 15682 gene locus_tag LOCUS_13030 16278 15682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 16767 16282 gene locus_tag LOCUS_13040 gene moaC 16767 16282 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_13040 17793 16771 gene locus_tag LOCUS_13050 gene moaA 17793 16771 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257065.1 protein_id gnl|my_center|LOCUS_13050 18253 17798 gene locus_tag LOCUS_13060 18253 17798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 19382 18438 gene locus_tag LOCUS_13070 19382 18438 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085684.1 protein_id gnl|my_center|LOCUS_13070 20131 19382 gene locus_tag LOCUS_13080 20131 19382 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632942.1 protein_id gnl|my_center|LOCUS_13080 21113 20265 gene locus_tag LOCUS_13090 21113 20265 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949086.1 protein_id gnl|my_center|LOCUS_13090 22367 21156 gene locus_tag LOCUS_13100 22367 21156 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_13100 23412 22501 gene locus_tag LOCUS_13110 23412 22501 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_13110 24293 23409 gene locus_tag LOCUS_13120 24293 23409 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_13120 25041 24571 gene locus_tag LOCUS_13130 25041 24571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 <26592 25303 gene locus_tag LOCUS_13140 <26592 25303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258815.1:pyruvate, phosphate dikinase 25341 25422 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence037 1485 370 gene locus_tag LOCUS_13150 1485 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1643 2362 gene locus_tag LOCUS_13160 1643 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 2619 3554 gene locus_tag LOCUS_13170 2619 3554 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391485.1 protein_id gnl|my_center|LOCUS_13170 4213 3551 gene locus_tag LOCUS_13180 gene msrA 4213 3551 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056729.1 protein_id gnl|my_center|LOCUS_13180 4395 5636 gene locus_tag LOCUS_13190 4395 5636 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 protein_id gnl|my_center|LOCUS_13190 7112 5658 gene locus_tag LOCUS_13200 gene xylB 7112 5658 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_13200 8309 7401 gene locus_tag LOCUS_13210 8309 7401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 8546 8956 gene locus_tag LOCUS_13220 8546 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 9083 9841 gene locus_tag LOCUS_13230 9083 9841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 9849 10724 gene locus_tag LOCUS_13240 9849 10724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 10902 12104 gene locus_tag LOCUS_13250 10902 12104 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085634.1 protein_id gnl|my_center|LOCUS_13250 12222 13511 gene locus_tag LOCUS_13260 12222 13511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 14149 13508 gene locus_tag LOCUS_13270 14149 13508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 15356 14286 gene locus_tag LOCUS_13280 15356 14286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 15505 15969 gene locus_tag LOCUS_13290 15505 15969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 16019 17995 gene locus_tag LOCUS_13300 16019 17995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 17896 18798 gene locus_tag LOCUS_13310 17896 18798 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_13310 19043 18795 gene locus_tag LOCUS_13320 19043 18795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 19474 19133 gene locus_tag LOCUS_13330 19474 19133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 20979 19750 gene locus_tag LOCUS_13340 20979 19750 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533215.1 protein_id gnl|my_center|LOCUS_13340 21313 21134 gene locus_tag LOCUS_13350 21313 21134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 21726 22709 gene locus_tag LOCUS_13360 21726 22709 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257547.1 protein_id gnl|my_center|LOCUS_13360 23091 22723 gene locus_tag LOCUS_13370 23091 22723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 23339 23998 gene locus_tag LOCUS_13380 23339 23998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 24677 23988 gene locus_tag LOCUS_13390 24677 23988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 24791 25708 gene locus_tag LOCUS_13400 24791 25708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence038 2353 2970 gene locus_tag LOCUS_13410 2353 2970 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583168.1 protein_id gnl|my_center|LOCUS_13410 2997 3704 gene locus_tag LOCUS_13420 2997 3704 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403639.1 protein_id gnl|my_center|LOCUS_13420 4005 4262 gene locus_tag LOCUS_13430 4005 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 4726 4328 gene locus_tag LOCUS_13440 4726 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 4995 7349 gene locus_tag LOCUS_13450 4995 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 7555 7328 gene locus_tag LOCUS_13460 7555 7328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 7466 8191 gene locus_tag LOCUS_13470 7466 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 8188 8850 gene locus_tag LOCUS_13480 8188 8850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 9538 8942 gene locus_tag LOCUS_13490 9538 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 11185 9794 gene locus_tag LOCUS_13500 11185 9794 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028961.1 protein_id gnl|my_center|LOCUS_13500 11321 12682 gene locus_tag LOCUS_13510 11321 12682 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_13510 12919 13500 gene locus_tag LOCUS_13520 12919 13500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 14383 13589 gene locus_tag LOCUS_13530 14383 13589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 14577 15983 gene locus_tag LOCUS_13540 14577 15983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 16065 17030 gene locus_tag LOCUS_13550 16065 17030 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889308.1 protein_id gnl|my_center|LOCUS_13550 17067 17981 gene locus_tag LOCUS_13560 17067 17981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 18054 18641 gene locus_tag LOCUS_13570 18054 18641 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229426.1 protein_id gnl|my_center|LOCUS_13570 18638 19453 gene locus_tag LOCUS_13580 18638 19453 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805182.1 protein_id gnl|my_center|LOCUS_13580 19524 20819 gene locus_tag LOCUS_13590 19524 20819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 20955 21194 gene locus_tag LOCUS_13600 20955 21194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 21542 21249 gene locus_tag LOCUS_13610 21542 21249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 21745 22812 gene locus_tag LOCUS_13620 21745 22812 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039386.1 protein_id gnl|my_center|LOCUS_13620 23113 24270 gene locus_tag LOCUS_13630 23113 24270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 24414 24665 gene locus_tag LOCUS_13640 24414 24665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 24791 25087 gene locus_tag LOCUS_13650 24791 25087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 25089 26000 gene locus_tag LOCUS_13660 25089 26000 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062236.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence039 3020 585 gene locus_tag LOCUS_13670 3020 585 CDS product GH116 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929020.1 protein_id gnl|my_center|LOCUS_13670 4118 3027 gene locus_tag LOCUS_13680 4118 3027 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256964.1 protein_id gnl|my_center|LOCUS_13680 5080 4115 gene locus_tag LOCUS_13690 5080 4115 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256965.1 protein_id gnl|my_center|LOCUS_13690 6600 5176 gene locus_tag LOCUS_13700 6600 5176 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256966.1 protein_id gnl|my_center|LOCUS_13700 6551 6892 gene locus_tag LOCUS_13710 6551 6892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 7746 6823 gene locus_tag LOCUS_13720 7746 6823 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031126.1 protein_id gnl|my_center|LOCUS_13720 9401 8349 gene locus_tag LOCUS_13730 9401 8349 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976006.1 protein_id gnl|my_center|LOCUS_13730 10955 9717 gene locus_tag LOCUS_13740 10955 9717 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 protein_id gnl|my_center|LOCUS_13740 11419 12234 gene locus_tag LOCUS_13750 11419 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 12819 12583 gene locus_tag LOCUS_13760 12819 12583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 14209 13124 gene locus_tag LOCUS_13770 14209 13124 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_13770 14494 15456 gene locus_tag LOCUS_13780 14494 15456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 15453 15929 gene locus_tag LOCUS_13790 15453 15929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 15932 16942 gene locus_tag LOCUS_13800 15932 16942 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 protein_id gnl|my_center|LOCUS_13800 17031 18053 gene locus_tag LOCUS_13810 17031 18053 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_13810 18246 19232 gene locus_tag LOCUS_13820 18246 19232 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_13820 19244 19663 gene locus_tag LOCUS_13830 19244 19663 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328798.1 protein_id gnl|my_center|LOCUS_13830 19693 20670 gene locus_tag LOCUS_13840 19693 20670 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337354.1 protein_id gnl|my_center|LOCUS_13840 20689 22515 gene locus_tag LOCUS_13850 20689 22515 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614258.1 protein_id gnl|my_center|LOCUS_13850 22851 22660 gene locus_tag LOCUS_13860 22851 22660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 23344 23063 gene locus_tag LOCUS_13870 23344 23063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 24059 24397 gene locus_tag LOCUS_13880 24059 24397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 24755 24429 gene locus_tag LOCUS_13890 24755 24429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 >Feature sequence040 736 245 gene locus_tag LOCUS_13900 736 245 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355150.1 protein_id gnl|my_center|LOCUS_13900 1499 765 gene locus_tag LOCUS_13910 1499 765 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140975.1 protein_id gnl|my_center|LOCUS_13910 3925 1496 gene locus_tag LOCUS_13920 3925 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 5035 3926 gene locus_tag LOCUS_13930 gene ltaE 5035 3926 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258446.1 protein_id gnl|my_center|LOCUS_13930 5166 5242 gene locus_tag LOCUS_t00160 5166 5242 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5397 6755 gene locus_tag LOCUS_13940 5397 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 6718 7053 gene locus_tag LOCUS_13950 6718 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 8293 7391 gene locus_tag LOCUS_13960 8293 7391 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230419.1 protein_id gnl|my_center|LOCUS_13960 9204 8290 gene locus_tag LOCUS_13970 9204 8290 CDS product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526233.1 protein_id gnl|my_center|LOCUS_13970 9656 9201 gene locus_tag LOCUS_13980 9656 9201 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385810.1 protein_id gnl|my_center|LOCUS_13980 9805 10320 gene locus_tag LOCUS_13990 9805 10320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 10361 11269 gene locus_tag LOCUS_14000 10361 11269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 11302 12138 gene locus_tag LOCUS_14010 11302 12138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 12936 12169 gene locus_tag LOCUS_14020 12936 12169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 13992 12985 gene locus_tag LOCUS_14030 13992 12985 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_14030 14726 13989 gene locus_tag LOCUS_14040 14726 13989 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_14040 14938 16155 gene locus_tag LOCUS_14050 14938 16155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 17043 16183 gene locus_tag LOCUS_14060 17043 16183 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888943.1 protein_id gnl|my_center|LOCUS_14060 18029 17040 gene locus_tag LOCUS_14070 18029 17040 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888944.1 protein_id gnl|my_center|LOCUS_14070 19265 18036 gene locus_tag LOCUS_14080 19265 18036 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479723.1 protein_id gnl|my_center|LOCUS_14080 20047 19334 gene locus_tag LOCUS_14090 20047 19334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 20278 21684 gene locus_tag LOCUS_14100 20278 21684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 22022 22573 gene locus_tag LOCUS_14110 22022 22573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 22563 24581 gene locus_tag LOCUS_14120 22563 24581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 25248 24610 gene locus_tag LOCUS_14130 25248 24610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 25419 25661 gene locus_tag LOCUS_14140 25419 25661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence041 252 2810 gene locus_tag LOCUS_14150 252 2810 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942320.1 protein_id gnl|my_center|LOCUS_14150 2929 3837 gene locus_tag LOCUS_14160 2929 3837 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932202.1 protein_id gnl|my_center|LOCUS_14160 3834 4436 gene locus_tag LOCUS_14170 3834 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 4609 5268 gene locus_tag LOCUS_14180 4609 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 5265 5945 gene locus_tag LOCUS_14190 5265 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 7076 5976 gene locus_tag LOCUS_14200 7076 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 8327 7383 gene locus_tag LOCUS_14210 8327 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 8986 8324 gene locus_tag LOCUS_14220 8986 8324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 9140 8979 gene locus_tag LOCUS_14230 9140 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 9971 9573 gene locus_tag LOCUS_14240 9971 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 9889 11154 gene locus_tag LOCUS_14250 9889 11154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 11151 14942 gene locus_tag LOCUS_14260 11151 14942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 15801 14917 gene locus_tag LOCUS_14270 15801 14917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 16806 15886 gene locus_tag LOCUS_14280 16806 15886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 17767 16928 gene locus_tag LOCUS_14290 17767 16928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 18017 19342 gene locus_tag LOCUS_14300 18017 19342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 20803 19352 gene locus_tag LOCUS_14310 20803 19352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 22248 20800 gene locus_tag LOCUS_14320 22248 20800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 23435 22443 gene locus_tag LOCUS_14330 gene axeA 23435 22443 CDS product cephalosporin-C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082599.1 protein_id gnl|my_center|LOCUS_14330 25301 23715 gene locus_tag LOCUS_14340 25301 23715 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980180.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence042 2495 1347 gene locus_tag LOCUS_14350 gene argC 2495 1347 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459299.1 protein_id gnl|my_center|LOCUS_14350 3254 2571 gene locus_tag LOCUS_14360 3254 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 3533 5083 gene locus_tag LOCUS_14370 3533 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 5584 5093 gene locus_tag LOCUS_14380 5584 5093 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868143.1 protein_id gnl|my_center|LOCUS_14380 7702 5630 gene locus_tag LOCUS_14390 7702 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 7882 8145 gene locus_tag LOCUS_14400 7882 8145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 9283 8174 gene locus_tag LOCUS_14410 gene trxB 9283 8174 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_14410 10292 9399 gene locus_tag LOCUS_14420 10292 9399 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222502.1 protein_id gnl|my_center|LOCUS_14420 10645 11790 gene locus_tag LOCUS_14430 10645 11790 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680821.1 protein_id gnl|my_center|LOCUS_14430 12761 11823 gene locus_tag LOCUS_14440 12761 11823 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028728.1 protein_id gnl|my_center|LOCUS_14440 13573 12758 gene locus_tag LOCUS_14450 gene cofE 13573 12758 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_14450 14217 13570 gene locus_tag LOCUS_14460 gene cofC 14217 13570 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893758.1 protein_id gnl|my_center|LOCUS_14460 15251 14214 gene locus_tag LOCUS_14470 gene cofD 15251 14214 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_14470 16407 15418 gene locus_tag LOCUS_14480 16407 15418 CDS product TIGR03557 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258687.1 protein_id gnl|my_center|LOCUS_14480 16880 16449 gene locus_tag LOCUS_14490 16880 16449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 18149 16983 gene locus_tag LOCUS_14500 18149 16983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 18681 19430 gene locus_tag LOCUS_14510 18681 19430 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173486.1 protein_id gnl|my_center|LOCUS_14510 19427 20275 gene locus_tag LOCUS_14520 19427 20275 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258574.1 protein_id gnl|my_center|LOCUS_14520 21210 20329 gene locus_tag LOCUS_14530 21210 20329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 21901 21242 gene locus_tag LOCUS_14540 gene pncA 21901 21242 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942927.1 protein_id gnl|my_center|LOCUS_14540 22685 22275 gene locus_tag LOCUS_14550 22685 22275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14550 22572 22799 gene locus_tag LOCUS_14560 22572 22799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 23098 22796 gene locus_tag LOCUS_14570 23098 22796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14570 >Feature sequence043 352 1719 gene locus_tag LOCUS_14580 352 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1772 2740 gene locus_tag LOCUS_14590 1772 2740 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967849.1 protein_id gnl|my_center|LOCUS_14590 3516 2917 gene locus_tag LOCUS_14600 3516 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 4333 3509 gene locus_tag LOCUS_14610 4333 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 4516 5628 gene locus_tag LOCUS_14620 4516 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 5890 7854 gene locus_tag LOCUS_14630 5890 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 8077 9612 gene locus_tag LOCUS_14640 8077 9612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 9577 9502 gene locus_tag LOCUS_t00170 9577 9502 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9829 11859 gene locus_tag LOCUS_14650 9829 11859 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729974.1 protein_id gnl|my_center|LOCUS_14650 12113 14257 gene locus_tag LOCUS_14660 12113 14257 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_14660 15573 14362 gene locus_tag LOCUS_14670 15573 14362 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_14670 17178 15712 gene locus_tag LOCUS_14680 17178 15712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 17437 18702 gene locus_tag LOCUS_14690 gene galK 17437 18702 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707767.1 protein_id gnl|my_center|LOCUS_14690 19780 18683 gene locus_tag LOCUS_14700 19780 18683 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036408.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14700 21784 20498 gene locus_tag LOCUS_14710 21784 20498 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_14710 22593 21880 gene locus_tag LOCUS_14720 22593 21880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 22504 23112 gene locus_tag LOCUS_14730 22504 23112 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_14730 23575 23156 gene locus_tag LOCUS_14740 23575 23156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 24325 23708 gene locus_tag LOCUS_14750 24325 23708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 24351 24277 gene locus_tag LOCUS_t00180 24351 24277 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 <25506 24445 gene locus_tag LOCUS_14760 <25506 24445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000120539.1:kelch repeat-containing protein >Feature sequence044 4423 4181 gene locus_tag LOCUS_14770 4423 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 5312 5100 gene locus_tag LOCUS_14780 5312 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 5677 7014 gene locus_tag LOCUS_14790 5677 7014 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_14790 7044 7541 gene locus_tag LOCUS_14800 7044 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 7538 9004 gene locus_tag LOCUS_14810 gene terL 7538 9004 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697216.1 protein_id gnl|my_center|LOCUS_14810 9322 9017 gene locus_tag LOCUS_14820 9322 9017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 9485 10600 gene locus_tag LOCUS_14830 9485 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 10943 10713 gene locus_tag LOCUS_14840 10943 10713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 11280 10990 gene locus_tag LOCUS_14850 11280 10990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 11922 11614 gene locus_tag LOCUS_14860 11922 11614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 12999 12202 gene locus_tag LOCUS_14870 12999 12202 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259477.1 protein_id gnl|my_center|LOCUS_14870 13136 14035 gene locus_tag LOCUS_14880 13136 14035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 14057 15112 gene locus_tag LOCUS_14890 14057 15112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 16259 15279 gene locus_tag LOCUS_14900 16259 15279 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876826.1 protein_id gnl|my_center|LOCUS_14900 17434 16613 gene locus_tag LOCUS_14910 17434 16613 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921895.1 protein_id gnl|my_center|LOCUS_14910 18602 17622 gene locus_tag LOCUS_14920 18602 17622 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_14920 19564 18605 gene locus_tag LOCUS_14930 19564 18605 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_14930 20414 19551 gene locus_tag LOCUS_14940 20414 19551 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083858.1 protein_id gnl|my_center|LOCUS_14940 21432 20416 gene locus_tag LOCUS_14950 21432 20416 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083857.1 protein_id gnl|my_center|LOCUS_14950 22546 21581 gene locus_tag LOCUS_14960 22546 21581 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_14960 23384 22548 gene locus_tag LOCUS_14970 23384 22548 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729452.1 protein_id gnl|my_center|LOCUS_14970 24178 23381 gene locus_tag LOCUS_14980 24178 23381 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814132.1 protein_id gnl|my_center|LOCUS_14980 <25115 24318 gene locus_tag LOCUS_14990 <25115 24318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069456935.1:ABC transporter substrate-binding protein >Feature sequence045 334 152 gene locus_tag LOCUS_15000 334 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 492 770 gene locus_tag LOCUS_15010 492 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1260 907 gene locus_tag LOCUS_15020 1260 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 2899 1490 gene locus_tag LOCUS_15030 2899 1490 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167413.1 protein_id gnl|my_center|LOCUS_15030 4220 3195 gene locus_tag LOCUS_15040 4220 3195 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 protein_id gnl|my_center|LOCUS_15040 6047 4707 gene locus_tag LOCUS_15050 6047 4707 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113286.1 protein_id gnl|my_center|LOCUS_15050 6950 6306 gene locus_tag LOCUS_15060 gene dhaL 6950 6306 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015008607.1 protein_id gnl|my_center|LOCUS_15060 7993 6947 gene locus_tag LOCUS_15070 7993 6947 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533065.1 protein_id gnl|my_center|LOCUS_15070 7992 8168 gene locus_tag LOCUS_15080 7992 8168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 9889 8201 gene locus_tag LOCUS_15090 9889 8201 CDS product acetolactate synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064664.1 protein_id gnl|my_center|LOCUS_15090 11157 10108 gene locus_tag LOCUS_15100 11157 10108 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028064.1 protein_id gnl|my_center|LOCUS_15100 11664 11413 gene locus_tag LOCUS_15110 11664 11413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 13886 11661 gene locus_tag LOCUS_15120 13886 11661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 14618 14004 gene locus_tag LOCUS_15130 gene leuD 14618 14004 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256079.1 protein_id gnl|my_center|LOCUS_15130 16036 14615 gene locus_tag LOCUS_15140 gene leuC 16036 14615 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256078.1 protein_id gnl|my_center|LOCUS_15140 16772 16110 gene locus_tag LOCUS_15150 16772 16110 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243784.1 protein_id gnl|my_center|LOCUS_15150 17820 16960 gene locus_tag LOCUS_15160 17820 16960 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970045.1 protein_id gnl|my_center|LOCUS_15160 18704 17817 gene locus_tag LOCUS_15170 18704 17817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 20373 19354 gene locus_tag LOCUS_15180 20373 19354 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729196.1 protein_id gnl|my_center|LOCUS_15180 21418 20402 gene locus_tag LOCUS_15190 21418 20402 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892758.1 protein_id gnl|my_center|LOCUS_15190 21878 22684 gene locus_tag LOCUS_15200 21878 22684 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275390.1 protein_id gnl|my_center|LOCUS_15200 23944 23048 gene locus_tag LOCUS_15210 23944 23048 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182306545.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence046 <1 1311 gene locus_tag LOCUS_15220 <1 1311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_040121148.1:cytochrome c biogenesis protein DipZ 1546 1313 gene locus_tag LOCUS_15230 1546 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1598 1993 gene locus_tag LOCUS_15240 1598 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 2000 2875 gene locus_tag LOCUS_15250 gene galU 2000 2875 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583975.1 protein_id gnl|my_center|LOCUS_15250 2957 4756 gene locus_tag LOCUS_15260 2957 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 5198 4758 gene locus_tag LOCUS_15270 5198 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 6420 5320 gene locus_tag LOCUS_15280 6420 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 6687 7190 gene locus_tag LOCUS_15290 6687 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 7187 8557 gene locus_tag LOCUS_15300 7187 8557 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423784.1 protein_id gnl|my_center|LOCUS_15300 8554 9456 gene locus_tag LOCUS_15310 gene folP 8554 9456 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966209.1 protein_id gnl|my_center|LOCUS_15310 9453 9848 gene locus_tag LOCUS_15320 gene folB 9453 9848 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391948.1 protein_id gnl|my_center|LOCUS_15320 11158 9845 gene locus_tag LOCUS_15330 11158 9845 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258067.1 protein_id gnl|my_center|LOCUS_15330 13237 11405 gene locus_tag LOCUS_15340 13237 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 14042 13389 gene locus_tag LOCUS_15350 14042 13389 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272485.1 protein_id gnl|my_center|LOCUS_15350 14158 14799 gene locus_tag LOCUS_15360 14158 14799 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092871.1 protein_id gnl|my_center|LOCUS_15360 14924 16195 gene locus_tag LOCUS_15370 14924 16195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 17343 16192 gene locus_tag LOCUS_15380 17343 16192 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266746.1 protein_id gnl|my_center|LOCUS_15380 18125 17340 gene locus_tag LOCUS_15390 18125 17340 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771267.1 protein_id gnl|my_center|LOCUS_15390 19015 18122 gene locus_tag LOCUS_15400 19015 18122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 19759 19070 gene locus_tag LOCUS_15410 19759 19070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228097.1 protein_id gnl|my_center|LOCUS_15410 20393 19923 gene locus_tag LOCUS_15420 20393 19923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 21205 20390 gene locus_tag LOCUS_15430 21205 20390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 22475 21270 gene locus_tag LOCUS_15440 22475 21270 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728185.1 protein_id gnl|my_center|LOCUS_15440 23814 22594 gene locus_tag LOCUS_15450 gene hydA 23814 22594 CDS product NADPH-dependent hydrogenase/sulfhydrogenase 1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251019.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence047 863 1705 gene locus_tag LOCUS_15460 863 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15460 3026 2403 gene locus_tag LOCUS_15470 3026 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 2944 3699 gene locus_tag LOCUS_15480 2944 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3823 7242 gene locus_tag LOCUS_15490 3823 7242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 8260 7361 gene locus_tag LOCUS_15500 8260 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 8259 8969 gene locus_tag LOCUS_15510 8259 8969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 9080 10933 gene locus_tag LOCUS_15520 9080 10933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 10982 12145 gene locus_tag LOCUS_15530 10982 12145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 13784 12207 gene locus_tag LOCUS_15540 13784 12207 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_15540 15528 13822 gene locus_tag LOCUS_15550 15528 13822 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681003.1 protein_id gnl|my_center|LOCUS_15550 15681 17285 gene locus_tag LOCUS_15560 15681 17285 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_15560 18627 17323 gene locus_tag LOCUS_15570 18627 17323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 18553 18747 gene locus_tag LOCUS_15580 18553 18747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 19554 18832 gene locus_tag LOCUS_15590 19554 18832 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804151.1 protein_id gnl|my_center|LOCUS_15590 20453 19551 gene locus_tag LOCUS_15600 gene nagA 20453 19551 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722368.1 protein_id gnl|my_center|LOCUS_15600 20499 20708 gene locus_tag LOCUS_15610 20499 20708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 21745 20894 gene locus_tag LOCUS_15620 21745 20894 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225176.1 protein_id gnl|my_center|LOCUS_15620 22605 21742 gene locus_tag LOCUS_15630 22605 21742 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226208.1 protein_id gnl|my_center|LOCUS_15630 <23914 22790 gene locus_tag LOCUS_15640 <23914 22790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226207.1:sugar ABC transporter substrate-binding protein >Feature sequence048 <1 1026 gene locus_tag LOCUS_15650 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020431.1:ABC transporter permease 1097 1834 gene locus_tag LOCUS_15660 1097 1834 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944199.1 protein_id gnl|my_center|LOCUS_15660 2121 3077 gene locus_tag LOCUS_15670 gene ilvE 2121 3077 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065968.1 protein_id gnl|my_center|LOCUS_15670 3367 4008 gene locus_tag LOCUS_15680 3367 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 4069 4407 gene locus_tag LOCUS_15690 4069 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 4464 4835 gene locus_tag LOCUS_15700 4464 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 4861 5505 gene locus_tag LOCUS_15710 4861 5505 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_15710 5589 6326 gene locus_tag LOCUS_15720 5589 6326 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939740.1 protein_id gnl|my_center|LOCUS_15720 6627 6394 gene locus_tag LOCUS_15730 6627 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 6587 7714 gene locus_tag LOCUS_15740 6587 7714 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205624253.1 protein_id gnl|my_center|LOCUS_15740 10135 8300 gene locus_tag LOCUS_15750 10135 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 11401 10322 gene locus_tag LOCUS_15760 11401 10322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 12941 11418 gene locus_tag LOCUS_15770 12941 11418 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224190.1 protein_id gnl|my_center|LOCUS_15770 13165 12938 gene locus_tag LOCUS_15780 13165 12938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 14243 13380 gene locus_tag LOCUS_15790 14243 13380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 14637 14275 gene locus_tag LOCUS_15800 14637 14275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 14684 15142 gene locus_tag LOCUS_15810 14684 15142 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_15810 15182 16054 gene locus_tag LOCUS_15820 gene sufC 15182 16054 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259318.1 protein_id gnl|my_center|LOCUS_15820 16067 17380 gene locus_tag LOCUS_15830 16067 17380 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_15830 17398 17799 gene locus_tag LOCUS_15840 17398 17799 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_15840 18035 18871 gene locus_tag LOCUS_15850 18035 18871 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228583.1 protein_id gnl|my_center|LOCUS_15850 19387 18884 gene locus_tag LOCUS_15860 19387 18884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15860 20085 19321 gene locus_tag LOCUS_15870 20085 19321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15870 20245 21315 gene locus_tag LOCUS_15880 20245 21315 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028618.1 protein_id gnl|my_center|LOCUS_15880 21497 22531 gene locus_tag LOCUS_15890 gene tdh 21497 22531 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868502.1 protein_id gnl|my_center|LOCUS_15890 23143 23161 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence049 1943 1350 gene locus_tag LOCUS_15900 1943 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 3425 2055 gene locus_tag LOCUS_15910 3425 2055 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256439.1 protein_id gnl|my_center|LOCUS_15910 4935 3478 gene locus_tag LOCUS_15920 gene proS 4935 3478 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227720.1 protein_id gnl|my_center|LOCUS_15920 5096 5215 gene locus_tag LOCUS_15930 5096 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 6554 5292 gene locus_tag LOCUS_15940 gene ispG 6554 5292 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887031.1 protein_id gnl|my_center|LOCUS_15940 7666 6557 gene locus_tag LOCUS_15950 gene rseP 7666 6557 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810655.1 protein_id gnl|my_center|LOCUS_15950 8925 7663 gene locus_tag LOCUS_15960 8925 7663 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392555.1 protein_id gnl|my_center|LOCUS_15960 9754 8927 gene locus_tag LOCUS_15970 9754 8927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 10455 9763 gene locus_tag LOCUS_15980 10455 9763 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_15980 11138 10581 gene locus_tag LOCUS_15990 gene frr 11138 10581 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583561.1 protein_id gnl|my_center|LOCUS_15990 11932 11135 gene locus_tag LOCUS_16000 gene pyrH 11932 11135 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056115.1 protein_id gnl|my_center|LOCUS_16000 12526 11933 gene locus_tag LOCUS_16010 gene tsf 12526 11933 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583563.1 protein_id gnl|my_center|LOCUS_16010 13507 12608 gene locus_tag LOCUS_16020 gene rpsB 13507 12608 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111483.1 protein_id gnl|my_center|LOCUS_16020 13661 13909 gene locus_tag LOCUS_16030 13661 13909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 14308 13913 gene locus_tag LOCUS_16040 14308 13913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 15159 14326 gene locus_tag LOCUS_16050 15159 14326 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944761.1 protein_id gnl|my_center|LOCUS_16050 15524 15174 gene locus_tag LOCUS_16060 gene rplS 15524 15174 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_16060 17094 15679 gene locus_tag LOCUS_16070 17094 15679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 17645 17091 gene locus_tag LOCUS_16080 17645 17091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 18546 17722 gene locus_tag LOCUS_16090 gene trmD 18546 17722 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_16090 18788 18543 gene locus_tag LOCUS_16100 18788 18543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 18822 18830 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19283 19050 gene locus_tag LOCUS_16110 19283 19050 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670215.1 protein_id gnl|my_center|LOCUS_16110 19614 19336 gene locus_tag LOCUS_16120 gene rpsP 19614 19336 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887937.1 protein_id gnl|my_center|LOCUS_16120 21410 19662 gene locus_tag LOCUS_16130 21410 19662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 <22624 21422 gene locus_tag LOCUS_16140 <22624 21422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813193.1:signal recognition particle protein >Feature sequence050 1131 142 gene locus_tag LOCUS_16150 1131 142 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898171.1 protein_id gnl|my_center|LOCUS_16150 1590 2783 gene locus_tag LOCUS_16160 1590 2783 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723135.1 protein_id gnl|my_center|LOCUS_16160 2777 3592 gene locus_tag LOCUS_16170 2777 3592 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897420.1 protein_id gnl|my_center|LOCUS_16170 3592 4392 gene locus_tag LOCUS_16180 3592 4392 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530724.1 protein_id gnl|my_center|LOCUS_16180 4538 5704 gene locus_tag LOCUS_16190 4538 5704 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369724.1 protein_id gnl|my_center|LOCUS_16190 5745 6503 gene locus_tag LOCUS_16200 5745 6503 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392770.1 protein_id gnl|my_center|LOCUS_16200 6630 7736 gene locus_tag LOCUS_16210 6630 7736 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_16210 7873 8241 gene locus_tag LOCUS_16220 7873 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 8285 9169 gene locus_tag LOCUS_16230 8285 9169 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_16230 9166 10134 gene locus_tag LOCUS_16240 9166 10134 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_16240 11395 10463 gene locus_tag LOCUS_16250 11395 10463 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085684.1 protein_id gnl|my_center|LOCUS_16250 12034 11708 gene locus_tag LOCUS_16260 12034 11708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 13357 12167 gene locus_tag LOCUS_16270 13357 12167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 13428 13820 gene locus_tag LOCUS_16280 13428 13820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 15486 14671 gene locus_tag LOCUS_16290 15486 14671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013597.1 protein_id gnl|my_center|LOCUS_16290 16447 15500 gene locus_tag LOCUS_16300 16447 15500 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979037.1 protein_id gnl|my_center|LOCUS_16300 17259 16444 gene locus_tag LOCUS_16310 17259 16444 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230073.1 protein_id gnl|my_center|LOCUS_16310 18952 17369 gene locus_tag LOCUS_16320 18952 17369 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979926.1 protein_id gnl|my_center|LOCUS_16320 20435 19122 gene locus_tag LOCUS_16330 20435 19122 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229620.1 protein_id gnl|my_center|LOCUS_16330 21217 20429 gene locus_tag LOCUS_16340 21217 20429 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978037.1 protein_id gnl|my_center|LOCUS_16340 21469 21305 gene locus_tag LOCUS_16350 21469 21305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 21824 22066 gene locus_tag LOCUS_16360 21824 22066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 22351 22434 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence051 904 143 gene locus_tag LOCUS_16370 904 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1630 914 gene locus_tag LOCUS_16380 gene phoP 1630 914 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229442.1 protein_id gnl|my_center|LOCUS_16380 1811 2272 gene locus_tag LOCUS_16390 1811 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 2753 2301 gene locus_tag LOCUS_16400 2753 2301 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_16400 4062 2938 gene locus_tag LOCUS_16410 gene rsgA 4062 2938 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143435.1 protein_id gnl|my_center|LOCUS_16410 4863 4063 gene locus_tag LOCUS_16420 4863 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 6133 5234 gene locus_tag LOCUS_16430 6133 5234 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918723.1 protein_id gnl|my_center|LOCUS_16430 7624 6506 gene locus_tag LOCUS_16440 7624 6506 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_16440 8156 9127 gene locus_tag LOCUS_16450 8156 9127 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530992.1 protein_id gnl|my_center|LOCUS_16450 9128 10075 gene locus_tag LOCUS_16460 9128 10075 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530993.1 protein_id gnl|my_center|LOCUS_16460 10072 11073 gene locus_tag LOCUS_16470 10072 11073 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729614.1 protein_id gnl|my_center|LOCUS_16470 11143 11307 gene locus_tag LOCUS_16480 11143 11307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 11409 12917 gene locus_tag LOCUS_16490 gene araA 11409 12917 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226247.1 protein_id gnl|my_center|LOCUS_16490 12973 13686 gene locus_tag LOCUS_16500 12973 13686 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837546.1 protein_id gnl|my_center|LOCUS_16500 13738 15423 gene locus_tag LOCUS_16510 gene araB 13738 15423 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 protein_id gnl|my_center|LOCUS_16510 15643 15801 gene locus_tag LOCUS_16520 15643 15801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 16028 17425 gene locus_tag LOCUS_16530 16028 17425 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546190.1 protein_id gnl|my_center|LOCUS_16530 17845 18024 gene locus_tag LOCUS_16540 17845 18024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 18025 18822 gene locus_tag LOCUS_16550 gene hisN 18025 18822 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917127.1 protein_id gnl|my_center|LOCUS_16550 19029 19298 gene locus_tag LOCUS_16560 19029 19298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 19379 20632 gene locus_tag LOCUS_16570 19379 20632 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224419.1 protein_id gnl|my_center|LOCUS_16570 20636 21139 gene locus_tag LOCUS_16580 20636 21139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 21196 21633 gene locus_tag LOCUS_16590 21196 21633 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028745.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence052 1383 2435 gene locus_tag LOCUS_16600 1383 2435 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350706.1 protein_id gnl|my_center|LOCUS_16600 2438 3241 gene locus_tag LOCUS_16610 2438 3241 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804600.1 protein_id gnl|my_center|LOCUS_16610 3231 4061 gene locus_tag LOCUS_16620 3231 4061 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760733.1 protein_id gnl|my_center|LOCUS_16620 4905 4135 gene locus_tag LOCUS_16630 4905 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 4850 4996 gene locus_tag LOCUS_16640 4850 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 5173 5248 gene locus_tag LOCUS_t00190 5173 5248 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5525 5361 gene locus_tag LOCUS_16650 5525 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 5629 6876 gene locus_tag LOCUS_16660 5629 6876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 7425 8468 gene locus_tag LOCUS_16670 7425 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 9126 8518 gene locus_tag LOCUS_16680 9126 8518 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230184.1 protein_id gnl|my_center|LOCUS_16680 12362 9123 gene locus_tag LOCUS_16690 12362 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16690 12739 13668 gene locus_tag LOCUS_16700 12739 13668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 13907 14320 gene locus_tag LOCUS_16710 13907 14320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 14390 14674 gene locus_tag LOCUS_16720 14390 14674 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919553.1 protein_id gnl|my_center|LOCUS_16720 14797 15357 gene locus_tag LOCUS_16730 14797 15357 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228850.1 protein_id gnl|my_center|LOCUS_16730 15397 16164 gene locus_tag LOCUS_16740 15397 16164 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972454.1 protein_id gnl|my_center|LOCUS_16740 16161 18296 gene locus_tag LOCUS_16750 16161 18296 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223224.1 protein_id gnl|my_center|LOCUS_16750 18679 18527 gene locus_tag LOCUS_16760 18679 18527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 19642 18878 gene locus_tag LOCUS_16770 19642 18878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 20639 19842 gene locus_tag LOCUS_16780 20639 19842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence053 770 1525 gene locus_tag LOCUS_16790 770 1525 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_16790 2090 1773 gene locus_tag LOCUS_16800 2090 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 2032 3051 gene locus_tag LOCUS_16810 2032 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 3147 4712 gene locus_tag LOCUS_16820 3147 4712 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210000.1 protein_id gnl|my_center|LOCUS_16820 4709 5695 gene locus_tag LOCUS_16830 4709 5695 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152827741.1 protein_id gnl|my_center|LOCUS_16830 5714 6175 gene locus_tag LOCUS_16840 5714 6175 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329360.1 protein_id gnl|my_center|LOCUS_16840 6225 7193 gene locus_tag LOCUS_16850 gene doeB 6225 7193 CDS product N(2)-acetyl-L-2,4-diaminobutanoate deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014530717.1 protein_id gnl|my_center|LOCUS_16850 7172 8413 gene locus_tag LOCUS_16860 7172 8413 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583399.1 protein_id gnl|my_center|LOCUS_16860 8485 9804 gene locus_tag LOCUS_16870 gene hemL 8485 9804 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020630.1 protein_id gnl|my_center|LOCUS_16870 9916 10881 gene locus_tag LOCUS_16880 9916 10881 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_16880 10970 11344 gene locus_tag LOCUS_16890 10970 11344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 12211 11525 gene locus_tag LOCUS_16900 12211 11525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 12092 12304 gene locus_tag LOCUS_16910 12092 12304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 12541 13575 gene locus_tag LOCUS_16920 12541 13575 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942346.1 protein_id gnl|my_center|LOCUS_16920 13590 14747 gene locus_tag LOCUS_16930 13590 14747 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223730.1 protein_id gnl|my_center|LOCUS_16930 14887 15855 gene locus_tag LOCUS_16940 14887 15855 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532177.1 protein_id gnl|my_center|LOCUS_16940 15866 16645 gene locus_tag LOCUS_16950 15866 16645 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339543.1 protein_id gnl|my_center|LOCUS_16950 16706 17833 gene locus_tag LOCUS_16960 16706 17833 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195337.1 protein_id gnl|my_center|LOCUS_16960 17841 18533 gene locus_tag LOCUS_16970 gene rpe 17841 18533 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106173.1 protein_id gnl|my_center|LOCUS_16970 18533 19720 gene locus_tag LOCUS_16980 18533 19720 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_16980 19925 20674 gene locus_tag LOCUS_16990 19925 20674 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_16990 21038 20766 gene locus_tag LOCUS_17000 21038 20766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 >Feature sequence054 351 1169 gene locus_tag LOCUS_17010 351 1169 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726796.1 protein_id gnl|my_center|LOCUS_17010 1166 1849 gene locus_tag LOCUS_17020 1166 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 1846 2853 gene locus_tag LOCUS_17030 1846 2853 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866323.1 protein_id gnl|my_center|LOCUS_17030 4028 2925 gene locus_tag LOCUS_17040 4028 2925 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306915.1 protein_id gnl|my_center|LOCUS_17040 5008 4025 gene locus_tag LOCUS_17050 5008 4025 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230097.1 protein_id gnl|my_center|LOCUS_17050 5909 4989 gene locus_tag LOCUS_17060 5909 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 6891 5920 gene locus_tag LOCUS_17070 6891 5920 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776034.1 protein_id gnl|my_center|LOCUS_17070 8697 6928 gene locus_tag LOCUS_17080 8697 6928 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383105.1 protein_id gnl|my_center|LOCUS_17080 8955 10193 gene locus_tag LOCUS_17090 8955 10193 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225276.1 protein_id gnl|my_center|LOCUS_17090 10335 10757 gene locus_tag LOCUS_17100 10335 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 11773 10862 gene locus_tag LOCUS_17110 11773 10862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 11865 12761 gene locus_tag LOCUS_17120 11865 12761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 12761 13756 gene locus_tag LOCUS_17130 gene galT 12761 13756 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393433.1 protein_id gnl|my_center|LOCUS_17130 13911 14531 gene locus_tag LOCUS_17140 gene ylaC 13911 14531 CDS product RNA polymerase sigma factor YlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245485.1 protein_id gnl|my_center|LOCUS_17140 14528 16540 gene locus_tag LOCUS_17150 14528 16540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 16789 17358 gene locus_tag LOCUS_17160 gene pyrR 16789 17358 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460661.1 protein_id gnl|my_center|LOCUS_17160 17355 18407 gene locus_tag LOCUS_17170 17355 18407 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257760.1 protein_id gnl|my_center|LOCUS_17170 18404 19912 gene locus_tag LOCUS_17180 18404 19912 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257761.1 protein_id gnl|my_center|LOCUS_17180 20086 20412 gene locus_tag LOCUS_17190 20086 20412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence055 <1 579 gene locus_tag LOCUS_17200 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876759.1:F420-non-reducing hydrogenase subunit MvhG 586 2073 gene locus_tag LOCUS_17210 586 2073 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_17210 2086 2730 gene locus_tag LOCUS_17220 2086 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 2821 3243 gene locus_tag LOCUS_17230 2821 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 3440 4300 gene locus_tag LOCUS_17240 3440 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 5129 4341 gene locus_tag LOCUS_17250 5129 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 5324 6298 gene locus_tag LOCUS_17260 gene fabD 5324 6298 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974943.1 protein_id gnl|my_center|LOCUS_17260 6356 7618 gene locus_tag LOCUS_17270 gene fabF 6356 7618 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244890.1 protein_id gnl|my_center|LOCUS_17270 7752 8204 gene locus_tag LOCUS_17280 7752 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 8314 8853 gene locus_tag LOCUS_17290 8314 8853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 9033 10298 gene locus_tag LOCUS_17300 gene fabF 9033 10298 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_17300 10331 10891 gene locus_tag LOCUS_17310 10331 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 13228 10901 gene locus_tag LOCUS_17320 13228 10901 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391498.1 protein_id gnl|my_center|LOCUS_17320 13313 13876 gene locus_tag LOCUS_17330 13313 13876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 14652 14110 gene locus_tag LOCUS_17340 14652 14110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 15277 14663 gene locus_tag LOCUS_17350 15277 14663 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250077.1 protein_id gnl|my_center|LOCUS_17350 16096 15305 gene locus_tag LOCUS_17360 16096 15305 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867632.1 protein_id gnl|my_center|LOCUS_17360 17228 16122 gene locus_tag LOCUS_17370 17228 16122 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041082676.1 protein_id gnl|my_center|LOCUS_17370 17381 17680 gene locus_tag LOCUS_17380 17381 17680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 18383 17811 gene locus_tag LOCUS_17390 18383 17811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 19110 18385 gene locus_tag LOCUS_17400 gene nadD 19110 18385 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228912.1 protein_id gnl|my_center|LOCUS_17400 20399 19107 gene locus_tag LOCUS_17410 gene obgE 20399 19107 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384537.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence056 442 1620 gene locus_tag LOCUS_17420 442 1620 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_17420 1652 2332 gene locus_tag LOCUS_17430 gene pyrE 1652 2332 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583288.1 protein_id gnl|my_center|LOCUS_17430 3031 2339 gene locus_tag LOCUS_17440 3031 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 3435 3028 gene locus_tag LOCUS_17450 3435 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 5144 3444 gene locus_tag LOCUS_17460 5144 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 5288 6643 gene locus_tag LOCUS_17470 5288 6643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 7067 6795 gene locus_tag LOCUS_17480 7067 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 7219 8043 gene locus_tag LOCUS_17490 7219 8043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 8224 8961 gene locus_tag LOCUS_17500 8224 8961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 9823 8990 gene locus_tag LOCUS_17510 9823 8990 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727225.1 protein_id gnl|my_center|LOCUS_17510 10510 9824 gene locus_tag LOCUS_17520 10510 9824 CDS product DUF5612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870978.1 protein_id gnl|my_center|LOCUS_17520 10791 10510 gene locus_tag LOCUS_17530 10791 10510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 10879 11319 gene locus_tag LOCUS_17540 10879 11319 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480298.1 protein_id gnl|my_center|LOCUS_17540 11523 12470 gene locus_tag LOCUS_17550 11523 12470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 13664 12543 gene locus_tag LOCUS_17560 13664 12543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 13987 14940 gene locus_tag LOCUS_17570 13987 14940 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085687.1 protein_id gnl|my_center|LOCUS_17570 15515 14964 gene locus_tag LOCUS_17580 15515 14964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 15949 15539 gene locus_tag LOCUS_17590 gene sodN 15949 15539 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125519.1 protein_id gnl|my_center|LOCUS_17590 16356 17765 gene locus_tag LOCUS_17600 16356 17765 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225544.1 protein_id gnl|my_center|LOCUS_17600 17784 18197 gene locus_tag LOCUS_17610 17784 18197 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225543.1 protein_id gnl|my_center|LOCUS_17610 18983 18255 gene locus_tag LOCUS_17620 18983 18255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 19354 20295 gene locus_tag LOCUS_17630 19354 20295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 20645 20316 gene locus_tag LOCUS_17640 20645 20316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence057 <1 1206 gene locus_tag LOCUS_17650 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965691.1:potassium-transporting ATPase subunit KdpB 1216 1797 gene locus_tag LOCUS_17660 gene kdpC 1216 1797 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391518.1 protein_id gnl|my_center|LOCUS_17660 1794 2957 gene locus_tag LOCUS_17670 1794 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 2980 3204 gene locus_tag LOCUS_17680 2980 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 4276 3146 gene locus_tag LOCUS_17690 4276 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 5466 4273 gene locus_tag LOCUS_17700 5466 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 5679 5604 gene locus_tag LOCUS_t00200 5679 5604 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 6976 5756 gene locus_tag LOCUS_17710 6976 5756 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058160.1 protein_id gnl|my_center|LOCUS_17710 7055 7897 gene locus_tag LOCUS_17720 7055 7897 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257844.1 protein_id gnl|my_center|LOCUS_17720 8528 7974 gene locus_tag LOCUS_17730 8528 7974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 10396 8585 gene locus_tag LOCUS_17740 10396 8585 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022536.1 protein_id gnl|my_center|LOCUS_17740 10477 11058 gene locus_tag LOCUS_17750 10477 11058 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948772.1 protein_id gnl|my_center|LOCUS_17750 11578 11120 gene locus_tag LOCUS_17760 11578 11120 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942284.1 protein_id gnl|my_center|LOCUS_17760 12592 11744 gene locus_tag LOCUS_17770 12592 11744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 12647 13264 gene locus_tag LOCUS_17780 12647 13264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 13431 14600 gene locus_tag LOCUS_17790 13431 14600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17790 14585 15028 gene locus_tag LOCUS_17800 14585 15028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17800 15116 15409 gene locus_tag LOCUS_17810 15116 15409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 15758 15468 gene locus_tag LOCUS_17820 15758 15468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 15904 17331 gene locus_tag LOCUS_17830 15904 17331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 17328 17984 gene locus_tag LOCUS_17840 17328 17984 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_17840 18324 19832 gene locus_tag LOCUS_17850 18324 19832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 20261 20431 gene locus_tag LOCUS_17860 20261 20431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence058 4598 1278 gene locus_tag LOCUS_17870 4598 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 5622 4735 gene locus_tag LOCUS_17880 5622 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 6586 5615 gene locus_tag LOCUS_17890 6586 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 6892 6689 gene locus_tag LOCUS_17900 6892 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 8313 6964 gene locus_tag LOCUS_17910 gene dnaB 8313 6964 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256839.1 protein_id gnl|my_center|LOCUS_17910 9253 8603 gene locus_tag LOCUS_17920 gene lexA 9253 8603 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640747.1 protein_id gnl|my_center|LOCUS_17920 9451 9969 gene locus_tag LOCUS_17930 9451 9969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 9966 10412 gene locus_tag LOCUS_17940 gene rplI 9966 10412 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_17940 11115 10432 gene locus_tag LOCUS_17950 11115 10432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 11277 11492 gene locus_tag LOCUS_17960 11277 11492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 12308 11568 gene locus_tag LOCUS_17970 12308 11568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 12715 13962 gene locus_tag LOCUS_17980 gene dinB 12715 13962 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_17980 14026 14967 gene locus_tag LOCUS_17990 14026 14967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 16166 14964 gene locus_tag LOCUS_18000 gene ada 16166 14964 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190110.1 protein_id gnl|my_center|LOCUS_18000 16349 17281 gene locus_tag LOCUS_18010 16349 17281 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226734.1 protein_id gnl|my_center|LOCUS_18010 17495 17764 gene locus_tag LOCUS_18020 17495 17764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 18008 17817 gene locus_tag LOCUS_18030 18008 17817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 18035 18715 gene locus_tag LOCUS_18040 18035 18715 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836510.1 protein_id gnl|my_center|LOCUS_18040 18712 19650 gene locus_tag LOCUS_18050 gene folD 18712 19650 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence059 <1 690 gene locus_tag LOCUS_18060 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258493.1:formate--tetrahydrofolate ligase 965 1693 gene locus_tag LOCUS_18070 gene cobC 965 1693 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_18070 1799 2971 gene locus_tag LOCUS_18080 1799 2971 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389347.1 protein_id gnl|my_center|LOCUS_18080 4005 3001 gene locus_tag LOCUS_18090 4005 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 4963 4298 gene locus_tag LOCUS_18100 4963 4298 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_18100 5260 6918 gene locus_tag LOCUS_18110 gene hutH 5260 6918 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_18110 7753 6947 gene locus_tag LOCUS_18120 7753 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 8272 8060 gene locus_tag LOCUS_18130 8272 8060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 8462 8518 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8536 8724 gene locus_tag LOCUS_18140 8536 8724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 8726 8932 gene locus_tag LOCUS_18150 8726 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 8992 9804 gene locus_tag LOCUS_18160 8992 9804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 9806 10417 gene locus_tag LOCUS_18170 9806 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 10613 12181 gene locus_tag LOCUS_18180 10613 12181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 11692 11722 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12243 12680 gene locus_tag LOCUS_18190 12243 12680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 12763 13725 gene locus_tag LOCUS_18200 gene ftcD 12763 13725 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836511.1 protein_id gnl|my_center|LOCUS_18200 13722 15038 gene locus_tag LOCUS_18210 gene hutI 13722 15038 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244327.1 protein_id gnl|my_center|LOCUS_18210 15233 16162 gene locus_tag LOCUS_18220 15233 16162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 16870 16196 gene locus_tag LOCUS_18230 16870 16196 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257009.1 protein_id gnl|my_center|LOCUS_18230 17266 18567 gene locus_tag LOCUS_18240 17266 18567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 18647 19294 gene locus_tag LOCUS_18250 18647 19294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 19689 19363 gene locus_tag LOCUS_18260 19689 19363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence060 970 302 gene locus_tag LOCUS_18270 970 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 2789 1032 gene locus_tag LOCUS_18280 gene ilvD 2789 1032 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228538.1 protein_id gnl|my_center|LOCUS_18280 4561 3008 gene locus_tag LOCUS_18290 4561 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 5289 4660 gene locus_tag LOCUS_18300 gene leuD 5289 4660 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256079.1 protein_id gnl|my_center|LOCUS_18300 6742 5291 gene locus_tag LOCUS_18310 gene leuC 6742 5291 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256078.1 protein_id gnl|my_center|LOCUS_18310 9498 6937 gene locus_tag LOCUS_18320 9498 6937 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256961.1 protein_id gnl|my_center|LOCUS_18320 9709 11307 gene locus_tag LOCUS_18330 9709 11307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 11682 12374 gene locus_tag LOCUS_18340 11682 12374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 12371 13336 gene locus_tag LOCUS_18350 12371 13336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 13339 14253 gene locus_tag LOCUS_18360 13339 14253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 14349 17252 gene locus_tag LOCUS_18370 14349 17252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 17701 17426 gene locus_tag LOCUS_18380 17701 17426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 17773 19731 gene locus_tag LOCUS_18390 gene ilvB 17773 19731 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256073.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence061 2116 770 gene locus_tag LOCUS_18400 2116 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 2843 2187 gene locus_tag LOCUS_18410 2843 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 4288 2840 gene locus_tag LOCUS_18420 4288 2840 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030488.1 protein_id gnl|my_center|LOCUS_18420 5598 4285 gene locus_tag LOCUS_18430 5598 4285 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_18430 5862 6947 gene locus_tag LOCUS_18440 5862 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 7072 7251 gene locus_tag LOCUS_18450 7072 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 7395 7634 gene locus_tag LOCUS_18460 7395 7634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 7662 8984 gene locus_tag LOCUS_18470 7662 8984 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886935.1 protein_id gnl|my_center|LOCUS_18470 10462 9110 gene locus_tag LOCUS_18480 10462 9110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 10992 10459 gene locus_tag LOCUS_18490 10992 10459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 11189 12241 gene locus_tag LOCUS_18500 11189 12241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 12977 12261 gene locus_tag LOCUS_18510 12977 12261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18510 12964 13311 gene locus_tag LOCUS_18520 12964 13311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 15715 13727 gene locus_tag LOCUS_18530 15715 13727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18530 16343 15885 gene locus_tag LOCUS_18540 16343 15885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 16601 16374 gene locus_tag LOCUS_18550 16601 16374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_18550 16851 16591 gene locus_tag LOCUS_18560 16851 16591 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_18560 17699 17298 gene locus_tag LOCUS_18570 17699 17298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 17941 17687 gene locus_tag LOCUS_18580 17941 17687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 18252 18007 gene locus_tag LOCUS_18590 18252 18007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 18816 18391 gene locus_tag LOCUS_18600 18816 18391 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272025.1 protein_id gnl|my_center|LOCUS_18600 20075 18873 gene locus_tag LOCUS_18610 gene carA 20075 18873 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104362.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence062 544 1554 gene locus_tag LOCUS_18620 544 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 2610 1579 gene locus_tag LOCUS_18630 gene holA 2610 1579 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140070.1 protein_id gnl|my_center|LOCUS_18630 3047 2610 gene locus_tag LOCUS_18640 3047 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 5757 3079 gene locus_tag LOCUS_18650 5757 3079 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775771.1 protein_id gnl|my_center|LOCUS_18650 6460 5765 gene locus_tag LOCUS_18660 6460 5765 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392107.1 protein_id gnl|my_center|LOCUS_18660 7959 6598 gene locus_tag LOCUS_18670 7959 6598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 10868 8082 gene locus_tag LOCUS_18680 gene leuS 10868 8082 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479923.1 protein_id gnl|my_center|LOCUS_18680 10877 11185 gene locus_tag LOCUS_18690 10877 11185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 11230 11556 gene locus_tag LOCUS_18700 11230 11556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 11557 12495 gene locus_tag LOCUS_18710 11557 12495 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227736.1 protein_id gnl|my_center|LOCUS_18710 12492 14423 gene locus_tag LOCUS_18720 12492 14423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 14420 14671 gene locus_tag LOCUS_18730 14420 14671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 15785 15201 gene locus_tag LOCUS_18740 15785 15201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 16186 16111 gene locus_tag LOCUS_t00210 16186 16111 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 16836 17294 gene locus_tag LOCUS_18750 16836 17294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 17255 17770 gene locus_tag LOCUS_18760 17255 17770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 18532 17981 gene locus_tag LOCUS_18770 18532 17981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 20135 19662 gene locus_tag LOCUS_18780 20135 19662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 >Feature sequence063 2292 592 gene locus_tag LOCUS_18790 2292 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 3356 2280 gene locus_tag LOCUS_18800 3356 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 3780 3538 gene locus_tag LOCUS_18810 3780 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 3852 5006 gene locus_tag LOCUS_18820 3852 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 6272 4992 gene locus_tag LOCUS_18830 6272 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 6639 7160 gene locus_tag LOCUS_18840 6639 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256057.1 protein_id gnl|my_center|LOCUS_18840 8419 7658 gene locus_tag LOCUS_18850 8419 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 8896 8510 gene locus_tag LOCUS_18860 8896 8510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 9501 8893 gene locus_tag LOCUS_18870 9501 8893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728163.1 protein_id gnl|my_center|LOCUS_18870 9735 11054 gene locus_tag LOCUS_18880 9735 11054 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967094.1 protein_id gnl|my_center|LOCUS_18880 11086 11562 gene locus_tag LOCUS_18890 11086 11562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 12372 11608 gene locus_tag LOCUS_18900 12372 11608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 12316 12549 gene locus_tag LOCUS_18910 12316 12549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 13227 12604 gene locus_tag LOCUS_18920 13227 12604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 13932 13360 gene locus_tag LOCUS_18930 13932 13360 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679998.1 protein_id gnl|my_center|LOCUS_18930 14868 13942 gene locus_tag LOCUS_18940 14868 13942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 15512 15027 gene locus_tag LOCUS_18950 15512 15027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 15859 15662 gene locus_tag LOCUS_18960 15859 15662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18960 16828 15935 gene locus_tag LOCUS_18970 16828 15935 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_18970 18124 17129 gene locus_tag LOCUS_18980 18124 17129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 18315 19700 gene locus_tag LOCUS_18990 18315 19700 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225363.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence064 2092 824 gene locus_tag LOCUS_19000 2092 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19000 2298 2825 gene locus_tag LOCUS_19010 2298 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 3265 2996 gene locus_tag LOCUS_19020 3265 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 3512 3333 gene locus_tag LOCUS_19030 3512 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 4271 3534 gene locus_tag LOCUS_19040 4271 3534 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943121.1 protein_id gnl|my_center|LOCUS_19040 5935 4268 gene locus_tag LOCUS_19050 5935 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 6720 6058 gene locus_tag LOCUS_19060 6720 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 6764 7129 gene locus_tag LOCUS_19070 6764 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19070 7126 7803 gene locus_tag LOCUS_19080 7126 7803 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222372.1 protein_id gnl|my_center|LOCUS_19080 7764 8489 gene locus_tag LOCUS_19090 7764 8489 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030627.1 protein_id gnl|my_center|LOCUS_19090 8630 9535 gene locus_tag LOCUS_19100 8630 9535 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020544063.1 protein_id gnl|my_center|LOCUS_19100 10022 9630 gene locus_tag LOCUS_19110 10022 9630 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477828.1 protein_id gnl|my_center|LOCUS_19110 11590 10028 gene locus_tag LOCUS_19120 11590 10028 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_19120 11910 11608 gene locus_tag LOCUS_19130 11910 11608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 12428 12883 gene locus_tag LOCUS_19140 12428 12883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 13471 12929 gene locus_tag LOCUS_19150 13471 12929 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_19150 13903 13571 gene locus_tag LOCUS_19160 13903 13571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 14405 14076 gene locus_tag LOCUS_19170 14405 14076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 14287 15153 gene locus_tag LOCUS_19180 14287 15153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 15180 16187 gene locus_tag LOCUS_19190 15180 16187 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_19190 16207 17292 gene locus_tag LOCUS_19200 16207 17292 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226780.1 protein_id gnl|my_center|LOCUS_19200 17295 18314 gene locus_tag LOCUS_19210 17295 18314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence065 2014 1028 gene locus_tag LOCUS_19220 gene murB 2014 1028 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392364.1 protein_id gnl|my_center|LOCUS_19220 3093 2011 gene locus_tag LOCUS_19230 3093 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 4420 3068 gene locus_tag LOCUS_19240 gene ftsW 4420 3068 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_19240 5973 4417 gene locus_tag LOCUS_19250 gene murD 5973 4417 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_19250 6523 5981 gene locus_tag LOCUS_19260 6523 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19260 6960 6454 gene locus_tag LOCUS_19270 6960 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19270 9070 7238 gene locus_tag LOCUS_19280 9070 7238 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_19280 9478 9083 gene locus_tag LOCUS_19290 9478 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 9678 9478 gene locus_tag LOCUS_19300 9678 9478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 10713 9703 gene locus_tag LOCUS_19310 gene rsmH 10713 9703 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_19310 11151 10723 gene locus_tag LOCUS_19320 gene mraZ 11151 10723 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256658.1 protein_id gnl|my_center|LOCUS_19320 11469 11786 gene locus_tag LOCUS_19330 11469 11786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 12171 11770 gene locus_tag LOCUS_19340 12171 11770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 13630 12545 gene locus_tag LOCUS_19350 13630 12545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 13771 14013 gene locus_tag LOCUS_19360 13771 14013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 14318 15133 gene locus_tag LOCUS_19370 14318 15133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 15240 16070 gene locus_tag LOCUS_19380 15240 16070 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789758.1 protein_id gnl|my_center|LOCUS_19380 16622 16227 gene locus_tag LOCUS_19390 16622 16227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19390 17524 16823 gene locus_tag LOCUS_19400 17524 16823 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228693.1 protein_id gnl|my_center|LOCUS_19400 <19067 17538 gene locus_tag LOCUS_19410 <19067 17538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228694.1:succinate dehydrogenase flavoprotein subunit >Feature sequence066 385 570 gene locus_tag LOCUS_19420 385 570 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258244.1 protein_id gnl|my_center|LOCUS_19420 578 976 gene locus_tag LOCUS_19430 gene rpsH 578 976 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966398.1 protein_id gnl|my_center|LOCUS_19430 984 1526 gene locus_tag LOCUS_19440 gene rplF 984 1526 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_19440 1523 1885 gene locus_tag LOCUS_19450 gene rplR 1523 1885 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055951.1 protein_id gnl|my_center|LOCUS_19450 1904 2437 gene locus_tag LOCUS_19460 gene rpsE 1904 2437 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_19460 2427 2636 gene locus_tag LOCUS_19470 2427 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 2633 3328 gene locus_tag LOCUS_19480 2633 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 3344 4666 gene locus_tag LOCUS_19490 gene secY 3344 4666 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_19490 4663 5343 gene locus_tag LOCUS_19500 4663 5343 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829774.1 protein_id gnl|my_center|LOCUS_19500 5393 6103 gene locus_tag LOCUS_19510 gene map 5393 6103 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_19510 6242 6487 gene locus_tag LOCUS_19520 gene infA 6242 6487 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393913.1 protein_id gnl|my_center|LOCUS_19520 6913 6593 gene locus_tag LOCUS_19530 6913 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 6794 7015 gene locus_tag LOCUS_19540 6794 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 7035 7430 gene locus_tag LOCUS_19550 gene rpsK 7035 7430 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258256.1 protein_id gnl|my_center|LOCUS_19550 7443 8069 gene locus_tag LOCUS_19560 gene rpsD 7443 8069 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_19560 8079 9077 gene locus_tag LOCUS_19570 8079 9077 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_19570 9091 9444 gene locus_tag LOCUS_19580 gene rplQ 9091 9444 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459109.1 protein_id gnl|my_center|LOCUS_19580 9518 10402 gene locus_tag LOCUS_19590 gene truA 9518 10402 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_19590 10374 10805 gene locus_tag LOCUS_19600 gene rplM 10374 10805 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881226.1 protein_id gnl|my_center|LOCUS_19600 10817 11215 gene locus_tag LOCUS_19610 gene rpsI 10817 11215 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399691.1 protein_id gnl|my_center|LOCUS_19610 11579 12811 gene locus_tag LOCUS_19620 11579 12811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 12895 13860 gene locus_tag LOCUS_19630 gene cdaA 12895 13860 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_19630 13857 15095 gene locus_tag LOCUS_19640 13857 15095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 15105 16436 gene locus_tag LOCUS_19650 gene glmM 15105 16436 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393729.1 protein_id gnl|my_center|LOCUS_19650 16483 18492 gene locus_tag LOCUS_19660 gene glmS 16483 18492 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808420.1 protein_id gnl|my_center|LOCUS_19660 18292 18307 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18549 18791 gene locus_tag LOCUS_19670 18549 18791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence067 <1 1017 gene locus_tag LOCUS_19680 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405061.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase 1026 2213 gene locus_tag LOCUS_19690 1026 2213 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_19690 2264 2566 gene locus_tag LOCUS_19700 2264 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 3917 2541 gene locus_tag LOCUS_19710 3917 2541 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_19710 4841 4065 gene locus_tag LOCUS_19720 4841 4065 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_19720 5703 4951 gene locus_tag LOCUS_19730 gene iolB 5703 4951 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583016.1 protein_id gnl|my_center|LOCUS_19730 5939 7018 gene locus_tag LOCUS_19740 5939 7018 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_19740 7079 8098 gene locus_tag LOCUS_19750 gene gnd 7079 8098 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405880.1 protein_id gnl|my_center|LOCUS_19750 8253 9566 gene locus_tag LOCUS_19760 8253 9566 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229854.1 protein_id gnl|my_center|LOCUS_19760 11037 9583 gene locus_tag LOCUS_19770 11037 9583 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392725.1 protein_id gnl|my_center|LOCUS_19770 13074 11101 gene locus_tag LOCUS_19780 13074 11101 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742114.1 protein_id gnl|my_center|LOCUS_19780 13568 13128 gene locus_tag LOCUS_19790 13568 13128 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230086.1 protein_id gnl|my_center|LOCUS_19790 15512 14148 gene locus_tag LOCUS_19800 15512 14148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 17485 15659 gene locus_tag LOCUS_19810 17485 15659 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence068 814 56 gene locus_tag LOCUS_19820 814 56 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022168.1 protein_id gnl|my_center|LOCUS_19820 1945 929 gene locus_tag LOCUS_19830 1945 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 2936 1971 gene locus_tag LOCUS_19840 2936 1971 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301207.1 protein_id gnl|my_center|LOCUS_19840 3955 3248 gene locus_tag LOCUS_19850 gene radC 3955 3248 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259440.1 protein_id gnl|my_center|LOCUS_19850 5731 4220 gene locus_tag LOCUS_19860 5731 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 6371 5763 gene locus_tag LOCUS_19870 6371 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 7521 6544 gene locus_tag LOCUS_19880 7521 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 8791 7718 gene locus_tag LOCUS_19890 8791 7718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 12108 8797 gene locus_tag LOCUS_19900 12108 8797 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392653.1 protein_id gnl|my_center|LOCUS_19900 12621 12160 gene locus_tag LOCUS_19910 12621 12160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 13451 12672 gene locus_tag LOCUS_19920 13451 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 15138 13513 gene locus_tag LOCUS_19930 gene guaA 15138 13513 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_19930 15899 15234 gene locus_tag LOCUS_19940 15899 15234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 <18578 15927 gene locus_tag LOCUS_19950 <18578 15927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084235.1:methionine synthase >Feature sequence069 503 1669 gene locus_tag LOCUS_19960 gene nusA 503 1669 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_19960 1723 1995 gene locus_tag LOCUS_19970 1723 1995 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869742.1 protein_id gnl|my_center|LOCUS_19970 1995 3386 gene locus_tag LOCUS_19980 1995 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19980 3290 3874 gene locus_tag LOCUS_19990 3290 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19990 3894 4454 gene locus_tag LOCUS_20000 3894 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 4451 5485 gene locus_tag LOCUS_20010 4451 5485 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220194564.1 protein_id gnl|my_center|LOCUS_20010 5487 7379 gene locus_tag LOCUS_20020 5487 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 9379 7376 gene locus_tag LOCUS_20030 9379 7376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 9867 9376 gene locus_tag LOCUS_20040 9867 9376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 10032 10301 gene locus_tag LOCUS_20050 gene rpsO 10032 10301 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973291.1 protein_id gnl|my_center|LOCUS_20050 10412 12829 gene locus_tag LOCUS_20060 10412 12829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 11983 12004 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13004 14077 gene locus_tag LOCUS_20070 gene asd 13004 14077 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881220.1 protein_id gnl|my_center|LOCUS_20070 14074 14808 gene locus_tag LOCUS_20080 14074 14808 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256875.1 protein_id gnl|my_center|LOCUS_20080 14847 16514 gene locus_tag LOCUS_20090 14847 16514 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence070 75 1 gene locus_tag LOCUS_t00220 75 1 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 474 271 gene locus_tag LOCUS_20100 474 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 434 1462 gene locus_tag LOCUS_20110 434 1462 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_20110 2335 1508 gene locus_tag LOCUS_20120 2335 1508 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061398.1 protein_id gnl|my_center|LOCUS_20120 3716 2352 gene locus_tag LOCUS_20130 3716 2352 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312497.1 protein_id gnl|my_center|LOCUS_20130 4951 3833 gene locus_tag LOCUS_20140 gene xylF 4951 3833 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329224.1 protein_id gnl|my_center|LOCUS_20140 5501 6877 gene locus_tag LOCUS_20150 5501 6877 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081059.1 protein_id gnl|my_center|LOCUS_20150 7174 8235 gene locus_tag LOCUS_20160 7174 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20160 8376 9785 gene locus_tag LOCUS_20170 gene xylB 8376 9785 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027626.1 protein_id gnl|my_center|LOCUS_20170 9782 10651 gene locus_tag LOCUS_20180 9782 10651 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029144.1 protein_id gnl|my_center|LOCUS_20180 11250 10783 gene locus_tag LOCUS_20190 11250 10783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 11423 11554 gene locus_tag LOCUS_20200 11423 11554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20200 12200 11646 gene locus_tag LOCUS_20210 12200 11646 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_20210 12276 12863 gene locus_tag LOCUS_20220 12276 12863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 12975 14378 gene locus_tag LOCUS_20230 12975 14378 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401386.1 protein_id gnl|my_center|LOCUS_20230 15818 14703 gene locus_tag LOCUS_20240 15818 14703 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742235.1 protein_id gnl|my_center|LOCUS_20240 17237 15936 gene locus_tag LOCUS_20250 17237 15936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 17736 17227 gene locus_tag LOCUS_20260 17736 17227 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919519.1 protein_id gnl|my_center|LOCUS_20260 18166 18240 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence071 1618 392 gene locus_tag LOCUS_20270 gene galK 1618 392 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 protein_id gnl|my_center|LOCUS_20270 2683 1628 gene locus_tag LOCUS_20280 gene galT 2683 1628 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097520.1 protein_id gnl|my_center|LOCUS_20280 3572 2676 gene locus_tag LOCUS_20290 3572 2676 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230059.1 protein_id gnl|my_center|LOCUS_20290 4636 3569 gene locus_tag LOCUS_20300 4636 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 4788 6002 gene locus_tag LOCUS_20310 4788 6002 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230102.1 protein_id gnl|my_center|LOCUS_20310 6060 7430 gene locus_tag LOCUS_20320 6060 7430 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722711.1 protein_id gnl|my_center|LOCUS_20320 7575 8444 gene locus_tag LOCUS_20330 7575 8444 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225105.1 protein_id gnl|my_center|LOCUS_20330 8441 9304 gene locus_tag LOCUS_20340 8441 9304 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_20340 9349 12141 gene locus_tag LOCUS_20350 9349 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 12429 14768 gene locus_tag LOCUS_20360 12429 14768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 15285 16109 gene locus_tag LOCUS_20370 15285 16109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 17256 16861 gene locus_tag LOCUS_20380 17256 16861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 17351 17497 gene locus_tag LOCUS_20390 17351 17497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 17884 17510 gene locus_tag LOCUS_20400 17884 17510 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675692.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence072 943 1392 gene locus_tag LOCUS_20410 943 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 1543 4746 gene locus_tag LOCUS_20420 1543 4746 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976652.1 protein_id gnl|my_center|LOCUS_20420 6117 4837 gene locus_tag LOCUS_20430 6117 4837 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606476.1 protein_id gnl|my_center|LOCUS_20430 8641 6371 gene locus_tag LOCUS_20440 8641 6371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 8859 10751 gene locus_tag LOCUS_20450 8859 10751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 10529 10556 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10732 12375 gene locus_tag LOCUS_20460 10732 12375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 12437 12850 gene locus_tag LOCUS_20470 12437 12850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 14370 12883 gene locus_tag LOCUS_20480 gene xylB 14370 12883 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_20480 14508 15038 gene locus_tag LOCUS_20490 14508 15038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 15716 15414 gene locus_tag LOCUS_20500 15716 15414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 17160 15637 gene locus_tag LOCUS_20510 17160 15637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence073 1513 1770 gene locus_tag LOCUS_20520 1513 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 3288 2470 gene locus_tag LOCUS_20530 3288 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 4129 3362 gene locus_tag LOCUS_20540 gene fabG 4129 3362 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_20540 4211 5311 gene locus_tag LOCUS_20550 gene pepQ 4211 5311 CDS product Xaa-Pro dipeptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249918.1 protein_id gnl|my_center|LOCUS_20550 5344 6621 gene locus_tag LOCUS_20560 5344 6621 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436698.1 protein_id gnl|my_center|LOCUS_20560 6767 7456 gene locus_tag LOCUS_20570 6767 7456 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728466.1 protein_id gnl|my_center|LOCUS_20570 9086 7617 gene locus_tag LOCUS_20580 9086 7617 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877623.1 protein_id gnl|my_center|LOCUS_20580 10451 9117 gene locus_tag LOCUS_20590 gene glyA 10451 9117 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061037.1 protein_id gnl|my_center|LOCUS_20590 10542 11924 gene locus_tag LOCUS_20600 10542 11924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 11939 12763 gene locus_tag LOCUS_20610 11939 12763 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727031.1 protein_id gnl|my_center|LOCUS_20610 12772 13611 gene locus_tag LOCUS_20620 12772 13611 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113103.1 protein_id gnl|my_center|LOCUS_20620 13608 14465 gene locus_tag LOCUS_20630 gene ssuC 13608 14465 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120785.1 protein_id gnl|my_center|LOCUS_20630 14484 16034 gene locus_tag LOCUS_20640 gene xylB 14484 16034 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_20640 16141 16422 gene locus_tag LOCUS_20650 16141 16422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 17255 16419 gene locus_tag LOCUS_20660 17255 16419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence074 241 1200 gene locus_tag LOCUS_20670 gene pip 241 1200 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141435.1 protein_id gnl|my_center|LOCUS_20670 1569 1321 gene locus_tag LOCUS_20680 1569 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 1906 1706 gene locus_tag LOCUS_20690 1906 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 2232 2993 gene locus_tag LOCUS_20700 2232 2993 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089420.1 protein_id gnl|my_center|LOCUS_20700 3131 3508 gene locus_tag LOCUS_20710 3131 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 3558 4241 gene locus_tag LOCUS_20720 3558 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 4268 5983 gene locus_tag LOCUS_20730 4268 5983 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083856.1 protein_id gnl|my_center|LOCUS_20730 5988 7085 gene locus_tag LOCUS_20740 5988 7085 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083857.1 protein_id gnl|my_center|LOCUS_20740 7136 7948 gene locus_tag LOCUS_20750 7136 7948 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083858.1 protein_id gnl|my_center|LOCUS_20750 7949 8932 gene locus_tag LOCUS_20760 7949 8932 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705199.1 protein_id gnl|my_center|LOCUS_20760 9013 9975 gene locus_tag LOCUS_20770 9013 9975 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039184056.1 protein_id gnl|my_center|LOCUS_20770 9996 11246 gene locus_tag LOCUS_20780 9996 11246 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_20780 11303 12127 gene locus_tag LOCUS_20790 gene iolO 11303 12127 CDS product 5-keto-L-gluconate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083268.1 protein_id gnl|my_center|LOCUS_20790 12253 13686 gene locus_tag LOCUS_20800 12253 13686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 13742 14536 gene locus_tag LOCUS_20810 13742 14536 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259477.1 protein_id gnl|my_center|LOCUS_20810 14609 15520 gene locus_tag LOCUS_20820 gene garR 14609 15520 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566608.1 protein_id gnl|my_center|LOCUS_20820 16361 15855 gene locus_tag LOCUS_20830 16361 15855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 17475 16696 gene locus_tag LOCUS_20840 gene fabG 17475 16696 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence075 89 183 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcgtggcttcgttgcgtgg 716 1849 gene locus_tag LOCUS_20850 716 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 2633 2010 gene locus_tag LOCUS_20860 2633 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2669 3523 gene locus_tag LOCUS_20870 2669 3523 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250685.1 protein_id gnl|my_center|LOCUS_20870 3707 4807 gene locus_tag LOCUS_20880 3707 4807 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_20880 4939 6060 gene locus_tag LOCUS_20890 4939 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 6183 7688 gene locus_tag LOCUS_20900 6183 7688 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_20900 7788 8450 gene locus_tag LOCUS_20910 7788 8450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 9881 8454 gene locus_tag LOCUS_20920 9881 8454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 10299 11654 gene locus_tag LOCUS_20930 10299 11654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 11805 13235 gene locus_tag LOCUS_20940 11805 13235 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258382.1 protein_id gnl|my_center|LOCUS_20940 13324 15909 gene locus_tag LOCUS_20950 13324 15909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 16722 15979 gene locus_tag LOCUS_20960 16722 15979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 <17600 16770 gene locus_tag LOCUS_20970 <17600 16770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259287.1:ABC transporter ATP-binding protein >Feature sequence076 2086 170 gene locus_tag LOCUS_20980 2086 170 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974433.1 protein_id gnl|my_center|LOCUS_20980 2459 4081 gene locus_tag LOCUS_20990 2459 4081 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_20990 4132 5637 gene locus_tag LOCUS_21000 4132 5637 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533079.1 protein_id gnl|my_center|LOCUS_21000 5782 6645 gene locus_tag LOCUS_21010 5782 6645 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891419.1 protein_id gnl|my_center|LOCUS_21010 6821 7003 gene locus_tag LOCUS_21020 6821 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 7464 7027 gene locus_tag LOCUS_21030 7464 7027 CDS product F420H(2)-dependent quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407780.1 protein_id gnl|my_center|LOCUS_21030 8000 8317 gene locus_tag LOCUS_21040 8000 8317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 8636 8406 gene locus_tag LOCUS_21050 8636 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 9213 8653 gene locus_tag LOCUS_21060 9213 8653 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967488.1 protein_id gnl|my_center|LOCUS_21060 10826 9654 gene locus_tag LOCUS_21070 10826 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 12206 10932 gene locus_tag LOCUS_21080 12206 10932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 12464 12237 gene locus_tag LOCUS_21090 12464 12237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 12761 13420 gene locus_tag LOCUS_21100 12761 13420 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_21100 13574 14101 gene locus_tag LOCUS_21110 13574 14101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 14425 14219 gene locus_tag LOCUS_21120 14425 14219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 14315 14575 gene locus_tag LOCUS_21130 14315 14575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 15171 15509 gene locus_tag LOCUS_21140 15171 15509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 15977 15801 gene locus_tag LOCUS_21150 15977 15801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 16118 16636 gene locus_tag LOCUS_21160 16118 16636 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962904.1 protein_id gnl|my_center|LOCUS_21160 17215 16940 gene locus_tag LOCUS_21170 17215 16940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence077 277 1317 gene locus_tag LOCUS_21180 277 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 1809 2429 gene locus_tag LOCUS_21190 1809 2429 CDS product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528738.1 protein_id gnl|my_center|LOCUS_21190 2518 3321 gene locus_tag LOCUS_21200 2518 3321 CDS product DUF2182 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528739.1 protein_id gnl|my_center|LOCUS_21200 4896 3709 gene locus_tag LOCUS_21210 4896 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 5410 4910 gene locus_tag LOCUS_21220 5410 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 5701 5967 gene locus_tag LOCUS_21230 5701 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 5977 6225 gene locus_tag LOCUS_21240 5977 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 6229 6606 gene locus_tag LOCUS_21250 6229 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 7465 7202 gene locus_tag LOCUS_21260 7465 7202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 7791 8408 gene locus_tag LOCUS_21270 7791 8408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 8830 8405 gene locus_tag LOCUS_21280 8830 8405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 8956 9231 gene locus_tag LOCUS_21290 8956 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 9803 10723 gene locus_tag LOCUS_21300 9803 10723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 10906 13242 gene locus_tag LOCUS_21310 10906 13242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 16913 13413 gene locus_tag LOCUS_21320 16913 13413 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403927.1 protein_id gnl|my_center|LOCUS_21320 17138 17374 gene locus_tag LOCUS_21330 17138 17374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 >Feature sequence078 <1 696 gene locus_tag LOCUS_21340 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257622.1:anthranilate phosphoribosyltransferase 693 3779 gene locus_tag LOCUS_21350 693 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 3776 4732 gene locus_tag LOCUS_21360 gene trpA 3776 4732 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228434.1 protein_id gnl|my_center|LOCUS_21360 6269 4779 gene locus_tag LOCUS_21370 6269 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 6811 6266 gene locus_tag LOCUS_21380 6811 6266 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143573.1 protein_id gnl|my_center|LOCUS_21380 7098 6937 gene locus_tag LOCUS_21390 7098 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 7404 7117 gene locus_tag LOCUS_21400 7404 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 7844 7401 gene locus_tag LOCUS_21410 gene aroQ 7844 7401 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194379.1 protein_id gnl|my_center|LOCUS_21410 9517 7841 gene locus_tag LOCUS_21420 9517 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 10795 9521 gene locus_tag LOCUS_21430 gene aroC 10795 9521 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_21430 11740 10805 gene locus_tag LOCUS_21440 11740 10805 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405001.1 protein_id gnl|my_center|LOCUS_21440 13110 11737 gene locus_tag LOCUS_21450 gene aroA 13110 11737 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141040.1 protein_id gnl|my_center|LOCUS_21450 14188 13115 gene locus_tag LOCUS_21460 gene aroF 14188 13115 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_21460 14555 14815 gene locus_tag LOCUS_21470 14555 14815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 14998 14834 gene locus_tag LOCUS_21480 14998 14834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 15207 17111 gene locus_tag LOCUS_21490 15207 17111 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223434.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence079 1493 669 gene locus_tag LOCUS_21500 gene rhaD 1493 669 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703941.1 protein_id gnl|my_center|LOCUS_21500 1922 1608 gene locus_tag LOCUS_21510 1922 1608 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978053.1 protein_id gnl|my_center|LOCUS_21510 3109 2018 gene locus_tag LOCUS_21520 gene rhaS 3109 2018 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226381.1 protein_id gnl|my_center|LOCUS_21520 4342 3200 gene locus_tag LOCUS_21530 4342 3200 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978051.1 protein_id gnl|my_center|LOCUS_21530 5364 4339 gene locus_tag LOCUS_21540 5364 4339 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226379.1 protein_id gnl|my_center|LOCUS_21540 6913 5354 gene locus_tag LOCUS_21550 6913 5354 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226378.1 protein_id gnl|my_center|LOCUS_21550 7776 6910 gene locus_tag LOCUS_21560 7776 6910 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582797.1 protein_id gnl|my_center|LOCUS_21560 7857 9191 gene locus_tag LOCUS_21570 gene rhaI 7857 9191 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027369.1 protein_id gnl|my_center|LOCUS_21570 9184 10707 gene locus_tag LOCUS_21580 9184 10707 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978046.1 protein_id gnl|my_center|LOCUS_21580 10918 12159 gene locus_tag LOCUS_21590 10918 12159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 12156 14207 gene locus_tag LOCUS_21600 12156 14207 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027370.1 protein_id gnl|my_center|LOCUS_21600 14222 15937 gene locus_tag LOCUS_21610 14222 15937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 15934 16947 gene locus_tag LOCUS_21620 15934 16947 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006494597.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence080 297 1085 gene locus_tag LOCUS_21630 297 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 2016 1078 gene locus_tag LOCUS_21640 2016 1078 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392390.1 protein_id gnl|my_center|LOCUS_21640 2183 5725 gene locus_tag LOCUS_21650 2183 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 6237 6923 gene locus_tag LOCUS_21660 6237 6923 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942574.1 protein_id gnl|my_center|LOCUS_21660 8470 7001 gene locus_tag LOCUS_21670 8470 7001 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404930.1 protein_id gnl|my_center|LOCUS_21670 8798 8484 gene locus_tag LOCUS_21680 8798 8484 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 protein_id gnl|my_center|LOCUS_21680 9955 8795 gene locus_tag LOCUS_21690 9955 8795 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401026.1 protein_id gnl|my_center|LOCUS_21690 10452 10787 gene locus_tag LOCUS_21700 10452 10787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 10927 12219 gene locus_tag LOCUS_21710 10927 12219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 12978 12238 gene locus_tag LOCUS_21720 12978 12238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 13768 13292 gene locus_tag LOCUS_21730 gene bcp 13768 13292 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_21730 14647 13862 gene locus_tag LOCUS_21740 14647 13862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 16452 14644 gene locus_tag LOCUS_21750 16452 14644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence081 987 151 gene locus_tag LOCUS_21760 987 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21760 1647 1021 gene locus_tag LOCUS_21770 gene grpE 1647 1021 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257941.1 protein_id gnl|my_center|LOCUS_21770 2713 1640 gene locus_tag LOCUS_21780 gene hrcA 2713 1640 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257942.1 protein_id gnl|my_center|LOCUS_21780 4214 2919 gene locus_tag LOCUS_21790 4214 2919 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584153.1 protein_id gnl|my_center|LOCUS_21790 5634 4327 gene locus_tag LOCUS_21800 gene hemW 5634 4327 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087641.1 protein_id gnl|my_center|LOCUS_21800 6601 5690 gene locus_tag LOCUS_21810 6601 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 7974 6598 gene locus_tag LOCUS_21820 7974 6598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21820 8416 8138 gene locus_tag LOCUS_21830 8416 8138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21830 8556 9314 gene locus_tag LOCUS_21840 8556 9314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 9683 10036 gene locus_tag LOCUS_21850 9683 10036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 10036 10383 gene locus_tag LOCUS_21860 10036 10383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 10491 10643 gene locus_tag LOCUS_21870 10491 10643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 11251 11652 gene locus_tag LOCUS_21880 11251 11652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 11649 12641 gene locus_tag LOCUS_21890 11649 12641 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259359.1 protein_id gnl|my_center|LOCUS_21890 12652 13776 gene locus_tag LOCUS_21900 12652 13776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 13819 14637 gene locus_tag LOCUS_21910 13819 14637 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_21910 14653 15924 gene locus_tag LOCUS_21920 14653 15924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 >Feature sequence082 1046 2068 gene locus_tag LOCUS_21930 1046 2068 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_21930 2093 2590 gene locus_tag LOCUS_21940 2093 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 3506 2658 gene locus_tag LOCUS_21950 3506 2658 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284355.1 protein_id gnl|my_center|LOCUS_21950 4315 3548 gene locus_tag LOCUS_21960 4315 3548 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 protein_id gnl|my_center|LOCUS_21960 4466 5410 gene locus_tag LOCUS_21970 4466 5410 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143624.1 protein_id gnl|my_center|LOCUS_21970 6984 5527 gene locus_tag LOCUS_21980 6984 5527 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876257.1 protein_id gnl|my_center|LOCUS_21980 7271 10186 gene locus_tag LOCUS_21990 7271 10186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 11994 10297 gene locus_tag LOCUS_22000 11994 10297 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230797.1 protein_id gnl|my_center|LOCUS_22000 12332 13987 gene locus_tag LOCUS_22010 12332 13987 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941147.1 protein_id gnl|my_center|LOCUS_22010 14152 14361 gene locus_tag LOCUS_22020 14152 14361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 14383 14544 gene locus_tag LOCUS_22030 14383 14544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 14701 15255 gene locus_tag LOCUS_22040 14701 15255 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229065.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence083 860 162 gene locus_tag LOCUS_22050 gene hypB 860 162 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258628.1 protein_id gnl|my_center|LOCUS_22050 1226 861 gene locus_tag LOCUS_22060 1226 861 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728272.1 protein_id gnl|my_center|LOCUS_22060 1444 1830 gene locus_tag LOCUS_22070 1444 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 1827 3761 gene locus_tag LOCUS_22080 1827 3761 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937741.1 protein_id gnl|my_center|LOCUS_22080 3761 4615 gene locus_tag LOCUS_22090 3761 4615 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937740.1 protein_id gnl|my_center|LOCUS_22090 4621 5046 gene locus_tag LOCUS_22100 4621 5046 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937739.1 protein_id gnl|my_center|LOCUS_22100 5046 5441 gene locus_tag LOCUS_22110 5046 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 5438 6523 gene locus_tag LOCUS_22120 5438 6523 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937737.1 protein_id gnl|my_center|LOCUS_22120 6526 6933 gene locus_tag LOCUS_22130 6526 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 7268 8668 gene locus_tag LOCUS_22140 7268 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 8836 9669 gene locus_tag LOCUS_22150 8836 9669 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943683.1 protein_id gnl|my_center|LOCUS_22150 9669 11153 gene locus_tag LOCUS_22160 gene gltA 9669 11153 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943682.1 protein_id gnl|my_center|LOCUS_22160 12397 11189 gene locus_tag LOCUS_22170 12397 11189 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630214.1 protein_id gnl|my_center|LOCUS_22170 13850 12438 gene locus_tag LOCUS_22180 13850 12438 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_22180 13988 14662 gene locus_tag LOCUS_22190 13988 14662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 14819 15367 gene locus_tag LOCUS_22200 14819 15367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 >Feature sequence084 1886 435 gene locus_tag LOCUS_22210 1886 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 2412 2104 gene locus_tag LOCUS_22220 2412 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 2426 3418 gene locus_tag LOCUS_22230 2426 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 3554 3718 gene locus_tag LOCUS_22240 3554 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 4300 3773 gene locus_tag LOCUS_22250 4300 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 4688 4422 gene locus_tag LOCUS_22260 4688 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 4910 6115 gene locus_tag LOCUS_22270 4910 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 6553 6110 gene locus_tag LOCUS_22280 6553 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 7099 8607 gene locus_tag LOCUS_22290 7099 8607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 8598 9188 gene locus_tag LOCUS_22300 8598 9188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 9390 10652 gene locus_tag LOCUS_22310 9390 10652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 11284 11102 gene locus_tag LOCUS_22320 11284 11102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 11763 12005 gene locus_tag LOCUS_22330 11763 12005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 12017 12265 gene locus_tag LOCUS_22340 12017 12265 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_22340 13157 13705 gene locus_tag LOCUS_22350 13157 13705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 14117 13824 gene locus_tag LOCUS_22360 14117 13824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 14351 14896 gene locus_tag LOCUS_22370 14351 14896 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_22370 14893 15504 gene locus_tag LOCUS_22380 14893 15504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 >Feature sequence085 1369 878 gene locus_tag LOCUS_22390 gene hoxE 1369 878 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943357.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22390 1624 2733 gene locus_tag LOCUS_22400 1624 2733 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230305.1 protein_id gnl|my_center|LOCUS_22400 3291 2770 gene locus_tag LOCUS_22410 3291 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 4005 3577 gene locus_tag LOCUS_22420 4005 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 4355 4002 gene locus_tag LOCUS_22430 4355 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 4273 4737 gene locus_tag LOCUS_22440 4273 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 5140 4874 gene locus_tag LOCUS_22450 5140 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 5302 5676 gene locus_tag LOCUS_22460 5302 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 5741 6112 gene locus_tag LOCUS_22470 5741 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 6157 6324 gene locus_tag LOCUS_22480 6157 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 6799 8241 gene locus_tag LOCUS_22490 6799 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 8270 8623 gene locus_tag LOCUS_22500 8270 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 9587 8640 gene locus_tag LOCUS_22510 9587 8640 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877324.1 protein_id gnl|my_center|LOCUS_22510 9834 10238 gene locus_tag LOCUS_22520 9834 10238 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188904829.1 protein_id gnl|my_center|LOCUS_22520 10327 10494 gene locus_tag LOCUS_22530 10327 10494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 10740 10597 gene locus_tag LOCUS_22540 10740 10597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 12655 10841 gene locus_tag LOCUS_22550 12655 10841 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_22550 12832 12975 gene locus_tag LOCUS_22560 12832 12975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 13180 13713 gene locus_tag LOCUS_22570 gene nuoE 13180 13713 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence086 57 1331 gene locus_tag LOCUS_22580 gene wlbH 57 1331 CDS product O-antigen biosynthesis protein WlbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929609.1 protein_id gnl|my_center|LOCUS_22580 1328 2740 gene locus_tag LOCUS_22590 1328 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 2737 4131 gene locus_tag LOCUS_22600 2737 4131 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038479.1 protein_id gnl|my_center|LOCUS_22600 4128 5438 gene locus_tag LOCUS_22610 4128 5438 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038479.1 protein_id gnl|my_center|LOCUS_22610 6797 5484 gene locus_tag LOCUS_22620 6797 5484 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582949.1 protein_id gnl|my_center|LOCUS_22620 8010 6850 gene locus_tag LOCUS_22630 gene wecB 8010 6850 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_22630 8181 9353 gene locus_tag LOCUS_22640 8181 9353 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048110.1 protein_id gnl|my_center|LOCUS_22640 10649 9366 gene locus_tag LOCUS_22650 10649 9366 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_22650 11920 10646 gene locus_tag LOCUS_22660 11920 10646 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355958.1 protein_id gnl|my_center|LOCUS_22660 12363 13688 gene locus_tag LOCUS_22670 12363 13688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 >Feature sequence087 413 1267 gene locus_tag LOCUS_22680 413 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 1177 2529 gene locus_tag LOCUS_22690 1177 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 2493 3920 gene locus_tag LOCUS_22700 2493 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 4010 4912 gene locus_tag LOCUS_22710 4010 4912 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_22710 5213 4890 gene locus_tag LOCUS_22720 5213 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 5184 6170 gene locus_tag LOCUS_22730 5184 6170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_22730 6167 7102 gene locus_tag LOCUS_22740 6167 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 7099 8139 gene locus_tag LOCUS_22750 7099 8139 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_22750 8172 8894 gene locus_tag LOCUS_22760 8172 8894 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974984.1 protein_id gnl|my_center|LOCUS_22760 8896 9330 gene locus_tag LOCUS_22770 8896 9330 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986971.1 protein_id gnl|my_center|LOCUS_22770 10339 9359 gene locus_tag LOCUS_22780 10339 9359 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258763.1 protein_id gnl|my_center|LOCUS_22780 12661 10940 gene locus_tag LOCUS_22790 12661 10940 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_22790 13227 12658 gene locus_tag LOCUS_22800 13227 12658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22800 14573 13668 gene locus_tag LOCUS_22810 14573 13668 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763252.1 protein_id gnl|my_center|LOCUS_22810 >Feature sequence088 179 838 gene locus_tag LOCUS_22820 179 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 1710 949 gene locus_tag LOCUS_22830 1710 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 2031 4100 gene locus_tag LOCUS_22840 2031 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 4097 4555 gene locus_tag LOCUS_22850 4097 4555 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866321.1 protein_id gnl|my_center|LOCUS_22850 4760 5467 gene locus_tag LOCUS_22860 4760 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 5692 6009 gene locus_tag LOCUS_22870 5692 6009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 6817 6137 gene locus_tag LOCUS_22880 gene clpP 6817 6137 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942436.1 protein_id gnl|my_center|LOCUS_22880 7273 6845 gene locus_tag LOCUS_22890 7273 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 7361 7837 gene locus_tag LOCUS_22900 7361 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 8406 7882 gene locus_tag LOCUS_22910 8406 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 9173 9589 gene locus_tag LOCUS_22920 9173 9589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 10157 11335 gene locus_tag LOCUS_22930 10157 11335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22930 11313 12461 gene locus_tag LOCUS_22940 11313 12461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22940 12706 12748 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12795 13307 gene locus_tag LOCUS_22950 12795 13307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 13799 13620 gene locus_tag LOCUS_22960 13799 13620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 <15158 14032 gene locus_tag LOCUS_22970 <15158 14032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227649.1:ABC transporter permease >Feature sequence089 <1 1197 gene locus_tag LOCUS_22980 <1 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460697.1:stage V sporulation protein E 1118 2272 gene locus_tag LOCUS_22990 1118 2272 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256649.1 protein_id gnl|my_center|LOCUS_22990 2269 3258 gene locus_tag LOCUS_23000 gene murB 2269 3258 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943692.1 protein_id gnl|my_center|LOCUS_23000 3344 4429 gene locus_tag LOCUS_23010 3344 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 4573 5805 gene locus_tag LOCUS_23020 gene ftsA 4573 5805 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094115.1 protein_id gnl|my_center|LOCUS_23020 5851 6255 gene locus_tag LOCUS_23030 5851 6255 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413208.1 protein_id gnl|my_center|LOCUS_23030 6506 6925 gene locus_tag LOCUS_23040 6506 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23040 6891 7784 gene locus_tag LOCUS_23050 6891 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23050 7797 8528 gene locus_tag LOCUS_23060 7797 8528 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_23060 8623 8931 gene locus_tag LOCUS_23070 8623 8931 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921449.1 protein_id gnl|my_center|LOCUS_23070 9036 9112 gene locus_tag LOCUS_t00230 9036 9112 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9221 10366 gene locus_tag LOCUS_23080 9221 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 10476 10688 gene locus_tag LOCUS_23090 10476 10688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 10765 11814 gene locus_tag LOCUS_23100 10765 11814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 12258 11920 gene locus_tag LOCUS_23110 12258 11920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 12690 12262 gene locus_tag LOCUS_23120 12690 12262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 12893 13477 gene locus_tag LOCUS_23130 12893 13477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 13491 14456 gene locus_tag LOCUS_23140 13491 14456 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258874.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence090 1545 1075 gene locus_tag LOCUS_23150 1545 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 2165 1605 gene locus_tag LOCUS_23160 2165 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 3643 2234 gene locus_tag LOCUS_23170 3643 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 4854 3925 gene locus_tag LOCUS_23180 4854 3925 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902161.1 protein_id gnl|my_center|LOCUS_23180 5305 4889 gene locus_tag LOCUS_23190 5305 4889 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228473.1 protein_id gnl|my_center|LOCUS_23190 5985 5701 gene locus_tag LOCUS_23200 5985 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 6152 5982 gene locus_tag LOCUS_23210 6152 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 7163 6282 gene locus_tag LOCUS_23220 7163 6282 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070939922.1 protein_id gnl|my_center|LOCUS_23220 8132 7227 gene locus_tag LOCUS_23230 gene lgt 8132 7227 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257228.1 protein_id gnl|my_center|LOCUS_23230 8335 8730 gene locus_tag LOCUS_23240 8335 8730 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942061.1 protein_id gnl|my_center|LOCUS_23240 8827 9309 gene locus_tag LOCUS_23250 8827 9309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 9831 9340 gene locus_tag LOCUS_23260 9831 9340 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206189.1 protein_id gnl|my_center|LOCUS_23260 10458 9838 gene locus_tag LOCUS_23270 10458 9838 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081641.1 protein_id gnl|my_center|LOCUS_23270 10796 10461 gene locus_tag LOCUS_23280 10796 10461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 11119 10820 gene locus_tag LOCUS_23290 gene groES 11119 10820 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817319.1 protein_id gnl|my_center|LOCUS_23290 11419 11135 gene locus_tag LOCUS_23300 11419 11135 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582458.1 protein_id gnl|my_center|LOCUS_23300 11823 11419 gene locus_tag LOCUS_23310 11823 11419 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228875.1 protein_id gnl|my_center|LOCUS_23310 12215 11838 gene locus_tag LOCUS_23320 12215 11838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 12911 12492 gene locus_tag LOCUS_23330 12911 12492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 13741 13028 gene locus_tag LOCUS_23340 13741 13028 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089728.1 protein_id gnl|my_center|LOCUS_23340 13943 14236 gene locus_tag LOCUS_23350 13943 14236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 14248 14514 gene locus_tag LOCUS_23360 14248 14514 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256473.1 protein_id gnl|my_center|LOCUS_23360 14511 14936 gene locus_tag LOCUS_23370 14511 14936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence091 1382 78 gene locus_tag LOCUS_23380 gene arcA 1382 78 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526983.1 protein_id gnl|my_center|LOCUS_23380 1443 1823 gene locus_tag LOCUS_23390 1443 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 1926 2153 gene locus_tag LOCUS_23400 1926 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 2216 2566 gene locus_tag LOCUS_23410 2216 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 2706 4919 gene locus_tag LOCUS_23420 2706 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 5277 4912 gene locus_tag LOCUS_23430 5277 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23430 5430 5618 gene locus_tag LOCUS_23440 5430 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 6443 5838 gene locus_tag LOCUS_23450 6443 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 6981 6703 gene locus_tag LOCUS_23460 6981 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 6923 8122 gene locus_tag LOCUS_23470 6923 8122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 8804 8112 gene locus_tag LOCUS_23480 8804 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 9174 9791 gene locus_tag LOCUS_23490 9174 9791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 10652 9846 gene locus_tag LOCUS_23500 10652 9846 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532089.1 protein_id gnl|my_center|LOCUS_23500 12228 10807 gene locus_tag LOCUS_23510 12228 10807 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_23510 12769 12239 gene locus_tag LOCUS_23520 12769 12239 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257073.1 protein_id gnl|my_center|LOCUS_23520 13476 12769 gene locus_tag LOCUS_23530 gene hoxU 13476 12769 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943355.1 protein_id gnl|my_center|LOCUS_23530 <14889 13489 gene locus_tag LOCUS_23540 <14889 13489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813982.1:NAD(P)-binding protein >Feature sequence092 3324 2500 gene locus_tag LOCUS_23550 3324 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 3975 3343 gene locus_tag LOCUS_23560 3975 3343 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_23560 4147 4233 gene locus_tag LOCUS_t00240 4147 4233 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5916 4288 gene locus_tag LOCUS_23570 5916 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23570 7764 5998 gene locus_tag LOCUS_23580 7764 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 9790 7916 gene locus_tag LOCUS_23590 9790 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 10800 9979 gene locus_tag LOCUS_23600 10800 9979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 14768 10797 gene locus_tag LOCUS_23610 14768 10797 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_23610 >Feature sequence093 <1 723 gene locus_tag LOCUS_23620 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243394.1:triose-phosphate isomerase 720 2324 gene locus_tag LOCUS_23630 gene gpmI 720 2324 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_23630 2448 2675 gene locus_tag LOCUS_23640 2448 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2761 4602 gene locus_tag LOCUS_23650 2761 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 4619 4704 gene locus_tag LOCUS_t00250 4619 4704 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4750 4834 gene locus_tag LOCUS_t00260 4750 4834 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4934 5009 gene locus_tag LOCUS_t00270 4934 5009 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5592 6152 gene locus_tag LOCUS_23660 5592 6152 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_23660 6214 7197 gene locus_tag LOCUS_23670 gene htpX 6214 7197 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895736.1 protein_id gnl|my_center|LOCUS_23670 7320 7395 gene locus_tag LOCUS_t00280 7320 7395 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 7420 7495 gene locus_tag LOCUS_t00290 7420 7495 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7558 7653 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7794 7880 gene locus_tag LOCUS_t00300 7794 7880 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7975 8403 gene locus_tag LOCUS_23680 7975 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 8437 8886 gene locus_tag LOCUS_23690 8437 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 8975 9259 gene locus_tag LOCUS_23700 gene rpsR 8975 9259 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391678.1 protein_id gnl|my_center|LOCUS_23700 9472 10515 gene locus_tag LOCUS_23710 9472 10515 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392337.1 protein_id gnl|my_center|LOCUS_23710 10615 11592 gene locus_tag LOCUS_23720 10615 11592 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_23720 11585 13300 gene locus_tag LOCUS_23730 11585 13300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence094 66 459 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcctcaatgaaagcagcgccgggaagacgctgcaac 917 417 gene locus_tag LOCUS_23740 917 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 1255 1470 gene locus_tag LOCUS_23750 1255 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 3220 1505 gene locus_tag LOCUS_23760 3220 1505 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929046.1 protein_id gnl|my_center|LOCUS_23760 3444 3983 gene locus_tag LOCUS_23770 3444 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 4676 4062 gene locus_tag LOCUS_23780 4676 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 5474 5100 gene locus_tag LOCUS_23790 5474 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 5550 6731 gene locus_tag LOCUS_23800 5550 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 8530 6752 gene locus_tag LOCUS_23810 8530 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 8734 10152 gene locus_tag LOCUS_23820 8734 10152 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_23820 10145 10546 gene locus_tag LOCUS_23830 10145 10546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 10543 11871 gene locus_tag LOCUS_23840 10543 11871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 13365 12208 gene locus_tag LOCUS_23850 13365 12208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 >Feature sequence095 843 121 gene locus_tag LOCUS_23860 843 121 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258927.1 protein_id gnl|my_center|LOCUS_23860 1306 1869 gene locus_tag LOCUS_23870 1306 1869 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228850.1 protein_id gnl|my_center|LOCUS_23870 2192 3373 gene locus_tag LOCUS_23880 2192 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 3384 4376 gene locus_tag LOCUS_23890 3384 4376 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258178.1 protein_id gnl|my_center|LOCUS_23890 5052 6317 gene locus_tag LOCUS_23900 5052 6317 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_23900 6370 7845 gene locus_tag LOCUS_23910 6370 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 8867 7842 gene locus_tag LOCUS_23920 8867 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 9072 10505 gene locus_tag LOCUS_23930 9072 10505 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942285.1 protein_id gnl|my_center|LOCUS_23930 10507 11520 gene locus_tag LOCUS_23940 gene cydB 10507 11520 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_23940 13120 11798 gene locus_tag LOCUS_23950 13120 11798 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992304.1 protein_id gnl|my_center|LOCUS_23950 13926 13117 gene locus_tag LOCUS_23960 13926 13117 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933909.1 protein_id gnl|my_center|LOCUS_23960 <14791 13923 gene locus_tag LOCUS_23970 <14791 13923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545135.1:4-hydroxy-tetrahydrodipicolinate synthase >Feature sequence096 521 1489 gene locus_tag LOCUS_23980 521 1489 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969981.1 protein_id gnl|my_center|LOCUS_23980 1668 2168 gene locus_tag LOCUS_23990 1668 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 2226 2882 gene locus_tag LOCUS_24000 2226 2882 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990775.1 protein_id gnl|my_center|LOCUS_24000 4007 3033 gene locus_tag LOCUS_24010 4007 3033 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900287.1 protein_id gnl|my_center|LOCUS_24010 4442 4044 gene locus_tag LOCUS_24020 4442 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 4925 4533 gene locus_tag LOCUS_24030 4925 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 5463 5044 gene locus_tag LOCUS_24040 5463 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 5912 5484 gene locus_tag LOCUS_24050 5912 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 5918 5923 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6061 6759 gene locus_tag LOCUS_24060 6061 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 8315 7437 gene locus_tag LOCUS_24070 8315 7437 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052303786.1 protein_id gnl|my_center|LOCUS_24070 9213 8317 gene locus_tag LOCUS_24080 gene proC 9213 8317 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_24080 10578 9682 gene locus_tag LOCUS_24090 10578 9682 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_24090 10987 10700 gene locus_tag LOCUS_24100 10987 10700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 11290 11123 gene locus_tag LOCUS_24110 11290 11123 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429811.1 protein_id gnl|my_center|LOCUS_24110 11464 11796 gene locus_tag LOCUS_24120 11464 11796 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324538.1 protein_id gnl|my_center|LOCUS_24120 12124 12297 gene locus_tag LOCUS_24130 12124 12297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 12414 12677 gene locus_tag LOCUS_24140 12414 12677 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096161.1 protein_id gnl|my_center|LOCUS_24140 13056 12775 gene locus_tag LOCUS_24150 13056 12775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065696.1 protein_id gnl|my_center|LOCUS_24150 13417 13343 gene locus_tag LOCUS_t00310 13417 13343 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14294 13449 gene locus_tag LOCUS_24160 14294 13449 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057817.1 protein_id gnl|my_center|LOCUS_24160 >Feature sequence097 421 1380 gene locus_tag LOCUS_24170 421 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 1746 3014 gene locus_tag LOCUS_24180 1746 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 3380 4426 gene locus_tag LOCUS_24190 3380 4426 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223381.1 protein_id gnl|my_center|LOCUS_24190 4894 4661 gene locus_tag LOCUS_24200 4894 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 5524 5859 gene locus_tag LOCUS_24210 5524 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 5999 6628 gene locus_tag LOCUS_24220 5999 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24220 6589 8775 gene locus_tag LOCUS_24230 6589 8775 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889379.1 protein_id gnl|my_center|LOCUS_24230 8775 9707 gene locus_tag LOCUS_24240 8775 9707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 9715 10137 gene locus_tag LOCUS_24250 9715 10137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 10172 10855 gene locus_tag LOCUS_24260 10172 10855 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_24260 11738 11055 gene locus_tag LOCUS_24270 11738 11055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 13697 12822 gene locus_tag LOCUS_24280 13697 12822 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417254.1 protein_id gnl|my_center|LOCUS_24280 14077 14259 gene locus_tag LOCUS_24290 14077 14259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 14435 14537 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence098 825 325 gene locus_tag LOCUS_24300 825 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 1106 822 gene locus_tag LOCUS_24310 1106 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 2053 1118 gene locus_tag LOCUS_24320 2053 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 2211 2050 gene locus_tag LOCUS_24330 2211 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 2414 2208 gene locus_tag LOCUS_24340 2414 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2867 2652 gene locus_tag LOCUS_24350 2867 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 4141 2864 gene locus_tag LOCUS_24360 4141 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 4163 4474 gene locus_tag LOCUS_24370 4163 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 5460 4564 gene locus_tag LOCUS_24380 5460 4564 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 protein_id gnl|my_center|LOCUS_24380 5920 5453 gene locus_tag LOCUS_24390 5920 5453 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816436.1 protein_id gnl|my_center|LOCUS_24390 6012 6872 gene locus_tag LOCUS_24400 gene udp 6012 6872 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250430.1 protein_id gnl|my_center|LOCUS_24400 7905 6895 gene locus_tag LOCUS_24410 7905 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 9167 7971 gene locus_tag LOCUS_24420 9167 7971 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074497.1 protein_id gnl|my_center|LOCUS_24420 10717 9164 gene locus_tag LOCUS_24430 10717 9164 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 protein_id gnl|my_center|LOCUS_24430 11904 10804 gene locus_tag LOCUS_24440 11904 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 13159 12107 gene locus_tag LOCUS_24450 13159 12107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 13224 13604 gene locus_tag LOCUS_24460 13224 13604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 14506 13664 gene locus_tag LOCUS_24470 gene rsmI 14506 13664 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_24470 >Feature sequence099 484 618 gene locus_tag LOCUS_24480 484 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 819 631 gene locus_tag LOCUS_24490 819 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 871 1278 gene locus_tag LOCUS_24500 871 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 1374 2093 gene locus_tag LOCUS_24510 1374 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 2278 2556 gene locus_tag LOCUS_24520 2278 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 2733 3338 gene locus_tag LOCUS_24530 2733 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 4072 3458 gene locus_tag LOCUS_24540 4072 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 6248 4065 gene locus_tag LOCUS_24550 6248 4065 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762635.1 protein_id gnl|my_center|LOCUS_24550 6553 6245 gene locus_tag LOCUS_24560 6553 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 7039 6746 gene locus_tag LOCUS_24570 7039 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 9086 7122 gene locus_tag LOCUS_24580 9086 7122 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250346.1 protein_id gnl|my_center|LOCUS_24580 9839 9174 gene locus_tag LOCUS_24590 9839 9174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 10871 9882 gene locus_tag LOCUS_24600 10871 9882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 11090 14332 gene locus_tag LOCUS_24610 11090 14332 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014855724.1 protein_id gnl|my_center|LOCUS_24610 >Feature sequence100 1783 1709 gene locus_tag LOCUS_t00320 1783 1709 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1960 3054 gene locus_tag LOCUS_24620 1960 3054 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186205.1 protein_id gnl|my_center|LOCUS_24620 4059 3124 gene locus_tag LOCUS_24630 4059 3124 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113373.1 protein_id gnl|my_center|LOCUS_24630 4552 4094 gene locus_tag LOCUS_24640 4552 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 4661 7000 gene locus_tag LOCUS_24650 gene mrfA 4661 7000 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_24650 6997 8319 gene locus_tag LOCUS_24660 6997 8319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 9258 8341 gene locus_tag LOCUS_24670 9258 8341 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256060.1 protein_id gnl|my_center|LOCUS_24670 9278 9634 gene locus_tag LOCUS_24680 9278 9634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 10792 9665 gene locus_tag LOCUS_24690 gene ychF 10792 9665 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_24690 11882 10872 gene locus_tag LOCUS_24700 11882 10872 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728382.1 protein_id gnl|my_center|LOCUS_24700 13083 11932 gene locus_tag LOCUS_24710 13083 11932 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256151.1 protein_id gnl|my_center|LOCUS_24710 14087 13167 gene locus_tag LOCUS_24720 gene racE 14087 13167 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723856.1 protein_id gnl|my_center|LOCUS_24720 14209 14263 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence101 1354 239 gene locus_tag LOCUS_24730 1354 239 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530830.1 protein_id gnl|my_center|LOCUS_24730 2260 1400 gene locus_tag LOCUS_24740 2260 1400 CDS product glucosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921804.1 protein_id gnl|my_center|LOCUS_24740 3334 2273 gene locus_tag LOCUS_24750 gene rbsK 3334 2273 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246357.1 protein_id gnl|my_center|LOCUS_24750 4227 3331 gene locus_tag LOCUS_24760 4227 3331 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525321.1 protein_id gnl|my_center|LOCUS_24760 5144 4224 gene locus_tag LOCUS_24770 5144 4224 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975588.1 protein_id gnl|my_center|LOCUS_24770 6306 5164 gene locus_tag LOCUS_24780 6306 5164 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396179.1 protein_id gnl|my_center|LOCUS_24780 7737 6547 gene locus_tag LOCUS_24790 7737 6547 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224850.1 protein_id gnl|my_center|LOCUS_24790 9255 8101 gene locus_tag LOCUS_24800 9255 8101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 9420 9875 gene locus_tag LOCUS_24810 9420 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 10331 10825 gene locus_tag LOCUS_24820 10331 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 11517 10954 gene locus_tag LOCUS_24830 11517 10954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 12543 11632 gene locus_tag LOCUS_24840 12543 11632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 13029 12589 gene locus_tag LOCUS_24850 13029 12589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 13510 14238 gene locus_tag LOCUS_24860 13510 14238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence102 126 170 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 219 554 gene locus_tag LOCUS_24870 219 554 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255952.1 protein_id gnl|my_center|LOCUS_24870 565 1605 gene locus_tag LOCUS_24880 gene meaB 565 1605 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223478.1 protein_id gnl|my_center|LOCUS_24880 5676 1666 gene locus_tag LOCUS_24890 5676 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 5942 5619 gene locus_tag LOCUS_24900 5942 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 6159 6233 gene locus_tag LOCUS_t00330 6159 6233 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6593 6282 gene locus_tag LOCUS_24910 6593 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24910 7441 7220 gene locus_tag LOCUS_24920 7441 7220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 7326 8966 gene locus_tag LOCUS_24930 7326 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 9177 10361 gene locus_tag LOCUS_24940 9177 10361 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120539.1 protein_id gnl|my_center|LOCUS_24940 11915 10338 gene locus_tag LOCUS_24950 11915 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 12779 12096 gene locus_tag LOCUS_24960 12779 12096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24960 >Feature sequence103 3408 553 gene locus_tag LOCUS_24970 3408 553 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_24970 8594 3405 gene locus_tag LOCUS_24980 8594 3405 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 protein_id gnl|my_center|LOCUS_24980 8779 9966 gene locus_tag LOCUS_24990 8779 9966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 10042 10779 gene locus_tag LOCUS_25000 10042 10779 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142947.1 protein_id gnl|my_center|LOCUS_25000 11995 10853 gene locus_tag LOCUS_25010 11995 10853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 11969 12160 gene locus_tag LOCUS_25020 11969 12160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 12157 12864 gene locus_tag LOCUS_25030 12157 12864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 >Feature sequence104 <1 1452 gene locus_tag LOCUS_25040 <1 1452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_188106780.1:PAS domain S-box protein 1628 2191 gene locus_tag LOCUS_25050 1628 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 2358 2588 gene locus_tag LOCUS_25060 2358 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 2533 5028 gene locus_tag LOCUS_25070 2533 5028 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889379.1 protein_id gnl|my_center|LOCUS_25070 5705 5148 gene locus_tag LOCUS_25080 5705 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 6042 6440 gene locus_tag LOCUS_25090 6042 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 6951 6535 gene locus_tag LOCUS_25100 6951 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 6969 7190 gene locus_tag LOCUS_25110 6969 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 7247 8440 gene locus_tag LOCUS_25120 7247 8440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 8700 9137 gene locus_tag LOCUS_25130 8700 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 9405 9941 gene locus_tag LOCUS_25140 9405 9941 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_25140 10076 11308 gene locus_tag LOCUS_25150 10076 11308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 11622 12890 gene locus_tag LOCUS_25160 11622 12890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 >Feature sequence105 80 808 gene locus_tag LOCUS_25170 gene rpe 80 808 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545731.1 protein_id gnl|my_center|LOCUS_25170 1648 878 gene locus_tag LOCUS_25180 1648 878 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206877.1 protein_id gnl|my_center|LOCUS_25180 2470 1712 gene locus_tag LOCUS_25190 gene fabG 2470 1712 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_25190 3155 2646 gene locus_tag LOCUS_25200 3155 2646 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583637.1 protein_id gnl|my_center|LOCUS_25200 3317 4393 gene locus_tag LOCUS_25210 3317 4393 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046798190.1 protein_id gnl|my_center|LOCUS_25210 4657 5817 gene locus_tag LOCUS_25220 4657 5817 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_25220 5862 6821 gene locus_tag LOCUS_25230 5862 6821 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_25230 6966 8531 gene locus_tag LOCUS_25240 6966 8531 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892896.1 protein_id gnl|my_center|LOCUS_25240 8654 9772 gene locus_tag LOCUS_25250 8654 9772 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530830.1 protein_id gnl|my_center|LOCUS_25250 9984 10220 gene locus_tag LOCUS_25260 9984 10220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 10319 10762 gene locus_tag LOCUS_25270 10319 10762 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972448.1 protein_id gnl|my_center|LOCUS_25270 10887 11432 gene locus_tag LOCUS_25280 10887 11432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 <13023 11840 gene locus_tag LOCUS_25290 <13023 11840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339635.1:aspartate aminotransferase family protein >Feature sequence106 4197 3739 gene locus_tag LOCUS_25300 4197 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 4622 4254 gene locus_tag LOCUS_25310 4622 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 5761 4526 gene locus_tag LOCUS_25320 5761 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25320 8096 5805 gene locus_tag LOCUS_25330 8096 5805 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250760.1 protein_id gnl|my_center|LOCUS_25330 10305 8104 gene locus_tag LOCUS_25340 10305 8104 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_25340 10452 11846 gene locus_tag LOCUS_25350 gene nadB 10452 11846 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257285.1 protein_id gnl|my_center|LOCUS_25350 >Feature sequence107 3 650 gene locus_tag LOCUS_25360 3 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 671 1291 gene locus_tag LOCUS_25370 671 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 1291 1920 gene locus_tag LOCUS_25380 1291 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 1920 2897 gene locus_tag LOCUS_25390 gene accD 1920 2897 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_25390 2890 3870 gene locus_tag LOCUS_25400 2890 3870 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_25400 3874 4518 gene locus_tag LOCUS_25410 3874 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 4518 5882 gene locus_tag LOCUS_25420 gene accC 4518 5882 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142010.1 protein_id gnl|my_center|LOCUS_25420 5915 6385 gene locus_tag LOCUS_25430 gene fabZ 5915 6385 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931959.1 protein_id gnl|my_center|LOCUS_25430 6385 7128 gene locus_tag LOCUS_25440 6385 7128 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_25440 7125 8399 gene locus_tag LOCUS_25450 gene fabF 7125 8399 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_25450 8410 9021 gene locus_tag LOCUS_25460 8410 9021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 9021 10133 gene locus_tag LOCUS_25470 9021 10133 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460503.1 protein_id gnl|my_center|LOCUS_25470 10171 10920 gene locus_tag LOCUS_25480 gene fabG 10171 10920 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989818.1 protein_id gnl|my_center|LOCUS_25480 >Feature sequence108 1086 709 gene locus_tag LOCUS_25490 1086 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 1690 1094 gene locus_tag LOCUS_25500 1690 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 1983 1687 gene locus_tag LOCUS_25510 1983 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 2938 2312 gene locus_tag LOCUS_25520 2938 2312 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_25520 4583 2943 gene locus_tag LOCUS_25530 4583 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 6978 5161 gene locus_tag LOCUS_25540 6978 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 7418 6975 gene locus_tag LOCUS_25550 7418 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 8050 7397 gene locus_tag LOCUS_25560 8050 7397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 8172 9554 gene locus_tag LOCUS_25570 8172 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 10079 11023 gene locus_tag LOCUS_25580 10079 11023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 12069 11263 gene locus_tag LOCUS_25590 gene xerC 12069 11263 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392542.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence109 139 876 gene locus_tag LOCUS_25600 139 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 1021 2205 gene locus_tag LOCUS_25610 1021 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 2850 3143 gene locus_tag LOCUS_25620 2850 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 3386 3667 gene locus_tag LOCUS_25630 3386 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 3699 3755 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4328 4507 gene locus_tag LOCUS_25640 4328 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 4528 6675 gene locus_tag LOCUS_25650 4528 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 6675 9209 gene locus_tag LOCUS_25660 6675 9209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 9821 11353 gene locus_tag LOCUS_25670 9821 11353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 12020 11583 gene locus_tag LOCUS_25680 12020 11583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 >Feature sequence110 <1 3871 gene locus_tag LOCUS_25690 <1 3871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256730.1:N-6 DNA methylase 3893 6328 gene locus_tag LOCUS_25700 3893 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 6300 7526 gene locus_tag LOCUS_25710 6300 7526 CDS product McrBC 5-methylcytosine restriction system component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804187.1 protein_id gnl|my_center|LOCUS_25710 7639 10686 gene locus_tag LOCUS_25720 7639 10686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 9738 9801 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10693 11607 gene locus_tag LOCUS_25730 10693 11607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 >Feature sequence111 335 460 gene locus_tag LOCUS_25740 335 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 587 3565 gene locus_tag LOCUS_25750 587 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 3701 5419 gene locus_tag LOCUS_25760 3701 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 6119 5427 gene locus_tag LOCUS_25770 6119 5427 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155666.1 protein_id gnl|my_center|LOCUS_25770 7420 6116 gene locus_tag LOCUS_25780 7420 6116 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_25780 7965 8732 gene locus_tag LOCUS_25790 7965 8732 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_25790 8837 9826 gene locus_tag LOCUS_25800 8837 9826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 11280 10027 gene locus_tag LOCUS_25810 11280 10027 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_25810 >Feature sequence112 918 1667 gene locus_tag LOCUS_25820 918 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 2013 1747 gene locus_tag LOCUS_25830 2013 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 3824 2148 gene locus_tag LOCUS_25840 3824 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 4741 3824 gene locus_tag LOCUS_25850 4741 3824 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258911.1 protein_id gnl|my_center|LOCUS_25850 5153 4881 gene locus_tag LOCUS_25860 5153 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 7191 5251 gene locus_tag LOCUS_25870 7191 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 7900 7487 gene locus_tag LOCUS_25880 7900 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 8004 9008 gene locus_tag LOCUS_25890 8004 9008 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_25890 9005 9820 gene locus_tag LOCUS_25900 9005 9820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 9845 10573 gene locus_tag LOCUS_25910 9845 10573 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256276.1 protein_id gnl|my_center|LOCUS_25910 10693 10896 gene locus_tag LOCUS_25920 10693 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 11538 10996 gene locus_tag LOCUS_25930 11538 10996 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257075.1 protein_id gnl|my_center|LOCUS_25930 <12034 11528 gene locus_tag LOCUS_25940 <12034 11528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943353.1:Ni/Fe hydrogenase subunit alpha >Feature sequence113 1788 268 gene locus_tag LOCUS_25950 1788 268 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776894.1 protein_id gnl|my_center|LOCUS_25950 4008 1894 gene locus_tag LOCUS_25960 4008 1894 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053701.1 protein_id gnl|my_center|LOCUS_25960 5229 4345 gene locus_tag LOCUS_25970 5229 4345 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031642.1 protein_id gnl|my_center|LOCUS_25970 6158 5226 gene locus_tag LOCUS_25980 6158 5226 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467636.1 protein_id gnl|my_center|LOCUS_25980 7737 6271 gene locus_tag LOCUS_25990 7737 6271 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225936.1 protein_id gnl|my_center|LOCUS_25990 8948 7842 gene locus_tag LOCUS_26000 8948 7842 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_26000 9578 8976 gene locus_tag LOCUS_26010 9578 8976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26010 10119 9472 gene locus_tag LOCUS_26020 10119 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 11709 10816 gene locus_tag LOCUS_26030 11709 10816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 >Feature sequence114 <1 600 gene locus_tag LOCUS_26040 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258175.1:dTDP-glucose 4,6-dehydratase 614 1567 gene locus_tag LOCUS_26050 gene rfbD 614 1567 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256315.1 protein_id gnl|my_center|LOCUS_26050 1689 2624 gene locus_tag LOCUS_26060 1689 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 2870 3532 gene locus_tag LOCUS_26070 2870 3532 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259738.1 protein_id gnl|my_center|LOCUS_26070 3529 4635 gene locus_tag LOCUS_26080 3529 4635 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259620.1 protein_id gnl|my_center|LOCUS_26080 4632 5657 gene locus_tag LOCUS_26090 4632 5657 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259623.1 protein_id gnl|my_center|LOCUS_26090 5654 7120 gene locus_tag LOCUS_26100 5654 7120 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776106.1 protein_id gnl|my_center|LOCUS_26100 7133 8245 gene locus_tag LOCUS_26110 gene wecB 7133 8245 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048109.1 protein_id gnl|my_center|LOCUS_26110 8242 9480 gene locus_tag LOCUS_26120 8242 9480 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466568.1 protein_id gnl|my_center|LOCUS_26120 9610 11409 gene locus_tag LOCUS_26130 9610 11409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 >Feature sequence115 <1 537 gene locus_tag LOCUS_26140 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122045.1:Mrp/NBP35 family ATP-binding protein 634 2697 gene locus_tag LOCUS_26150 634 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 3737 2745 gene locus_tag LOCUS_26160 3737 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 4040 4738 gene locus_tag LOCUS_26170 4040 4738 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175285932.1 protein_id gnl|my_center|LOCUS_26170 5238 4756 gene locus_tag LOCUS_26180 5238 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 6513 5281 gene locus_tag LOCUS_26190 6513 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 6635 7483 gene locus_tag LOCUS_26200 6635 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 7444 8082 gene locus_tag LOCUS_26210 7444 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 8160 8247 gene locus_tag LOCUS_t00340 8160 8247 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8344 8925 gene locus_tag LOCUS_26220 8344 8925 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466608.1 protein_id gnl|my_center|LOCUS_26220 8922 10304 gene locus_tag LOCUS_26230 8922 10304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 10362 11063 gene locus_tag LOCUS_26240 10362 11063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence116 1299 520 gene locus_tag LOCUS_26250 1299 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 1303 1343 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1657 1908 gene locus_tag LOCUS_26260 1657 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 1912 2325 gene locus_tag LOCUS_26270 1912 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 3877 2474 gene locus_tag LOCUS_26280 3877 2474 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403748.1 protein_id gnl|my_center|LOCUS_26280 4803 4408 gene locus_tag LOCUS_26290 4803 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 4998 5837 gene locus_tag LOCUS_26300 4998 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 6010 9087 gene locus_tag LOCUS_26310 6010 9087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 9084 9887 gene locus_tag LOCUS_26320 9084 9887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 9897 10271 gene locus_tag LOCUS_26330 9897 10271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 10325 11134 gene locus_tag LOCUS_26340 10325 11134 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_26340 >Feature sequence117 144 791 gene locus_tag LOCUS_26350 144 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 800 1879 gene locus_tag LOCUS_26360 800 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 4194 1909 gene locus_tag LOCUS_26370 4194 1909 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889379.1 protein_id gnl|my_center|LOCUS_26370 4678 4187 gene locus_tag LOCUS_26380 4678 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26380 5680 4835 gene locus_tag LOCUS_26390 5680 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 5837 6721 gene locus_tag LOCUS_26400 5837 6721 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411125.1 protein_id gnl|my_center|LOCUS_26400 6718 7506 gene locus_tag LOCUS_26410 6718 7506 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889268.1 protein_id gnl|my_center|LOCUS_26410 8007 7717 gene locus_tag LOCUS_26420 8007 7717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 8096 8833 gene locus_tag LOCUS_26430 8096 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 9399 10922 gene locus_tag LOCUS_26440 gene hutH 9399 10922 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_26440 >Feature sequence118 2606 684 gene locus_tag LOCUS_26450 2606 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 4553 2913 gene locus_tag LOCUS_26460 4553 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 7248 4867 gene locus_tag LOCUS_26470 7248 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 9235 7820 gene locus_tag LOCUS_26480 9235 7820 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_26480 9431 10027 gene locus_tag LOCUS_26490 gene rfbC 9431 10027 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_26490 11202 11230 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence119 968 3 gene locus_tag LOCUS_26500 968 3 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027482.1 protein_id gnl|my_center|LOCUS_26500 2378 1071 gene locus_tag LOCUS_26510 2378 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 3063 2728 gene locus_tag LOCUS_26520 3063 2728 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537521.1 protein_id gnl|my_center|LOCUS_26520 3952 3101 gene locus_tag LOCUS_26530 3952 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 5389 4079 gene locus_tag LOCUS_26540 gene serS 5389 4079 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884187.1 protein_id gnl|my_center|LOCUS_26540 7071 5578 gene locus_tag LOCUS_26550 gene lysS 7071 5578 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878711.1 protein_id gnl|my_center|LOCUS_26550 7546 7082 gene locus_tag LOCUS_26560 gene greA 7546 7082 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391698.1 protein_id gnl|my_center|LOCUS_26560 8619 8155 gene locus_tag LOCUS_26570 gene argR 8619 8155 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810957.1 protein_id gnl|my_center|LOCUS_26570 9476 8637 gene locus_tag LOCUS_26580 gene uppP 9476 8637 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_26580 <11235 9571 gene locus_tag LOCUS_26590 <11235 9571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053104337.1:sodium-translocating pyrophosphatase >Feature sequence120 <1 918 gene locus_tag LOCUS_26600 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256378.1:bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase 923 2278 gene locus_tag LOCUS_26610 gene alr 923 2278 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_26610 2318 2605 gene locus_tag LOCUS_26620 2318 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 2687 4624 gene locus_tag LOCUS_26630 2687 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 4621 5844 gene locus_tag LOCUS_26640 4621 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 5857 6222 gene locus_tag LOCUS_26650 5857 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 6300 6824 gene locus_tag LOCUS_26660 6300 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 6821 7498 gene locus_tag LOCUS_26670 6821 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 7516 8175 gene locus_tag LOCUS_26680 7516 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 8172 9233 gene locus_tag LOCUS_26690 gene tsaD 8172 9233 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256815.1 protein_id gnl|my_center|LOCUS_26690 9230 10150 gene locus_tag LOCUS_26700 gene rsmA 9230 10150 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256787.1 protein_id gnl|my_center|LOCUS_26700 >Feature sequence121 <1 1041 gene locus_tag LOCUS_26710 <1 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143837.1:acetyl ornithine aminotransferase family protein 1238 1978 gene locus_tag LOCUS_26720 1238 1978 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768681.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26720 2079 2825 gene locus_tag LOCUS_26730 2079 2825 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035619.1 protein_id gnl|my_center|LOCUS_26730 3301 2852 gene locus_tag LOCUS_26740 3301 2852 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023219.1 protein_id gnl|my_center|LOCUS_26740 3559 5109 gene locus_tag LOCUS_26750 3559 5109 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026923.1 protein_id gnl|my_center|LOCUS_26750 5106 5777 gene locus_tag LOCUS_26760 5106 5777 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_26760 5872 7143 gene locus_tag LOCUS_26770 5872 7143 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931723.1 protein_id gnl|my_center|LOCUS_26770 7147 7701 gene locus_tag LOCUS_26780 7147 7701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 7711 8982 gene locus_tag LOCUS_26790 7711 8982 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931723.1 protein_id gnl|my_center|LOCUS_26790 9110 9916 gene locus_tag LOCUS_26800 9110 9916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence122 86 949 gene locus_tag LOCUS_26810 gene aroE 86 949 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973723.1 protein_id gnl|my_center|LOCUS_26810 2221 962 gene locus_tag LOCUS_26820 2221 962 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704482.1 protein_id gnl|my_center|LOCUS_26820 2761 2246 gene locus_tag LOCUS_26830 2761 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26830 3369 2764 gene locus_tag LOCUS_26840 3369 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 4201 3371 gene locus_tag LOCUS_26850 4201 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 5765 4311 gene locus_tag LOCUS_26860 5765 4311 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533311.1 protein_id gnl|my_center|LOCUS_26860 6095 7324 gene locus_tag LOCUS_26870 6095 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 7577 7581 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7726 8370 gene locus_tag LOCUS_26880 7726 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26880 8462 9382 gene locus_tag LOCUS_26890 8462 9382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26890 9482 10291 gene locus_tag LOCUS_26900 9482 10291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 >Feature sequence123 343 819 gene locus_tag LOCUS_26910 343 819 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056371.1 protein_id gnl|my_center|LOCUS_26910 1529 813 gene locus_tag LOCUS_26920 1529 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679004.1 protein_id gnl|my_center|LOCUS_26920 2127 1540 gene locus_tag LOCUS_26930 2127 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 3386 2229 gene locus_tag LOCUS_26940 gene qmoC 3386 2229 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878164.1 protein_id gnl|my_center|LOCUS_26940 3646 3383 gene locus_tag LOCUS_26950 3646 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 5388 3643 gene locus_tag LOCUS_26960 5388 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26960 8114 5385 gene locus_tag LOCUS_26970 8114 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26970 8554 8111 gene locus_tag LOCUS_26980 8554 8111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 8880 8626 gene locus_tag LOCUS_26990 8880 8626 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256473.1 protein_id gnl|my_center|LOCUS_26990 9270 8905 gene locus_tag LOCUS_27000 9270 8905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 9682 9314 gene locus_tag LOCUS_27010 9682 9314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 >Feature sequence124 <1 564 gene locus_tag LOCUS_27020 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545185.1:NADH-quinone oxidoreductase subunit M 578 1336 gene locus_tag LOCUS_27030 578 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27030 1298 1305 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1333 1971 gene locus_tag LOCUS_27040 1333 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27040 2318 2085 gene locus_tag LOCUS_27050 2318 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 2454 3266 gene locus_tag LOCUS_27060 2454 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 4380 3274 gene locus_tag LOCUS_27070 gene corA 4380 3274 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_27070 5983 4361 gene locus_tag LOCUS_27080 5983 4361 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462758.1 protein_id gnl|my_center|LOCUS_27080 6181 6717 gene locus_tag LOCUS_27090 6181 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 7665 6916 gene locus_tag LOCUS_27100 7665 6916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 8087 8512 gene locus_tag LOCUS_27110 8087 8512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 8512 9165 gene locus_tag LOCUS_27120 8512 9165 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020574.1 protein_id gnl|my_center|LOCUS_27120 >Feature sequence125 51 1247 gene locus_tag LOCUS_27130 51 1247 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120539.1 protein_id gnl|my_center|LOCUS_27130 1832 1401 gene locus_tag LOCUS_27140 1832 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 4001 2223 gene locus_tag LOCUS_27150 4001 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 7398 4087 gene locus_tag LOCUS_27160 7398 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 9866 8601 gene locus_tag LOCUS_27170 9866 8601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 >Feature sequence126 1674 1024 gene locus_tag LOCUS_27180 1674 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 2384 1926 gene locus_tag LOCUS_27190 2384 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 2931 2536 gene locus_tag LOCUS_27200 2931 2536 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_27200 3458 2928 gene locus_tag LOCUS_27210 3458 2928 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537140.1 protein_id gnl|my_center|LOCUS_27210 4030 3455 gene locus_tag LOCUS_27220 4030 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 4906 4490 gene locus_tag LOCUS_27230 4906 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 5389 6495 gene locus_tag LOCUS_27240 5389 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 6796 7284 gene locus_tag LOCUS_27250 6796 7284 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061267.1 protein_id gnl|my_center|LOCUS_27250 7289 7774 gene locus_tag LOCUS_27260 7289 7774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 8422 8123 gene locus_tag LOCUS_27270 8422 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 9876 9577 gene locus_tag LOCUS_27280 9876 9577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020545.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence127 847 1872 gene locus_tag LOCUS_27290 847 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 2793 1969 gene locus_tag LOCUS_27300 2793 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 3183 3416 gene locus_tag LOCUS_27310 3183 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 5052 3625 gene locus_tag LOCUS_27320 5052 3625 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003587.1 protein_id gnl|my_center|LOCUS_27320 6569 5049 gene locus_tag LOCUS_27330 6569 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 8297 6924 gene locus_tag LOCUS_27340 8297 6924 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525043.1 protein_id gnl|my_center|LOCUS_27340 8620 8399 gene locus_tag LOCUS_27350 8620 8399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 9428 8754 gene locus_tag LOCUS_27360 9428 8754 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229343.1 protein_id gnl|my_center|LOCUS_27360 9339 9554 gene locus_tag LOCUS_27370 9339 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 >Feature sequence128 461 1399 gene locus_tag LOCUS_27380 461 1399 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727633.1 protein_id gnl|my_center|LOCUS_27380 1452 2756 gene locus_tag LOCUS_27390 1452 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 2837 4468 gene locus_tag LOCUS_27400 2837 4468 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528166.1 protein_id gnl|my_center|LOCUS_27400 4465 5490 gene locus_tag LOCUS_27410 4465 5490 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970565.1 protein_id gnl|my_center|LOCUS_27410 5552 6637 gene locus_tag LOCUS_27420 5552 6637 CDS product erythritol/L-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402615.1 protein_id gnl|my_center|LOCUS_27420 6765 7235 gene locus_tag LOCUS_27430 gene rpiB 6765 7235 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402606.1 protein_id gnl|my_center|LOCUS_27430 7280 8311 gene locus_tag LOCUS_27440 7280 8311 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533065.1 protein_id gnl|my_center|LOCUS_27440 8308 8976 gene locus_tag LOCUS_27450 gene dhaL 8308 8976 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728173.1 protein_id gnl|my_center|LOCUS_27450 8980 9819 gene locus_tag LOCUS_27460 gene tpiA 8980 9819 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880184.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence129 255 2375 gene locus_tag LOCUS_27470 255 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 2372 3694 gene locus_tag LOCUS_27480 2372 3694 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338923.1 protein_id gnl|my_center|LOCUS_27480 3755 4282 gene locus_tag LOCUS_27490 gene rpiB 3755 4282 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402606.1 protein_id gnl|my_center|LOCUS_27490 4279 5310 gene locus_tag LOCUS_27500 4279 5310 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533065.1 protein_id gnl|my_center|LOCUS_27500 5307 5972 gene locus_tag LOCUS_27510 gene dhaL 5307 5972 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389096.1 protein_id gnl|my_center|LOCUS_27510 5969 6718 gene locus_tag LOCUS_27520 5969 6718 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976280.1 protein_id gnl|my_center|LOCUS_27520 6976 8055 gene locus_tag LOCUS_27530 6976 8055 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393144.1 protein_id gnl|my_center|LOCUS_27530 8048 9610 gene locus_tag LOCUS_27540 gene lsrK 8048 9610 CDS product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042875210.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence130 <1 765 gene locus_tag LOCUS_27550 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256188.1:phosphoglycerate dehydrogenase 762 1631 gene locus_tag LOCUS_27560 762 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 4097 1671 gene locus_tag LOCUS_27570 4097 1671 CDS product transglutaminaseTgpA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259434.1 protein_id gnl|my_center|LOCUS_27570 5370 4144 gene locus_tag LOCUS_27580 5370 4144 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259028.1 protein_id gnl|my_center|LOCUS_27580 6417 5392 gene locus_tag LOCUS_27590 6417 5392 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_27590 6830 8998 gene locus_tag LOCUS_27600 6830 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence131 826 548 gene locus_tag LOCUS_27610 826 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 1190 810 gene locus_tag LOCUS_27620 1190 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 1263 1409 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1820 1584 gene locus_tag LOCUS_27630 1820 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 4014 2578 gene locus_tag LOCUS_27640 4014 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210308580.1 protein_id gnl|my_center|LOCUS_27640 5735 4011 gene locus_tag LOCUS_27650 5735 4011 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942011.1 protein_id gnl|my_center|LOCUS_27650 6879 5881 gene locus_tag LOCUS_27660 6879 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 7773 6913 gene locus_tag LOCUS_27670 7773 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 8640 8092 gene locus_tag LOCUS_27680 8640 8092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 8584 8919 gene locus_tag LOCUS_27690 8584 8919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence132 2960 1872 gene locus_tag LOCUS_27700 2960 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 4034 3414 gene locus_tag LOCUS_27710 4034 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559189.1 protein_id gnl|my_center|LOCUS_27710 6596 4137 gene locus_tag LOCUS_27720 6596 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 7135 6593 gene locus_tag LOCUS_27730 7135 6593 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_27730 7251 8270 gene locus_tag LOCUS_27740 7251 8270 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027374.1 protein_id gnl|my_center|LOCUS_27740 8722 8312 gene locus_tag LOCUS_27750 8722 8312 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233882.1 protein_id gnl|my_center|LOCUS_27750 >Feature sequence133 873 1643 gene locus_tag LOCUS_27760 873 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 1779 3140 gene locus_tag LOCUS_27770 1779 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 3177 4445 gene locus_tag LOCUS_27780 3177 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 4854 4474 gene locus_tag LOCUS_27790 4854 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 4920 5621 gene locus_tag LOCUS_27800 gene thrH 4920 5621 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098078.1 protein_id gnl|my_center|LOCUS_27800 6753 5644 gene locus_tag LOCUS_27810 gene thrC 6753 5644 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546273.1 protein_id gnl|my_center|LOCUS_27810 8091 6769 gene locus_tag LOCUS_27820 8091 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 8643 8218 gene locus_tag LOCUS_27830 8643 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 >Feature sequence134 754 254 gene locus_tag LOCUS_27840 754 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 1965 1240 gene locus_tag LOCUS_27850 1965 1240 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_27850 2108 2881 gene locus_tag LOCUS_27860 2108 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 2884 3090 gene locus_tag LOCUS_27870 2884 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 4036 3248 gene locus_tag LOCUS_27880 4036 3248 CDS product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779966.1 protein_id gnl|my_center|LOCUS_27880 5218 4079 gene locus_tag LOCUS_27890 5218 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 5376 5858 gene locus_tag LOCUS_27900 5376 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 6987 5908 gene locus_tag LOCUS_27910 6987 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27910 7072 7518 gene locus_tag LOCUS_27920 7072 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 7641 8783 gene locus_tag LOCUS_27930 7641 8783 CDS product IS1380-like element ISMsm10 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731432.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27930 >Feature sequence135 77 1 gene locus_tag LOCUS_t00350 77 1 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1002 139 gene locus_tag LOCUS_27940 1002 139 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689582.1 protein_id gnl|my_center|LOCUS_27940 1619 999 gene locus_tag LOCUS_27950 gene dcd 1619 999 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064104.1 protein_id gnl|my_center|LOCUS_27950 2050 1616 gene locus_tag LOCUS_27960 gene nrdR 2050 1616 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548345.1 protein_id gnl|my_center|LOCUS_27960 2728 2180 gene locus_tag LOCUS_27970 2728 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 3409 2858 gene locus_tag LOCUS_27980 gene moaC 3409 2858 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087579.1 protein_id gnl|my_center|LOCUS_27980 4726 3536 gene locus_tag LOCUS_27990 4726 3536 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899401.1 protein_id gnl|my_center|LOCUS_27990 5421 4726 gene locus_tag LOCUS_28000 5421 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 6932 5418 gene locus_tag LOCUS_28010 6932 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 7553 7086 gene locus_tag LOCUS_28020 7553 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 7435 7857 gene locus_tag LOCUS_28030 7435 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 8580 8287 gene locus_tag LOCUS_28040 8580 8287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 8693 8617 gene locus_tag LOCUS_t00360 8693 8617 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence136 1439 483 gene locus_tag LOCUS_28050 1439 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 2569 1436 gene locus_tag LOCUS_28060 2569 1436 CDS product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704265.1 protein_id gnl|my_center|LOCUS_28060 3352 2579 gene locus_tag LOCUS_28070 3352 2579 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230914.1 protein_id gnl|my_center|LOCUS_28070 4010 3363 gene locus_tag LOCUS_28080 4010 3363 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434088.1 protein_id gnl|my_center|LOCUS_28080 4683 4015 gene locus_tag LOCUS_28090 4683 4015 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410344.1 protein_id gnl|my_center|LOCUS_28090 5721 4801 gene locus_tag LOCUS_28100 5721 4801 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243508.1 protein_id gnl|my_center|LOCUS_28100 6506 5802 gene locus_tag LOCUS_28110 6506 5802 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978037.1 protein_id gnl|my_center|LOCUS_28110 6725 7102 gene locus_tag LOCUS_28120 6725 7102 CDS product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804105.1 protein_id gnl|my_center|LOCUS_28120 7822 8442 gene locus_tag LOCUS_28130 7822 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 >Feature sequence137 150 254 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1895 744 gene locus_tag LOCUS_28140 1895 744 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_28140 2243 2103 gene locus_tag LOCUS_28150 2243 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 4703 2592 gene locus_tag LOCUS_28160 4703 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 4900 5808 gene locus_tag LOCUS_28170 4900 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 <8520 5874 gene locus_tag LOCUS_28180 <8520 5874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_136193899.1:error-prone DNA polymerase >Feature sequence138 <1 1032 gene locus_tag LOCUS_28190 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257882.1:S41 family peptidase 1127 1199 gene locus_tag LOCUS_t00370 1127 1199 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1583 1227 gene locus_tag LOCUS_28200 1583 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 1765 3222 gene locus_tag LOCUS_28210 1765 3222 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229346.1 protein_id gnl|my_center|LOCUS_28210 4362 3232 gene locus_tag LOCUS_28220 4362 3232 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532953.1 protein_id gnl|my_center|LOCUS_28220 5836 4382 gene locus_tag LOCUS_28230 5836 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 6290 5829 gene locus_tag LOCUS_28240 6290 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 7510 6446 gene locus_tag LOCUS_28250 7510 6446 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975976.1 protein_id gnl|my_center|LOCUS_28250 7696 8103 gene locus_tag LOCUS_28260 7696 8103 CDS product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223272.1 protein_id gnl|my_center|LOCUS_28260 >Feature sequence139 <1 796 gene locus_tag LOCUS_28270 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384741.1:ABC transporter permease 939 986 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 995 1735 gene locus_tag LOCUS_28280 995 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 1732 2946 gene locus_tag LOCUS_28290 1732 2946 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_28290 3045 4721 gene locus_tag LOCUS_28300 3045 4721 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887933.1 protein_id gnl|my_center|LOCUS_28300 4815 5795 gene locus_tag LOCUS_28310 4815 5795 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 protein_id gnl|my_center|LOCUS_28310 5795 6724 gene locus_tag LOCUS_28320 5795 6724 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941313.1 protein_id gnl|my_center|LOCUS_28320 6721 7632 gene locus_tag LOCUS_28330 gene rsmI 6721 7632 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243457.1 protein_id gnl|my_center|LOCUS_28330 >Feature sequence140 332 1543 gene locus_tag LOCUS_28340 332 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 1963 2850 gene locus_tag LOCUS_28350 1963 2850 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192698.1 protein_id gnl|my_center|LOCUS_28350 3132 3725 gene locus_tag LOCUS_28360 3132 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 4739 3924 gene locus_tag LOCUS_28370 4739 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 7006 5435 gene locus_tag LOCUS_28380 7006 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 7530 7003 gene locus_tag LOCUS_28390 7530 7003 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892873.1 protein_id gnl|my_center|LOCUS_28390 >Feature sequence141 <1 1743 gene locus_tag LOCUS_28400 <1 1743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940975.1:carbamoyltransferase HypF 1749 2057 gene locus_tag LOCUS_28410 1749 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 2054 3202 gene locus_tag LOCUS_28420 gene hypD 2054 3202 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_28420 3202 4359 gene locus_tag LOCUS_28430 gene hypE 3202 4359 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909296.1 protein_id gnl|my_center|LOCUS_28430 4556 4942 gene locus_tag LOCUS_28440 4556 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 4954 5367 gene locus_tag LOCUS_28450 4954 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 5426 5653 gene locus_tag LOCUS_28460 gene tusA 5426 5653 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_28460 5704 6201 gene locus_tag LOCUS_28470 5704 6201 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437722.1 protein_id gnl|my_center|LOCUS_28470 6649 6290 gene locus_tag LOCUS_28480 6649 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 7521 6646 gene locus_tag LOCUS_28490 7521 6646 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727947.1 protein_id gnl|my_center|LOCUS_28490 7652 7987 gene locus_tag LOCUS_28500 7652 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 >Feature sequence142 601 416 gene locus_tag LOCUS_28510 601 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 1318 701 gene locus_tag LOCUS_28520 gene recR 1318 701 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_28520 1632 1327 gene locus_tag LOCUS_28530 1632 1327 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391577.1 protein_id gnl|my_center|LOCUS_28530 3598 1883 gene locus_tag LOCUS_28540 3598 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 4165 4078 gene locus_tag LOCUS_t00380 4165 4078 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4846 4364 gene locus_tag LOCUS_28550 gene tadA 4846 4364 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391574.1 protein_id gnl|my_center|LOCUS_28550 5804 4854 gene locus_tag LOCUS_28560 5804 4854 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_28560 5958 7016 gene locus_tag LOCUS_28570 5958 7016 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944691.1 protein_id gnl|my_center|LOCUS_28570 7013 7801 gene locus_tag LOCUS_28580 7013 7801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 >Feature sequence143 327 1493 gene locus_tag LOCUS_28590 327 1493 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183337994.1 protein_id gnl|my_center|LOCUS_28590 1724 2014 gene locus_tag LOCUS_28600 1724 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 2011 2745 gene locus_tag LOCUS_28610 2011 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 2980 2780 gene locus_tag LOCUS_28620 2980 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 4262 3204 gene locus_tag LOCUS_28630 4262 3204 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_28630 4615 5283 gene locus_tag LOCUS_28640 4615 5283 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976241.1 protein_id gnl|my_center|LOCUS_28640 5547 5260 gene locus_tag LOCUS_28650 5547 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 5492 5842 gene locus_tag LOCUS_28660 5492 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 7080 5938 gene locus_tag LOCUS_28670 7080 5938 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227289.1 protein_id gnl|my_center|LOCUS_28670 7502 7056 gene locus_tag LOCUS_28680 7502 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28680 >Feature sequence144 508 122 gene locus_tag LOCUS_28690 508 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 784 527 gene locus_tag LOCUS_28700 784 527 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511315.1 protein_id gnl|my_center|LOCUS_28700 1405 1623 gene locus_tag LOCUS_28710 1405 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 2097 1858 gene locus_tag LOCUS_28720 2097 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 2751 2344 gene locus_tag LOCUS_28730 2751 2344 CDS product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225078.1 protein_id gnl|my_center|LOCUS_28730 3383 3141 gene locus_tag LOCUS_28740 3383 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 3382 4404 gene locus_tag LOCUS_28750 3382 4404 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389746.1 protein_id gnl|my_center|LOCUS_28750 5682 4738 gene locus_tag LOCUS_28760 5682 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 5870 6181 gene locus_tag LOCUS_28770 5870 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 6868 6197 gene locus_tag LOCUS_28780 6868 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 6954 7026 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7058 7273 gene locus_tag LOCUS_28790 7058 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 >Feature sequence145 969 298 gene locus_tag LOCUS_28800 gene tmk 969 298 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250354.1 protein_id gnl|my_center|LOCUS_28800 2757 973 gene locus_tag LOCUS_28810 2757 973 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037762.1 protein_id gnl|my_center|LOCUS_28810 3260 2889 gene locus_tag LOCUS_28820 3260 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 3536 3967 gene locus_tag LOCUS_28830 3536 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 4053 6140 gene locus_tag LOCUS_28840 4053 6140 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_28840 >Feature sequence146 <1 1173 gene locus_tag LOCUS_28850 <1 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731432.1:IS1380-like element ISMsm10 family transposase 2588 1275 gene locus_tag LOCUS_28860 gene ltrA 2588 1275 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561483.1 protein_id gnl|my_center|LOCUS_28860 3513 4733 gene locus_tag LOCUS_28870 3513 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 5117 5395 gene locus_tag LOCUS_28880 5117 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 5388 6707 gene locus_tag LOCUS_28890 5388 6707 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109056605.1 protein_id gnl|my_center|LOCUS_28890 >Feature sequence147 891 418 gene locus_tag LOCUS_28900 891 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 1084 1335 gene locus_tag LOCUS_28910 1084 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 1823 2080 gene locus_tag LOCUS_28920 1823 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 2684 2268 gene locus_tag LOCUS_28930 2684 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 2915 3553 gene locus_tag LOCUS_28940 2915 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 4116 5414 gene locus_tag LOCUS_28950 4116 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 5684 5421 gene locus_tag LOCUS_28960 5684 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 5871 5796 gene locus_tag LOCUS_t00390 5871 5796 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6122 6730 gene locus_tag LOCUS_28970 6122 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 7043 6780 gene locus_tag LOCUS_28980 7043 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 7404 7490 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence148 2072 1044 gene locus_tag LOCUS_28990 2072 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 3086 2223 gene locus_tag LOCUS_29000 3086 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 3466 3215 gene locus_tag LOCUS_29010 3466 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 3745 3660 gene locus_tag LOCUS_t00400 3745 3660 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4483 3869 gene locus_tag LOCUS_29020 4483 3869 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_29020 5299 4532 gene locus_tag LOCUS_29030 5299 4532 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_29030 6300 5296 gene locus_tag LOCUS_29040 6300 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 7526 6297 gene locus_tag LOCUS_29050 7526 6297 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064073.1 protein_id gnl|my_center|LOCUS_29050 >Feature sequence149 3 254 gene locus_tag LOCUS_29060 3 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 483 626 gene locus_tag LOCUS_29070 483 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 967 3144 gene locus_tag LOCUS_29080 967 3144 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284173.1 protein_id gnl|my_center|LOCUS_29080 3141 3329 gene locus_tag LOCUS_29090 3141 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 4474 3302 gene locus_tag LOCUS_29100 4474 3302 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048110.1 protein_id gnl|my_center|LOCUS_29100 4831 5445 gene locus_tag LOCUS_29110 4831 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 5782 6162 gene locus_tag LOCUS_29120 5782 6162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 6245 6601 gene locus_tag LOCUS_29130 6245 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 6903 7211 gene locus_tag LOCUS_29140 6903 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 >Feature sequence150 684 1739 gene locus_tag LOCUS_29150 684 1739 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976006.1 protein_id gnl|my_center|LOCUS_29150 2023 3378 gene locus_tag LOCUS_29160 2023 3378 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972377.1 protein_id gnl|my_center|LOCUS_29160 3455 4420 gene locus_tag LOCUS_29170 3455 4420 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031035.1 protein_id gnl|my_center|LOCUS_29170 4413 5252 gene locus_tag LOCUS_29180 4413 5252 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972375.1 protein_id gnl|my_center|LOCUS_29180 5317 6954 gene locus_tag LOCUS_29190 5317 6954 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457391.1 protein_id gnl|my_center|LOCUS_29190 6665 6685 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence151 136 61 gene locus_tag LOCUS_t00410 136 61 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 249 165 gene locus_tag LOCUS_t00420 249 165 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 380 305 gene locus_tag LOCUS_t00430 380 305 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1768 542 gene locus_tag LOCUS_29200 1768 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 1814 2419 gene locus_tag LOCUS_29210 1814 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 4249 2852 gene locus_tag LOCUS_29220 gene cysS 4249 2852 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570132.1 protein_id gnl|my_center|LOCUS_29220 5598 4246 gene locus_tag LOCUS_29230 5598 4246 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919606.1 protein_id gnl|my_center|LOCUS_29230 6647 5595 gene locus_tag LOCUS_29240 6647 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 <7306 6776 gene locus_tag LOCUS_29250 <7306 6776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393967.1:DNA repair protein RadA >Feature sequence152 646 86 gene locus_tag LOCUS_29260 646 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 620 937 gene locus_tag LOCUS_29270 620 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 1161 949 gene locus_tag LOCUS_29280 1161 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 1245 2129 gene locus_tag LOCUS_29290 1245 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 2786 6304 gene locus_tag LOCUS_29300 2786 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 6579 6628 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence153 1762 539 gene locus_tag LOCUS_29310 gene amrS 1762 539 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942373.1 protein_id gnl|my_center|LOCUS_29310 2166 2453 gene locus_tag LOCUS_29320 2166 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 2450 3694 gene locus_tag LOCUS_29330 2450 3694 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082297.1 protein_id gnl|my_center|LOCUS_29330 3655 4530 gene locus_tag LOCUS_29340 3655 4530 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_29340 4532 5098 gene locus_tag LOCUS_29350 4532 5098 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357379.1 protein_id gnl|my_center|LOCUS_29350 5422 5117 gene locus_tag LOCUS_29360 5422 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 5400 5639 gene locus_tag LOCUS_29370 5400 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 <7052 5877 gene locus_tag LOCUS_29380 <7052 5877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987043.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence154 219 911 gene locus_tag LOCUS_29390 219 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 2105 936 gene locus_tag LOCUS_29400 2105 936 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048110.1 protein_id gnl|my_center|LOCUS_29400 2232 2876 gene locus_tag LOCUS_29410 gene wlbG 2232 2876 CDS product O-antigen biosynthesis protein WlbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038693.1 protein_id gnl|my_center|LOCUS_29410 2873 4777 gene locus_tag LOCUS_29420 2873 4777 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256833.1 protein_id gnl|my_center|LOCUS_29420 4774 6006 gene locus_tag LOCUS_29430 gene pseC 4774 6006 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_29430 <7012 6060 gene locus_tag LOCUS_29440 <7012 6060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947933.1:polysaccharide deacetylase family protein >Feature sequence155 259 1203 gene locus_tag LOCUS_29450 gene cysK 259 1203 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645000.1 protein_id gnl|my_center|LOCUS_29450 1489 1674 gene locus_tag LOCUS_29460 1489 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 2358 1717 gene locus_tag LOCUS_29470 2358 1717 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325942.1 protein_id gnl|my_center|LOCUS_29470 3319 2534 gene locus_tag LOCUS_29480 3319 2534 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 protein_id gnl|my_center|LOCUS_29480 5180 3426 gene locus_tag LOCUS_29490 5180 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 5382 5101 gene locus_tag LOCUS_29500 5382 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 6782 5889 gene locus_tag LOCUS_29510 6782 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 >Feature sequence156 1365 58 gene locus_tag LOCUS_29520 1365 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 2695 1580 gene locus_tag LOCUS_29530 2695 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 2847 3479 gene locus_tag LOCUS_29540 2847 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 3835 4998 gene locus_tag LOCUS_29550 3835 4998 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888818.1 protein_id gnl|my_center|LOCUS_29550 5859 5401 gene locus_tag LOCUS_29560 5859 5401 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228279.1 protein_id gnl|my_center|LOCUS_29560 6200 6841 gene locus_tag LOCUS_29570 6200 6841 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325942.1 protein_id gnl|my_center|LOCUS_29570 >Feature sequence157 <1 618 gene locus_tag LOCUS_29580 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902772.1:1,4-dihydroxy-2-naphthoate polyprenyltransferase 623 1726 gene locus_tag LOCUS_29590 623 1726 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289275.1 protein_id gnl|my_center|LOCUS_29590 1723 4125 gene locus_tag LOCUS_29600 1723 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 4838 4062 gene locus_tag LOCUS_29610 gene hisA 4838 4062 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256251.1 protein_id gnl|my_center|LOCUS_29610 4931 5245 gene locus_tag LOCUS_29620 4931 5245 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393534.1 protein_id gnl|my_center|LOCUS_29620 5242 6102 gene locus_tag LOCUS_29630 gene hisG 5242 6102 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020275.1 protein_id gnl|my_center|LOCUS_29630 >Feature sequence158 800 2194 gene locus_tag LOCUS_29640 800 2194 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_29640 3254 2388 gene locus_tag LOCUS_29650 3254 2388 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651837.1 protein_id gnl|my_center|LOCUS_29650 3657 4361 gene locus_tag LOCUS_29660 3657 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 4883 6268 gene locus_tag LOCUS_29670 gene gltA 4883 6268 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082125.1 protein_id gnl|my_center|LOCUS_29670 >Feature sequence159 168 845 gene locus_tag LOCUS_29680 168 845 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_29680 2046 1528 gene locus_tag LOCUS_29690 2046 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 3181 2636 gene locus_tag LOCUS_29700 3181 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 4322 3717 gene locus_tag LOCUS_29710 4322 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 4722 4315 gene locus_tag LOCUS_29720 4722 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 5105 4725 gene locus_tag LOCUS_29730 5105 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 5993 5442 gene locus_tag LOCUS_29740 5993 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 6542 6766 gene locus_tag LOCUS_29750 6542 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 >Feature sequence160 168 1577 gene locus_tag LOCUS_29760 168 1577 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258857.1 protein_id gnl|my_center|LOCUS_29760 1731 2852 gene locus_tag LOCUS_29770 1731 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 2865 3554 gene locus_tag LOCUS_29780 2865 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 3562 4335 gene locus_tag LOCUS_29790 3562 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 4547 5902 gene locus_tag LOCUS_29800 4547 5902 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257295.1 protein_id gnl|my_center|LOCUS_29800 >Feature sequence161 2242 794 gene locus_tag LOCUS_29810 gene hemY 2242 794 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245394.1 protein_id gnl|my_center|LOCUS_29810 3419 2259 gene locus_tag LOCUS_29820 3419 2259 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046900.1 protein_id gnl|my_center|LOCUS_29820 4218 3448 gene locus_tag LOCUS_29830 4218 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 5391 4315 gene locus_tag LOCUS_29840 gene hemE 5391 4315 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228059.1 protein_id gnl|my_center|LOCUS_29840 <6620 5388 gene locus_tag LOCUS_29850 <6620 5388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140075.1:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence162 310 948 gene locus_tag LOCUS_29860 310 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 2302 1034 gene locus_tag LOCUS_29870 2302 1034 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_29870 2468 3616 gene locus_tag LOCUS_29880 2468 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 3782 4426 gene locus_tag LOCUS_29890 3782 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 4600 4959 gene locus_tag LOCUS_29900 4600 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 <6546 5059 gene locus_tag LOCUS_29910 <6546 5059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339463.1:glucoamylase family protein >Feature sequence163 130 777 gene locus_tag LOCUS_29920 130 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 1070 810 gene locus_tag LOCUS_29930 1070 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 1192 1989 gene locus_tag LOCUS_29940 1192 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 3016 2228 gene locus_tag LOCUS_29950 3016 2228 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_29950 3946 3020 gene locus_tag LOCUS_29960 3946 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 5274 4351 gene locus_tag LOCUS_29970 5274 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 5845 5489 gene locus_tag LOCUS_29980 5845 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 6402 5842 gene locus_tag LOCUS_29990 6402 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 >Feature sequence164 3641 885 gene locus_tag LOCUS_30000 3641 885 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_30000 >Feature sequence165 899 522 gene locus_tag LOCUS_30010 899 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 2797 1442 gene locus_tag LOCUS_30020 2797 1442 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391803.1 protein_id gnl|my_center|LOCUS_30020 3777 2794 gene locus_tag LOCUS_30030 gene rapZ 3777 2794 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391802.1 protein_id gnl|my_center|LOCUS_30030 4039 3824 gene locus_tag LOCUS_30040 4039 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 4989 4009 gene locus_tag LOCUS_30050 gene pyrF 4989 4009 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839147.1 protein_id gnl|my_center|LOCUS_30050 <6502 5024 gene locus_tag LOCUS_30060 <6502 5024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257020.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence166 335 1132 gene locus_tag LOCUS_30070 gene argB 335 1132 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974289.1 protein_id gnl|my_center|LOCUS_30070 1146 1682 gene locus_tag LOCUS_30080 gene argR 1146 1682 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935393.1 protein_id gnl|my_center|LOCUS_30080 1679 2965 gene locus_tag LOCUS_30090 1679 2965 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869501.1 protein_id gnl|my_center|LOCUS_30090 2989 4482 gene locus_tag LOCUS_30100 2989 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 4501 5211 gene locus_tag LOCUS_30110 4501 5211 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_30110 5264 5608 gene locus_tag LOCUS_30120 5264 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 <6437 5626 gene locus_tag LOCUS_30130 <6437 5626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461712.1:ammonium transporter >Feature sequence167 578 390 gene locus_tag LOCUS_30140 578 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 579 631 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1944 1096 gene locus_tag LOCUS_30150 gene menH 1944 1096 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255997.1 protein_id gnl|my_center|LOCUS_30150 3797 1941 gene locus_tag LOCUS_30160 gene menD 3797 1941 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259491.1 protein_id gnl|my_center|LOCUS_30160 5284 3794 gene locus_tag LOCUS_30170 5284 3794 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_30170 5952 5281 gene locus_tag LOCUS_30180 5952 5281 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407700.1 protein_id gnl|my_center|LOCUS_30180 >Feature sequence168 1249 644 gene locus_tag LOCUS_30190 1249 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 3333 1246 gene locus_tag LOCUS_30200 gene hdrA 3333 1246 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_30200 4349 3330 gene locus_tag LOCUS_30210 4349 3330 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_30210 4933 4346 gene locus_tag LOCUS_30220 4933 4346 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392330.1 protein_id gnl|my_center|LOCUS_30220 5794 5297 gene locus_tag LOCUS_30230 5794 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence169 1496 111 gene locus_tag LOCUS_30240 1496 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30240 1950 1390 gene locus_tag LOCUS_30250 1950 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30250 2846 2481 gene locus_tag LOCUS_30260 2846 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 2824 3216 gene locus_tag LOCUS_30270 2824 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 2868 2902 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3437 3180 gene locus_tag LOCUS_30280 3437 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 3580 3510 gene locus_tag LOCUS_t00440 3580 3510 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 5361 3586 gene locus_tag LOCUS_30290 5361 3586 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226836.1 protein_id gnl|my_center|LOCUS_30290 5864 5358 gene locus_tag LOCUS_30300 5864 5358 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258531.1 protein_id gnl|my_center|LOCUS_30300 6093 6137 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence170 1479 562 gene locus_tag LOCUS_30310 1479 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 1972 1472 gene locus_tag LOCUS_30320 1972 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 2582 2034 gene locus_tag LOCUS_30330 2582 2034 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227619.1 protein_id gnl|my_center|LOCUS_30330 3185 4645 gene locus_tag LOCUS_30340 3185 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 4720 5586 gene locus_tag LOCUS_30350 4720 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 >Feature sequence171 626 1735 gene locus_tag LOCUS_30360 626 1735 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226270.1 protein_id gnl|my_center|LOCUS_30360 2034 3452 gene locus_tag LOCUS_30370 2034 3452 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564318.1 protein_id gnl|my_center|LOCUS_30370 3599 4453 gene locus_tag LOCUS_30380 3599 4453 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031035.1 protein_id gnl|my_center|LOCUS_30380 4450 5367 gene locus_tag LOCUS_30390 4450 5367 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972375.1 protein_id gnl|my_center|LOCUS_30390 5516 5839 gene locus_tag LOCUS_30400 5516 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 >Feature sequence172 <1 555 gene locus_tag LOCUS_30410 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000626612.1:ABC transporter ATP-binding protein 617 1333 gene locus_tag LOCUS_30420 617 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 1474 1686 gene locus_tag LOCUS_30430 1474 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 1714 2616 gene locus_tag LOCUS_30440 1714 2616 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921782.1 protein_id gnl|my_center|LOCUS_30440 2973 3458 gene locus_tag LOCUS_30450 2973 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 3504 4820 gene locus_tag LOCUS_30460 3504 4820 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327635.1 protein_id gnl|my_center|LOCUS_30460 5014 5787 gene locus_tag LOCUS_30470 5014 5787 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333519.1 protein_id gnl|my_center|LOCUS_30470 >Feature sequence173 493 1866 gene locus_tag LOCUS_30480 493 1866 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943356.1 protein_id gnl|my_center|LOCUS_30480 1876 4689 gene locus_tag LOCUS_30490 1876 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 4745 5134 gene locus_tag LOCUS_30500 4745 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30500 5382 5600 gene locus_tag LOCUS_30510 5382 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 >Feature sequence174 853 113 gene locus_tag LOCUS_30520 853 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 1911 1102 gene locus_tag LOCUS_30530 1911 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 2921 1908 gene locus_tag LOCUS_30540 2921 1908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229772.1 protein_id gnl|my_center|LOCUS_30540 3214 3972 gene locus_tag LOCUS_30550 3214 3972 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_30550 5820 4285 gene locus_tag LOCUS_30560 5820 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 >Feature sequence175 <1 762 gene locus_tag LOCUS_30570 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004201153.1:pyridoxamine 5'-phosphate oxidase family protein 862 1875 gene locus_tag LOCUS_30580 862 1875 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257726.1 protein_id gnl|my_center|LOCUS_30580 2337 1879 gene locus_tag LOCUS_30590 2337 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 3751 2381 gene locus_tag LOCUS_30600 3751 2381 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_30600 5199 3748 gene locus_tag LOCUS_30610 gene glmU 5199 3748 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929929.1 protein_id gnl|my_center|LOCUS_30610 >Feature sequence176 222 1097 gene locus_tag LOCUS_30620 222 1097 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459478.1 protein_id gnl|my_center|LOCUS_30620 1191 1964 gene locus_tag LOCUS_30630 1191 1964 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776023.1 protein_id gnl|my_center|LOCUS_30630 2195 4306 gene locus_tag LOCUS_30640 2195 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30640 4267 4455 gene locus_tag LOCUS_30650 4267 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30650 4926 4486 gene locus_tag LOCUS_30660 4926 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 >Feature sequence177 1772 156 gene locus_tag LOCUS_30670 1772 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 257 393 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2040 1792 gene locus_tag LOCUS_30680 2040 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 3260 2037 gene locus_tag LOCUS_30690 3260 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 4497 3328 gene locus_tag LOCUS_30700 4497 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 >Feature sequence178 1217 132 gene locus_tag LOCUS_30710 gene tal 1217 132 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 protein_id gnl|my_center|LOCUS_30710 4857 1243 gene locus_tag LOCUS_30720 4857 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 2616 2626 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5380 4916 gene locus_tag LOCUS_30730 5380 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 >Feature sequence179 198 347 gene locus_tag LOCUS_30740 198 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 384 791 gene locus_tag LOCUS_30750 384 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 824 1039 gene locus_tag LOCUS_30760 824 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 1635 1084 gene locus_tag LOCUS_30770 1635 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 2506 2084 gene locus_tag LOCUS_30780 2506 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 2490 2930 gene locus_tag LOCUS_30790 2490 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 3006 3428 gene locus_tag LOCUS_30800 3006 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 3662 4015 gene locus_tag LOCUS_30810 3662 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 4271 5161 gene locus_tag LOCUS_30820 4271 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 >Feature sequence180 769 80 gene locus_tag LOCUS_30830 769 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 1083 766 gene locus_tag LOCUS_30840 1083 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30840 3528 1813 gene locus_tag LOCUS_30850 3528 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 4178 3525 gene locus_tag LOCUS_30860 4178 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 4392 4805 gene locus_tag LOCUS_30870 4392 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 <5313 4691 gene locus_tag LOCUS_30880 <5313 4691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259017.1:helix-turn-helix domain-containing protein >Feature sequence181 1125 1664 gene locus_tag LOCUS_30890 1125 1664 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224991.1 protein_id gnl|my_center|LOCUS_30890 1781 3403 gene locus_tag LOCUS_30900 1781 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 4056 3400 gene locus_tag LOCUS_30910 4056 3400 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_30910 4804 4070 gene locus_tag LOCUS_30920 gene rph 4804 4070 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942439.1 protein_id gnl|my_center|LOCUS_30920 >Feature sequence182 1026 448 gene locus_tag LOCUS_30930 gene dhaL 1026 448 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389114.1 protein_id gnl|my_center|LOCUS_30930 2093 1095 gene locus_tag LOCUS_30940 2093 1095 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389115.1 protein_id gnl|my_center|LOCUS_30940 3673 2168 gene locus_tag LOCUS_30950 gene araA 3673 2168 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226247.1 protein_id gnl|my_center|LOCUS_30950 5068 3794 gene locus_tag LOCUS_30960 5068 3794 CDS product IS256-like element ISRm5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969783.1 protein_id gnl|my_center|LOCUS_30960 >Feature sequence183 445 1857 gene locus_tag LOCUS_30970 gene zwf 445 1857 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974206.1 protein_id gnl|my_center|LOCUS_30970 1854 3167 gene locus_tag LOCUS_30980 1854 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30980 3675 3776 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3840 4316 gene locus_tag LOCUS_30990 3840 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 <4991 4365 gene locus_tag LOCUS_31000 <4991 4365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065180.1:plasma-membrane proton-efflux P-type ATPase >Feature sequence184 565 1977 gene locus_tag LOCUS_31010 565 1977 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140087.1 protein_id gnl|my_center|LOCUS_31010 2081 3373 gene locus_tag LOCUS_31020 2081 3373 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967889.1 protein_id gnl|my_center|LOCUS_31020 3799 3377 gene locus_tag LOCUS_31030 3799 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 4008 3787 gene locus_tag LOCUS_31040 4008 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 4669 4148 gene locus_tag LOCUS_31050 4669 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 >Feature sequence185 315 2240 gene locus_tag LOCUS_31060 315 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 3029 2553 gene locus_tag LOCUS_31070 3029 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 4146 3127 gene locus_tag LOCUS_31080 4146 3127 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 protein_id gnl|my_center|LOCUS_31080 >Feature sequence186 1864 32 gene locus_tag LOCUS_31090 1864 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 2171 1947 gene locus_tag LOCUS_31100 2171 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 3768 2287 gene locus_tag LOCUS_31110 gene gpmI 3768 2287 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257028.1 protein_id gnl|my_center|LOCUS_31110 4643 3876 gene locus_tag LOCUS_31120 gene tpiA 4643 3876 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121241.1 protein_id gnl|my_center|LOCUS_31120 >Feature sequence187 211 1131 gene locus_tag LOCUS_31130 211 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256034.1 protein_id gnl|my_center|LOCUS_31130 1128 2033 gene locus_tag LOCUS_31140 1128 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 2191 2430 gene locus_tag LOCUS_31150 2191 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 2772 3329 gene locus_tag LOCUS_31160 2772 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 3522 4259 gene locus_tag LOCUS_31170 3522 4259 CDS product FAD/NAD-binding family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939633.1 protein_id gnl|my_center|LOCUS_31170 >Feature sequence188 926 363 gene locus_tag LOCUS_31180 926 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 2875 965 gene locus_tag LOCUS_31190 2875 965 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259371.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31190 4015 2915 gene locus_tag LOCUS_31200 4015 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 4383 4012 gene locus_tag LOCUS_31210 4383 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 >Feature sequence189 1940 96 gene locus_tag LOCUS_31220 1940 96 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226836.1 protein_id gnl|my_center|LOCUS_31220 2449 1937 gene locus_tag LOCUS_31230 2449 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 2867 4249 gene locus_tag LOCUS_31240 2867 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 4246 4791 gene locus_tag LOCUS_31250 4246 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 >Feature sequence190 <1 1131 gene locus_tag LOCUS_31260 <1 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943934.1:phosphoglucomutase/phosphomannomutase family protein 1133 1288 gene locus_tag LOCUS_31270 1133 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 1329 1604 gene locus_tag LOCUS_31280 1329 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256705.1 protein_id gnl|my_center|LOCUS_31280 1682 2371 gene locus_tag LOCUS_31290 1682 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 2687 2499 gene locus_tag LOCUS_31300 2687 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 2686 3141 gene locus_tag LOCUS_31310 2686 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 4471 3185 gene locus_tag LOCUS_31320 4471 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 >Feature sequence191 585 3020 gene locus_tag LOCUS_31330 585 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 2962 3741 gene locus_tag LOCUS_31340 2962 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 4100 3762 gene locus_tag LOCUS_31350 4100 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 >Feature sequence192 48 665 gene locus_tag LOCUS_31360 48 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 752 1096 gene locus_tag LOCUS_31370 752 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 1507 2559 gene locus_tag LOCUS_31380 1507 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 3159 2878 gene locus_tag LOCUS_31390 3159 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 3522 3265 gene locus_tag LOCUS_31400 3522 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 >Feature sequence193 <1 846 gene locus_tag LOCUS_31410 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938112.1:molecular chaperone DnaK 2384 771 gene locus_tag LOCUS_31420 2384 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 2565 3524 gene locus_tag LOCUS_31430 2565 3524 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_31430 3584 4339 gene locus_tag LOCUS_31440 3584 4339 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228483.1 protein_id gnl|my_center|LOCUS_31440 >Feature sequence194 568 281 gene locus_tag LOCUS_31450 568 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 828 1766 gene locus_tag LOCUS_31460 828 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 2939 2016 gene locus_tag LOCUS_31470 2939 2016 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31470 3681 3115 gene locus_tag LOCUS_31480 3681 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31480 <4402 3678 gene locus_tag LOCUS_31490 <4402 3678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007056527.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence195 1595 168 gene locus_tag LOCUS_31500 1595 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 315 409 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2595 1477 gene locus_tag LOCUS_31510 2595 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 1671 1704 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4173 2875 gene locus_tag LOCUS_31520 4173 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 >Feature sequence196 886 620 gene locus_tag LOCUS_31530 886 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 2128 929 gene locus_tag LOCUS_31540 gene mnmA 2128 929 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256566.1 protein_id gnl|my_center|LOCUS_31540 3357 2125 gene locus_tag LOCUS_31550 gene nifS 3357 2125 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_31550 3601 3392 gene locus_tag LOCUS_31560 3601 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 3639 3980 gene locus_tag LOCUS_31570 3639 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 >Feature sequence197 253 2004 gene locus_tag LOCUS_31580 253 2004 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887933.1 protein_id gnl|my_center|LOCUS_31580 2124 3128 gene locus_tag LOCUS_31590 2124 3128 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230616.1 protein_id gnl|my_center|LOCUS_31590 >Feature sequence198 145 465 gene locus_tag LOCUS_31600 145 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 633 914 gene locus_tag LOCUS_31610 633 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 2842 1538 gene locus_tag LOCUS_31620 2842 1538 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327635.1 protein_id gnl|my_center|LOCUS_31620 3140 3355 gene locus_tag LOCUS_31630 3140 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 >Feature sequence199 30 644 gene locus_tag LOCUS_31640 gene rplC 30 644 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258231.1 protein_id gnl|my_center|LOCUS_31640 647 1273 gene locus_tag LOCUS_31650 gene rplD 647 1273 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_31650 1270 1572 gene locus_tag LOCUS_31660 gene rplW 1270 1572 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_31660 1574 2407 gene locus_tag LOCUS_31670 gene rplB 1574 2407 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393934.1 protein_id gnl|my_center|LOCUS_31670 2684 3025 gene locus_tag LOCUS_31680 gene rplV 2684 3025 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854297.1 protein_id gnl|my_center|LOCUS_31680 3026 3703 gene locus_tag LOCUS_31690 gene rpsC 3026 3703 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254113.1 protein_id gnl|my_center|LOCUS_31690 >Feature sequence200 3189 1123 gene locus_tag LOCUS_31700 3189 1123 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223434.1 protein_id gnl|my_center|LOCUS_31700 >Feature sequence201 2212 1295 gene locus_tag LOCUS_31710 2212 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 >Feature sequence202 462 199 gene locus_tag LOCUS_31720 462 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 461 1480 gene locus_tag LOCUS_31730 461 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31730 1204 1208 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence203 <1 1254 gene locus_tag LOCUS_31740 <1 1254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003900533.1:phosphatidylinositol mannoside acyltransferase 1251 2267 gene locus_tag LOCUS_31750 1251 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 2264 3145 gene locus_tag LOCUS_31760 2264 3145 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258853.1 protein_id gnl|my_center|LOCUS_31760 3429 3506 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence204 1807 1034 gene locus_tag LOCUS_31770 1807 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 1988 2836 gene locus_tag LOCUS_31780 1988 2836 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729862.1 protein_id gnl|my_center|LOCUS_31780 2639 2659 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2912 3142 gene locus_tag LOCUS_31790 2912 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 >Feature sequence205 361 774 gene locus_tag LOCUS_31800 361 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 1016 2071 gene locus_tag LOCUS_31810 1016 2071 CDS product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943079.1 protein_id gnl|my_center|LOCUS_31810 2608 2078 gene locus_tag LOCUS_31820 2608 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 3538 3014 gene locus_tag LOCUS_31830 3538 3014 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081283.1 protein_id gnl|my_center|LOCUS_31830 >Feature sequence206 689 75 gene locus_tag LOCUS_31840 689 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 136 147 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2572 686 gene locus_tag LOCUS_31850 2572 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 >Feature sequence207 784 353 gene locus_tag LOCUS_31860 784 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 972 1313 gene locus_tag LOCUS_31870 972 1313 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227432.1 protein_id gnl|my_center|LOCUS_31870 1306 2649 gene locus_tag LOCUS_31880 1306 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 2651 2920 gene locus_tag LOCUS_31890 2651 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 >Feature sequence208 <1 1160 gene locus_tag LOCUS_31900 <1 1160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256762.1:DNA-directed RNA polymerase subunit beta' 1594 2022 gene locus_tag LOCUS_31910 gene rpsL 1594 2022 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_31910 2025 2492 gene locus_tag LOCUS_31920 gene rpsG 2025 2492 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385326.1 protein_id gnl|my_center|LOCUS_31920 >Feature sequence209 >Feature sequence210 351 1190 gene locus_tag LOCUS_31930 351 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 1283 1786 gene locus_tag LOCUS_31940 1283 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 1925 2893 gene locus_tag LOCUS_31950 1925 2893 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128975761.1 protein_id gnl|my_center|LOCUS_31950 >Feature sequence211 <1 510 gene locus_tag LOCUS_31960 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014497734.1:tyrosine-type recombinase/integrase 751 1386 gene locus_tag LOCUS_31970 751 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 1452 1700 gene locus_tag LOCUS_31980 1452 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 >Feature sequence212 205 1818 gene locus_tag LOCUS_31990 205 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31990 1733 1996 gene locus_tag LOCUS_32000 1733 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 >Feature sequence213 3 572 gene locus_tag LOCUS_32010 3 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 919 1869 gene locus_tag LOCUS_32020 919 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 2555 1917 gene locus_tag LOCUS_32030 2555 1917 CDS product DUF4389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409492.1 protein_id gnl|my_center|LOCUS_32030 >Feature sequence214 129 512 gene locus_tag LOCUS_32040 129 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 527 814 gene locus_tag LOCUS_32050 527 814 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089416.1 protein_id gnl|my_center|LOCUS_32050 970 1428 gene locus_tag LOCUS_32060 970 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 >Feature sequence215 146 253 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1379 1630 gene locus_tag LOCUS_32070 1379 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32070 1546 1914 gene locus_tag LOCUS_32080 1546 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32080 1874 3280 gene locus_tag LOCUS_32090 1874 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32090 >Feature sequence216 208 1137 gene locus_tag LOCUS_32100 208 1137 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_32100 1258 1998 gene locus_tag LOCUS_32110 1258 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32110 2038 3072 gene locus_tag LOCUS_32120 2038 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32120 >Feature sequence217 440 1660 gene locus_tag LOCUS_32130 440 1660 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228372.1 protein_id gnl|my_center|LOCUS_32130 1971 2975 gene locus_tag LOCUS_32140 gene xerC 1971 2975 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392542.1 protein_id gnl|my_center|LOCUS_32140 >Feature sequence218 592 1542 gene locus_tag LOCUS_32150 592 1542 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228777.1 protein_id gnl|my_center|LOCUS_32150 2625 1687 gene locus_tag LOCUS_32160 2625 1687 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257279.1 protein_id gnl|my_center|LOCUS_32160 2711 2950 gene locus_tag LOCUS_32170 2711 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 >Feature sequence219 97 999 gene locus_tag LOCUS_32180 97 999 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 protein_id gnl|my_center|LOCUS_32180 1219 1866 gene locus_tag LOCUS_32190 1219 1866 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582625.1 protein_id gnl|my_center|LOCUS_32190 >Feature sequence220 1682 219 gene locus_tag LOCUS_32200 1682 219 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228372.1 protein_id gnl|my_center|LOCUS_32200 2253 3125 gene locus_tag LOCUS_32210 2253 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 >Feature sequence221 189 710 gene locus_tag LOCUS_32220 189 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 1829 966 gene locus_tag LOCUS_32230 1829 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 2018 2329 gene locus_tag LOCUS_32240 2018 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 2344 2595 gene locus_tag LOCUS_32250 2344 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 >Feature sequence222 1532 1002 gene locus_tag LOCUS_32260 1532 1002 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257073.1 protein_id gnl|my_center|LOCUS_32260 2245 1529 gene locus_tag LOCUS_32270 gene hoxU 2245 1529 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943355.1 protein_id gnl|my_center|LOCUS_32270 <3039 2242 gene locus_tag LOCUS_32280 <3039 2242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583284.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence223 1 585 gene locus_tag LOCUS_32290 1 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 582 2024 gene locus_tag LOCUS_32300 gene sufD 582 2024 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_32300 2101 2385 gene locus_tag LOCUS_32310 2101 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 >Feature sequence224 <1 1107 gene locus_tag LOCUS_32320 <1 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250733.1:serpin family protein 1637 1969 gene locus_tag LOCUS_32330 1637 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 <3011 2124 gene locus_tag LOCUS_32340 <3011 2124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533215.1:Nramp family divalent metal transporter >Feature sequence225 158 1042 gene locus_tag LOCUS_32350 158 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 1075 2073 gene locus_tag LOCUS_32360 1075 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 2070 2276 gene locus_tag LOCUS_32370 2070 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 >Feature sequence226 903 148 gene locus_tag LOCUS_32380 903 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 2164 1688 gene locus_tag LOCUS_32390 2164 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 2525 2779 gene locus_tag LOCUS_32400 2525 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 >Feature sequence227 1337 513 gene locus_tag LOCUS_32410 1337 513 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_32410 2107 1622 gene locus_tag LOCUS_32420 2107 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 >Feature sequence228 1460 852 gene locus_tag LOCUS_32430 1460 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 1720 2802 gene locus_tag LOCUS_32440 1720 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 >Feature sequence229 475 903 gene locus_tag LOCUS_32450 475 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 2114 1068 gene locus_tag LOCUS_32460 2114 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 >Feature sequence230 1576 479 gene locus_tag LOCUS_32470 1576 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 2161 2799 gene locus_tag LOCUS_32480 2161 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 >Feature sequence231 <1 1868 gene locus_tag LOCUS_32490 <1 1868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_119948893.1:thioredoxin domain-containing protein 476 500 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2063 2440 gene locus_tag LOCUS_32500 2063 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 >Feature sequence232 1717 128 gene locus_tag LOCUS_32510 1717 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 2253 1714 gene locus_tag LOCUS_32520 gene sigL 2253 1714 CDS product sigma-70 family RNA polymerase sigma factor SigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403731.1 protein_id gnl|my_center|LOCUS_32520 >Feature sequence233 178 1035 gene locus_tag LOCUS_32530 178 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 899 926 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 972 1313 gene locus_tag LOCUS_32540 972 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 2030 1353 gene locus_tag LOCUS_32550 2030 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 2431 1991 gene locus_tag LOCUS_32560 2431 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 >Feature sequence234 929 534 gene locus_tag LOCUS_32570 929 534 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256810.1 protein_id gnl|my_center|LOCUS_32570 1402 926 gene locus_tag LOCUS_32580 1402 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 1563 2660 gene locus_tag LOCUS_32590 1563 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 >Feature sequence235 609 379 gene locus_tag LOCUS_32600 609 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 1671 634 gene locus_tag LOCUS_32610 1671 634 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731187.1 protein_id gnl|my_center|LOCUS_32610 <2682 1885 gene locus_tag LOCUS_32620 <2682 1885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003816050.1:ABC transporter substrate-binding protein >Feature sequence236 815 2608 gene locus_tag LOCUS_32630 815 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 >Feature sequence237 424 77 gene locus_tag LOCUS_32640 424 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 956 666 gene locus_tag LOCUS_32650 956 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 1594 1202 gene locus_tag LOCUS_32660 1594 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 2591 1998 gene locus_tag LOCUS_32670 2591 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 >Feature sequence238 707 39 gene locus_tag LOCUS_32680 707 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 1420 710 gene locus_tag LOCUS_32690 1420 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 1922 1461 gene locus_tag LOCUS_32700 1922 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 >Feature sequence239 >Feature sequence240 2463 1303 gene locus_tag LOCUS_32710 2463 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 >Feature sequence241 336 127 gene locus_tag LOCUS_32720 336 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 938 651 gene locus_tag LOCUS_32730 938 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 1387 2181 gene locus_tag LOCUS_32740 1387 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 >Feature sequence242 2 283 gene locus_tag LOCUS_32750 2 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 463 1209 gene locus_tag LOCUS_32760 463 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 1510 1247 gene locus_tag LOCUS_32770 1510 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 1718 2155 gene locus_tag LOCUS_32780 1718 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 >Feature sequence243 529 915 gene locus_tag LOCUS_32790 529 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 1134 1679 gene locus_tag LOCUS_32800 1134 1679 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943161.1 protein_id gnl|my_center|LOCUS_32800 1859 2272 gene locus_tag LOCUS_32810 1859 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 >Feature sequence244 168 276 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 738 1382 gene locus_tag LOCUS_32820 738 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 1560 2336 gene locus_tag LOCUS_32830 1560 2336 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965070.1 protein_id gnl|my_center|LOCUS_32830 >Feature sequence245 <1 1203 gene locus_tag LOCUS_32840 <1 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082399.1:glycosyl transferase >Feature sequence246 438 190 gene locus_tag LOCUS_32850 438 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 1724 435 gene locus_tag LOCUS_32860 1724 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 <2515 1612 gene locus_tag LOCUS_32870 <2515 1612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003894107.1:recombinase RecA >Feature sequence247 240 806 gene locus_tag LOCUS_32880 240 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 1990 941 gene locus_tag LOCUS_32890 1990 941 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120539.1 protein_id gnl|my_center|LOCUS_32890