>Feature sequence001 31 684 gene locus_tag LOCUS_00010 31 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 748 2001 gene locus_tag LOCUS_00020 748 2001 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113206.1 protein_id gnl|my_center|LOCUS_00020 2065 2892 gene locus_tag LOCUS_00030 2065 2892 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099535.1 protein_id gnl|my_center|LOCUS_00030 2905 4371 gene locus_tag LOCUS_00040 gene gabD 2905 4371 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 protein_id gnl|my_center|LOCUS_00040 4529 5809 gene locus_tag LOCUS_00050 gene gabT 4529 5809 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401617.1 protein_id gnl|my_center|LOCUS_00050 5913 6587 gene locus_tag LOCUS_00060 gene rpe 5913 6587 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085122.1 protein_id gnl|my_center|LOCUS_00060 6584 7285 gene locus_tag LOCUS_00070 6584 7285 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113205.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00070 7466 8950 gene locus_tag LOCUS_00080 gene trpE 7466 8950 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113204.1 protein_id gnl|my_center|LOCUS_00080 9138 10406 gene locus_tag LOCUS_00090 9138 10406 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772650.1 protein_id gnl|my_center|LOCUS_00090 11058 10432 gene locus_tag LOCUS_00100 11058 10432 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038252.1 protein_id gnl|my_center|LOCUS_00100 11237 11458 gene locus_tag LOCUS_00110 11237 11458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13258 11477 gene locus_tag LOCUS_00120 gene mobH 13258 11477 CDS product MobH family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038851.1 protein_id gnl|my_center|LOCUS_00120 14448 13528 gene locus_tag LOCUS_00130 14448 13528 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038852.1 protein_id gnl|my_center|LOCUS_00130 15058 14441 gene locus_tag LOCUS_00140 15058 14441 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199747194.1 protein_id gnl|my_center|LOCUS_00140 14963 15151 gene locus_tag LOCUS_00150 14963 15151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15552 15869 gene locus_tag LOCUS_00160 15552 15869 CDS product type II toxin-antitoxin system PrlF family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212347691.1 protein_id gnl|my_center|LOCUS_00160 15869 16333 gene locus_tag LOCUS_00170 15869 16333 CDS product type II toxin-antitoxin system YhaV family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037275395.1 protein_id gnl|my_center|LOCUS_00170 16357 16716 gene locus_tag LOCUS_00180 16357 16716 CDS product DUF3742 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041106822.1 protein_id gnl|my_center|LOCUS_00180 17220 16744 gene locus_tag LOCUS_00190 17220 16744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00190 18263 17232 gene locus_tag LOCUS_00200 18263 17232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00200 18626 18282 gene locus_tag LOCUS_00210 18626 18282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 20035 18623 gene locus_tag LOCUS_00220 20035 18623 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038856.1 protein_id gnl|my_center|LOCUS_00220 20984 20046 gene locus_tag LOCUS_00230 20984 20046 CDS product TIGR03756 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038857.1 protein_id gnl|my_center|LOCUS_00230 21412 20981 gene locus_tag LOCUS_00240 21412 20981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 22139 21690 gene locus_tag LOCUS_00250 22139 21690 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201060.1 protein_id gnl|my_center|LOCUS_00250 22803 22204 gene locus_tag LOCUS_00260 22803 22204 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090288.1 protein_id gnl|my_center|LOCUS_00260 24185 22815 gene locus_tag LOCUS_00270 gene chrA 24185 22815 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_00270 25105 24182 gene locus_tag LOCUS_00280 25105 24182 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196334.1 protein_id gnl|my_center|LOCUS_00280 25820 25320 gene locus_tag LOCUS_00290 25820 25320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 26777 26028 gene locus_tag LOCUS_00300 26777 26028 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038859.1 protein_id gnl|my_center|LOCUS_00300 29673 26791 gene locus_tag LOCUS_00310 29673 26791 CDS product conjugative transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038860.1 protein_id gnl|my_center|LOCUS_00310 30108 29674 gene locus_tag LOCUS_00320 30108 29674 CDS product TIGR03751 family conjugal transfer lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038861.1 protein_id gnl|my_center|LOCUS_00320 31507 30089 gene locus_tag LOCUS_00330 31507 30089 CDS product TIGR03752 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038862.1 protein_id gnl|my_center|LOCUS_00330 32384 31497 gene locus_tag LOCUS_00340 32384 31497 CDS product TIGR03749 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011805409.1 protein_id gnl|my_center|LOCUS_00340 33064 32396 gene locus_tag LOCUS_00350 33064 32396 CDS product TIGR03746 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203388111.1 protein_id gnl|my_center|LOCUS_00350 33459 33061 gene locus_tag LOCUS_00360 33459 33061 CDS product TIGR03750 family conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267025.1 protein_id gnl|my_center|LOCUS_00360 33841 33473 gene locus_tag LOCUS_00370 33841 33473 CDS product TIGR03745 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003294215.1 protein_id gnl|my_center|LOCUS_00370 34093 33860 gene locus_tag LOCUS_00380 34093 33860 CDS product TIGR03758 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267027.1 protein_id gnl|my_center|LOCUS_00380 34440 34090 gene locus_tag LOCUS_00390 34440 34090 CDS product RAQPRD family integrative conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317499.1 protein_id gnl|my_center|LOCUS_00390 36290 34551 gene locus_tag LOCUS_00400 36290 34551 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289508.1 protein_id gnl|my_center|LOCUS_00400 38352 36283 gene locus_tag LOCUS_00410 38352 36283 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547409.1 protein_id gnl|my_center|LOCUS_00410 39207 38458 gene locus_tag LOCUS_00420 39207 38458 CDS product TIGR03747 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038879.1 protein_id gnl|my_center|LOCUS_00420 41369 39204 gene locus_tag LOCUS_00430 gene traD 41369 39204 CDS product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038880.1 protein_id gnl|my_center|LOCUS_00430 41907 41371 gene locus_tag LOCUS_00440 41907 41371 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038881.1 protein_id gnl|my_center|LOCUS_00440 42476 41904 gene locus_tag LOCUS_00450 42476 41904 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038882.1 protein_id gnl|my_center|LOCUS_00450 43204 42473 gene locus_tag LOCUS_00460 43204 42473 CDS product TIGR03759 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038883.1 protein_id gnl|my_center|LOCUS_00460 43873 43214 gene locus_tag LOCUS_00470 43873 43214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038884.1 protein_id gnl|my_center|LOCUS_00470 44376 43870 gene locus_tag LOCUS_00480 44376 43870 CDS product PilL N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024537152.1 protein_id gnl|my_center|LOCUS_00480 45738 44524 gene locus_tag LOCUS_00490 45738 44524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 48107 45837 gene locus_tag LOCUS_00500 48107 45837 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165797420.1 protein_id gnl|my_center|LOCUS_00500 48457 48212 gene locus_tag LOCUS_00510 48457 48212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024889622.1 protein_id gnl|my_center|LOCUS_00510 49718 48609 gene locus_tag LOCUS_00520 49718 48609 CDS product DUF6094 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104230471.1 protein_id gnl|my_center|LOCUS_00520 50410 49787 gene locus_tag LOCUS_00530 50410 49787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267038.1 protein_id gnl|my_center|LOCUS_00530 51584 50757 gene locus_tag LOCUS_00540 51584 50757 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101824524.1 protein_id gnl|my_center|LOCUS_00540 51997 51737 gene locus_tag LOCUS_00550 51997 51737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 52394 52014 gene locus_tag LOCUS_00560 52394 52014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 53096 52485 gene locus_tag LOCUS_00570 53096 52485 CDS product DUF3275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038889.1 protein_id gnl|my_center|LOCUS_00570 53728 53198 gene locus_tag LOCUS_00580 53728 53198 CDS product STY4534 family ICE replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267041.1 protein_id gnl|my_center|LOCUS_00580 54819 54094 gene locus_tag LOCUS_00590 54819 54094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038892.1 protein_id gnl|my_center|LOCUS_00590 55318 54926 gene locus_tag LOCUS_00600 55318 54926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003141051.1 protein_id gnl|my_center|LOCUS_00600 55585 55352 gene locus_tag LOCUS_00610 55585 55352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958171.1 protein_id gnl|my_center|LOCUS_00610 58401 56386 gene locus_tag LOCUS_00620 58401 56386 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038895.1 protein_id gnl|my_center|LOCUS_00620 59294 58545 gene locus_tag LOCUS_00630 59294 58545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 59223 59462 gene locus_tag LOCUS_00640 59223 59462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 60386 59604 gene locus_tag LOCUS_00650 60386 59604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 60999 60601 gene locus_tag LOCUS_00660 60999 60601 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013721963.1 protein_id gnl|my_center|LOCUS_00660 61547 60996 gene locus_tag LOCUS_00670 61547 60996 CDS product DUF3158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895541.1 protein_id gnl|my_center|LOCUS_00670 62350 61544 gene locus_tag LOCUS_00680 62350 61544 CDS product TIGR03761 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038897.1 protein_id gnl|my_center|LOCUS_00680 62695 63435 gene locus_tag LOCUS_00690 62695 63435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 64640 63432 gene locus_tag LOCUS_00700 64640 63432 CDS product STY4528 family pathogenicity island replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136258754.1 protein_id gnl|my_center|LOCUS_00700 65204 64644 gene locus_tag LOCUS_00710 65204 64644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 66942 65221 gene locus_tag LOCUS_00720 66942 65221 CDS product ParB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150625513.1 protein_id gnl|my_center|LOCUS_00720 67192 66935 gene locus_tag LOCUS_00730 67192 66935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 68040 67189 gene locus_tag LOCUS_00740 68040 67189 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018076212.1 protein_id gnl|my_center|LOCUS_00740 68303 68085 gene locus_tag LOCUS_00750 68303 68085 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205185.1 protein_id gnl|my_center|LOCUS_00750 69003 68413 gene locus_tag LOCUS_00760 69003 68413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036990101.1 protein_id gnl|my_center|LOCUS_00760 70760 69861 gene locus_tag LOCUS_00770 70760 69861 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213173803.1 protein_id gnl|my_center|LOCUS_00770 71066 71464 gene locus_tag LOCUS_00780 71066 71464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 71624 72460 gene locus_tag LOCUS_00790 71624 72460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 72597 73844 gene locus_tag LOCUS_00800 72597 73844 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920567.1 protein_id gnl|my_center|LOCUS_00800 73841 75076 gene locus_tag LOCUS_00810 73841 75076 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920247.1 protein_id gnl|my_center|LOCUS_00810 75087 78227 gene locus_tag LOCUS_00820 75087 78227 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 protein_id gnl|my_center|LOCUS_00820 78388 79068 gene locus_tag LOCUS_00830 78388 79068 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970465.1 protein_id gnl|my_center|LOCUS_00830 79091 79714 gene locus_tag LOCUS_00840 79091 79714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 protein_id gnl|my_center|LOCUS_00840 79849 80073 gene locus_tag LOCUS_00850 79849 80073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 80173 81501 gene locus_tag LOCUS_00860 80173 81501 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967861.1 protein_id gnl|my_center|LOCUS_00860 82193 82792 gene locus_tag LOCUS_00870 82193 82792 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767895.1 protein_id gnl|my_center|LOCUS_00870 82792 83838 gene locus_tag LOCUS_00880 gene trpD 82792 83838 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085203.1 protein_id gnl|my_center|LOCUS_00880 83835 84671 gene locus_tag LOCUS_00890 gene trpC 83835 84671 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269105.1 protein_id gnl|my_center|LOCUS_00890 85178 84714 gene locus_tag LOCUS_00900 85178 84714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 85569 85991 gene locus_tag LOCUS_00910 85569 85991 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767887.1 protein_id gnl|my_center|LOCUS_00910 87054 86407 gene locus_tag LOCUS_00920 gene coq7 87054 86407 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085224.1 protein_id gnl|my_center|LOCUS_00920 87462 87121 gene locus_tag LOCUS_00930 87462 87121 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085225.1 protein_id gnl|my_center|LOCUS_00930 87539 89017 gene locus_tag LOCUS_00940 87539 89017 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113173.1 protein_id gnl|my_center|LOCUS_00940 89929 89027 gene locus_tag LOCUS_00950 89929 89027 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113171.1 protein_id gnl|my_center|LOCUS_00950 90540 90112 gene locus_tag LOCUS_00960 gene hemJ 90540 90112 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_00960 90671 91705 gene locus_tag LOCUS_00970 gene argC 90671 91705 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113169.1 protein_id gnl|my_center|LOCUS_00970 91819 92169 gene locus_tag LOCUS_00980 gene erpA 91819 92169 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551953.1 protein_id gnl|my_center|LOCUS_00980 >Feature sequence002 <1 820 gene locus_tag LOCUS_00990 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383177.1:MFS transporter 1370 867 gene locus_tag LOCUS_01000 1370 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 2094 1552 gene locus_tag LOCUS_01010 2094 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 2294 2989 gene locus_tag LOCUS_01020 2294 2989 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531178.1 protein_id gnl|my_center|LOCUS_01020 3555 3145 gene locus_tag LOCUS_01030 3555 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 3736 4437 gene locus_tag LOCUS_01040 3736 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 4448 4705 gene locus_tag LOCUS_01050 4448 4705 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889331.1 protein_id gnl|my_center|LOCUS_01050 4880 5752 gene locus_tag LOCUS_01060 gene kdsA 4880 5752 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532215.1 protein_id gnl|my_center|LOCUS_01060 7674 5803 gene locus_tag LOCUS_01070 gene mobH 7674 5803 CDS product MobH family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038851.1 protein_id gnl|my_center|LOCUS_01070 7991 8617 gene locus_tag LOCUS_01080 7991 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 8630 9262 gene locus_tag LOCUS_01090 8630 9262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 9347 9712 gene locus_tag LOCUS_01100 9347 9712 CDS product DUF3742 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041106822.1 protein_id gnl|my_center|LOCUS_01100 11244 9724 gene locus_tag LOCUS_01110 11244 9724 CDS product conjugal transfer protein TraG N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066267399.1 protein_id gnl|my_center|LOCUS_01110 11631 11260 gene locus_tag LOCUS_01120 11631 11260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 13025 11628 gene locus_tag LOCUS_01130 13025 11628 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066267402.1 protein_id gnl|my_center|LOCUS_01130 13982 13035 gene locus_tag LOCUS_01140 13982 13035 CDS product TIGR03756 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038857.1 protein_id gnl|my_center|LOCUS_01140 14425 13979 gene locus_tag LOCUS_01150 14425 13979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 15082 14588 gene locus_tag LOCUS_01160 15082 14588 CDS product RadC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098171.1 protein_id gnl|my_center|LOCUS_01160 16050 15265 gene locus_tag LOCUS_01170 16050 15265 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038859.1 protein_id gnl|my_center|LOCUS_01170 18940 16064 gene locus_tag LOCUS_01180 18940 16064 CDS product conjugative transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038860.1 protein_id gnl|my_center|LOCUS_01180 19380 18940 gene locus_tag LOCUS_01190 19380 18940 CDS product TIGR03751 family conjugal transfer lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038861.1 protein_id gnl|my_center|LOCUS_01190 20779 19361 gene locus_tag LOCUS_01200 20779 19361 CDS product TIGR03752 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038862.1 protein_id gnl|my_center|LOCUS_01200 21686 20769 gene locus_tag LOCUS_01210 21686 20769 CDS product TIGR03749 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011805409.1 protein_id gnl|my_center|LOCUS_01210 22375 21683 gene locus_tag LOCUS_01220 22375 21683 CDS product TIGR03746 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203388111.1 protein_id gnl|my_center|LOCUS_01220 22782 22372 gene locus_tag LOCUS_01230 22782 22372 CDS product TIGR03750 family conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267025.1 protein_id gnl|my_center|LOCUS_01230 23154 22795 gene locus_tag LOCUS_01240 23154 22795 CDS product TIGR03745 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003294215.1 protein_id gnl|my_center|LOCUS_01240 23404 23171 gene locus_tag LOCUS_01250 23404 23171 CDS product TIGR03758 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267027.1 protein_id gnl|my_center|LOCUS_01250 23781 23401 gene locus_tag LOCUS_01260 23781 23401 CDS product RAQPRD family integrative conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103322.1 protein_id gnl|my_center|LOCUS_01260 24635 24919 gene locus_tag LOCUS_01270 24635 24919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 25727 24966 gene locus_tag LOCUS_01280 25727 24966 CDS product TIGR03747 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038879.1 protein_id gnl|my_center|LOCUS_01280 27916 25724 gene locus_tag LOCUS_01290 gene traD 27916 25724 CDS product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038880.1 protein_id gnl|my_center|LOCUS_01290 28460 27921 gene locus_tag LOCUS_01300 28460 27921 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038881.1 protein_id gnl|my_center|LOCUS_01300 29047 28457 gene locus_tag LOCUS_01310 29047 28457 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038882.1 protein_id gnl|my_center|LOCUS_01310 29754 29029 gene locus_tag LOCUS_01320 29754 29029 CDS product TIGR03759 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038883.1 protein_id gnl|my_center|LOCUS_01320 30410 29769 gene locus_tag LOCUS_01330 30410 29769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 31006 30407 gene locus_tag LOCUS_01340 31006 30407 CDS product PilL N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024537152.1 protein_id gnl|my_center|LOCUS_01340 32034 31165 gene locus_tag LOCUS_01350 32034 31165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 34427 32148 gene locus_tag LOCUS_01360 34427 32148 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165797420.1 protein_id gnl|my_center|LOCUS_01360 34841 34530 gene locus_tag LOCUS_01370 34841 34530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024889622.1 protein_id gnl|my_center|LOCUS_01370 36093 34945 gene locus_tag LOCUS_01380 36093 34945 CDS product DUF6094 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104230471.1 protein_id gnl|my_center|LOCUS_01380 36769 36119 gene locus_tag LOCUS_01390 36769 36119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267038.1 protein_id gnl|my_center|LOCUS_01390 37106 36846 gene locus_tag LOCUS_01400 37106 36846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 37530 37123 gene locus_tag LOCUS_01410 37530 37123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 37954 37631 gene locus_tag LOCUS_01420 37954 37631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 38738 38049 gene locus_tag LOCUS_01430 38738 38049 CDS product DUF3275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038889.1 protein_id gnl|my_center|LOCUS_01430 39713 38796 gene locus_tag LOCUS_01440 39713 38796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 40428 40075 gene locus_tag LOCUS_01450 40428 40075 CDS product DUF3085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097141722.1 protein_id gnl|my_center|LOCUS_01450 41310 40507 gene locus_tag LOCUS_01460 41310 40507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054019012.1 protein_id gnl|my_center|LOCUS_01460 41873 41595 gene locus_tag LOCUS_01470 41873 41595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 42705 41968 gene locus_tag LOCUS_01480 42705 41968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038892.1 protein_id gnl|my_center|LOCUS_01480 43472 42786 gene locus_tag LOCUS_01490 43472 42786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 44008 43616 gene locus_tag LOCUS_01500 44008 43616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003141051.1 protein_id gnl|my_center|LOCUS_01500 44255 44031 gene locus_tag LOCUS_01510 44255 44031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958171.1 protein_id gnl|my_center|LOCUS_01510 45143 44586 gene locus_tag LOCUS_01520 45143 44586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 46985 45387 gene locus_tag LOCUS_01530 46985 45387 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186448606.1 protein_id gnl|my_center|LOCUS_01530 49547 47523 gene locus_tag LOCUS_01540 49547 47523 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038895.1 protein_id gnl|my_center|LOCUS_01540 50274 49822 gene locus_tag LOCUS_01550 50274 49822 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013721963.1 protein_id gnl|my_center|LOCUS_01550 50875 50348 gene locus_tag LOCUS_01560 50875 50348 CDS product DUF3158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895541.1 protein_id gnl|my_center|LOCUS_01560 51645 50872 gene locus_tag LOCUS_01570 51645 50872 CDS product TIGR03761 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038897.1 protein_id gnl|my_center|LOCUS_01570 53223 51961 gene locus_tag LOCUS_01580 53223 51961 CDS product STY4528 family pathogenicity island replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136258754.1 protein_id gnl|my_center|LOCUS_01580 53786 53226 gene locus_tag LOCUS_01590 53786 53226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 55439 53802 gene locus_tag LOCUS_01600 55439 53802 CDS product ParB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150625513.1 protein_id gnl|my_center|LOCUS_01600 55680 55432 gene locus_tag LOCUS_01610 55680 55432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 56539 55664 gene locus_tag LOCUS_01620 56539 55664 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018076212.1 protein_id gnl|my_center|LOCUS_01620 56794 56582 gene locus_tag LOCUS_01630 56794 56582 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205185.1 protein_id gnl|my_center|LOCUS_01630 57362 56913 gene locus_tag LOCUS_01640 57362 56913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 57297 57548 gene locus_tag LOCUS_01650 57297 57548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 57573 57827 gene locus_tag LOCUS_01660 57573 57827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 59131 58841 gene locus_tag LOCUS_01670 59131 58841 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258399.1 protein_id gnl|my_center|LOCUS_01670 59319 59636 gene locus_tag LOCUS_01680 59319 59636 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298602.1 protein_id gnl|my_center|LOCUS_01680 59633 60067 gene locus_tag LOCUS_01690 59633 60067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064705.1 protein_id gnl|my_center|LOCUS_01690 60070 60489 gene locus_tag LOCUS_01700 60070 60489 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 protein_id gnl|my_center|LOCUS_01700 60503 60703 gene locus_tag LOCUS_01710 60503 60703 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_01710 61147 60767 gene locus_tag LOCUS_01720 61147 60767 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969103.1 protein_id gnl|my_center|LOCUS_01720 62922 61144 gene locus_tag LOCUS_01730 62922 61144 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_01730 64667 62919 gene locus_tag LOCUS_01740 64667 62919 CDS product bifunctional protein tyrosine phosphatase family protein/NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527135.1 protein_id gnl|my_center|LOCUS_01740 65555 64692 gene locus_tag LOCUS_01750 65555 64692 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_01750 66448 65717 gene locus_tag LOCUS_01760 gene lolD 66448 65717 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812422.1 protein_id gnl|my_center|LOCUS_01760 67661 66441 gene locus_tag LOCUS_01770 67661 66441 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963567.1 protein_id gnl|my_center|LOCUS_01770 68850 67666 gene locus_tag LOCUS_01780 68850 67666 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494103.1 protein_id gnl|my_center|LOCUS_01780 69035 69967 gene locus_tag LOCUS_01790 69035 69967 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930758.1 protein_id gnl|my_center|LOCUS_01790 <70498 69972 gene locus_tag LOCUS_01800 <70498 69972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003083090.1:flagellar motor protein MotD >Feature sequence003 628 131 gene locus_tag LOCUS_01810 628 131 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092262.1 protein_id gnl|my_center|LOCUS_01810 1848 736 gene locus_tag LOCUS_01820 1848 736 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185303.1 protein_id gnl|my_center|LOCUS_01820 2316 4895 gene locus_tag LOCUS_01830 gene mutS 2316 4895 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113873.1 protein_id gnl|my_center|LOCUS_01830 5017 5340 gene locus_tag LOCUS_01840 5017 5340 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 protein_id gnl|my_center|LOCUS_01840 5597 5406 gene locus_tag LOCUS_01850 5597 5406 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085193.1 protein_id gnl|my_center|LOCUS_01850 6677 5685 gene locus_tag LOCUS_01860 6677 5685 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093885.1 protein_id gnl|my_center|LOCUS_01860 7435 6674 gene locus_tag LOCUS_01870 7435 6674 CDS product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112786.1 protein_id gnl|my_center|LOCUS_01870 8543 7428 gene locus_tag LOCUS_01880 8543 7428 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101181.1 protein_id gnl|my_center|LOCUS_01880 9575 8700 gene locus_tag LOCUS_01890 9575 8700 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090797.1 protein_id gnl|my_center|LOCUS_01890 10680 9646 gene locus_tag LOCUS_01900 10680 9646 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113130.1 protein_id gnl|my_center|LOCUS_01900 11800 10760 gene locus_tag LOCUS_01910 11800 10760 CDS product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113129.1 protein_id gnl|my_center|LOCUS_01910 12266 11919 gene locus_tag LOCUS_01920 12266 11919 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104861.1 protein_id gnl|my_center|LOCUS_01920 13573 12344 gene locus_tag LOCUS_01930 13573 12344 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619903.1 protein_id gnl|my_center|LOCUS_01930 14550 13861 gene locus_tag LOCUS_01940 gene urtE 14550 13861 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767488.1 protein_id gnl|my_center|LOCUS_01940 15415 14657 gene locus_tag LOCUS_01950 gene urtD 15415 14657 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104862.1 protein_id gnl|my_center|LOCUS_01950 16602 15412 gene locus_tag LOCUS_01960 gene urtC 16602 15412 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104863.1 protein_id gnl|my_center|LOCUS_01960 17531 16614 gene locus_tag LOCUS_01970 gene urtB 17531 16614 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044393615.1 protein_id gnl|my_center|LOCUS_01970 18836 17595 gene locus_tag LOCUS_01980 gene urtA 18836 17595 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767480.1 protein_id gnl|my_center|LOCUS_01980 19161 22568 gene locus_tag LOCUS_01990 19161 22568 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044393613.1 protein_id gnl|my_center|LOCUS_01990 22555 23223 gene locus_tag LOCUS_02000 22555 23223 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104866.1 protein_id gnl|my_center|LOCUS_02000 23365 23598 gene locus_tag LOCUS_02010 23365 23598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 23861 24835 gene locus_tag LOCUS_02020 23861 24835 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_02020 25218 26768 gene locus_tag LOCUS_02030 25218 26768 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817287.1 protein_id gnl|my_center|LOCUS_02030 28034 26850 gene locus_tag LOCUS_02040 gene pobA 28034 26850 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112685.1 protein_id gnl|my_center|LOCUS_02040 28197 29075 gene locus_tag LOCUS_02050 28197 29075 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084097.1 protein_id gnl|my_center|LOCUS_02050 29624 29079 gene locus_tag LOCUS_02060 29624 29079 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109279.1 protein_id gnl|my_center|LOCUS_02060 29724 31202 gene locus_tag LOCUS_02070 29724 31202 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112356.1 protein_id gnl|my_center|LOCUS_02070 31348 31270 gene locus_tag LOCUS_t00010 31348 31270 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 31473 32876 gene locus_tag LOCUS_02080 31473 32876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 32873 33394 gene locus_tag LOCUS_02090 32873 33394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 33497 33772 gene locus_tag LOCUS_02100 33497 33772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 33772 34077 gene locus_tag LOCUS_02110 33772 34077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 34227 35102 gene locus_tag LOCUS_02120 34227 35102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 35102 36730 gene locus_tag LOCUS_02130 35102 36730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 37048 37338 gene locus_tag LOCUS_02140 37048 37338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 37816 37607 gene locus_tag LOCUS_02150 37816 37607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 42202 39164 gene locus_tag LOCUS_02160 42202 39164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 44457 42202 gene locus_tag LOCUS_02170 44457 42202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 45218 44454 gene locus_tag LOCUS_02180 45218 44454 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252511.1 protein_id gnl|my_center|LOCUS_02180 47563 45218 gene locus_tag LOCUS_02190 gene zorA 47563 45218 CDS product anti-phage ZorAB system protein ZorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132365.1 protein_id gnl|my_center|LOCUS_02190 48695 47610 gene locus_tag LOCUS_02200 48695 47610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 50295 48712 gene locus_tag LOCUS_02210 50295 48712 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100193.1 protein_id gnl|my_center|LOCUS_02210 51260 50292 gene locus_tag LOCUS_02220 gene rhuM 51260 50292 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_02220 52723 51257 gene locus_tag LOCUS_02230 52723 51257 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939433.1 protein_id gnl|my_center|LOCUS_02230 54018 52726 gene locus_tag LOCUS_02240 54018 52726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 56462 54099 gene locus_tag LOCUS_02250 56462 54099 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_02250 57387 56740 gene locus_tag LOCUS_02260 57387 56740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 57993 57676 gene locus_tag LOCUS_02270 57993 57676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 58174 58099 gene locus_tag LOCUS_t00020 58174 58099 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence004 7 1080 gene locus_tag LOCUS_02280 7 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 1083 1601 gene locus_tag LOCUS_02290 gene cobU 1083 1601 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082599.1 protein_id gnl|my_center|LOCUS_02290 1601 2650 gene locus_tag LOCUS_02300 gene cobT 1601 2650 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112354.1 protein_id gnl|my_center|LOCUS_02300 2647 3225 gene locus_tag LOCUS_02310 2647 3225 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_02310 3235 3972 gene locus_tag LOCUS_02320 3235 3972 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086787.1 protein_id gnl|my_center|LOCUS_02320 4384 4052 gene locus_tag LOCUS_02330 gene grxD 4384 4052 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120913.1 protein_id gnl|my_center|LOCUS_02330 4748 4389 gene locus_tag LOCUS_02340 gene glpE 4748 4389 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694416.1 protein_id gnl|my_center|LOCUS_02340 5302 4745 gene locus_tag LOCUS_02350 5302 4745 CDS product nitrogen fixation protein NifQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565963.1 protein_id gnl|my_center|LOCUS_02350 5638 5558 gene locus_tag LOCUS_t00030 5638 5558 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6034 5756 gene locus_tag LOCUS_02360 6034 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 7554 6046 gene locus_tag LOCUS_02370 gene nifB 7554 6046 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084568.1 protein_id gnl|my_center|LOCUS_02370 8176 7778 gene locus_tag LOCUS_02380 8176 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 8066 8377 gene locus_tag LOCUS_02390 8066 8377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 8281 8703 gene locus_tag LOCUS_02400 8281 8703 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114391.1 protein_id gnl|my_center|LOCUS_02400 9654 8731 gene locus_tag LOCUS_02410 9654 8731 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024697938.1 protein_id gnl|my_center|LOCUS_02410 9797 10198 gene locus_tag LOCUS_02420 9797 10198 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101334.1 protein_id gnl|my_center|LOCUS_02420 10904 10305 gene locus_tag LOCUS_02430 10904 10305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02430 11077 10829 gene locus_tag LOCUS_02440 11077 10829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02440 11264 12475 gene locus_tag LOCUS_02450 11264 12475 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267172.1 protein_id gnl|my_center|LOCUS_02450 14093 12528 gene locus_tag LOCUS_02460 14093 12528 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880089.1 protein_id gnl|my_center|LOCUS_02460 15657 14107 gene locus_tag LOCUS_02470 15657 14107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 16084 16656 gene locus_tag LOCUS_02480 gene rsxA 16084 16656 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723764.1 protein_id gnl|my_center|LOCUS_02480 16694 17218 gene locus_tag LOCUS_02490 16694 17218 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339116.1 protein_id gnl|my_center|LOCUS_02490 17261 18724 gene locus_tag LOCUS_02500 gene rsxC 17261 18724 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339117.1 protein_id gnl|my_center|LOCUS_02500 18721 19821 gene locus_tag LOCUS_02510 18721 19821 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339118.1 protein_id gnl|my_center|LOCUS_02510 19818 20492 gene locus_tag LOCUS_02520 gene rsxG 19818 20492 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339119.1 protein_id gnl|my_center|LOCUS_02520 20489 21208 gene locus_tag LOCUS_02530 20489 21208 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561393.1 protein_id gnl|my_center|LOCUS_02530 21232 21492 gene locus_tag LOCUS_02540 21232 21492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 21533 22264 gene locus_tag LOCUS_02550 21533 22264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 22261 22659 gene locus_tag LOCUS_02560 22261 22659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389789.1 protein_id gnl|my_center|LOCUS_02560 23584 23015 gene locus_tag LOCUS_02570 23584 23015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 24457 23606 gene locus_tag LOCUS_02580 24457 23606 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388754.1 protein_id gnl|my_center|LOCUS_02580 24874 25755 gene locus_tag LOCUS_02590 gene nifH 24874 25755 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943447.1 protein_id gnl|my_center|LOCUS_02590 25867 27348 gene locus_tag LOCUS_02600 gene nifD 25867 27348 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084552.1 protein_id gnl|my_center|LOCUS_02600 27451 29022 gene locus_tag LOCUS_02610 gene nifK 27451 29022 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084553.1 protein_id gnl|my_center|LOCUS_02610 29114 29335 gene locus_tag LOCUS_02620 29114 29335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 29339 30073 gene locus_tag LOCUS_02630 29339 30073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 30070 30339 gene locus_tag LOCUS_02640 30070 30339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 30349 31080 gene locus_tag LOCUS_02650 30349 31080 CDS product 4Fe4S-binding leucine-rich repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338306.1 protein_id gnl|my_center|LOCUS_02650 31492 32913 gene locus_tag LOCUS_02660 gene nifE 31492 32913 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857642.1 protein_id gnl|my_center|LOCUS_02660 32924 34300 gene locus_tag LOCUS_02670 gene nifN 32924 34300 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389940.1 protein_id gnl|my_center|LOCUS_02670 34304 34783 gene locus_tag LOCUS_02680 gene nifX 34304 34783 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545689.1 protein_id gnl|my_center|LOCUS_02680 34812 35291 gene locus_tag LOCUS_02690 34812 35291 CDS product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533485.1 protein_id gnl|my_center|LOCUS_02690 35306 35515 gene locus_tag LOCUS_02700 35306 35515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 35598 35894 gene locus_tag LOCUS_02710 gene fdxB 35598 35894 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720698.1 protein_id gnl|my_center|LOCUS_02710 35907 36227 gene locus_tag LOCUS_02720 35907 36227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 36231 36728 gene locus_tag LOCUS_02730 36231 36728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 36728 37102 gene locus_tag LOCUS_02740 36728 37102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 37095 37847 gene locus_tag LOCUS_02750 37095 37847 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392938.1 protein_id gnl|my_center|LOCUS_02750 37844 38218 gene locus_tag LOCUS_02760 37844 38218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 38573 38355 gene locus_tag LOCUS_02770 38573 38355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 39833 38736 gene locus_tag LOCUS_02780 gene modC 39833 38736 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098212.1 protein_id gnl|my_center|LOCUS_02780 40526 39846 gene locus_tag LOCUS_02790 gene modB 40526 39846 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_02790 41285 40533 gene locus_tag LOCUS_02800 gene modA 41285 40533 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_02800 42103 41297 gene locus_tag LOCUS_02810 42103 41297 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818535.1 protein_id gnl|my_center|LOCUS_02810 42491 42814 gene locus_tag LOCUS_02820 42491 42814 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565964.1 protein_id gnl|my_center|LOCUS_02820 42876 43826 gene locus_tag LOCUS_02830 gene nifU 42876 43826 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_02830 43828 45036 gene locus_tag LOCUS_02840 gene nifS 43828 45036 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_02840 45077 46222 gene locus_tag LOCUS_02850 gene nifV 45077 46222 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 protein_id gnl|my_center|LOCUS_02850 46219 46962 gene locus_tag LOCUS_02860 gene cysE 46219 46962 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_02860 46975 47514 gene locus_tag LOCUS_02870 46975 47514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 47511 47858 gene locus_tag LOCUS_02880 47511 47858 CDS product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389923.1 protein_id gnl|my_center|LOCUS_02880 47878 48348 gene locus_tag LOCUS_02890 47878 48348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 48338 49216 gene locus_tag LOCUS_02900 48338 49216 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941029.1 protein_id gnl|my_center|LOCUS_02900 49213 50529 gene locus_tag LOCUS_02910 gene clpX 49213 50529 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880858.1 protein_id gnl|my_center|LOCUS_02910 50729 51271 gene locus_tag LOCUS_02920 gene fldA 50729 51271 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018622.1 protein_id gnl|my_center|LOCUS_02920 51458 52006 gene locus_tag LOCUS_02930 51458 52006 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082631.1 protein_id gnl|my_center|LOCUS_02930 <53235 52053 gene locus_tag LOCUS_02940 <53235 52053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046463934.1:outer membrane protein transport protein >Feature sequence005 2005 1751 gene locus_tag LOCUS_02950 2005 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 2502 2879 gene locus_tag LOCUS_02960 2502 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 4833 3097 gene locus_tag LOCUS_02970 4833 3097 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528531.1 protein_id gnl|my_center|LOCUS_02970 5869 4922 gene locus_tag LOCUS_02980 5869 4922 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975888.1 protein_id gnl|my_center|LOCUS_02980 7538 5931 gene locus_tag LOCUS_02990 7538 5931 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969590.1 protein_id gnl|my_center|LOCUS_02990 8484 7558 gene locus_tag LOCUS_03000 8484 7558 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723881.1 protein_id gnl|my_center|LOCUS_03000 9332 8484 gene locus_tag LOCUS_03010 9332 8484 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311615.1 protein_id gnl|my_center|LOCUS_03010 9931 9329 gene locus_tag LOCUS_03020 9931 9329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 11067 9928 gene locus_tag LOCUS_03030 11067 9928 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969594.1 protein_id gnl|my_center|LOCUS_03030 12192 14276 gene locus_tag LOCUS_03040 12192 14276 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091102695.1 protein_id gnl|my_center|LOCUS_03040 14289 15641 gene locus_tag LOCUS_03050 14289 15641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 15638 16318 gene locus_tag LOCUS_03060 15638 16318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 16315 20739 gene locus_tag LOCUS_03070 gene mukB 16315 20739 CDS product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572729.1 protein_id gnl|my_center|LOCUS_03070 20739 21725 gene locus_tag LOCUS_03080 20739 21725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 21978 21748 gene locus_tag LOCUS_03090 21978 21748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 23188 22160 gene locus_tag LOCUS_03100 23188 22160 CDS product IS30-like element ISCfr4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204525119.1 protein_id gnl|my_center|LOCUS_03100 23233 24495 gene locus_tag LOCUS_03110 23233 24495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 24589 25305 gene locus_tag LOCUS_03120 24589 25305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03120 25253 25798 gene locus_tag LOCUS_03130 25253 25798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03130 25780 26007 gene locus_tag LOCUS_03140 25780 26007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03140 27792 26233 gene locus_tag LOCUS_03150 27792 26233 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087330.1 protein_id gnl|my_center|LOCUS_03150 29262 27934 gene locus_tag LOCUS_03160 29262 27934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 31180 29282 gene locus_tag LOCUS_03170 31180 29282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 33690 31222 gene locus_tag LOCUS_03180 33690 31222 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104717.1 protein_id gnl|my_center|LOCUS_03180 34727 33702 gene locus_tag LOCUS_03190 34727 33702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 36762 35071 gene locus_tag LOCUS_03200 36762 35071 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206221.1 protein_id gnl|my_center|LOCUS_03200 37179 37448 gene locus_tag LOCUS_03210 37179 37448 CDS product phenol 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206219.1 protein_id gnl|my_center|LOCUS_03210 37497 38492 gene locus_tag LOCUS_03220 37497 38492 CDS product aromatic/alkene monooxygenase hydroxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206218.1 protein_id gnl|my_center|LOCUS_03220 38496 38768 gene locus_tag LOCUS_03230 38496 38768 CDS product MmoB/DmpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049448.1 protein_id gnl|my_center|LOCUS_03230 38780 40333 gene locus_tag LOCUS_03240 38780 40333 CDS product aromatic/alkene/methane monooxygenase hydroxylase/oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206217.1 protein_id gnl|my_center|LOCUS_03240 40401 40760 gene locus_tag LOCUS_03250 40401 40760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 40771 41832 gene locus_tag LOCUS_03260 40771 41832 CDS product phenol 2-monooxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206216.1 protein_id gnl|my_center|LOCUS_03260 41841 42179 gene locus_tag LOCUS_03270 41841 42179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 42176 43099 gene locus_tag LOCUS_03280 42176 43099 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086600.1 protein_id gnl|my_center|LOCUS_03280 43136 44596 gene locus_tag LOCUS_03290 43136 44596 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_03290 44604 45452 gene locus_tag LOCUS_03300 44604 45452 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257237.1 protein_id gnl|my_center|LOCUS_03300 45476 46249 gene locus_tag LOCUS_03310 45476 46249 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_03310 46265 47203 gene locus_tag LOCUS_03320 gene mhpF 46265 47203 CDS product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044321.1 protein_id gnl|my_center|LOCUS_03320 47215 48249 gene locus_tag LOCUS_03330 gene dmpG 47215 48249 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013499.1 protein_id gnl|my_center|LOCUS_03330 48249 49043 gene locus_tag LOCUS_03340 48249 49043 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_03340 49094 49285 gene locus_tag LOCUS_03350 49094 49285 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723612.1 protein_id gnl|my_center|LOCUS_03350 49772 50332 gene locus_tag LOCUS_03360 49772 50332 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147567.1 protein_id gnl|my_center|LOCUS_03360 >Feature sequence006 352 2313 gene locus_tag LOCUS_03370 352 2313 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097695.1 protein_id gnl|my_center|LOCUS_03370 5306 2322 gene locus_tag LOCUS_03380 5306 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 5522 7519 gene locus_tag LOCUS_03390 5522 7519 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895565.1 protein_id gnl|my_center|LOCUS_03390 9237 7516 gene locus_tag LOCUS_03400 9237 7516 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 protein_id gnl|my_center|LOCUS_03400 10113 9301 gene locus_tag LOCUS_03410 10113 9301 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965820.1 protein_id gnl|my_center|LOCUS_03410 10663 10280 gene locus_tag LOCUS_03420 gene nirD 10663 10280 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268220.1 protein_id gnl|my_center|LOCUS_03420 13221 10663 gene locus_tag LOCUS_03430 gene nirB 13221 10663 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268219.1 protein_id gnl|my_center|LOCUS_03430 14370 13612 gene locus_tag LOCUS_03440 14370 13612 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112491.1 protein_id gnl|my_center|LOCUS_03440 14577 15905 gene locus_tag LOCUS_03450 gene hemN 14577 15905 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 protein_id gnl|my_center|LOCUS_03450 17405 15912 gene locus_tag LOCUS_03460 17405 15912 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236858.1 protein_id gnl|my_center|LOCUS_03460 18722 17457 gene locus_tag LOCUS_03470 18722 17457 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266739.1 protein_id gnl|my_center|LOCUS_03470 19524 18709 gene locus_tag LOCUS_03480 19524 18709 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406949.1 protein_id gnl|my_center|LOCUS_03480 20768 19521 gene locus_tag LOCUS_03490 20768 19521 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_03490 21538 20771 gene locus_tag LOCUS_03500 21538 20771 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768839.1 protein_id gnl|my_center|LOCUS_03500 21963 21535 gene locus_tag LOCUS_03510 21963 21535 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736559.1 protein_id gnl|my_center|LOCUS_03510 23390 21960 gene locus_tag LOCUS_03520 gene phrB 23390 21960 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768836.1 protein_id gnl|my_center|LOCUS_03520 24322 23387 gene locus_tag LOCUS_03530 24322 23387 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266744.1 protein_id gnl|my_center|LOCUS_03530 25284 24325 gene locus_tag LOCUS_03540 25284 24325 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406942.1 protein_id gnl|my_center|LOCUS_03540 25614 26516 gene locus_tag LOCUS_03550 25614 26516 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266746.1 protein_id gnl|my_center|LOCUS_03550 26592 27617 gene locus_tag LOCUS_03560 gene hemH 26592 27617 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406934.1 protein_id gnl|my_center|LOCUS_03560 30320 27660 gene locus_tag LOCUS_03570 30320 27660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 30937 30497 gene locus_tag LOCUS_03580 30937 30497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 31537 31022 gene locus_tag LOCUS_03590 31537 31022 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104051.1 protein_id gnl|my_center|LOCUS_03590 32781 31546 gene locus_tag LOCUS_03600 32781 31546 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_03600 33299 32778 gene locus_tag LOCUS_03610 33299 32778 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104050.1 protein_id gnl|my_center|LOCUS_03610 33659 33309 gene locus_tag LOCUS_03620 gene folX 33659 33309 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091897.1 protein_id gnl|my_center|LOCUS_03620 34237 33680 gene locus_tag LOCUS_03630 gene folE 34237 33680 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346200.1 protein_id gnl|my_center|LOCUS_03630 34747 34397 gene locus_tag LOCUS_03640 34747 34397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 34840 35787 gene locus_tag LOCUS_03650 34840 35787 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094990.1 protein_id gnl|my_center|LOCUS_03650 35822 38353 gene locus_tag LOCUS_03660 gene pqqF 35822 38353 CDS product pyrroloquinoline quinone biosynthesis protein PqqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443183.1 protein_id gnl|my_center|LOCUS_03660 38611 39798 gene locus_tag LOCUS_03670 38611 39798 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107001.1 protein_id gnl|my_center|LOCUS_03670 40133 41275 gene locus_tag LOCUS_03680 40133 41275 CDS product FIST signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106998.1 protein_id gnl|my_center|LOCUS_03680 41244 43844 gene locus_tag LOCUS_03690 41244 43844 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895594.1 protein_id gnl|my_center|LOCUS_03690 44888 43884 gene locus_tag LOCUS_03700 44888 43884 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268267.1 protein_id gnl|my_center|LOCUS_03700 45956 44973 gene locus_tag LOCUS_03710 45956 44973 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268266.1 protein_id gnl|my_center|LOCUS_03710 46285 45953 gene locus_tag LOCUS_03720 46285 45953 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268265.1 protein_id gnl|my_center|LOCUS_03720 46584 46282 gene locus_tag LOCUS_03730 gene tusB 46584 46282 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090391.1 protein_id gnl|my_center|LOCUS_03730 46943 46584 gene locus_tag LOCUS_03740 gene tusC 46943 46584 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090389.1 protein_id gnl|my_center|LOCUS_03740 47335 46943 gene locus_tag LOCUS_03750 gene tusD 47335 46943 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090387.1 protein_id gnl|my_center|LOCUS_03750 47551 48819 gene locus_tag LOCUS_03760 47551 48819 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770220.1 protein_id gnl|my_center|LOCUS_03760 49587 48919 gene locus_tag LOCUS_03770 49587 48919 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090386.1 protein_id gnl|my_center|LOCUS_03770 49716 49805 gene locus_tag LOCUS_t00040 49716 49805 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 50067 50339 gene locus_tag LOCUS_03780 50067 50339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 >Feature sequence007 438 1349 gene locus_tag LOCUS_03790 gene yegS 438 1349 CDS product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091230.1 protein_id gnl|my_center|LOCUS_03790 1462 2394 gene locus_tag LOCUS_03800 1462 2394 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378076.1 protein_id gnl|my_center|LOCUS_03800 2473 3270 gene locus_tag LOCUS_03810 2473 3270 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113973.1 protein_id gnl|my_center|LOCUS_03810 5238 3316 gene locus_tag LOCUS_03820 5238 3316 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268340.1 protein_id gnl|my_center|LOCUS_03820 5532 7448 gene locus_tag LOCUS_03830 5532 7448 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_03830 7603 8295 gene locus_tag LOCUS_03840 7603 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091213.1 protein_id gnl|my_center|LOCUS_03840 8780 8340 gene locus_tag LOCUS_03850 8780 8340 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091210.1 protein_id gnl|my_center|LOCUS_03850 9007 9474 gene locus_tag LOCUS_03860 9007 9474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086834.1 protein_id gnl|my_center|LOCUS_03860 9519 10301 gene locus_tag LOCUS_03870 9519 10301 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619831.1 protein_id gnl|my_center|LOCUS_03870 10295 10810 gene locus_tag LOCUS_03880 10295 10810 CDS product DUF2937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082681.1 protein_id gnl|my_center|LOCUS_03880 12041 10863 gene locus_tag LOCUS_03890 12041 10863 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101527.1 protein_id gnl|my_center|LOCUS_03890 12489 12085 gene locus_tag LOCUS_03900 12489 12085 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101529.1 protein_id gnl|my_center|LOCUS_03900 13390 12542 gene locus_tag LOCUS_03910 13390 12542 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090571.1 protein_id gnl|my_center|LOCUS_03910 14606 13536 gene locus_tag LOCUS_03920 14606 13536 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090572.1 protein_id gnl|my_center|LOCUS_03920 14731 15705 gene locus_tag LOCUS_03930 gene cysK 14731 15705 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090573.1 protein_id gnl|my_center|LOCUS_03930 16648 15731 gene locus_tag LOCUS_03940 16648 15731 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705854.1 protein_id gnl|my_center|LOCUS_03940 16753 18495 gene locus_tag LOCUS_03950 gene aceK 16753 18495 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112397.1 protein_id gnl|my_center|LOCUS_03950 19496 18825 gene locus_tag LOCUS_03960 19496 18825 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 protein_id gnl|my_center|LOCUS_03960 19584 20162 gene locus_tag LOCUS_03970 19584 20162 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082973.1 protein_id gnl|my_center|LOCUS_03970 20628 20209 gene locus_tag LOCUS_03980 20628 20209 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268622.1 protein_id gnl|my_center|LOCUS_03980 21398 20811 gene locus_tag LOCUS_03990 21398 20811 CDS product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767637.1 protein_id gnl|my_center|LOCUS_03990 21568 23691 gene locus_tag LOCUS_04000 gene recQ 21568 23691 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245677.1 protein_id gnl|my_center|LOCUS_04000 23873 24304 gene locus_tag LOCUS_04010 23873 24304 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363288.1 protein_id gnl|my_center|LOCUS_04010 26403 24301 gene locus_tag LOCUS_04020 gene plpD 26403 24301 CDS product patatin-like phospholipase PlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_04020 26559 26840 gene locus_tag LOCUS_04030 26559 26840 CDS product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091717.1 protein_id gnl|my_center|LOCUS_04030 27740 26865 gene locus_tag LOCUS_04040 27740 26865 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114815.1 protein_id gnl|my_center|LOCUS_04040 28622 27864 gene locus_tag LOCUS_04050 28622 27864 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114816.1 protein_id gnl|my_center|LOCUS_04050 30082 28694 gene locus_tag LOCUS_04060 30082 28694 CDS product protein CyaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124349.1 protein_id gnl|my_center|LOCUS_04060 30660 30343 gene locus_tag LOCUS_04070 30660 30343 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114819.1 protein_id gnl|my_center|LOCUS_04070 30781 31794 gene locus_tag LOCUS_04080 30781 31794 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_04080 31861 32793 gene locus_tag LOCUS_04090 31861 32793 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 protein_id gnl|my_center|LOCUS_04090 34245 32794 gene locus_tag LOCUS_04100 34245 32794 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268527.1 protein_id gnl|my_center|LOCUS_04100 34531 34806 gene locus_tag LOCUS_04110 34531 34806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 34898 35461 gene locus_tag LOCUS_04120 34898 35461 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_04120 36813 35455 gene locus_tag LOCUS_04130 36813 35455 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103711.1 protein_id gnl|my_center|LOCUS_04130 37317 36904 gene locus_tag LOCUS_04140 37317 36904 CDS product Spy/CpxP family protein refolding chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114831.1 protein_id gnl|my_center|LOCUS_04140 38152 37475 gene locus_tag LOCUS_04150 38152 37475 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396544.1 protein_id gnl|my_center|LOCUS_04150 38543 38166 gene locus_tag LOCUS_04160 38543 38166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 38916 38617 gene locus_tag LOCUS_04170 38916 38617 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091489.1 protein_id gnl|my_center|LOCUS_04170 39256 40122 gene locus_tag LOCUS_04180 39256 40122 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767709.1 protein_id gnl|my_center|LOCUS_04180 40136 40759 gene locus_tag LOCUS_04190 40136 40759 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_04190 40959 42173 gene locus_tag LOCUS_04200 40959 42173 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_04200 42201 43019 gene locus_tag LOCUS_04210 42201 43019 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404131.1 protein_id gnl|my_center|LOCUS_04210 43039 43806 gene locus_tag LOCUS_04220 gene scpB 43039 43806 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767714.1 protein_id gnl|my_center|LOCUS_04220 43979 45808 gene locus_tag LOCUS_04230 gene edd 43979 45808 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406660.1 protein_id gnl|my_center|LOCUS_04230 45805 46767 gene locus_tag LOCUS_04240 45805 46767 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764052.1 protein_id gnl|my_center|LOCUS_04240 46825 47559 gene locus_tag LOCUS_04250 gene gltR 46825 47559 CDS product two-component system response regulator GltR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091475.1 protein_id gnl|my_center|LOCUS_04250 47543 48994 gene locus_tag LOCUS_04260 47543 48994 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197678549.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence008 1097 249 gene locus_tag LOCUS_04270 1097 249 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096656.1 protein_id gnl|my_center|LOCUS_04270 3536 1386 gene locus_tag LOCUS_04280 gene glgX 3536 1386 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268142.1 protein_id gnl|my_center|LOCUS_04280 3974 3636 gene locus_tag LOCUS_04290 3974 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 6781 3971 gene locus_tag LOCUS_04300 6781 3971 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104397.1 protein_id gnl|my_center|LOCUS_04300 8853 6778 gene locus_tag LOCUS_04310 gene malQ 8853 6778 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268139.1 protein_id gnl|my_center|LOCUS_04310 10622 8850 gene locus_tag LOCUS_04320 gene treZ 10622 8850 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268138.1 protein_id gnl|my_center|LOCUS_04320 12185 10635 gene locus_tag LOCUS_04330 gene glgA 12185 10635 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766223.1 protein_id gnl|my_center|LOCUS_04330 12484 12990 gene locus_tag LOCUS_04340 12484 12990 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147560.1 protein_id gnl|my_center|LOCUS_04340 14106 12994 gene locus_tag LOCUS_04350 14106 12994 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193577.1 protein_id gnl|my_center|LOCUS_04350 14310 14840 gene locus_tag LOCUS_04360 14310 14840 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113674.1 protein_id gnl|my_center|LOCUS_04360 14948 15232 gene locus_tag LOCUS_04370 14948 15232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 15514 15239 gene locus_tag LOCUS_04380 15514 15239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 15799 16095 gene locus_tag LOCUS_04390 15799 16095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 16124 18679 gene locus_tag LOCUS_04400 gene ligD 16124 18679 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113639.1 protein_id gnl|my_center|LOCUS_04400 18742 20544 gene locus_tag LOCUS_04410 18742 20544 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530887.1 protein_id gnl|my_center|LOCUS_04410 21590 20577 gene locus_tag LOCUS_04420 21590 20577 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036279.1 protein_id gnl|my_center|LOCUS_04420 23202 21727 gene locus_tag LOCUS_04430 23202 21727 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254372.1 protein_id gnl|my_center|LOCUS_04430 23618 24667 gene locus_tag LOCUS_04440 23618 24667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 24945 24709 gene locus_tag LOCUS_04450 24945 24709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 26160 25225 gene locus_tag LOCUS_04460 26160 25225 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895497.1 protein_id gnl|my_center|LOCUS_04460 27647 26160 gene locus_tag LOCUS_04470 27647 26160 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039234.1 protein_id gnl|my_center|LOCUS_04470 28510 27611 gene locus_tag LOCUS_04480 28510 27611 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275480.1 protein_id gnl|my_center|LOCUS_04480 28717 28514 gene locus_tag LOCUS_04490 28717 28514 CDS product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057042.1 protein_id gnl|my_center|LOCUS_04490 30753 28714 gene locus_tag LOCUS_04500 30753 28714 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463355.1 protein_id gnl|my_center|LOCUS_04500 30902 31786 gene locus_tag LOCUS_04510 30902 31786 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704314.1 protein_id gnl|my_center|LOCUS_04510 32351 32803 gene locus_tag LOCUS_04520 32351 32803 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391482.1 protein_id gnl|my_center|LOCUS_04520 34547 33156 gene locus_tag LOCUS_04530 34547 33156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 38672 35037 gene locus_tag LOCUS_04540 38672 35037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 39267 38809 gene locus_tag LOCUS_04550 39267 38809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 41566 39260 gene locus_tag LOCUS_04560 41566 39260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 43055 41559 gene locus_tag LOCUS_04570 43055 41559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 >Feature sequence009 3207 190 gene locus_tag LOCUS_04580 3207 190 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064929.1 protein_id gnl|my_center|LOCUS_04580 4942 3299 gene locus_tag LOCUS_04590 4942 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 6315 4942 gene locus_tag LOCUS_04600 6315 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 8707 6308 gene locus_tag LOCUS_04610 8707 6308 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350101.1 protein_id gnl|my_center|LOCUS_04610 9146 8862 gene locus_tag LOCUS_04620 9146 8862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 10318 9158 gene locus_tag LOCUS_04630 10318 9158 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063648.1 protein_id gnl|my_center|LOCUS_04630 10544 10311 gene locus_tag LOCUS_04640 10544 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 10694 10906 gene locus_tag LOCUS_04650 10694 10906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 14050 10925 gene locus_tag LOCUS_04660 14050 10925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 15378 14047 gene locus_tag LOCUS_04670 15378 14047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 16970 16491 gene locus_tag LOCUS_04680 16970 16491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 17674 17273 gene locus_tag LOCUS_04690 17674 17273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 17835 17671 gene locus_tag LOCUS_04700 17835 17671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 18001 18555 gene locus_tag LOCUS_04710 18001 18555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 19213 18989 gene locus_tag LOCUS_04720 19213 18989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 19618 19337 gene locus_tag LOCUS_04730 19618 19337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 20521 19916 gene locus_tag LOCUS_04740 20521 19916 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526832.1 protein_id gnl|my_center|LOCUS_04740 20787 20524 gene locus_tag LOCUS_04750 20787 20524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 21080 20793 gene locus_tag LOCUS_04760 21080 20793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 22118 21585 gene locus_tag LOCUS_04770 22118 21585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 23383 22115 gene locus_tag LOCUS_04780 gene ltrA 23383 22115 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022749.1 protein_id gnl|my_center|LOCUS_04780 24415 23876 gene locus_tag LOCUS_04790 24415 23876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 26606 26043 gene locus_tag LOCUS_04800 26606 26043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 28577 26994 gene locus_tag LOCUS_04810 28577 26994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 29541 28891 gene locus_tag LOCUS_04820 29541 28891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 30183 31274 gene locus_tag LOCUS_04830 30183 31274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 31271 32224 gene locus_tag LOCUS_04840 31271 32224 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403237.1 protein_id gnl|my_center|LOCUS_04840 32544 33047 gene locus_tag LOCUS_04850 32544 33047 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105385.1 protein_id gnl|my_center|LOCUS_04850 34447 33089 gene locus_tag LOCUS_04860 gene gorA 34447 33089 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100366.1 protein_id gnl|my_center|LOCUS_04860 34519 34941 gene locus_tag LOCUS_04870 34519 34941 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100368.1 protein_id gnl|my_center|LOCUS_04870 35815 34976 gene locus_tag LOCUS_04880 gene galU 35815 34976 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088639.1 protein_id gnl|my_center|LOCUS_04880 36420 38039 gene locus_tag LOCUS_04890 36420 38039 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080109.1 protein_id gnl|my_center|LOCUS_04890 38255 39643 gene locus_tag LOCUS_04900 gene hemN 38255 39643 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938468.1 protein_id gnl|my_center|LOCUS_04900 39779 41416 gene locus_tag LOCUS_04910 gene fan1 39779 41416 CDS product nuclease Fan1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113615.1 protein_id gnl|my_center|LOCUS_04910 >Feature sequence010 4626 1168 gene locus_tag LOCUS_04920 gene bcsC 4626 1168 CDS product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817392.1 protein_id gnl|my_center|LOCUS_04920 6855 4633 gene locus_tag LOCUS_04930 gene bcsB 6855 4633 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823808.1 protein_id gnl|my_center|LOCUS_04930 9449 6852 gene locus_tag LOCUS_04940 gene bcsA 9449 6852 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025914.1 protein_id gnl|my_center|LOCUS_04940 10185 9451 gene locus_tag LOCUS_04950 gene bcsQ 10185 9451 CDS product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174891.1 protein_id gnl|my_center|LOCUS_04950 10415 10182 gene locus_tag LOCUS_04960 10415 10182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 12048 10423 gene locus_tag LOCUS_04970 gene bcsG 12048 10423 CDS product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174899.1 protein_id gnl|my_center|LOCUS_04970 12227 12045 gene locus_tag LOCUS_04980 12227 12045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 13762 12224 gene locus_tag LOCUS_04990 gene bcsE 13762 12224 CDS product cellulose biosynthesis protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817396.1 protein_id gnl|my_center|LOCUS_04990 13979 14365 gene locus_tag LOCUS_05000 13979 14365 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092226.1 protein_id gnl|my_center|LOCUS_05000 14480 15214 gene locus_tag LOCUS_05010 gene amgR 14480 15214 CDS product two-component system response regulator AmgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096259.1 protein_id gnl|my_center|LOCUS_05010 15291 16622 gene locus_tag LOCUS_05020 15291 16622 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763465.1 protein_id gnl|my_center|LOCUS_05020 17550 16645 gene locus_tag LOCUS_05030 gene rimK 17550 16645 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318100.1 protein_id gnl|my_center|LOCUS_05030 18014 17547 gene locus_tag LOCUS_05040 18014 17547 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186005924.1 protein_id gnl|my_center|LOCUS_05040 18116 18514 gene locus_tag LOCUS_05050 18116 18514 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895698.1 protein_id gnl|my_center|LOCUS_05050 19302 18511 gene locus_tag LOCUS_05060 19302 18511 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114057.1 protein_id gnl|my_center|LOCUS_05060 19596 19381 gene locus_tag LOCUS_05070 19596 19381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 19498 20385 gene locus_tag LOCUS_05080 gene hslO 19498 20385 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096245.1 protein_id gnl|my_center|LOCUS_05080 20605 22149 gene locus_tag LOCUS_05090 20605 22149 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100068.1 protein_id gnl|my_center|LOCUS_05090 22313 22915 gene locus_tag LOCUS_05100 22313 22915 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100063.1 protein_id gnl|my_center|LOCUS_05100 23233 22991 gene locus_tag LOCUS_05110 23233 22991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 23528 25453 gene locus_tag LOCUS_05120 23528 25453 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236934.1 protein_id gnl|my_center|LOCUS_05120 27471 25450 gene locus_tag LOCUS_05130 27471 25450 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269368.1 protein_id gnl|my_center|LOCUS_05130 27664 27831 gene locus_tag LOCUS_05140 27664 27831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 27812 29371 gene locus_tag LOCUS_05150 27812 29371 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114016.1 protein_id gnl|my_center|LOCUS_05150 29897 30814 gene locus_tag LOCUS_05160 29897 30814 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926674.1 protein_id gnl|my_center|LOCUS_05160 30825 32135 gene locus_tag LOCUS_05170 30825 32135 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 protein_id gnl|my_center|LOCUS_05170 32196 32618 gene locus_tag LOCUS_05180 32196 32618 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365451.1 protein_id gnl|my_center|LOCUS_05180 32685 33290 gene locus_tag LOCUS_05190 32685 33290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 33416 34627 gene locus_tag LOCUS_05200 33416 34627 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403753.1 protein_id gnl|my_center|LOCUS_05200 37125 35176 gene locus_tag LOCUS_05210 37125 35176 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994087.1 protein_id gnl|my_center|LOCUS_05210 37984 37115 gene locus_tag LOCUS_05220 37984 37115 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036372.1 protein_id gnl|my_center|LOCUS_05220 38987 37977 gene locus_tag LOCUS_05230 38987 37977 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036371.1 protein_id gnl|my_center|LOCUS_05230 39388 38984 gene locus_tag LOCUS_05240 39388 38984 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036370.1 protein_id gnl|my_center|LOCUS_05240 39747 39385 gene locus_tag LOCUS_05250 39747 39385 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036369.1 protein_id gnl|my_center|LOCUS_05250 40595 39747 gene locus_tag LOCUS_05260 40595 39747 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036368.1 protein_id gnl|my_center|LOCUS_05260 41689 40790 gene locus_tag LOCUS_05270 41689 40790 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096239.1 protein_id gnl|my_center|LOCUS_05270 >Feature sequence011 <1 1405 gene locus_tag LOCUS_05280 <1 1405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003082438.1:two-component system sensor histidine kinase PhoQ 1482 1925 gene locus_tag LOCUS_05290 1482 1925 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114708.1 protein_id gnl|my_center|LOCUS_05290 3575 1926 gene locus_tag LOCUS_05300 3575 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 5065 3572 gene locus_tag LOCUS_05310 5065 3572 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_05310 6486 5062 gene locus_tag LOCUS_05320 6486 5062 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289183.1 protein_id gnl|my_center|LOCUS_05320 6764 6483 gene locus_tag LOCUS_05330 6764 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 7669 6761 gene locus_tag LOCUS_05340 7669 6761 CDS product MnhB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090053.1 protein_id gnl|my_center|LOCUS_05340 7970 7662 gene locus_tag LOCUS_05350 7970 7662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 8214 7963 gene locus_tag LOCUS_05360 8214 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 8705 8214 gene locus_tag LOCUS_05370 8705 8214 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090050.1 protein_id gnl|my_center|LOCUS_05370 8970 10646 gene locus_tag LOCUS_05380 8970 10646 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 protein_id gnl|my_center|LOCUS_05380 10643 10909 gene locus_tag LOCUS_05390 10643 10909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 10900 11892 gene locus_tag LOCUS_05400 10900 11892 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_05400 11986 12993 gene locus_tag LOCUS_05410 11986 12993 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523318.1 protein_id gnl|my_center|LOCUS_05410 13669 13016 gene locus_tag LOCUS_05420 13669 13016 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064925.1 protein_id gnl|my_center|LOCUS_05420 14334 13666 gene locus_tag LOCUS_05430 14334 13666 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526170.1 protein_id gnl|my_center|LOCUS_05430 14555 15640 gene locus_tag LOCUS_05440 14555 15640 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392694.1 protein_id gnl|my_center|LOCUS_05440 15627 17993 gene locus_tag LOCUS_05450 15627 17993 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392696.1 protein_id gnl|my_center|LOCUS_05450 18120 18599 gene locus_tag LOCUS_05460 18120 18599 CDS product BCAM0308 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943963.1 protein_id gnl|my_center|LOCUS_05460 19290 18616 gene locus_tag LOCUS_05470 19290 18616 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085655.1 protein_id gnl|my_center|LOCUS_05470 19762 19361 gene locus_tag LOCUS_05480 19762 19361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 21027 19759 gene locus_tag LOCUS_05490 21027 19759 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183209478.1 protein_id gnl|my_center|LOCUS_05490 21638 21180 gene locus_tag LOCUS_05500 21638 21180 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112599.1 protein_id gnl|my_center|LOCUS_05500 23090 21702 gene locus_tag LOCUS_05510 23090 21702 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_05510 24561 23083 gene locus_tag LOCUS_05520 24561 23083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05520 24711 25100 gene locus_tag LOCUS_05530 24711 25100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 26142 25261 gene locus_tag LOCUS_05540 26142 25261 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 protein_id gnl|my_center|LOCUS_05540 26321 26139 gene locus_tag LOCUS_05550 26321 26139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 26602 27048 gene locus_tag LOCUS_05560 26602 27048 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507213.1 protein_id gnl|my_center|LOCUS_05560 27857 27132 gene locus_tag LOCUS_05570 gene maeM 27857 27132 CDS product two-component system response regulator MaeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968074.1 protein_id gnl|my_center|LOCUS_05570 29461 27854 gene locus_tag LOCUS_05580 29461 27854 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746421.1 protein_id gnl|my_center|LOCUS_05580 29728 31041 gene locus_tag LOCUS_05590 29728 31041 CDS product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680734.1 protein_id gnl|my_center|LOCUS_05590 32755 31118 gene locus_tag LOCUS_05600 32755 31118 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267239.1 protein_id gnl|my_center|LOCUS_05600 34902 33082 gene locus_tag LOCUS_05610 gene typA 34902 33082 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096009.1 protein_id gnl|my_center|LOCUS_05610 <36440 35070 gene locus_tag LOCUS_05620 <36440 35070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096011.1:tRNA 4-thiouridine(8) synthase ThiI >Feature sequence012 26 102 gene locus_tag LOCUS_t00050 26 102 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 950 1723 gene locus_tag LOCUS_05630 950 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 1799 2977 gene locus_tag LOCUS_05640 1799 2977 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407602.1 protein_id gnl|my_center|LOCUS_05640 3000 4562 gene locus_tag LOCUS_05650 3000 4562 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268286.1 protein_id gnl|my_center|LOCUS_05650 4531 5463 gene locus_tag LOCUS_05660 4531 5463 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010216700.1 protein_id gnl|my_center|LOCUS_05660 5513 7723 gene locus_tag LOCUS_05670 5513 7723 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268289.1 protein_id gnl|my_center|LOCUS_05670 7746 8489 gene locus_tag LOCUS_05680 7746 8489 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765259.1 protein_id gnl|my_center|LOCUS_05680 8540 9049 gene locus_tag LOCUS_05690 gene rfaH 8540 9049 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268290.1 protein_id gnl|my_center|LOCUS_05690 9104 10414 gene locus_tag LOCUS_05700 9104 10414 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104562.1 protein_id gnl|my_center|LOCUS_05700 10308 11606 gene locus_tag LOCUS_05710 10308 11606 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236553.1 protein_id gnl|my_center|LOCUS_05710 11632 12939 gene locus_tag LOCUS_05720 11632 12939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105556.1 protein_id gnl|my_center|LOCUS_05720 13118 14224 gene locus_tag LOCUS_05730 13118 14224 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104563.1 protein_id gnl|my_center|LOCUS_05730 14280 15326 gene locus_tag LOCUS_05740 14280 15326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 15386 16588 gene locus_tag LOCUS_05750 15386 16588 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104564.1 protein_id gnl|my_center|LOCUS_05750 16634 16969 gene locus_tag LOCUS_05760 16634 16969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 17010 17204 gene locus_tag LOCUS_05770 17010 17204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 17216 18289 gene locus_tag LOCUS_05780 17216 18289 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104561.1 protein_id gnl|my_center|LOCUS_05780 18312 19379 gene locus_tag LOCUS_05790 18312 19379 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974005.1 protein_id gnl|my_center|LOCUS_05790 19465 20787 gene locus_tag LOCUS_05800 gene rimO 19465 20787 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086001.1 protein_id gnl|my_center|LOCUS_05800 22568 20895 gene locus_tag LOCUS_05810 gene betA 22568 20895 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104848.1 protein_id gnl|my_center|LOCUS_05810 24055 22583 gene locus_tag LOCUS_05820 gene betB 24055 22583 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114436.1 protein_id gnl|my_center|LOCUS_05820 26208 24142 gene locus_tag LOCUS_05830 gene betT 26208 24142 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704693.1 protein_id gnl|my_center|LOCUS_05830 26639 27847 gene locus_tag LOCUS_05840 gene trpB 26639 27847 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206663.1 protein_id gnl|my_center|LOCUS_05840 27958 28665 gene locus_tag LOCUS_05850 gene tsaA 27958 28665 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766043.1 protein_id gnl|my_center|LOCUS_05850 31221 28684 gene locus_tag LOCUS_05860 gene quiP 31221 28684 CDS product acyl-homoserine-lactone acylase QuiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112526.1 protein_id gnl|my_center|LOCUS_05860 31753 31292 gene locus_tag LOCUS_05870 31753 31292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 31752 31970 gene locus_tag LOCUS_05880 31752 31970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 32454 31957 gene locus_tag LOCUS_05890 32454 31957 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081986.1 protein_id gnl|my_center|LOCUS_05890 33338 32601 gene locus_tag LOCUS_05900 33338 32601 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_05900 34361 33363 gene locus_tag LOCUS_05910 gene nagZ 34361 33363 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118092.1 protein_id gnl|my_center|LOCUS_05910 34900 34376 gene locus_tag LOCUS_05920 gene elsL 34900 34376 CDS product cell wall-recycling L,D-carboxypeptidase ElsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_05920 35647 34940 gene locus_tag LOCUS_05930 gene psrA 35647 34940 CDS product transcriptional regulator PsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403692.1 protein_id gnl|my_center|LOCUS_05930 >Feature sequence013 1158 130 gene locus_tag LOCUS_05940 1158 130 CDS product IS30-like element ISBlo4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783747.1 protein_id gnl|my_center|LOCUS_05940 1809 1183 gene locus_tag LOCUS_05950 1809 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 3722 2793 gene locus_tag LOCUS_05960 gene argC 3722 2793 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919254.1 protein_id gnl|my_center|LOCUS_05960 3837 4721 gene locus_tag LOCUS_05970 3837 4721 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971214.1 protein_id gnl|my_center|LOCUS_05970 4908 4789 gene locus_tag LOCUS_05980 4908 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 5168 4905 gene locus_tag LOCUS_05990 5168 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05990 6127 5579 gene locus_tag LOCUS_06000 6127 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 6688 6155 gene locus_tag LOCUS_06010 6688 6155 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707712.1 protein_id gnl|my_center|LOCUS_06010 6806 7648 gene locus_tag LOCUS_06020 6806 7648 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063703.1 protein_id gnl|my_center|LOCUS_06020 7977 8282 gene locus_tag LOCUS_06030 7977 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 8535 9839 gene locus_tag LOCUS_06040 8535 9839 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114922.1 protein_id gnl|my_center|LOCUS_06040 11611 10235 gene locus_tag LOCUS_06050 11611 10235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 12765 11614 gene locus_tag LOCUS_06060 12765 11614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 14191 12758 gene locus_tag LOCUS_06070 14191 12758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 14635 14342 gene locus_tag LOCUS_06080 14635 14342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 14883 14650 gene locus_tag LOCUS_06090 14883 14650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 15134 15328 gene locus_tag LOCUS_06100 15134 15328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 15383 16363 gene locus_tag LOCUS_06110 15383 16363 CDS product IS5-like element ISPsy2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054991743.1 protein_id gnl|my_center|LOCUS_06110 16702 17403 gene locus_tag LOCUS_06120 16702 17403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 17408 19036 gene locus_tag LOCUS_06130 17408 19036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 19520 19155 gene locus_tag LOCUS_06140 19520 19155 CDS product DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105154.1 protein_id gnl|my_center|LOCUS_06140 20157 19837 gene locus_tag LOCUS_06150 20157 19837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 21377 22390 gene locus_tag LOCUS_06160 21377 22390 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167364873.1 protein_id gnl|my_center|LOCUS_06160 22400 24127 gene locus_tag LOCUS_06170 22400 24127 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064474.1 protein_id gnl|my_center|LOCUS_06170 24280 26001 gene locus_tag LOCUS_06180 24280 26001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 26567 26154 gene locus_tag LOCUS_06190 26567 26154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 28447 26570 gene locus_tag LOCUS_06200 28447 26570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 30084 28447 gene locus_tag LOCUS_06210 30084 28447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 31225 30077 gene locus_tag LOCUS_06220 31225 30077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 31247 31855 gene locus_tag LOCUS_06230 31247 31855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 31985 33958 gene locus_tag LOCUS_06240 gene betT 31985 33958 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096496.1 protein_id gnl|my_center|LOCUS_06240 35647 33989 gene locus_tag LOCUS_06250 35647 33989 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121292.1 protein_id gnl|my_center|LOCUS_06250 >Feature sequence014 473 1363 gene locus_tag LOCUS_06260 gene trpI 473 1363 CDS product trpBA operon transcriptional activator TrpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114633.1 protein_id gnl|my_center|LOCUS_06260 1542 2039 gene locus_tag LOCUS_06270 1542 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 3180 2116 gene locus_tag LOCUS_06280 gene galE 3180 2116 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104263.1 protein_id gnl|my_center|LOCUS_06280 3605 4789 gene locus_tag LOCUS_06290 3605 4789 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038780.1 protein_id gnl|my_center|LOCUS_06290 4777 5997 gene locus_tag LOCUS_06300 gene glf 4777 5997 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038781.1 protein_id gnl|my_center|LOCUS_06300 6096 7250 gene locus_tag LOCUS_06310 6096 7250 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038782.1 protein_id gnl|my_center|LOCUS_06310 7247 9052 gene locus_tag LOCUS_06320 7247 9052 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038783.1 protein_id gnl|my_center|LOCUS_06320 9049 9264 gene locus_tag LOCUS_06330 9049 9264 CDS product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161573.1 protein_id gnl|my_center|LOCUS_06330 10986 9301 gene locus_tag LOCUS_06340 10986 9301 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084968.1 protein_id gnl|my_center|LOCUS_06340 12496 10970 gene locus_tag LOCUS_06350 12496 10970 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084967.1 protein_id gnl|my_center|LOCUS_06350 12908 14209 gene locus_tag LOCUS_06360 12908 14209 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_06360 14226 14693 gene locus_tag LOCUS_06370 14226 14693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06370 14696 14926 gene locus_tag LOCUS_06380 14696 14926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06380 16978 14933 gene locus_tag LOCUS_06390 16978 14933 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994064.1 protein_id gnl|my_center|LOCUS_06390 17258 18046 gene locus_tag LOCUS_06400 17258 18046 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811973.1 protein_id gnl|my_center|LOCUS_06400 18245 18559 gene locus_tag LOCUS_06410 18245 18559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 18534 19442 gene locus_tag LOCUS_06420 gene rfbD 18534 19442 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651858.1 protein_id gnl|my_center|LOCUS_06420 19704 21242 gene locus_tag LOCUS_06430 19704 21242 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336811.1 protein_id gnl|my_center|LOCUS_06430 21264 23165 gene locus_tag LOCUS_06440 21264 23165 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336813.1 protein_id gnl|my_center|LOCUS_06440 23162 23410 gene locus_tag LOCUS_06450 23162 23410 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802828.1 protein_id gnl|my_center|LOCUS_06450 23414 24475 gene locus_tag LOCUS_06460 23414 24475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336816.1 protein_id gnl|my_center|LOCUS_06460 24855 26342 gene locus_tag LOCUS_06470 24855 26342 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115333.1 protein_id gnl|my_center|LOCUS_06470 26692 27081 gene locus_tag LOCUS_06480 26692 27081 CDS product DUF6152 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536268.1 protein_id gnl|my_center|LOCUS_06480 27092 27565 gene locus_tag LOCUS_06490 27092 27565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968939.1 protein_id gnl|my_center|LOCUS_06490 28523 27621 gene locus_tag LOCUS_06500 28523 27621 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529395.1 protein_id gnl|my_center|LOCUS_06500 28637 29065 gene locus_tag LOCUS_06510 28637 29065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 29062 29649 gene locus_tag LOCUS_06520 29062 29649 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113966.1 protein_id gnl|my_center|LOCUS_06520 30562 29657 gene locus_tag LOCUS_06530 30562 29657 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268178.1 protein_id gnl|my_center|LOCUS_06530 30715 31761 gene locus_tag LOCUS_06540 30715 31761 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899238.1 protein_id gnl|my_center|LOCUS_06540 31823 33142 gene locus_tag LOCUS_06550 31823 33142 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 protein_id gnl|my_center|LOCUS_06550 34466 33198 gene locus_tag LOCUS_06560 34466 33198 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736419.1 protein_id gnl|my_center|LOCUS_06560 35119 34631 gene locus_tag LOCUS_06570 35119 34631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 <35708 35208 gene locus_tag LOCUS_06580 <35708 35208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051000371.1:PQQ-dependent methanol/ethanol family dehydrogenase note possible pseudo, frameshifted >Feature sequence015 503 1885 gene locus_tag LOCUS_06590 503 1885 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_06590 1894 2124 gene locus_tag LOCUS_06600 1894 2124 CDS product MTH895/ArsE family thioredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060920.1 protein_id gnl|my_center|LOCUS_06600 2671 2426 gene locus_tag LOCUS_06610 2671 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 2894 2821 gene locus_tag LOCUS_t00060 2894 2821 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4587 3259 gene locus_tag LOCUS_06620 4587 3259 CDS product Cu(+)/Ag(+) sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704248.1 protein_id gnl|my_center|LOCUS_06620 5359 4667 gene locus_tag LOCUS_06630 gene cusR 5359 4667 CDS product copper response regulator transcription factor CusR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770953.1 protein_id gnl|my_center|LOCUS_06630 5614 7506 gene locus_tag LOCUS_06640 gene pcoA 5614 7506 CDS product multicopper oxidase PcoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925240.1 protein_id gnl|my_center|LOCUS_06640 7532 8512 gene locus_tag LOCUS_06650 7532 8512 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448268.1 protein_id gnl|my_center|LOCUS_06650 8550 9035 gene locus_tag LOCUS_06660 8550 9035 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064916.1 protein_id gnl|my_center|LOCUS_06660 9069 9341 gene locus_tag LOCUS_06670 9069 9341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 9860 11935 gene locus_tag LOCUS_06680 9860 11935 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_06680 12077 12463 gene locus_tag LOCUS_06690 gene copC 12077 12463 CDS product copper resistance system chaperone CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267052.1 protein_id gnl|my_center|LOCUS_06690 12468 13394 gene locus_tag LOCUS_06700 gene copD 12468 13394 CDS product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267053.1 protein_id gnl|my_center|LOCUS_06700 13523 13807 gene locus_tag LOCUS_06710 13523 13807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 14984 13914 gene locus_tag LOCUS_06720 14984 13914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 15287 15212 gene locus_tag LOCUS_t00070 15287 15212 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15914 15357 gene locus_tag LOCUS_06730 gene pgsA 15914 15357 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268070.1 protein_id gnl|my_center|LOCUS_06730 17772 15949 gene locus_tag LOCUS_06740 gene uvrC 17772 15949 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_06740 18416 17772 gene locus_tag LOCUS_06750 gene uvrY 18416 17772 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553344.1 protein_id gnl|my_center|LOCUS_06750 18624 19340 gene locus_tag LOCUS_06760 18624 19340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 22475 19326 gene locus_tag LOCUS_06770 22475 19326 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704244.1 protein_id gnl|my_center|LOCUS_06770 23968 22472 gene locus_tag LOCUS_06780 23968 22472 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936048.1 protein_id gnl|my_center|LOCUS_06780 25218 23965 gene locus_tag LOCUS_06790 25218 23965 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189952.1 protein_id gnl|my_center|LOCUS_06790 25653 25309 gene locus_tag LOCUS_06800 25653 25309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 27406 25706 gene locus_tag LOCUS_06810 27406 25706 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106469.1 protein_id gnl|my_center|LOCUS_06810 28553 27390 gene locus_tag LOCUS_06820 28553 27390 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088548.1 protein_id gnl|my_center|LOCUS_06820 30587 28662 gene locus_tag LOCUS_06830 30587 28662 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269166.1 protein_id gnl|my_center|LOCUS_06830 31738 30584 gene locus_tag LOCUS_06840 gene pqqE 31738 30584 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763799.1 protein_id gnl|my_center|LOCUS_06840 31988 31710 gene locus_tag LOCUS_06850 gene pqqD 31988 31710 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088542.1 protein_id gnl|my_center|LOCUS_06850 32826 32074 gene locus_tag LOCUS_06860 gene pqqC 32826 32074 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111679.1 protein_id gnl|my_center|LOCUS_06860 33809 32898 gene locus_tag LOCUS_06870 gene pqqB 33809 32898 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269163.1 protein_id gnl|my_center|LOCUS_06870 >Feature sequence016 1618 689 gene locus_tag LOCUS_06880 1618 689 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969567.1 protein_id gnl|my_center|LOCUS_06880 2248 1805 gene locus_tag LOCUS_06890 2248 1805 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113165.1 protein_id gnl|my_center|LOCUS_06890 2371 3615 gene locus_tag LOCUS_06900 2371 3615 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032611452.1 protein_id gnl|my_center|LOCUS_06900 3734 4441 gene locus_tag LOCUS_06910 3734 4441 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037009.1 protein_id gnl|my_center|LOCUS_06910 4519 5073 gene locus_tag LOCUS_06920 4519 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093439.1 protein_id gnl|my_center|LOCUS_06920 5075 5824 gene locus_tag LOCUS_06930 5075 5824 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090986.1 protein_id gnl|my_center|LOCUS_06930 5945 6364 gene locus_tag LOCUS_06940 5945 6364 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086910.1 protein_id gnl|my_center|LOCUS_06940 6382 6798 gene locus_tag LOCUS_06950 6382 6798 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082839.1 protein_id gnl|my_center|LOCUS_06950 6993 8156 gene locus_tag LOCUS_06960 6993 8156 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408090.1 protein_id gnl|my_center|LOCUS_06960 8816 8235 gene locus_tag LOCUS_06970 8816 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06970 9547 8798 gene locus_tag LOCUS_06980 9547 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06980 9748 11388 gene locus_tag LOCUS_06990 9748 11388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 11452 12465 gene locus_tag LOCUS_07000 11452 12465 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207210.1 protein_id gnl|my_center|LOCUS_07000 12575 13462 gene locus_tag LOCUS_07010 gene yghX 12575 13462 CDS product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267754.1 protein_id gnl|my_center|LOCUS_07010 13616 14431 gene locus_tag LOCUS_07020 13616 14431 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936067.1 protein_id gnl|my_center|LOCUS_07020 15353 14514 gene locus_tag LOCUS_07030 15353 14514 CDS product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086528.1 protein_id gnl|my_center|LOCUS_07030 16406 15786 gene locus_tag LOCUS_07040 gene rlmE 16406 15786 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095202.1 protein_id gnl|my_center|LOCUS_07040 16653 18290 gene locus_tag LOCUS_07050 16653 18290 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402342.1 protein_id gnl|my_center|LOCUS_07050 18302 19027 gene locus_tag LOCUS_07060 18302 19027 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246182.1 protein_id gnl|my_center|LOCUS_07060 19233 20009 gene locus_tag LOCUS_07070 19233 20009 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036194.1 protein_id gnl|my_center|LOCUS_07070 20040 21584 gene locus_tag LOCUS_07080 20040 21584 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198040062.1 protein_id gnl|my_center|LOCUS_07080 21642 22481 gene locus_tag LOCUS_07090 21642 22481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 23504 22587 gene locus_tag LOCUS_07100 gene rarD 23504 22587 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268385.1 protein_id gnl|my_center|LOCUS_07100 27588 23512 gene locus_tag LOCUS_07110 gene hrpA 27588 23512 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_07110 29299 27695 gene locus_tag LOCUS_07120 gene paaP 29299 27695 CDS product aminopeptidase PaaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101464.1 protein_id gnl|my_center|LOCUS_07120 31229 29544 gene locus_tag LOCUS_07130 31229 29544 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895628.1 protein_id gnl|my_center|LOCUS_07130 33103 31418 gene locus_tag LOCUS_07140 33103 31418 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895628.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence017 21 97 gene locus_tag LOCUS_t00080 21 97 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 707 231 gene locus_tag LOCUS_07150 gene soxR 707 231 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706522.1 protein_id gnl|my_center|LOCUS_07150 1430 834 gene locus_tag LOCUS_07160 1430 834 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113093.1 protein_id gnl|my_center|LOCUS_07160 2231 1599 gene locus_tag LOCUS_07170 2231 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 2341 2535 gene locus_tag LOCUS_07180 2341 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 2887 2573 gene locus_tag LOCUS_07190 2887 2573 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088238.1 protein_id gnl|my_center|LOCUS_07190 3363 2887 gene locus_tag LOCUS_07200 3363 2887 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088234.1 protein_id gnl|my_center|LOCUS_07200 7252 3383 gene locus_tag LOCUS_07210 gene cobN 7252 3383 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114926.1 protein_id gnl|my_center|LOCUS_07210 9209 7254 gene locus_tag LOCUS_07220 9209 7254 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114927.1 protein_id gnl|my_center|LOCUS_07220 9556 9299 gene locus_tag LOCUS_07230 9556 9299 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092213.1 protein_id gnl|my_center|LOCUS_07230 9885 10931 gene locus_tag LOCUS_07240 9885 10931 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105702.1 protein_id gnl|my_center|LOCUS_07240 11964 11056 gene locus_tag LOCUS_07250 11964 11056 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970176.1 protein_id gnl|my_center|LOCUS_07250 12066 12692 gene locus_tag LOCUS_07260 gene wrbA 12066 12692 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970175.1 protein_id gnl|my_center|LOCUS_07260 12689 13867 gene locus_tag LOCUS_07270 12689 13867 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895662.1 protein_id gnl|my_center|LOCUS_07270 14718 13882 gene locus_tag LOCUS_07280 14718 13882 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088098.1 protein_id gnl|my_center|LOCUS_07280 14984 17110 gene locus_tag LOCUS_07290 14984 17110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 17451 17119 gene locus_tag LOCUS_07300 17451 17119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811320.1 protein_id gnl|my_center|LOCUS_07300 17919 17461 gene locus_tag LOCUS_07310 17919 17461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07310 18503 17994 gene locus_tag LOCUS_07320 18503 17994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07320 18703 20142 gene locus_tag LOCUS_07330 gene cioA 18703 20142 CDS product cyanide-insensitive cytochrome bd quinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103027.1 protein_id gnl|my_center|LOCUS_07330 20146 21153 gene locus_tag LOCUS_07340 gene cydB 20146 21153 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105098.1 protein_id gnl|my_center|LOCUS_07340 21153 21320 gene locus_tag LOCUS_07350 21153 21320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 22624 21587 gene locus_tag LOCUS_07360 22624 21587 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267164.1 protein_id gnl|my_center|LOCUS_07360 23634 22621 gene locus_tag LOCUS_07370 23634 22621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 23823 25853 gene locus_tag LOCUS_07380 23823 25853 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_07380 25886 26308 gene locus_tag LOCUS_07390 25886 26308 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102139.1 protein_id gnl|my_center|LOCUS_07390 26496 27854 gene locus_tag LOCUS_07400 26496 27854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119759.1 protein_id gnl|my_center|LOCUS_07400 27860 28810 gene locus_tag LOCUS_07410 27860 28810 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091346.1 protein_id gnl|my_center|LOCUS_07410 28828 29931 gene locus_tag LOCUS_07420 28828 29931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 31336 29942 gene locus_tag LOCUS_07430 gene pmpM 31336 29942 CDS product proton-coupled multidrug efflux MATE transporter PmpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112388.1 protein_id gnl|my_center|LOCUS_07430 31458 32603 gene locus_tag LOCUS_07440 gene pdxB 31458 32603 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267266.1 protein_id gnl|my_center|LOCUS_07440 >Feature sequence018 427 1803 gene locus_tag LOCUS_07450 427 1803 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113277.1 protein_id gnl|my_center|LOCUS_07450 1793 2551 gene locus_tag LOCUS_07460 1793 2551 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084693.1 protein_id gnl|my_center|LOCUS_07460 2552 3064 gene locus_tag LOCUS_07470 2552 3064 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199982.1 protein_id gnl|my_center|LOCUS_07470 3356 4618 gene locus_tag LOCUS_07480 3356 4618 CDS product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266703.1 protein_id gnl|my_center|LOCUS_07480 5041 4718 gene locus_tag LOCUS_07490 5041 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 6570 5044 gene locus_tag LOCUS_07500 6570 5044 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114194.1 protein_id gnl|my_center|LOCUS_07500 6863 6567 gene locus_tag LOCUS_07510 6863 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 9036 6916 gene locus_tag LOCUS_07520 9036 6916 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039372.1 protein_id gnl|my_center|LOCUS_07520 10074 9184 gene locus_tag LOCUS_07530 10074 9184 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195077.1 protein_id gnl|my_center|LOCUS_07530 11089 10160 gene locus_tag LOCUS_07540 11089 10160 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064103.1 protein_id gnl|my_center|LOCUS_07540 12522 11113 gene locus_tag LOCUS_07550 12522 11113 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_07550 14099 12534 gene locus_tag LOCUS_07560 gene garD 14099 12534 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268905.1 protein_id gnl|my_center|LOCUS_07560 15560 14220 gene locus_tag LOCUS_07570 gene gudD 15560 14220 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268234.1 protein_id gnl|my_center|LOCUS_07570 17096 15654 gene locus_tag LOCUS_07580 17096 15654 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088614.1 protein_id gnl|my_center|LOCUS_07580 18081 17170 gene locus_tag LOCUS_07590 gene kdgD 18081 17170 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620479.1 protein_id gnl|my_center|LOCUS_07590 18551 19942 gene locus_tag LOCUS_07600 gene gudD 18551 19942 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268234.1 protein_id gnl|my_center|LOCUS_07600 19971 20951 gene locus_tag LOCUS_07610 19971 20951 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816965.1 protein_id gnl|my_center|LOCUS_07610 21019 21516 gene locus_tag LOCUS_07620 21019 21516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 21527 23047 gene locus_tag LOCUS_07630 21527 23047 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582707.1 protein_id gnl|my_center|LOCUS_07630 24227 23085 gene locus_tag LOCUS_07640 24227 23085 CDS product L-talarate/galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218254.1 protein_id gnl|my_center|LOCUS_07640 24331 25245 gene locus_tag LOCUS_07650 24331 25245 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764318.1 protein_id gnl|my_center|LOCUS_07650 25837 25280 gene locus_tag LOCUS_07660 25837 25280 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626149.1 protein_id gnl|my_center|LOCUS_07660 25945 26931 gene locus_tag LOCUS_07670 25945 26931 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974978.1 protein_id gnl|my_center|LOCUS_07670 27107 27823 gene locus_tag LOCUS_07680 27107 27823 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480275.1 protein_id gnl|my_center|LOCUS_07680 27813 28121 gene locus_tag LOCUS_07690 27813 28121 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460963.1 protein_id gnl|my_center|LOCUS_07690 29157 28132 gene locus_tag LOCUS_07700 29157 28132 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981551.1 protein_id gnl|my_center|LOCUS_07700 29470 30285 gene locus_tag LOCUS_07710 29470 30285 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103399.1 protein_id gnl|my_center|LOCUS_07710 30327 31223 gene locus_tag LOCUS_07720 30327 31223 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103398.1 protein_id gnl|my_center|LOCUS_07720 31294 32268 gene locus_tag LOCUS_07730 31294 32268 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770956.1 protein_id gnl|my_center|LOCUS_07730 >Feature sequence019 1035 73 gene locus_tag LOCUS_07740 1035 73 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004349090.1 protein_id gnl|my_center|LOCUS_07740 1192 2283 gene locus_tag LOCUS_07750 gene aroC 1192 2283 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087653.1 protein_id gnl|my_center|LOCUS_07750 2349 3500 gene locus_tag LOCUS_07760 2349 3500 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_07760 3744 4289 gene locus_tag LOCUS_07770 3744 4289 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087656.1 protein_id gnl|my_center|LOCUS_07770 4498 4707 gene locus_tag LOCUS_07780 4498 4707 CDS product PLDc N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552853.1 protein_id gnl|my_center|LOCUS_07780 4714 4905 gene locus_tag LOCUS_07790 4714 4905 CDS product PLDc N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552853.1 protein_id gnl|my_center|LOCUS_07790 4909 5469 gene locus_tag LOCUS_07800 4909 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 6353 5478 gene locus_tag LOCUS_07810 6353 5478 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103194.1 protein_id gnl|my_center|LOCUS_07810 6540 7400 gene locus_tag LOCUS_07820 gene speE 6540 7400 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766858.1 protein_id gnl|my_center|LOCUS_07820 7797 7573 gene locus_tag LOCUS_07830 7797 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 7714 8055 gene locus_tag LOCUS_07840 7714 8055 CDS product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617305.1 protein_id gnl|my_center|LOCUS_07840 9015 8059 gene locus_tag LOCUS_07850 9015 8059 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119870.1 protein_id gnl|my_center|LOCUS_07850 9125 9877 gene locus_tag LOCUS_07860 9125 9877 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114755.1 protein_id gnl|my_center|LOCUS_07860 11104 9884 gene locus_tag LOCUS_07870 gene chrA 11104 9884 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 protein_id gnl|my_center|LOCUS_07870 12125 11163 gene locus_tag LOCUS_07880 12125 11163 CDS product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104731.1 protein_id gnl|my_center|LOCUS_07880 12327 13214 gene locus_tag LOCUS_07890 12327 13214 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091343.1 protein_id gnl|my_center|LOCUS_07890 13214 14182 gene locus_tag LOCUS_07900 13214 14182 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091336.1 protein_id gnl|my_center|LOCUS_07900 14179 15036 gene locus_tag LOCUS_07910 14179 15036 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104987.1 protein_id gnl|my_center|LOCUS_07910 15108 15386 gene locus_tag LOCUS_07920 15108 15386 CDS product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104989.1 protein_id gnl|my_center|LOCUS_07920 15386 16225 gene locus_tag LOCUS_07930 15386 16225 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010208878.1 protein_id gnl|my_center|LOCUS_07930 16445 19105 gene locus_tag LOCUS_07940 gene pepN 16445 19105 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_07940 19455 20546 gene locus_tag LOCUS_07950 19455 20546 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237280.1 protein_id gnl|my_center|LOCUS_07950 20563 22917 gene locus_tag LOCUS_07960 20563 22917 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 protein_id gnl|my_center|LOCUS_07960 23188 22985 gene locus_tag LOCUS_07970 23188 22985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 24069 23332 gene locus_tag LOCUS_07980 gene cobA 24069 23332 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765713.1 protein_id gnl|my_center|LOCUS_07980 26800 24095 gene locus_tag LOCUS_07990 26800 24095 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113578.1 protein_id gnl|my_center|LOCUS_07990 27172 26843 gene locus_tag LOCUS_08000 gene nirD 27172 26843 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087853.1 protein_id gnl|my_center|LOCUS_08000 29661 27196 gene locus_tag LOCUS_08010 gene nirB 29661 27196 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113579.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence020 478 1533 gene locus_tag LOCUS_08020 478 1533 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035286.1 protein_id gnl|my_center|LOCUS_08020 1552 2739 gene locus_tag LOCUS_08030 1552 2739 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068376.1 protein_id gnl|my_center|LOCUS_08030 2742 3974 gene locus_tag LOCUS_08040 2742 3974 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875986.1 protein_id gnl|my_center|LOCUS_08040 4039 5289 gene locus_tag LOCUS_08050 4039 5289 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875980.1 protein_id gnl|my_center|LOCUS_08050 5334 6584 gene locus_tag LOCUS_08060 5334 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 6544 7419 gene locus_tag LOCUS_08070 6544 7419 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_08070 7412 8179 gene locus_tag LOCUS_08080 7412 8179 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061718.1 protein_id gnl|my_center|LOCUS_08080 8624 9724 gene locus_tag LOCUS_08090 8624 9724 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771202.1 protein_id gnl|my_center|LOCUS_08090 11174 9990 gene locus_tag LOCUS_08100 11174 9990 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114496.1 protein_id gnl|my_center|LOCUS_08100 12950 11451 gene locus_tag LOCUS_08110 gene pap 12950 11451 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091935.1 protein_id gnl|my_center|LOCUS_08110 13262 13903 gene locus_tag LOCUS_08120 13262 13903 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112468.1 protein_id gnl|my_center|LOCUS_08120 14090 14497 gene locus_tag LOCUS_08130 14090 14497 CDS product PA2817 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770653.1 protein_id gnl|my_center|LOCUS_08130 16686 14680 gene locus_tag LOCUS_08140 16686 14680 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895647.1 protein_id gnl|my_center|LOCUS_08140 17384 16836 gene locus_tag LOCUS_08150 17384 16836 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261052.1 protein_id gnl|my_center|LOCUS_08150 18395 17403 gene locus_tag LOCUS_08160 18395 17403 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268560.1 protein_id gnl|my_center|LOCUS_08160 19087 18335 gene locus_tag LOCUS_08170 19087 18335 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922020.1 protein_id gnl|my_center|LOCUS_08170 20503 19097 gene locus_tag LOCUS_08180 gene cpsB 20503 19097 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084309.1 protein_id gnl|my_center|LOCUS_08180 20995 20525 gene locus_tag LOCUS_08190 gene gmm 20995 20525 CDS product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393539.1 protein_id gnl|my_center|LOCUS_08190 21970 20996 gene locus_tag LOCUS_08200 21970 20996 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097874.1 protein_id gnl|my_center|LOCUS_08200 23092 21974 gene locus_tag LOCUS_08210 gene gmd 23092 21974 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706703.1 protein_id gnl|my_center|LOCUS_08210 24093 23089 gene locus_tag LOCUS_08220 24093 23089 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208591.1 protein_id gnl|my_center|LOCUS_08220 26365 25514 gene locus_tag LOCUS_08230 26365 25514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 26987 26310 gene locus_tag LOCUS_08240 26987 26310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 28363 27227 gene locus_tag LOCUS_08250 28363 27227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 <29455 28735 gene locus_tag LOCUS_08260 <29455 28735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054991743.1:IS5-like element ISPsy2 family transposase >Feature sequence021 230 814 gene locus_tag LOCUS_08270 gene pth 230 814 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099278.1 protein_id gnl|my_center|LOCUS_08270 839 1939 gene locus_tag LOCUS_08280 gene ychF 839 1939 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099270.1 protein_id gnl|my_center|LOCUS_08280 2161 3354 gene locus_tag LOCUS_08290 2161 3354 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615166.1 protein_id gnl|my_center|LOCUS_08290 3335 4021 gene locus_tag LOCUS_08300 3335 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 5683 4061 gene locus_tag LOCUS_08310 5683 4061 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058062.1 protein_id gnl|my_center|LOCUS_08310 6795 5680 gene locus_tag LOCUS_08320 6795 5680 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262887.1 protein_id gnl|my_center|LOCUS_08320 8075 6792 gene locus_tag LOCUS_08330 8075 6792 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794333.1 protein_id gnl|my_center|LOCUS_08330 9235 8072 gene locus_tag LOCUS_08340 9235 8072 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039748.1 protein_id gnl|my_center|LOCUS_08340 11859 9217 gene locus_tag LOCUS_08350 11859 9217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039747.1 protein_id gnl|my_center|LOCUS_08350 14834 11856 gene locus_tag LOCUS_08360 14834 11856 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035715.1 protein_id gnl|my_center|LOCUS_08360 15111 14902 gene locus_tag LOCUS_08370 15111 14902 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_08370 16486 15719 gene locus_tag LOCUS_08380 16486 15719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 16586 18160 gene locus_tag LOCUS_08390 16586 18160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 18436 18167 gene locus_tag LOCUS_08400 18436 18167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 18899 18423 gene locus_tag LOCUS_08410 18899 18423 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921917.1 protein_id gnl|my_center|LOCUS_08410 19312 18896 gene locus_tag LOCUS_08420 19312 18896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 19953 19309 gene locus_tag LOCUS_08430 19953 19309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 20627 19971 gene locus_tag LOCUS_08440 20627 19971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 20772 21011 gene locus_tag LOCUS_08450 20772 21011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 21347 21189 gene locus_tag LOCUS_08460 21347 21189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08460 21620 21408 gene locus_tag LOCUS_08470 21620 21408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08470 22026 21529 gene locus_tag LOCUS_08480 22026 21529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08480 22649 22128 gene locus_tag LOCUS_08490 gene lspA 22649 22128 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004863699.1 protein_id gnl|my_center|LOCUS_08490 24142 22703 gene locus_tag LOCUS_08500 gene lnt 24142 22703 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118259.1 protein_id gnl|my_center|LOCUS_08500 25198 24437 gene locus_tag LOCUS_08510 25198 24437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 26096 25341 gene locus_tag LOCUS_08520 26096 25341 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574643.1 protein_id gnl|my_center|LOCUS_08520 26336 26770 gene locus_tag LOCUS_08530 gene cadR 26336 26770 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004364961.1 protein_id gnl|my_center|LOCUS_08530 28347 27325 gene locus_tag LOCUS_08540 28347 27325 CDS product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205285.1 protein_id gnl|my_center|LOCUS_08540 28598 28386 gene locus_tag LOCUS_08550 28598 28386 CDS product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103414.1 protein_id gnl|my_center|LOCUS_08550 29193 28921 gene locus_tag LOCUS_08560 29193 28921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence022 114 1244 gene locus_tag LOCUS_08570 114 1244 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101151.1 protein_id gnl|my_center|LOCUS_08570 1237 2184 gene locus_tag LOCUS_08580 1237 2184 CDS product iron-sulfur-binding ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112777.1 protein_id gnl|my_center|LOCUS_08580 3684 2236 gene locus_tag LOCUS_08590 gene pyk 3684 2236 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093930.1 protein_id gnl|my_center|LOCUS_08590 3835 4212 gene locus_tag LOCUS_08600 3835 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463668.1 protein_id gnl|my_center|LOCUS_08600 4239 4661 gene locus_tag LOCUS_08610 4239 4661 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093901.1 protein_id gnl|my_center|LOCUS_08610 4708 5136 gene locus_tag LOCUS_08620 4708 5136 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093898.1 protein_id gnl|my_center|LOCUS_08620 6495 5164 gene locus_tag LOCUS_08630 6495 5164 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112779.1 protein_id gnl|my_center|LOCUS_08630 7505 6492 gene locus_tag LOCUS_08640 7505 6492 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112780.1 protein_id gnl|my_center|LOCUS_08640 8674 7502 gene locus_tag LOCUS_08650 8674 7502 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112781.1 protein_id gnl|my_center|LOCUS_08650 10224 8671 gene locus_tag LOCUS_08660 10224 8671 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112782.1 protein_id gnl|my_center|LOCUS_08660 11191 10211 gene locus_tag LOCUS_08670 11191 10211 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112783.1 protein_id gnl|my_center|LOCUS_08670 11895 11188 gene locus_tag LOCUS_08680 11895 11188 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268792.1 protein_id gnl|my_center|LOCUS_08680 12098 13555 gene locus_tag LOCUS_08690 gene sbcB 12098 13555 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123272.1 protein_id gnl|my_center|LOCUS_08690 14065 13688 gene locus_tag LOCUS_08700 14065 13688 CDS product DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554971.1 protein_id gnl|my_center|LOCUS_08700 14412 15263 gene locus_tag LOCUS_08710 gene purU 14412 15263 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101174.1 protein_id gnl|my_center|LOCUS_08710 15279 15485 gene locus_tag LOCUS_08720 15279 15485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 15507 16982 gene locus_tag LOCUS_08730 15507 16982 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114975.1 protein_id gnl|my_center|LOCUS_08730 17366 17043 gene locus_tag LOCUS_08740 17366 17043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 18996 17551 gene locus_tag LOCUS_08750 18996 17551 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092113.1 protein_id gnl|my_center|LOCUS_08750 20514 19735 gene locus_tag LOCUS_08760 gene yaaA 20514 19735 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092094.1 protein_id gnl|my_center|LOCUS_08760 20650 21633 gene locus_tag LOCUS_08770 gene dmeF 20650 21633 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704592.1 protein_id gnl|my_center|LOCUS_08770 21891 23279 gene locus_tag LOCUS_08780 21891 23279 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093038.1 protein_id gnl|my_center|LOCUS_08780 23382 23852 gene locus_tag LOCUS_08790 gene moaC 23382 23852 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093030.1 protein_id gnl|my_center|LOCUS_08790 23849 24097 gene locus_tag LOCUS_08800 gene moaD 23849 24097 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093027.1 protein_id gnl|my_center|LOCUS_08800 24100 24558 gene locus_tag LOCUS_08810 gene moaE 24100 24558 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093025.1 protein_id gnl|my_center|LOCUS_08810 24727 24563 gene locus_tag LOCUS_08820 24727 24563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 26299 24869 gene locus_tag LOCUS_08830 gene rhlB 26299 24869 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119269.1 protein_id gnl|my_center|LOCUS_08830 27140 26484 gene locus_tag LOCUS_08840 27140 26484 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266805.1 protein_id gnl|my_center|LOCUS_08840 27465 28493 gene locus_tag LOCUS_08850 27465 28493 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266806.1 protein_id gnl|my_center|LOCUS_08850 >Feature sequence023 <1 1271 gene locus_tag LOCUS_08860 <1 1271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114299.1:pyruvate kinase 1272 2213 gene locus_tag LOCUS_08870 1272 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 2538 2227 gene locus_tag LOCUS_08880 2538 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 2706 3884 gene locus_tag LOCUS_08890 gene hmpA 2706 3884 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113387.1 protein_id gnl|my_center|LOCUS_08890 3934 4191 gene locus_tag LOCUS_08900 3934 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 4405 4575 gene locus_tag LOCUS_08910 4405 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 4980 6179 gene locus_tag LOCUS_08920 gene pncB 4980 6179 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099996.1 protein_id gnl|my_center|LOCUS_08920 7404 6208 gene locus_tag LOCUS_08930 7404 6208 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390308.1 protein_id gnl|my_center|LOCUS_08930 7303 7584 gene locus_tag LOCUS_08940 7303 7584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 7761 9671 gene locus_tag LOCUS_08950 gene estA 7761 9671 CDS product esterase EstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115524.1 protein_id gnl|my_center|LOCUS_08950 10628 9729 gene locus_tag LOCUS_08960 10628 9729 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268817.1 protein_id gnl|my_center|LOCUS_08960 10989 11261 gene locus_tag LOCUS_08970 10989 11261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 12162 11272 gene locus_tag LOCUS_08980 12162 11272 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120877.1 protein_id gnl|my_center|LOCUS_08980 12255 12863 gene locus_tag LOCUS_08990 12255 12863 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094003.1 protein_id gnl|my_center|LOCUS_08990 13265 13846 gene locus_tag LOCUS_09000 gene sodB 13265 13846 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094005.1 protein_id gnl|my_center|LOCUS_09000 14131 14466 gene locus_tag LOCUS_09010 14131 14466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09010 14649 16190 gene locus_tag LOCUS_09020 14649 16190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09020 16296 16979 gene locus_tag LOCUS_09030 16296 16979 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328012.1 protein_id gnl|my_center|LOCUS_09030 17879 16986 gene locus_tag LOCUS_09040 17879 16986 CDS product GIDE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 protein_id gnl|my_center|LOCUS_09040 18441 17881 gene locus_tag LOCUS_09050 18441 17881 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_09050 18621 19955 gene locus_tag LOCUS_09060 18621 19955 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246223.1 protein_id gnl|my_center|LOCUS_09060 20124 21542 gene locus_tag LOCUS_09070 20124 21542 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_09070 21552 22688 gene locus_tag LOCUS_09080 21552 22688 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102644.1 protein_id gnl|my_center|LOCUS_09080 22690 23784 gene locus_tag LOCUS_09090 22690 23784 CDS product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102648.1 protein_id gnl|my_center|LOCUS_09090 23869 25491 gene locus_tag LOCUS_09100 23869 25491 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463594.1 protein_id gnl|my_center|LOCUS_09100 25741 26724 gene locus_tag LOCUS_09110 gene mexV 25741 26724 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115243.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence024 24 1520 gene locus_tag LOCUS_09120 24 1520 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096875.1 protein_id gnl|my_center|LOCUS_09120 1754 2812 gene locus_tag LOCUS_09130 gene nadA 1754 2812 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112547.1 protein_id gnl|my_center|LOCUS_09130 4350 2920 gene locus_tag LOCUS_09140 4350 2920 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409438.1 protein_id gnl|my_center|LOCUS_09140 4461 4712 gene locus_tag LOCUS_09150 4461 4712 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317380.1 protein_id gnl|my_center|LOCUS_09150 4734 5810 gene locus_tag LOCUS_09160 4734 5810 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267087.1 protein_id gnl|my_center|LOCUS_09160 6320 5847 gene locus_tag LOCUS_09170 6320 5847 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086262.1 protein_id gnl|my_center|LOCUS_09170 6895 6335 gene locus_tag LOCUS_09180 6895 6335 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379024.1 protein_id gnl|my_center|LOCUS_09180 7122 8000 gene locus_tag LOCUS_09190 gene dapA 7122 8000 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_09190 8017 9117 gene locus_tag LOCUS_09200 gene bamC 8017 9117 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406091.1 protein_id gnl|my_center|LOCUS_09200 9212 10081 gene locus_tag LOCUS_09210 9212 10081 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020996787.1 protein_id gnl|my_center|LOCUS_09210 10198 10287 gene locus_tag LOCUS_t00090 10198 10287 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10405 12798 gene locus_tag LOCUS_09220 10405 12798 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895586.1 protein_id gnl|my_center|LOCUS_09220 12871 13179 gene locus_tag LOCUS_09230 12871 13179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942311.1 protein_id gnl|my_center|LOCUS_09230 13572 13228 gene locus_tag LOCUS_09240 13572 13228 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098276.1 protein_id gnl|my_center|LOCUS_09240 13772 13581 gene locus_tag LOCUS_09250 13772 13581 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096523.1 protein_id gnl|my_center|LOCUS_09250 16375 13790 gene locus_tag LOCUS_09260 16375 13790 CDS product YdbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895700.1 protein_id gnl|my_center|LOCUS_09260 16916 17269 gene locus_tag LOCUS_09270 16916 17269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 17338 18810 gene locus_tag LOCUS_09280 17338 18810 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024699212.1 protein_id gnl|my_center|LOCUS_09280 20073 18826 gene locus_tag LOCUS_09290 20073 18826 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003128157.1 protein_id gnl|my_center|LOCUS_09290 23833 20366 gene locus_tag LOCUS_09300 23833 20366 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 protein_id gnl|my_center|LOCUS_09300 24111 24671 gene locus_tag LOCUS_09310 24111 24671 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119682.1 protein_id gnl|my_center|LOCUS_09310 24825 25541 gene locus_tag LOCUS_09320 24825 25541 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113515.1 protein_id gnl|my_center|LOCUS_09320 25538 25864 gene locus_tag LOCUS_09330 25538 25864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 25861 27270 gene locus_tag LOCUS_09340 25861 27270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 28267 27311 gene locus_tag LOCUS_09350 gene rdgC 28267 27311 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317427.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence025 1310 828 gene locus_tag LOCUS_09360 1310 828 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090910.1 protein_id gnl|my_center|LOCUS_09360 1725 1327 gene locus_tag LOCUS_09370 gene msrB 1725 1327 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090911.1 protein_id gnl|my_center|LOCUS_09370 1996 3207 gene locus_tag LOCUS_09380 1996 3207 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090913.1 protein_id gnl|my_center|LOCUS_09380 3212 3682 gene locus_tag LOCUS_09390 3212 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115276.1 protein_id gnl|my_center|LOCUS_09390 3771 4643 gene locus_tag LOCUS_09400 gene htpX 3771 4643 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090915.1 protein_id gnl|my_center|LOCUS_09400 4727 5371 gene locus_tag LOCUS_09410 4727 5371 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456820.1 protein_id gnl|my_center|LOCUS_09410 5933 5394 gene locus_tag LOCUS_09420 5933 5394 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809767.1 protein_id gnl|my_center|LOCUS_09420 7504 6110 gene locus_tag LOCUS_09430 7504 6110 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103783.1 protein_id gnl|my_center|LOCUS_09430 8423 7509 gene locus_tag LOCUS_09440 8423 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 8310 8699 gene locus_tag LOCUS_09450 8310 8699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 10295 8829 gene locus_tag LOCUS_09460 gene fleQ 10295 8829 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086448.1 protein_id gnl|my_center|LOCUS_09460 10978 10682 gene locus_tag LOCUS_09470 gene fleP 10978 10682 CDS product pili length/flagellar attachment protein FleP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082194.1 protein_id gnl|my_center|LOCUS_09470 11560 11120 gene locus_tag LOCUS_09480 11560 11120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087156.1 protein_id gnl|my_center|LOCUS_09480 12798 11578 gene locus_tag LOCUS_09490 gene ccmI 12798 11578 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083145.1 protein_id gnl|my_center|LOCUS_09490 13268 12795 gene locus_tag LOCUS_09500 13268 12795 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104639.1 protein_id gnl|my_center|LOCUS_09500 13795 13265 gene locus_tag LOCUS_09510 gene dsbE 13795 13265 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083138.1 protein_id gnl|my_center|LOCUS_09510 15770 13797 gene locus_tag LOCUS_09520 15770 13797 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_09520 16234 15767 gene locus_tag LOCUS_09530 gene ccmE 16234 15767 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107323.1 protein_id gnl|my_center|LOCUS_09530 16407 16231 gene locus_tag LOCUS_09540 gene ccmD 16407 16231 CDS product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083136.1 protein_id gnl|my_center|LOCUS_09540 17159 16404 gene locus_tag LOCUS_09550 17159 16404 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083135.1 protein_id gnl|my_center|LOCUS_09550 17918 17247 gene locus_tag LOCUS_09560 gene ccmB 17918 17247 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114289.1 protein_id gnl|my_center|LOCUS_09560 18550 17915 gene locus_tag LOCUS_09570 gene ccmA 18550 17915 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895571.1 protein_id gnl|my_center|LOCUS_09570 18687 20204 gene locus_tag LOCUS_09580 18687 20204 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895570.1 protein_id gnl|my_center|LOCUS_09580 20201 20533 gene locus_tag LOCUS_09590 20201 20533 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083121.1 protein_id gnl|my_center|LOCUS_09590 20954 20514 gene locus_tag LOCUS_09600 20954 20514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 21492 21079 gene locus_tag LOCUS_09610 21492 21079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 21975 21496 gene locus_tag LOCUS_09620 21975 21496 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554262.1 protein_id gnl|my_center|LOCUS_09620 22887 22057 gene locus_tag LOCUS_09630 22887 22057 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244357.1 protein_id gnl|my_center|LOCUS_09630 23726 22974 gene locus_tag LOCUS_09640 23726 22974 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083092.1 protein_id gnl|my_center|LOCUS_09640 24685 23849 gene locus_tag LOCUS_09650 gene motD 24685 23849 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083090.1 protein_id gnl|my_center|LOCUS_09650 25431 24691 gene locus_tag LOCUS_09660 25431 24691 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 protein_id gnl|my_center|LOCUS_09660 26549 25431 gene locus_tag LOCUS_09670 26549 25431 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895569.1 protein_id gnl|my_center|LOCUS_09670 <27659 26600 gene locus_tag LOCUS_09680 <27659 26600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114282.1:chemotaxis protein CheA >Feature sequence026 <1 2179 gene locus_tag LOCUS_09690 <1 2179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267471.1:phenylalanine--tRNA ligase subunit beta 2183 2485 gene locus_tag LOCUS_09700 gene ihfA 2183 2485 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090661.1 protein_id gnl|my_center|LOCUS_09700 2466 2822 gene locus_tag LOCUS_09710 2466 2822 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_09710 2908 2984 gene locus_tag LOCUS_t00100 2908 2984 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4129 3734 gene locus_tag LOCUS_09720 4129 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 5563 4151 gene locus_tag LOCUS_09730 5563 4151 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275381.1 protein_id gnl|my_center|LOCUS_09730 7269 7580 gene locus_tag LOCUS_09740 7269 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 7684 9366 gene locus_tag LOCUS_09750 7684 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09750 9424 10527 gene locus_tag LOCUS_09760 9424 10527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09760 10764 11231 gene locus_tag LOCUS_09770 10764 11231 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152114.1 protein_id gnl|my_center|LOCUS_09770 11555 13336 gene locus_tag LOCUS_09780 11555 13336 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037333.1 protein_id gnl|my_center|LOCUS_09780 13557 14525 gene locus_tag LOCUS_09790 13557 14525 CDS product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112461.1 protein_id gnl|my_center|LOCUS_09790 15511 14753 gene locus_tag LOCUS_09800 gene yecC 15511 14753 CDS product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273033.1 protein_id gnl|my_center|LOCUS_09800 16179 15511 gene locus_tag LOCUS_09810 gene tcyL 16179 15511 CDS product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403129.1 protein_id gnl|my_center|LOCUS_09810 16970 16176 gene locus_tag LOCUS_09820 gene tcyJ 16970 16176 CDS product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266348.1 protein_id gnl|my_center|LOCUS_09820 18073 17075 gene locus_tag LOCUS_09830 18073 17075 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765567.1 protein_id gnl|my_center|LOCUS_09830 18282 18461 gene locus_tag LOCUS_09840 18282 18461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 20029 18602 gene locus_tag LOCUS_09850 20029 18602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457111.1 protein_id gnl|my_center|LOCUS_09850 23427 20347 gene locus_tag LOCUS_09860 gene dnaE2 23427 20347 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895514.1 protein_id gnl|my_center|LOCUS_09860 24836 23424 gene locus_tag LOCUS_09870 24836 23424 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112733.1 protein_id gnl|my_center|LOCUS_09870 25360 24845 gene locus_tag LOCUS_09880 gene imuA 25360 24845 CDS product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112732.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence027 530 2443 gene locus_tag LOCUS_09890 gene nosZ 530 2443 CDS product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098686.1 protein_id gnl|my_center|LOCUS_09890 2557 3864 gene locus_tag LOCUS_09900 2557 3864 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113112.1 protein_id gnl|my_center|LOCUS_09900 3861 4787 gene locus_tag LOCUS_09910 3861 4787 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113111.1 protein_id gnl|my_center|LOCUS_09910 4784 5614 gene locus_tag LOCUS_09920 4784 5614 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113110.1 protein_id gnl|my_center|LOCUS_09920 5640 6212 gene locus_tag LOCUS_09930 5640 6212 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113109.1 protein_id gnl|my_center|LOCUS_09930 6260 6442 gene locus_tag LOCUS_09940 6260 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 6757 7947 gene locus_tag LOCUS_09950 6757 7947 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_09950 8066 8809 gene locus_tag LOCUS_09960 8066 8809 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877896.1 protein_id gnl|my_center|LOCUS_09960 8822 9532 gene locus_tag LOCUS_09970 8822 9532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 9502 9915 gene locus_tag LOCUS_09980 9502 9915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09980 10335 10589 gene locus_tag LOCUS_09990 10335 10589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09990 10685 11824 gene locus_tag LOCUS_10000 10685 11824 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113608.1 protein_id gnl|my_center|LOCUS_10000 12730 11867 gene locus_tag LOCUS_10010 12730 11867 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098205.1 protein_id gnl|my_center|LOCUS_10010 14337 12829 gene locus_tag LOCUS_10020 gene nirN 14337 12829 CDS product dihydro-heme d1 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113244.1 protein_id gnl|my_center|LOCUS_10020 15164 14328 gene locus_tag LOCUS_10030 gene cobA 15164 14328 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113243.1 protein_id gnl|my_center|LOCUS_10030 16407 15226 gene locus_tag LOCUS_10040 gene nirJ 16407 15226 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113242.1 protein_id gnl|my_center|LOCUS_10040 16814 16566 gene locus_tag LOCUS_10050 16814 16566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 17412 16825 gene locus_tag LOCUS_10060 17412 16825 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118864.1 protein_id gnl|my_center|LOCUS_10060 18208 17396 gene locus_tag LOCUS_10070 gene nirQ 18208 17396 CDS product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 protein_id gnl|my_center|LOCUS_10070 18552 20234 gene locus_tag LOCUS_10080 gene nirS 18552 20234 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_10080 20304 20912 gene locus_tag LOCUS_10090 20304 20912 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082412.1 protein_id gnl|my_center|LOCUS_10090 20960 21835 gene locus_tag LOCUS_10100 20960 21835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 22155 22469 gene locus_tag LOCUS_10110 gene nirM 22155 22469 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_10110 22488 22829 gene locus_tag LOCUS_10120 22488 22829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 22826 24001 gene locus_tag LOCUS_10130 gene nirF 22826 24001 CDS product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 protein_id gnl|my_center|LOCUS_10130 24003 24461 gene locus_tag LOCUS_10140 24003 24461 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084864.1 protein_id gnl|my_center|LOCUS_10140 24458 24970 gene locus_tag LOCUS_10150 24458 24970 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111534.1 protein_id gnl|my_center|LOCUS_10150 24963 25406 gene locus_tag LOCUS_10160 24963 25406 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084860.1 protein_id gnl|my_center|LOCUS_10160 25381 25887 gene locus_tag LOCUS_10170 25381 25887 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084858.1 protein_id gnl|my_center|LOCUS_10170 26142 26582 gene locus_tag LOCUS_10180 gene norC 26142 26582 CDS product nitric oxide reductase subunit NorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113238.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence028 <1 559 gene locus_tag LOCUS_10190 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005769628.1:succinate dehydrogenase flavoprotein subunit 570 1274 gene locus_tag LOCUS_10200 570 1274 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382004.1 protein_id gnl|my_center|LOCUS_10200 1567 4398 gene locus_tag LOCUS_10210 1567 4398 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366703.1 protein_id gnl|my_center|LOCUS_10210 4470 5696 gene locus_tag LOCUS_10220 gene odhB 4470 5696 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114264.1 protein_id gnl|my_center|LOCUS_10220 5792 7228 gene locus_tag LOCUS_10230 gene lpdA 5792 7228 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087422.1 protein_id gnl|my_center|LOCUS_10230 7423 8589 gene locus_tag LOCUS_10240 gene sucC 7423 8589 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087425.1 protein_id gnl|my_center|LOCUS_10240 8589 9473 gene locus_tag LOCUS_10250 gene sucD 8589 9473 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087428.1 protein_id gnl|my_center|LOCUS_10250 9842 11161 gene locus_tag LOCUS_10260 gene brnQ 9842 11161 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114263.1 protein_id gnl|my_center|LOCUS_10260 11251 11976 gene locus_tag LOCUS_10270 11251 11976 CDS product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_10270 12034 12495 gene locus_tag LOCUS_10280 12034 12495 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106488.1 protein_id gnl|my_center|LOCUS_10280 12492 12935 gene locus_tag LOCUS_10290 12492 12935 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 protein_id gnl|my_center|LOCUS_10290 13002 14243 gene locus_tag LOCUS_10300 13002 14243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114261.1 protein_id gnl|my_center|LOCUS_10300 14365 16269 gene locus_tag LOCUS_10310 gene htpG 14365 16269 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087446.1 protein_id gnl|my_center|LOCUS_10310 16767 16333 gene locus_tag LOCUS_10320 16767 16333 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582738.1 protein_id gnl|my_center|LOCUS_10320 16968 17993 gene locus_tag LOCUS_10330 16968 17993 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097898.1 protein_id gnl|my_center|LOCUS_10330 18058 18528 gene locus_tag LOCUS_10340 18058 18528 CDS product DUF3859 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087466.1 protein_id gnl|my_center|LOCUS_10340 18683 19270 gene locus_tag LOCUS_10350 18683 19270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10350 19258 20307 gene locus_tag LOCUS_10360 19258 20307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10360 20462 22045 gene locus_tag LOCUS_10370 20462 22045 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109962.1 protein_id gnl|my_center|LOCUS_10370 22223 23461 gene locus_tag LOCUS_10380 gene sstT 22223 23461 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114881.1 protein_id gnl|my_center|LOCUS_10380 24743 23526 gene locus_tag LOCUS_10390 gene fabB 24743 23526 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_10390 25270 24755 gene locus_tag LOCUS_10400 gene fabA 25270 24755 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087475.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence029 424 1635 gene locus_tag LOCUS_10410 424 1635 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174809.1 protein_id gnl|my_center|LOCUS_10410 2981 2043 gene locus_tag LOCUS_10420 2981 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 3142 3300 gene locus_tag LOCUS_10430 3142 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 3360 3638 gene locus_tag LOCUS_10440 3360 3638 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015547.1 protein_id gnl|my_center|LOCUS_10440 3629 4510 gene locus_tag LOCUS_10450 3629 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10450 4595 4924 gene locus_tag LOCUS_10460 4595 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 5584 5015 gene locus_tag LOCUS_10470 5584 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 5967 5587 gene locus_tag LOCUS_10480 5967 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 6474 8393 gene locus_tag LOCUS_10490 6474 8393 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385729.1 protein_id gnl|my_center|LOCUS_10490 8390 9625 gene locus_tag LOCUS_10500 8390 9625 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_10500 9622 9759 gene locus_tag LOCUS_10510 9622 9759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 9756 10325 gene locus_tag LOCUS_10520 9756 10325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 10322 12004 gene locus_tag LOCUS_10530 10322 12004 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811470.1 protein_id gnl|my_center|LOCUS_10530 12234 15416 gene locus_tag LOCUS_10540 12234 15416 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385732.1 protein_id gnl|my_center|LOCUS_10540 16693 22425 gene locus_tag LOCUS_10550 16693 22425 CDS product DUF4011 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090812.1 protein_id gnl|my_center|LOCUS_10550 24345 22837 gene locus_tag LOCUS_10560 24345 22837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 24563 24342 gene locus_tag LOCUS_10570 24563 24342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence030 260 1381 gene locus_tag LOCUS_10580 260 1381 CDS product ISAs1-like element ISEc26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027427.1 protein_id gnl|my_center|LOCUS_10580 1665 2108 gene locus_tag LOCUS_10590 gene msrB 1665 2108 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510038.1 protein_id gnl|my_center|LOCUS_10590 2110 2649 gene locus_tag LOCUS_10600 gene msrA 2110 2649 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510037.1 protein_id gnl|my_center|LOCUS_10600 2790 3494 gene locus_tag LOCUS_10610 2790 3494 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265698.1 protein_id gnl|my_center|LOCUS_10610 3491 4459 gene locus_tag LOCUS_10620 3491 4459 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921017.1 protein_id gnl|my_center|LOCUS_10620 4831 4664 gene locus_tag LOCUS_10630 4831 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 4907 5920 gene locus_tag LOCUS_10640 4907 5920 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974854.1 protein_id gnl|my_center|LOCUS_10640 5993 6424 gene locus_tag LOCUS_10650 5993 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 6486 6776 gene locus_tag LOCUS_10660 6486 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 6773 6970 gene locus_tag LOCUS_10670 6773 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 7572 7102 gene locus_tag LOCUS_10680 7572 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 8040 8642 gene locus_tag LOCUS_10690 8040 8642 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528278.1 protein_id gnl|my_center|LOCUS_10690 8635 9381 gene locus_tag LOCUS_10700 8635 9381 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528277.1 protein_id gnl|my_center|LOCUS_10700 9835 10107 gene locus_tag LOCUS_10710 gene grxC 9835 10107 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143672.1 protein_id gnl|my_center|LOCUS_10710 10175 10456 gene locus_tag LOCUS_10720 10175 10456 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057607.1 protein_id gnl|my_center|LOCUS_10720 10626 10892 gene locus_tag LOCUS_10730 10626 10892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 11217 10972 gene locus_tag LOCUS_10740 11217 10972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 12127 11753 gene locus_tag LOCUS_10750 gene sdhC 12127 11753 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104388.1 protein_id gnl|my_center|LOCUS_10750 13672 12608 gene locus_tag LOCUS_10760 13672 12608 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460717.1 protein_id gnl|my_center|LOCUS_10760 13589 13918 gene locus_tag LOCUS_10770 13589 13918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 14505 15023 gene locus_tag LOCUS_10780 14505 15023 CDS product DUF417 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244513.1 protein_id gnl|my_center|LOCUS_10780 15898 15053 gene locus_tag LOCUS_10790 15898 15053 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113225.1 protein_id gnl|my_center|LOCUS_10790 19164 16135 gene locus_tag LOCUS_10800 19164 16135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 19750 19148 gene locus_tag LOCUS_10810 19750 19148 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014408000.1 protein_id gnl|my_center|LOCUS_10810 19942 20319 gene locus_tag LOCUS_10820 19942 20319 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 protein_id gnl|my_center|LOCUS_10820 20300 20635 gene locus_tag LOCUS_10830 20300 20635 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084909.1 protein_id gnl|my_center|LOCUS_10830 20650 20985 gene locus_tag LOCUS_10840 20650 20985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 21009 21335 gene locus_tag LOCUS_10850 21009 21335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100858.1 protein_id gnl|my_center|LOCUS_10850 21332 21712 gene locus_tag LOCUS_10860 21332 21712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100853.1 protein_id gnl|my_center|LOCUS_10860 22063 21800 gene locus_tag LOCUS_10870 22063 21800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 22124 23038 gene locus_tag LOCUS_10880 22124 23038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 23170 24435 gene locus_tag LOCUS_10890 23170 24435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence031 2194 842 gene locus_tag LOCUS_10900 gene rseP 2194 842 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406254.1 protein_id gnl|my_center|LOCUS_10900 3433 2255 gene locus_tag LOCUS_10910 gene ispC 3433 2255 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765988.1 protein_id gnl|my_center|LOCUS_10910 4257 3442 gene locus_tag LOCUS_10920 4257 3442 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103592.1 protein_id gnl|my_center|LOCUS_10920 5012 4251 gene locus_tag LOCUS_10930 gene uppS 5012 4251 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314296.1 protein_id gnl|my_center|LOCUS_10930 5696 5139 gene locus_tag LOCUS_10940 gene frr 5696 5139 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092390.1 protein_id gnl|my_center|LOCUS_10940 6436 5693 gene locus_tag LOCUS_10950 gene pyrH 6436 5693 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092391.1 protein_id gnl|my_center|LOCUS_10950 7499 6636 gene locus_tag LOCUS_10960 gene tsf 7499 6636 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092393.1 protein_id gnl|my_center|LOCUS_10960 8367 7627 gene locus_tag LOCUS_10970 gene rpsB 8367 7627 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092394.1 protein_id gnl|my_center|LOCUS_10970 8654 9436 gene locus_tag LOCUS_10980 gene map 8654 9436 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092395.1 protein_id gnl|my_center|LOCUS_10980 9473 12175 gene locus_tag LOCUS_10990 9473 12175 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245412.1 protein_id gnl|my_center|LOCUS_10990 12547 12218 gene locus_tag LOCUS_11000 12547 12218 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082083.1 protein_id gnl|my_center|LOCUS_11000 12826 12557 gene locus_tag LOCUS_11010 12826 12557 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082079.1 protein_id gnl|my_center|LOCUS_11010 13311 12811 gene locus_tag LOCUS_11020 13311 12811 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112515.1 protein_id gnl|my_center|LOCUS_11020 14807 13308 gene locus_tag LOCUS_11030 14807 13308 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112516.1 protein_id gnl|my_center|LOCUS_11030 15133 14804 gene locus_tag LOCUS_11040 15133 14804 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 protein_id gnl|my_center|LOCUS_11040 17925 15133 gene locus_tag LOCUS_11050 17925 15133 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 protein_id gnl|my_center|LOCUS_11050 18606 18145 gene locus_tag LOCUS_11060 18606 18145 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314430.1 protein_id gnl|my_center|LOCUS_11060 18772 19008 gene locus_tag LOCUS_11070 18772 19008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082053.1 protein_id gnl|my_center|LOCUS_11070 19832 19185 gene locus_tag LOCUS_11080 gene pdxH 19832 19185 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112518.1 protein_id gnl|my_center|LOCUS_11080 20653 20024 gene locus_tag LOCUS_11090 20653 20024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 21937 20789 gene locus_tag LOCUS_11100 21937 20789 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764919.1 protein_id gnl|my_center|LOCUS_11100 24193 22049 gene locus_tag LOCUS_11110 gene dinG 24193 22049 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112522.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence032 990 313 gene locus_tag LOCUS_11120 990 313 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114770.1 protein_id gnl|my_center|LOCUS_11120 1812 1045 gene locus_tag LOCUS_11130 1812 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114771.1 protein_id gnl|my_center|LOCUS_11130 2026 2101 gene locus_tag LOCUS_t00110 2026 2101 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2119 2194 gene locus_tag LOCUS_t00120 2119 2194 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2421 4364 gene locus_tag LOCUS_11140 2421 4364 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039577560.1 protein_id gnl|my_center|LOCUS_11140 5072 4431 gene locus_tag LOCUS_11150 5072 4431 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037262.1 protein_id gnl|my_center|LOCUS_11150 5177 5470 gene locus_tag LOCUS_11160 5177 5470 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038251.1 protein_id gnl|my_center|LOCUS_11160 6390 5497 gene locus_tag LOCUS_11170 6390 5497 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038250.1 protein_id gnl|my_center|LOCUS_11170 7307 6711 gene locus_tag LOCUS_11180 7307 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 7306 7524 gene locus_tag LOCUS_11190 7306 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 7625 7819 gene locus_tag LOCUS_11200 gene golB 7625 7819 CDS product gold resistance metallochaperone GolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159469.1 protein_id gnl|my_center|LOCUS_11200 8262 7894 gene locus_tag LOCUS_11210 8262 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11210 8630 8358 gene locus_tag LOCUS_11220 8630 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11220 9192 8854 gene locus_tag LOCUS_11230 gene fdx 9192 8854 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820620.1 protein_id gnl|my_center|LOCUS_11230 9687 9208 gene locus_tag LOCUS_11240 gene cueR 9687 9208 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975862.1 protein_id gnl|my_center|LOCUS_11240 12132 9703 gene locus_tag LOCUS_11250 12132 9703 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931165.1 protein_id gnl|my_center|LOCUS_11250 12434 12790 gene locus_tag LOCUS_11260 12434 12790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 14327 12900 gene locus_tag LOCUS_11270 gene lpdA 14327 12900 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065168.1 protein_id gnl|my_center|LOCUS_11270 14885 14433 gene locus_tag LOCUS_11280 14885 14433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 18031 14885 gene locus_tag LOCUS_11290 18031 14885 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_11290 19160 18045 gene locus_tag LOCUS_11300 19160 18045 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 protein_id gnl|my_center|LOCUS_11300 19708 19157 gene locus_tag LOCUS_11310 19708 19157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 21071 19743 gene locus_tag LOCUS_11320 21071 19743 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201245837.1 protein_id gnl|my_center|LOCUS_11320 21354 21611 gene locus_tag LOCUS_11330 21354 21611 CDS product nickel-sensing transcriptional repressor NcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196355.1 protein_id gnl|my_center|LOCUS_11330 21621 22931 gene locus_tag LOCUS_11340 21621 22931 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967861.1 protein_id gnl|my_center|LOCUS_11340 23065 24087 gene locus_tag LOCUS_11350 23065 24087 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836264.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence033 <1 1104 gene locus_tag LOCUS_11360 <1 1104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003377895.1:F0F1 ATP synthase subunit alpha 1155 2021 gene locus_tag LOCUS_11370 gene atpG 1155 2021 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_11370 2052 3428 gene locus_tag LOCUS_11380 gene atpD 2052 3428 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097130.1 protein_id gnl|my_center|LOCUS_11380 3504 3932 gene locus_tag LOCUS_11390 3504 3932 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004882435.1 protein_id gnl|my_center|LOCUS_11390 4076 5434 gene locus_tag LOCUS_11400 gene glmU 4076 5434 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269444.1 protein_id gnl|my_center|LOCUS_11400 5529 6140 gene locus_tag LOCUS_11410 gene leuE 5529 6140 CDS product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457190.1 protein_id gnl|my_center|LOCUS_11410 6239 7021 gene locus_tag LOCUS_11420 6239 7021 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114653.1 protein_id gnl|my_center|LOCUS_11420 7024 8874 gene locus_tag LOCUS_11430 gene glmS 7024 8874 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269442.1 protein_id gnl|my_center|LOCUS_11430 9489 8935 gene locus_tag LOCUS_11440 9489 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 11887 9482 gene locus_tag LOCUS_11450 11887 9482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 12427 11951 gene locus_tag LOCUS_11460 12427 11951 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316403.1 protein_id gnl|my_center|LOCUS_11460 13209 12427 gene locus_tag LOCUS_11470 13209 12427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11470 14697 13222 gene locus_tag LOCUS_11480 14697 13222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11480 14929 15336 gene locus_tag LOCUS_11490 14929 15336 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768316.1 protein_id gnl|my_center|LOCUS_11490 15417 15791 gene locus_tag LOCUS_11500 15417 15791 CDS product DUF3301 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401310.1 protein_id gnl|my_center|LOCUS_11500 16783 15797 gene locus_tag LOCUS_11510 16783 15797 CDS product CobW family GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269408.1 protein_id gnl|my_center|LOCUS_11510 16855 17217 gene locus_tag LOCUS_11520 16855 17217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099679.1 protein_id gnl|my_center|LOCUS_11520 17790 17260 gene locus_tag LOCUS_11530 17790 17260 CDS product DUF3617 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401328.1 protein_id gnl|my_center|LOCUS_11530 17956 18471 gene locus_tag LOCUS_11540 17956 18471 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088185.1 protein_id gnl|my_center|LOCUS_11540 18471 19433 gene locus_tag LOCUS_11550 18471 19433 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113764.1 protein_id gnl|my_center|LOCUS_11550 19533 22022 gene locus_tag LOCUS_11560 gene foxA 19533 22022 CDS product ferrioxamine receptor FoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113289.1 protein_id gnl|my_center|LOCUS_11560 22093 23298 gene locus_tag LOCUS_11570 22093 23298 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113288.1 protein_id gnl|my_center|LOCUS_11570 23955 23320 gene locus_tag LOCUS_11580 gene senC 23955 23320 CDS product cytochrome c oxidase copper chaperone SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence034 1175 852 gene locus_tag LOCUS_11590 1175 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1111 1491 gene locus_tag LOCUS_11600 1111 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11600 1783 3036 gene locus_tag LOCUS_11610 1783 3036 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088939.1 protein_id gnl|my_center|LOCUS_11610 3051 3968 gene locus_tag LOCUS_11620 3051 3968 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113650.1 protein_id gnl|my_center|LOCUS_11620 3965 4768 gene locus_tag LOCUS_11630 3965 4768 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010204659.1 protein_id gnl|my_center|LOCUS_11630 4765 6009 gene locus_tag LOCUS_11640 gene clsB 4765 6009 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113648.1 protein_id gnl|my_center|LOCUS_11640 6006 7013 gene locus_tag LOCUS_11650 6006 7013 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268326.1 protein_id gnl|my_center|LOCUS_11650 9471 7258 gene locus_tag LOCUS_11660 gene glgB 9471 7258 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104179.1 protein_id gnl|my_center|LOCUS_11660 12790 9464 gene locus_tag LOCUS_11670 gene treS 12790 9464 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267720.1 protein_id gnl|my_center|LOCUS_11670 14937 12925 gene locus_tag LOCUS_11680 14937 12925 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267719.1 protein_id gnl|my_center|LOCUS_11680 14088 14165 gene locus_tag LOCUS_t00130 14088 14165 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15023 15421 gene locus_tag LOCUS_11690 15023 15421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 16372 15425 gene locus_tag LOCUS_11700 gene fdhE 16372 15425 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027720.1 protein_id gnl|my_center|LOCUS_11700 17099 16395 gene locus_tag LOCUS_11710 17099 16395 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095316.1 protein_id gnl|my_center|LOCUS_11710 18034 17096 gene locus_tag LOCUS_11720 gene fdxH 18034 17096 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106793.1 protein_id gnl|my_center|LOCUS_11720 21110 18045 gene locus_tag LOCUS_11730 gene fdnG 21110 18045 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895684.1 transl_except (pos:complement(20517..20519),aa:Sec) note codon on position 198 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_11730 22199 21279 gene locus_tag LOCUS_11740 22199 21279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 23159 22203 gene locus_tag LOCUS_11750 23159 22203 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268304.1 protein_id gnl|my_center|LOCUS_11750 24050 23193 gene locus_tag LOCUS_11760 24050 23193 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113640.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence035 359 1456 gene locus_tag LOCUS_11770 gene spuD 359 1456 CDS product putrescine-binding protein SpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084299.1 protein_id gnl|my_center|LOCUS_11770 1673 1440 gene locus_tag LOCUS_11780 1673 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1734 2819 gene locus_tag LOCUS_11790 1734 2819 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269272.1 protein_id gnl|my_center|LOCUS_11790 2967 4118 gene locus_tag LOCUS_11800 gene potA 2967 4118 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084303.1 protein_id gnl|my_center|LOCUS_11800 4115 5011 gene locus_tag LOCUS_11810 4115 5011 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121722.1 protein_id gnl|my_center|LOCUS_11810 5008 5910 gene locus_tag LOCUS_11820 5008 5910 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407356.1 protein_id gnl|my_center|LOCUS_11820 7367 6111 gene locus_tag LOCUS_11830 7367 6111 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973818.1 protein_id gnl|my_center|LOCUS_11830 8185 7361 gene locus_tag LOCUS_11840 8185 7361 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973817.1 protein_id gnl|my_center|LOCUS_11840 8973 8182 gene locus_tag LOCUS_11850 8973 8182 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973816.1 protein_id gnl|my_center|LOCUS_11850 9962 8970 gene locus_tag LOCUS_11860 9962 8970 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973815.1 protein_id gnl|my_center|LOCUS_11860 12025 9962 gene locus_tag LOCUS_11870 12025 9962 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209062.1 protein_id gnl|my_center|LOCUS_11870 12710 12141 gene locus_tag LOCUS_11880 12710 12141 CDS product DUF6436 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352065.1 protein_id gnl|my_center|LOCUS_11880 12796 13734 gene locus_tag LOCUS_11890 12796 13734 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_11890 14512 13748 gene locus_tag LOCUS_11900 14512 13748 CDS product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420191.1 protein_id gnl|my_center|LOCUS_11900 14668 15276 gene locus_tag LOCUS_11910 14668 15276 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024666025.1 protein_id gnl|my_center|LOCUS_11910 16638 15358 gene locus_tag LOCUS_11920 gene dctM 16638 15358 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105529.1 protein_id gnl|my_center|LOCUS_11920 17264 16635 gene locus_tag LOCUS_11930 gene dctQ 17264 16635 CDS product C4-dicarboxylate TRAP transporter small permease protein DctQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105527.1 protein_id gnl|my_center|LOCUS_11930 18297 17530 gene locus_tag LOCUS_11940 gene dctP 18297 17530 CDS product C4-dicarboxylate TRAP substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105525.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11940 18524 18264 gene locus_tag LOCUS_11950 18524 18264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11950 20264 18870 gene locus_tag LOCUS_11960 20264 18870 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406997.1 protein_id gnl|my_center|LOCUS_11960 22066 20261 gene locus_tag LOCUS_11970 22066 20261 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246575.1 protein_id gnl|my_center|LOCUS_11970 <22690 22172 gene locus_tag LOCUS_11980 <22690 22172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035867.1:dTDP-4-dehydrorhamnose reductase >Feature sequence036 697 344 gene locus_tag LOCUS_11990 697 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 994 2694 gene locus_tag LOCUS_12000 gene kdpA 994 2694 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097846.1 protein_id gnl|my_center|LOCUS_12000 2706 4757 gene locus_tag LOCUS_12010 gene kdpB 2706 4757 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097844.1 protein_id gnl|my_center|LOCUS_12010 4800 5366 gene locus_tag LOCUS_12020 gene kdpC 4800 5366 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087529.1 protein_id gnl|my_center|LOCUS_12020 5372 8041 gene locus_tag LOCUS_12030 5372 8041 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114597.1 protein_id gnl|my_center|LOCUS_12030 8038 8733 gene locus_tag LOCUS_12040 8038 8733 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103914.1 protein_id gnl|my_center|LOCUS_12040 11255 8745 gene locus_tag LOCUS_12050 11255 8745 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_12050 10125 10216 gene locus_tag LOCUS_t00140 10125 10216 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 12424 11327 gene locus_tag LOCUS_12060 12424 11327 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_12060 15682 12563 gene locus_tag LOCUS_12070 15682 12563 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420345.1 protein_id gnl|my_center|LOCUS_12070 15876 16676 gene locus_tag LOCUS_12080 15876 16676 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113300.1 protein_id gnl|my_center|LOCUS_12080 16763 17488 gene locus_tag LOCUS_12090 16763 17488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 17485 17796 gene locus_tag LOCUS_12100 17485 17796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 18443 17802 gene locus_tag LOCUS_12110 18443 17802 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104779.1 protein_id gnl|my_center|LOCUS_12110 18930 21395 gene locus_tag LOCUS_12120 18930 21395 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104680.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence037 86 11 gene locus_tag LOCUS_t00150 86 11 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 928 170 gene locus_tag LOCUS_12130 928 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1353 925 gene locus_tag LOCUS_12140 1353 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 2120 1350 gene locus_tag LOCUS_12150 2120 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 4645 2567 gene locus_tag LOCUS_12160 4645 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 5179 5391 gene locus_tag LOCUS_12170 5179 5391 CDS product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031814.1 protein_id gnl|my_center|LOCUS_12170 5396 5974 gene locus_tag LOCUS_12180 5396 5974 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036824.1 protein_id gnl|my_center|LOCUS_12180 6824 5988 gene locus_tag LOCUS_12190 6824 5988 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268646.1 protein_id gnl|my_center|LOCUS_12190 9189 6856 gene locus_tag LOCUS_12200 9189 6856 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101675329.1 protein_id gnl|my_center|LOCUS_12200 10493 9345 gene locus_tag LOCUS_12210 gene hcuB 10493 9345 CDS product hydrophobic compound transporter HcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112500.1 protein_id gnl|my_center|LOCUS_12210 10671 10850 gene locus_tag LOCUS_12220 10671 10850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109112.1 protein_id gnl|my_center|LOCUS_12220 10935 11660 gene locus_tag LOCUS_12230 10935 11660 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112501.1 protein_id gnl|my_center|LOCUS_12230 11779 12549 gene locus_tag LOCUS_12240 11779 12549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 12628 13179 gene locus_tag LOCUS_12250 12628 13179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363378.1 protein_id gnl|my_center|LOCUS_12250 13391 13203 gene locus_tag LOCUS_12260 13391 13203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 13570 14433 gene locus_tag LOCUS_12270 13570 14433 CDS product DUF6279 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425465.1 protein_id gnl|my_center|LOCUS_12270 18763 14444 gene locus_tag LOCUS_12280 18763 14444 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147933.1 protein_id gnl|my_center|LOCUS_12280 18881 19186 gene locus_tag LOCUS_12290 18881 19186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 19196 19891 gene locus_tag LOCUS_12300 19196 19891 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932977.1 protein_id gnl|my_center|LOCUS_12300 20750 19935 gene locus_tag LOCUS_12310 20750 19935 CDS product OBAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698597.1 protein_id gnl|my_center|LOCUS_12310 20904 22193 gene locus_tag LOCUS_12320 gene egtB 20904 22193 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence038 1302 577 gene locus_tag LOCUS_12330 gene minC 1302 577 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104763.1 protein_id gnl|my_center|LOCUS_12330 1460 2407 gene locus_tag LOCUS_12340 1460 2407 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 protein_id gnl|my_center|LOCUS_12340 3301 2459 gene locus_tag LOCUS_12350 3301 2459 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770654.1 protein_id gnl|my_center|LOCUS_12350 4163 3396 gene locus_tag LOCUS_12360 4163 3396 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402525.1 protein_id gnl|my_center|LOCUS_12360 5448 4156 gene locus_tag LOCUS_12370 5448 4156 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114807.1 protein_id gnl|my_center|LOCUS_12370 5889 5668 gene locus_tag LOCUS_12380 5889 5668 CDS product DUF2061 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091551.1 protein_id gnl|my_center|LOCUS_12380 6169 6483 gene locus_tag LOCUS_12390 6169 6483 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091547.1 protein_id gnl|my_center|LOCUS_12390 6483 8138 gene locus_tag LOCUS_12400 6483 8138 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091546.1 protein_id gnl|my_center|LOCUS_12400 8376 9185 gene locus_tag LOCUS_12410 8376 9185 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114078.1 protein_id gnl|my_center|LOCUS_12410 9290 10447 gene locus_tag LOCUS_12420 9290 10447 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114593.1 protein_id gnl|my_center|LOCUS_12420 10560 10988 gene locus_tag LOCUS_12430 10560 10988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091617.1 protein_id gnl|my_center|LOCUS_12430 11228 11001 gene locus_tag LOCUS_12440 11228 11001 CDS product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004879420.1 protein_id gnl|my_center|LOCUS_12440 14004 11260 gene locus_tag LOCUS_12450 14004 11260 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115063.1 protein_id gnl|my_center|LOCUS_12450 15406 14201 gene locus_tag LOCUS_12460 15406 14201 CDS product osmoprotectant NAGGN system M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767612.1 protein_id gnl|my_center|LOCUS_12460 17271 15532 gene locus_tag LOCUS_12470 gene ngg 17271 15532 CDS product N-acetylglutaminylglutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767614.1 protein_id gnl|my_center|LOCUS_12470 19025 17409 gene locus_tag LOCUS_12480 19025 17409 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103637.1 protein_id gnl|my_center|LOCUS_12480 19041 19220 gene locus_tag LOCUS_12490 19041 19220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 19357 19830 gene locus_tag LOCUS_12500 19357 19830 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091943.1 protein_id gnl|my_center|LOCUS_12500 21564 19837 gene locus_tag LOCUS_12510 21564 19837 CDS product S8/S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086721.1 protein_id gnl|my_center|LOCUS_12510 <22371 21610 gene locus_tag LOCUS_12520 <22371 21610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967207.1:L-histidine N(alpha)-methyltransferase >Feature sequence039 329 934 gene locus_tag LOCUS_12530 329 934 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113918.1 protein_id gnl|my_center|LOCUS_12530 1073 2959 gene locus_tag LOCUS_12540 gene parE 1073 2959 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102062.1 protein_id gnl|my_center|LOCUS_12540 2956 3939 gene locus_tag LOCUS_12550 2956 3939 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095689.1 protein_id gnl|my_center|LOCUS_12550 3936 4463 gene locus_tag LOCUS_12560 3936 4463 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054081306.1 protein_id gnl|my_center|LOCUS_12560 4460 6712 gene locus_tag LOCUS_12570 gene parC 4460 6712 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_12570 6895 7602 gene locus_tag LOCUS_12580 6895 7602 CDS product PqiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024661443.1 protein_id gnl|my_center|LOCUS_12580 9244 7757 gene locus_tag LOCUS_12590 9244 7757 CDS product AhpA/YtjB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102052.1 protein_id gnl|my_center|LOCUS_12590 9479 10693 gene locus_tag LOCUS_12600 gene serB 9479 10693 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 protein_id gnl|my_center|LOCUS_12600 11815 10742 gene locus_tag LOCUS_12610 11815 10742 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113628.1 protein_id gnl|my_center|LOCUS_12610 14015 11949 gene locus_tag LOCUS_12620 gene fimX 14015 11949 CDS product cyclic di-GMP-binding protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_12620 15918 14077 gene locus_tag LOCUS_12630 gene fimW 15918 14077 CDS product cyclic-di-GMP receptor FimW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113922.1 protein_id gnl|my_center|LOCUS_12630 16956 16063 gene locus_tag LOCUS_12640 16956 16063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 17783 16968 gene locus_tag LOCUS_12650 gene rhdA 17783 16968 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113925.1 protein_id gnl|my_center|LOCUS_12650 19354 17831 gene locus_tag LOCUS_12660 19354 17831 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105242.1 protein_id gnl|my_center|LOCUS_12660 19519 20370 gene locus_tag LOCUS_12670 gene motA 19519 20370 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102044.1 protein_id gnl|my_center|LOCUS_12670 20380 21390 gene locus_tag LOCUS_12680 gene motB 20380 21390 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095673.1 protein_id gnl|my_center|LOCUS_12680 <22141 21403 gene locus_tag LOCUS_12690 <22141 21403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113927.1:small ribosomal subunit biogenesis GTPase RsgA >Feature sequence040 53 598 gene locus_tag LOCUS_12700 gene lptA 53 598 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120916.1 protein_id gnl|my_center|LOCUS_12700 598 1323 gene locus_tag LOCUS_12710 gene lptB 598 1323 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094355.1 protein_id gnl|my_center|LOCUS_12710 1470 2978 gene locus_tag LOCUS_12720 1470 2978 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377556.1 protein_id gnl|my_center|LOCUS_12720 3053 3361 gene locus_tag LOCUS_12730 gene raiA 3053 3361 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 protein_id gnl|my_center|LOCUS_12730 3370 3834 gene locus_tag LOCUS_12740 gene ptsN 3370 3834 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098853.1 protein_id gnl|my_center|LOCUS_12740 3850 4707 gene locus_tag LOCUS_12750 gene rapZ 3850 4707 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268862.1 protein_id gnl|my_center|LOCUS_12750 4722 4994 gene locus_tag LOCUS_12760 4722 4994 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400240.1 protein_id gnl|my_center|LOCUS_12760 6391 5045 gene locus_tag LOCUS_12770 gene pmbA 6391 5045 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112740.1 protein_id gnl|my_center|LOCUS_12770 6507 7028 gene locus_tag LOCUS_12780 gene yjgA 6507 7028 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094378.1 protein_id gnl|my_center|LOCUS_12780 8528 7086 gene locus_tag LOCUS_12790 gene tldD 8528 7086 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 protein_id gnl|my_center|LOCUS_12790 9376 8531 gene locus_tag LOCUS_12800 9376 8531 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112739.1 protein_id gnl|my_center|LOCUS_12800 13220 9420 gene locus_tag LOCUS_12810 13220 9420 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105014.1 protein_id gnl|my_center|LOCUS_12810 14727 13270 gene locus_tag LOCUS_12820 gene rng 14727 13270 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_12820 15405 14815 gene locus_tag LOCUS_12830 15405 14815 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112737.1 protein_id gnl|my_center|LOCUS_12830 16652 15504 gene locus_tag LOCUS_12840 16652 15504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 17320 16832 gene locus_tag LOCUS_12850 gene mreD 17320 16832 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094389.1 protein_id gnl|my_center|LOCUS_12850 18288 17317 gene locus_tag LOCUS_12860 gene mreC 18288 17317 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123307.1 protein_id gnl|my_center|LOCUS_12860 19451 18414 gene locus_tag LOCUS_12870 gene mreB 19451 18414 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094393.1 protein_id gnl|my_center|LOCUS_12870 19770 20057 gene locus_tag LOCUS_12880 gene gatC 19770 20057 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_12880 20057 21523 gene locus_tag LOCUS_12890 gene gatA 20057 21523 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112871.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence041 470 1354 gene locus_tag LOCUS_12900 470 1354 CDS product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032621927.1 protein_id gnl|my_center|LOCUS_12900 1347 2276 gene locus_tag LOCUS_12910 1347 2276 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400349.1 protein_id gnl|my_center|LOCUS_12910 3033 2347 gene locus_tag LOCUS_12920 3033 2347 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768999.1 protein_id gnl|my_center|LOCUS_12920 3218 4003 gene locus_tag LOCUS_12930 3218 4003 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_12930 4000 5346 gene locus_tag LOCUS_12940 4000 5346 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707200.1 protein_id gnl|my_center|LOCUS_12940 5339 5884 gene locus_tag LOCUS_12950 5339 5884 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_12950 5896 6309 gene locus_tag LOCUS_12960 5896 6309 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_12960 6309 7022 gene locus_tag LOCUS_12970 6309 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 7024 8115 gene locus_tag LOCUS_12980 7024 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 8678 8166 gene locus_tag LOCUS_12990 8678 8166 CDS product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769001.1 protein_id gnl|my_center|LOCUS_12990 9952 8687 gene locus_tag LOCUS_13000 9952 8687 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_13000 10663 9956 gene locus_tag LOCUS_13010 10663 9956 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093325.1 protein_id gnl|my_center|LOCUS_13010 11295 10681 gene locus_tag LOCUS_13020 11295 10681 CDS product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113048.1 protein_id gnl|my_center|LOCUS_13020 11403 11789 gene locus_tag LOCUS_13030 11403 11789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105273.1 protein_id gnl|my_center|LOCUS_13030 12652 11783 gene locus_tag LOCUS_13040 gene trxA 12652 11783 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105274.1 protein_id gnl|my_center|LOCUS_13040 12859 14085 gene locus_tag LOCUS_13050 gene yedE 12859 14085 CDS product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098565.1 protein_id gnl|my_center|LOCUS_13050 14054 14293 gene locus_tag LOCUS_13060 gene yedF 14054 14293 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092358.1 protein_id gnl|my_center|LOCUS_13060 14834 14313 gene locus_tag LOCUS_13070 gene thpR 14834 14313 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115273.1 protein_id gnl|my_center|LOCUS_13070 15503 14850 gene locus_tag LOCUS_13080 15503 14850 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269047.1 protein_id gnl|my_center|LOCUS_13080 15925 15500 gene locus_tag LOCUS_13090 15925 15500 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379143.1 protein_id gnl|my_center|LOCUS_13090 16039 16506 gene locus_tag LOCUS_13100 gene nrdR 16039 16506 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107181.1 protein_id gnl|my_center|LOCUS_13100 16503 17603 gene locus_tag LOCUS_13110 gene ribD 16503 17603 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113051.1 protein_id gnl|my_center|LOCUS_13110 18141 18803 gene locus_tag LOCUS_13120 18141 18803 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103236.1 protein_id gnl|my_center|LOCUS_13120 18815 19894 gene locus_tag LOCUS_13130 gene ribBA 18815 19894 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103237.1 protein_id gnl|my_center|LOCUS_13130 19954 20430 gene locus_tag LOCUS_13140 gene ribE 19954 20430 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093311.1 protein_id gnl|my_center|LOCUS_13140 20427 20912 gene locus_tag LOCUS_13150 gene nusB 20427 20912 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence042 1081 209 gene locus_tag LOCUS_13160 1081 209 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 protein_id gnl|my_center|LOCUS_13160 1230 2657 gene locus_tag LOCUS_13170 gene leuC 1230 2657 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038430.1 protein_id gnl|my_center|LOCUS_13170 2669 3316 gene locus_tag LOCUS_13180 gene leuD 2669 3316 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091398.1 protein_id gnl|my_center|LOCUS_13180 3500 4582 gene locus_tag LOCUS_13190 gene leuB 3500 4582 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091395.1 protein_id gnl|my_center|LOCUS_13190 4637 5749 gene locus_tag LOCUS_13200 gene asd 4637 5749 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111187.1 protein_id gnl|my_center|LOCUS_13200 6510 5851 gene locus_tag LOCUS_13210 6510 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 6472 6894 gene locus_tag LOCUS_13220 6472 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 7039 9783 gene locus_tag LOCUS_13230 gene fimV 7039 9783 CDS product motility hub landmark protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_13230 9786 10646 gene locus_tag LOCUS_13240 gene truA 9786 10646 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091390.1 protein_id gnl|my_center|LOCUS_13240 10729 11352 gene locus_tag LOCUS_13250 10729 11352 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_13250 11568 12461 gene locus_tag LOCUS_13260 gene accD 11568 12461 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104199.1 protein_id gnl|my_center|LOCUS_13260 12458 13762 gene locus_tag LOCUS_13270 gene folC 12458 13762 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115014.1 protein_id gnl|my_center|LOCUS_13270 13737 14372 gene locus_tag LOCUS_13280 13737 14372 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147893.1 protein_id gnl|my_center|LOCUS_13280 14504 15016 gene locus_tag LOCUS_13290 14504 15016 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 protein_id gnl|my_center|LOCUS_13290 15088 16593 gene locus_tag LOCUS_13300 gene purF 15088 16593 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347797.1 protein_id gnl|my_center|LOCUS_13300 16634 17845 gene locus_tag LOCUS_13310 16634 17845 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_13310 19869 17935 gene locus_tag LOCUS_13320 gene xcpQ 19869 17935 CDS product GspD family T2SS secretin variant XcpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113934.1 protein_id gnl|my_center|LOCUS_13320 20517 19873 gene locus_tag LOCUS_13330 gene xcpP 20517 19873 CDS product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119750.1 protein_id gnl|my_center|LOCUS_13330 20774 20849 gene locus_tag LOCUS_t00160 20774 20849 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 20887 20963 gene locus_tag LOCUS_t00170 20887 20963 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence043 1389 70 gene locus_tag LOCUS_13340 gene chrA 1389 70 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_13340 2326 1382 gene locus_tag LOCUS_13350 2326 1382 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196334.1 protein_id gnl|my_center|LOCUS_13350 3326 2400 gene locus_tag LOCUS_13360 3326 2400 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201417992.1 protein_id gnl|my_center|LOCUS_13360 4688 3462 gene locus_tag LOCUS_13370 4688 3462 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275407.1 protein_id gnl|my_center|LOCUS_13370 5040 7061 gene locus_tag LOCUS_13380 5040 7061 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966949.1 protein_id gnl|my_center|LOCUS_13380 8951 7104 gene locus_tag LOCUS_13390 8951 7104 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_13390 9193 10149 gene locus_tag LOCUS_13400 9193 10149 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669105.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13400 10146 10622 gene locus_tag LOCUS_13410 10146 10622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112531.1 protein_id gnl|my_center|LOCUS_13410 12651 10705 gene locus_tag LOCUS_13420 12651 10705 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104028.1 protein_id gnl|my_center|LOCUS_13420 12840 13052 gene locus_tag LOCUS_13430 12840 13052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 14313 13084 gene locus_tag LOCUS_13440 14313 13084 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207754.1 protein_id gnl|my_center|LOCUS_13440 14511 14834 gene locus_tag LOCUS_13450 14511 14834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 14908 15633 gene locus_tag LOCUS_13460 14908 15633 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072997.1 protein_id gnl|my_center|LOCUS_13460 17626 16700 gene locus_tag LOCUS_13470 17626 16700 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414641.1 protein_id gnl|my_center|LOCUS_13470 18798 17692 gene locus_tag LOCUS_13480 18798 17692 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245542.1 protein_id gnl|my_center|LOCUS_13480 20367 18811 gene locus_tag LOCUS_13490 20367 18811 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103272.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence044 836 1339 gene locus_tag LOCUS_13500 836 1339 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378342.1 protein_id gnl|my_center|LOCUS_13500 1453 1797 gene locus_tag LOCUS_13510 1453 1797 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101229.1 protein_id gnl|my_center|LOCUS_13510 2552 1845 gene locus_tag LOCUS_13520 2552 1845 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895592.1 protein_id gnl|my_center|LOCUS_13520 2680 3513 gene locus_tag LOCUS_13530 2680 3513 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_13530 4857 3520 gene locus_tag LOCUS_13540 4857 3520 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925621.1 protein_id gnl|my_center|LOCUS_13540 5138 5524 gene locus_tag LOCUS_13550 5138 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 6463 5537 gene locus_tag LOCUS_13560 6463 5537 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316999.1 protein_id gnl|my_center|LOCUS_13560 7599 6463 gene locus_tag LOCUS_13570 7599 6463 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266763.1 protein_id gnl|my_center|LOCUS_13570 9169 7592 gene locus_tag LOCUS_13580 9169 7592 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103450.1 protein_id gnl|my_center|LOCUS_13580 10263 9166 gene locus_tag LOCUS_13590 10263 9166 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103449.1 protein_id gnl|my_center|LOCUS_13590 10676 10290 gene locus_tag LOCUS_13600 10676 10290 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104311.1 protein_id gnl|my_center|LOCUS_13600 11683 10673 gene locus_tag LOCUS_13610 11683 10673 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104312.1 protein_id gnl|my_center|LOCUS_13610 12103 13659 gene locus_tag LOCUS_13620 12103 13659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 13902 14351 gene locus_tag LOCUS_13630 13902 14351 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765365.1 protein_id gnl|my_center|LOCUS_13630 14348 15646 gene locus_tag LOCUS_13640 14348 15646 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104674.1 protein_id gnl|my_center|LOCUS_13640 16103 15699 gene locus_tag LOCUS_13650 16103 15699 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728875.1 protein_id gnl|my_center|LOCUS_13650 16292 16684 gene locus_tag LOCUS_13660 16292 16684 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919370.1 protein_id gnl|my_center|LOCUS_13660 16813 17271 gene locus_tag LOCUS_13670 16813 17271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 17772 17314 gene locus_tag LOCUS_13680 17772 17314 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 protein_id gnl|my_center|LOCUS_13680 17867 18673 gene locus_tag LOCUS_13690 17867 18673 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100223.1 protein_id gnl|my_center|LOCUS_13690 18833 19822 gene locus_tag LOCUS_13700 18833 19822 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113607.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence045 452 727 gene locus_tag LOCUS_13710 452 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1766 861 gene locus_tag LOCUS_13720 1766 861 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762608.1 protein_id gnl|my_center|LOCUS_13720 2765 1833 gene locus_tag LOCUS_13730 2765 1833 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762619.1 protein_id gnl|my_center|LOCUS_13730 4235 2862 gene locus_tag LOCUS_13740 4235 2862 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895625.1 protein_id gnl|my_center|LOCUS_13740 5139 4327 gene locus_tag LOCUS_13750 gene xthA 5139 4327 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104469.1 protein_id gnl|my_center|LOCUS_13750 5360 5995 gene locus_tag LOCUS_13760 5360 5995 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345438.1 protein_id gnl|my_center|LOCUS_13760 6146 7879 gene locus_tag LOCUS_13770 6146 7879 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402770.1 protein_id gnl|my_center|LOCUS_13770 7876 11556 gene locus_tag LOCUS_13780 7876 11556 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463502.1 protein_id gnl|my_center|LOCUS_13780 12038 13381 gene locus_tag LOCUS_13790 12038 13381 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_13790 13518 14018 gene locus_tag LOCUS_13800 gene tpx 13518 14018 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089950.1 protein_id gnl|my_center|LOCUS_13800 14281 15513 gene locus_tag LOCUS_13810 14281 15513 CDS product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337933.1 protein_id gnl|my_center|LOCUS_13810 17082 15616 gene locus_tag LOCUS_13820 gene murJ 17082 15616 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020041.1 protein_id gnl|my_center|LOCUS_13820 17358 18602 gene locus_tag LOCUS_13830 17358 18602 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762525.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence046 392 66 gene locus_tag LOCUS_13840 392 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 828 664 gene locus_tag LOCUS_13850 828 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 6335 1209 gene locus_tag LOCUS_13860 6335 1209 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235238.1 protein_id gnl|my_center|LOCUS_13860 7834 6848 gene locus_tag LOCUS_13870 7834 6848 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 protein_id gnl|my_center|LOCUS_13870 8421 7882 gene locus_tag LOCUS_13880 8421 7882 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267941.1 protein_id gnl|my_center|LOCUS_13880 9874 8855 gene locus_tag LOCUS_13890 9874 8855 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142257.1 protein_id gnl|my_center|LOCUS_13890 10178 9885 gene locus_tag LOCUS_13900 10178 9885 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104358.1 protein_id gnl|my_center|LOCUS_13900 11266 10277 gene locus_tag LOCUS_13910 11266 10277 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902587.1 protein_id gnl|my_center|LOCUS_13910 12484 11393 gene locus_tag LOCUS_13920 12484 11393 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267490.1 protein_id gnl|my_center|LOCUS_13920 12553 12870 gene locus_tag LOCUS_13930 12553 12870 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770289.1 protein_id gnl|my_center|LOCUS_13930 12878 13207 gene locus_tag LOCUS_13940 12878 13207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 13419 13880 gene locus_tag LOCUS_13950 13419 13880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 14077 13877 gene locus_tag LOCUS_13960 14077 13877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 14114 14323 gene locus_tag LOCUS_13970 14114 14323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 14320 14460 gene locus_tag LOCUS_13980 14320 14460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 14610 14972 gene locus_tag LOCUS_13990 14610 14972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 15564 15256 gene locus_tag LOCUS_14000 15564 15256 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112569.1 protein_id gnl|my_center|LOCUS_14000 15827 16966 gene locus_tag LOCUS_14010 15827 16966 CDS product glutathione-independent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405501.1 protein_id gnl|my_center|LOCUS_14010 18055 17750 gene locus_tag LOCUS_14020 18055 17750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 18268 18068 gene locus_tag LOCUS_14030 18268 18068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 18703 19827 gene locus_tag LOCUS_14040 18703 19827 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112378.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence047 381 1379 gene locus_tag LOCUS_14050 381 1379 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084243.1 protein_id gnl|my_center|LOCUS_14050 1565 2383 gene locus_tag LOCUS_14060 gene cysT 1565 2383 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084241.1 protein_id gnl|my_center|LOCUS_14060 2394 3269 gene locus_tag LOCUS_14070 gene cysW 2394 3269 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084239.1 protein_id gnl|my_center|LOCUS_14070 3266 4252 gene locus_tag LOCUS_14080 3266 4252 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084237.1 protein_id gnl|my_center|LOCUS_14080 4256 5338 gene locus_tag LOCUS_14090 4256 5338 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112591.1 protein_id gnl|my_center|LOCUS_14090 6008 5328 gene locus_tag LOCUS_14100 6008 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 6541 6005 gene locus_tag LOCUS_14110 6541 6005 CDS product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401267.1 protein_id gnl|my_center|LOCUS_14110 6846 6595 gene locus_tag LOCUS_14120 6846 6595 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096795.1 protein_id gnl|my_center|LOCUS_14120 8016 6931 gene locus_tag LOCUS_14130 8016 6931 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105529.1 protein_id gnl|my_center|LOCUS_14130 8580 8092 gene locus_tag LOCUS_14140 gene purE 8580 8092 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106314.1 protein_id gnl|my_center|LOCUS_14140 11233 8741 gene locus_tag LOCUS_14150 11233 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 13276 11351 gene locus_tag LOCUS_14160 13276 11351 CDS product bifunctional sugar phosphate isomerase/epimerase/4-hydroxyphenylpyruvate dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738807.1 protein_id gnl|my_center|LOCUS_14160 16080 13345 gene locus_tag LOCUS_14170 16080 13345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 15995 16252 gene locus_tag LOCUS_14180 15995 16252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 17180 16272 gene locus_tag LOCUS_14190 17180 16272 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096819.1 protein_id gnl|my_center|LOCUS_14190 17343 18767 gene locus_tag LOCUS_14200 gene aspA 17343 18767 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096822.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence048 86 853 gene locus_tag LOCUS_14210 gene livG 86 853 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082125.1 protein_id gnl|my_center|LOCUS_14210 856 1557 gene locus_tag LOCUS_14220 856 1557 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764926.1 protein_id gnl|my_center|LOCUS_14220 1722 2528 gene locus_tag LOCUS_14230 1722 2528 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112467.1 protein_id gnl|my_center|LOCUS_14230 2625 3065 gene locus_tag LOCUS_14240 2625 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112592.1 protein_id gnl|my_center|LOCUS_14240 3062 3463 gene locus_tag LOCUS_14250 3062 3463 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407731.1 protein_id gnl|my_center|LOCUS_14250 4872 3790 gene locus_tag LOCUS_14260 gene dinB 4872 3790 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406165.1 protein_id gnl|my_center|LOCUS_14260 4952 5203 gene locus_tag LOCUS_14270 4952 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 5663 5214 gene locus_tag LOCUS_14280 5663 5214 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 protein_id gnl|my_center|LOCUS_14280 5931 5856 gene locus_tag LOCUS_t00180 5931 5856 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6049 5974 gene locus_tag LOCUS_t00190 6049 5974 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6168 6093 gene locus_tag LOCUS_t00200 6168 6093 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6309 6234 gene locus_tag LOCUS_t00210 6309 6234 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7958 6477 gene locus_tag LOCUS_14290 gene gltX 7958 6477 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104596.1 protein_id gnl|my_center|LOCUS_14290 10132 8117 gene locus_tag LOCUS_14300 gene uvrB 10132 8117 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769676.1 protein_id gnl|my_center|LOCUS_14300 10334 11626 gene locus_tag LOCUS_14310 10334 11626 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104588.1 protein_id gnl|my_center|LOCUS_14310 11726 11801 gene locus_tag LOCUS_t00220 11726 11801 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 12571 12209 gene locus_tag LOCUS_14320 12571 12209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 13090 12764 gene locus_tag LOCUS_14330 gene grxD 13090 12764 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092082.1 protein_id gnl|my_center|LOCUS_14330 13365 14285 gene locus_tag LOCUS_14340 gene argF 13365 14285 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092090.1 protein_id gnl|my_center|LOCUS_14340 14282 15379 gene locus_tag LOCUS_14350 14282 15379 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044390643.1 protein_id gnl|my_center|LOCUS_14350 15858 15376 gene locus_tag LOCUS_14360 gene tadA 15858 15376 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247479.1 protein_id gnl|my_center|LOCUS_14360 17248 15878 gene locus_tag LOCUS_14370 17248 15878 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406430.1 protein_id gnl|my_center|LOCUS_14370 17135 17404 gene locus_tag LOCUS_14380 17135 17404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 18939 17359 gene locus_tag LOCUS_14390 gene guaA 18939 17359 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266918.1 protein_id gnl|my_center|LOCUS_14390 <19763 19056 gene locus_tag LOCUS_14400 <19763 19056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003380633.1:IMP dehydrogenase >Feature sequence049 5 2122 gene locus_tag LOCUS_14410 gene bglX 5 2122 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054993324.1 protein_id gnl|my_center|LOCUS_14410 2261 3832 gene locus_tag LOCUS_14420 2261 3832 CDS product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095915.1 protein_id gnl|my_center|LOCUS_14420 3843 6401 gene locus_tag LOCUS_14430 gene mdoH 3843 6401 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103448.1 protein_id gnl|my_center|LOCUS_14430 6786 6445 gene locus_tag LOCUS_14440 6786 6445 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092567.1 protein_id gnl|my_center|LOCUS_14440 7016 7714 gene locus_tag LOCUS_14450 7016 7714 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086661.1 protein_id gnl|my_center|LOCUS_14450 7785 8384 gene locus_tag LOCUS_14460 gene wrbA 7785 8384 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211168.1 protein_id gnl|my_center|LOCUS_14460 8907 8422 gene locus_tag LOCUS_14470 8907 8422 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385392.1 protein_id gnl|my_center|LOCUS_14470 9085 9624 gene locus_tag LOCUS_14480 9085 9624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 10293 9637 gene locus_tag LOCUS_14490 10293 9637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 11206 10304 gene locus_tag LOCUS_14500 11206 10304 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109652.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14500 11513 11196 gene locus_tag LOCUS_14510 11513 11196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 12982 11525 gene locus_tag LOCUS_14520 12982 11525 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114867.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14520 13010 13378 gene locus_tag LOCUS_14530 13010 13378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 14069 13587 gene locus_tag LOCUS_14540 14069 13587 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095106.1 protein_id gnl|my_center|LOCUS_14540 14317 14054 gene locus_tag LOCUS_14550 14317 14054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 14527 15210 gene locus_tag LOCUS_14560 14527 15210 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267054.1 protein_id gnl|my_center|LOCUS_14560 15207 16571 gene locus_tag LOCUS_14570 15207 16571 CDS product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267055.1 protein_id gnl|my_center|LOCUS_14570 17894 16572 gene locus_tag LOCUS_14580 17894 16572 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103567.1 protein_id gnl|my_center|LOCUS_14580 18568 17891 gene locus_tag LOCUS_14590 18568 17891 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103570.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence050 995 2404 gene locus_tag LOCUS_14600 995 2404 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167297427.1 protein_id gnl|my_center|LOCUS_14600 2419 3891 gene locus_tag LOCUS_14610 gene amn 2419 3891 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376603.1 protein_id gnl|my_center|LOCUS_14610 5934 3892 gene locus_tag LOCUS_14620 5934 3892 CDS product membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491174.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14620 6303 5944 gene locus_tag LOCUS_14630 6303 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14630 7037 6465 gene locus_tag LOCUS_14640 7037 6465 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368916.1 protein_id gnl|my_center|LOCUS_14640 7680 7066 gene locus_tag LOCUS_14650 gene ureG 7680 7066 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368915.1 protein_id gnl|my_center|LOCUS_14650 9177 8584 gene locus_tag LOCUS_14660 9177 8584 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269042.1 protein_id gnl|my_center|LOCUS_14660 9773 9273 gene locus_tag LOCUS_14670 gene ureE 9773 9273 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095526.1 protein_id gnl|my_center|LOCUS_14670 10440 9937 gene locus_tag LOCUS_14680 10440 9937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 10684 11556 gene locus_tag LOCUS_14690 10684 11556 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 protein_id gnl|my_center|LOCUS_14690 11668 12531 gene locus_tag LOCUS_14700 11668 12531 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121125.1 protein_id gnl|my_center|LOCUS_14700 12597 13751 gene locus_tag LOCUS_14710 12597 13751 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748737.1 protein_id gnl|my_center|LOCUS_14710 14492 13773 gene locus_tag LOCUS_14720 14492 13773 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268648.1 protein_id gnl|my_center|LOCUS_14720 14791 15057 gene locus_tag LOCUS_14730 14791 15057 CDS product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 protein_id gnl|my_center|LOCUS_14730 15318 15058 gene locus_tag LOCUS_14740 15318 15058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14740 16284 15397 gene locus_tag LOCUS_14750 16284 15397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14750 17781 16309 gene locus_tag LOCUS_14760 17781 16309 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268495.1 protein_id gnl|my_center|LOCUS_14760 <19242 18148 gene locus_tag LOCUS_14770 <19242 18148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269033.1:urease subunit alpha >Feature sequence051 215 691 gene locus_tag LOCUS_14780 215 691 CDS product TIGR02444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769473.1 protein_id gnl|my_center|LOCUS_14780 1512 667 gene locus_tag LOCUS_14790 1512 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14790 2078 1617 gene locus_tag LOCUS_14800 gene rsd 2078 1617 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120370.1 protein_id gnl|my_center|LOCUS_14800 2833 2342 gene locus_tag LOCUS_14810 2833 2342 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099230.1 protein_id gnl|my_center|LOCUS_14810 4172 2952 gene locus_tag LOCUS_14820 4172 2952 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_14820 5353 4169 gene locus_tag LOCUS_14830 5353 4169 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103003.1 protein_id gnl|my_center|LOCUS_14830 6140 5370 gene locus_tag LOCUS_14840 6140 5370 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114032.1 protein_id gnl|my_center|LOCUS_14840 7075 6137 gene locus_tag LOCUS_14850 gene hemC 7075 6137 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114031.1 protein_id gnl|my_center|LOCUS_14850 7977 7231 gene locus_tag LOCUS_14860 7977 7231 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401565.1 protein_id gnl|my_center|LOCUS_14860 9032 7974 gene locus_tag LOCUS_14870 gene algZ 9032 7974 CDS product alginate biosynthesis two-component system sensor histidine kinase AlgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_14870 9239 10633 gene locus_tag LOCUS_14880 gene argH 9239 10633 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 protein_id gnl|my_center|LOCUS_14880 10689 11837 gene locus_tag LOCUS_14890 10689 11837 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312302.1 protein_id gnl|my_center|LOCUS_14890 11915 12442 gene locus_tag LOCUS_14900 11915 12442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010209025.1 protein_id gnl|my_center|LOCUS_14900 12512 12952 gene locus_tag LOCUS_14910 12512 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 13031 13276 gene locus_tag LOCUS_14920 13031 13276 CDS product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344490.1 protein_id gnl|my_center|LOCUS_14920 13427 16243 gene locus_tag LOCUS_14930 13427 16243 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266242.1 protein_id gnl|my_center|LOCUS_14930 16988 16584 gene locus_tag LOCUS_14940 gene rnk 16988 16584 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246537.1 protein_id gnl|my_center|LOCUS_14940 17481 17149 gene locus_tag LOCUS_14950 gene cyaY 17481 17149 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121284.1 protein_id gnl|my_center|LOCUS_14950 17669 17809 gene locus_tag LOCUS_14960 17669 17809 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096430.1 protein_id gnl|my_center|LOCUS_14960 17822 19069 gene locus_tag LOCUS_14970 gene lysA 17822 19069 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114343.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence052 59 874 gene locus_tag LOCUS_14980 59 874 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313589.1 protein_id gnl|my_center|LOCUS_14980 867 1664 gene locus_tag LOCUS_14990 gene mlaE 867 1664 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094341.1 protein_id gnl|my_center|LOCUS_14990 1127 1205 gene locus_tag LOCUS_t00230 1127 1205 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1664 2122 gene locus_tag LOCUS_15000 gene mlaD 1664 2122 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094339.1 protein_id gnl|my_center|LOCUS_15000 2134 2781 gene locus_tag LOCUS_15010 2134 2781 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400251.1 protein_id gnl|my_center|LOCUS_15010 2774 3088 gene locus_tag LOCUS_15020 2774 3088 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112744.1 protein_id gnl|my_center|LOCUS_15020 3102 3593 gene locus_tag LOCUS_15030 3102 3593 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091838.1 protein_id gnl|my_center|LOCUS_15030 3685 3924 gene locus_tag LOCUS_15040 3685 3924 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555079.1 protein_id gnl|my_center|LOCUS_15040 4028 5293 gene locus_tag LOCUS_15050 gene murA 4028 5293 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_15050 5531 6163 gene locus_tag LOCUS_15060 gene hisG 5531 6163 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098837.1 protein_id gnl|my_center|LOCUS_15060 6456 7763 gene locus_tag LOCUS_15070 gene hisD 6456 7763 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094326.1 protein_id gnl|my_center|LOCUS_15070 7804 8922 gene locus_tag LOCUS_15080 gene hisC 7804 8922 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098833.1 protein_id gnl|my_center|LOCUS_15080 10120 8969 gene locus_tag LOCUS_15090 gene algW 10120 8969 CDS product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340656.1 protein_id gnl|my_center|LOCUS_15090 10274 11032 gene locus_tag LOCUS_15100 10274 11032 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094318.1 protein_id gnl|my_center|LOCUS_15100 11221 12138 gene locus_tag LOCUS_15110 gene cysD 11221 12138 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094311.1 protein_id gnl|my_center|LOCUS_15110 12150 14048 gene locus_tag LOCUS_15120 gene cysN 12150 14048 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110029.1 protein_id gnl|my_center|LOCUS_15120 14614 14174 gene locus_tag LOCUS_15130 14614 14174 CDS product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 protein_id gnl|my_center|LOCUS_15130 16259 14874 gene locus_tag LOCUS_15140 16259 14874 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838686.1 protein_id gnl|my_center|LOCUS_15140 16944 16522 gene locus_tag LOCUS_15150 gene pilA 16944 16522 CDS product type 4a pilus biogenesis protein PilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112842.1 protein_id gnl|my_center|LOCUS_15150 17254 18957 gene locus_tag LOCUS_15160 gene pilB 17254 18957 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence053 451 2043 gene locus_tag LOCUS_15170 451 2043 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176720.1 protein_id gnl|my_center|LOCUS_15170 2279 2079 gene locus_tag LOCUS_15180 2279 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 2257 2805 gene locus_tag LOCUS_15190 2257 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 2829 3968 gene locus_tag LOCUS_15200 2829 3968 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921632.1 protein_id gnl|my_center|LOCUS_15200 3965 5302 gene locus_tag LOCUS_15210 gene norW 3965 5302 CDS product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064752.1 protein_id gnl|my_center|LOCUS_15210 5330 6724 gene locus_tag LOCUS_15220 5330 6724 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088478.1 protein_id gnl|my_center|LOCUS_15220 6735 7586 gene locus_tag LOCUS_15230 gene ntrB 6735 7586 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967199.1 protein_id gnl|my_center|LOCUS_15230 7576 8481 gene locus_tag LOCUS_15240 7576 8481 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088476.1 protein_id gnl|my_center|LOCUS_15240 8507 8956 gene locus_tag LOCUS_15250 gene cynS 8507 8956 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072180.1 protein_id gnl|my_center|LOCUS_15250 8990 9886 gene locus_tag LOCUS_15260 8990 9886 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063651.1 protein_id gnl|my_center|LOCUS_15260 9895 10698 gene locus_tag LOCUS_15270 9895 10698 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807247.1 protein_id gnl|my_center|LOCUS_15270 11193 10819 gene locus_tag LOCUS_15280 11193 10819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 11243 13114 gene locus_tag LOCUS_15290 11243 13114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 13111 14823 gene locus_tag LOCUS_15300 13111 14823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 15276 16436 gene locus_tag LOCUS_15310 15276 16436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 16551 17174 gene locus_tag LOCUS_15320 16551 17174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 18531 17626 gene locus_tag LOCUS_15330 18531 17626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 18673 18927 gene locus_tag LOCUS_15340 18673 18927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence054 <1 1413 gene locus_tag LOCUS_15350 <1 1413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112762.1:multidrug efflux RND transporter permease subunit MexW 1646 1425 gene locus_tag LOCUS_15360 1646 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268826.1 protein_id gnl|my_center|LOCUS_15360 3445 1805 gene locus_tag LOCUS_15370 gene groL 3445 1805 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094059.1 protein_id gnl|my_center|LOCUS_15370 3786 3493 gene locus_tag LOCUS_15380 3786 3493 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003304675.1 protein_id gnl|my_center|LOCUS_15380 4493 4035 gene locus_tag LOCUS_15390 gene fxsA 4493 4035 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094066.1 protein_id gnl|my_center|LOCUS_15390 5377 4625 gene locus_tag LOCUS_15400 5377 4625 CDS product HugZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112758.1 protein_id gnl|my_center|LOCUS_15400 5313 6191 gene locus_tag LOCUS_15410 5313 6191 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 protein_id gnl|my_center|LOCUS_15410 7272 6268 gene locus_tag LOCUS_15420 7272 6268 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620274.1 protein_id gnl|my_center|LOCUS_15420 7407 7766 gene locus_tag LOCUS_15430 7407 7766 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768582.1 protein_id gnl|my_center|LOCUS_15430 7805 9505 gene locus_tag LOCUS_15440 gene ampG 7805 9505 CDS product MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112756.1 protein_id gnl|my_center|LOCUS_15440 10379 9555 gene locus_tag LOCUS_15450 10379 9555 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_15450 10948 10469 gene locus_tag LOCUS_15460 10948 10469 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380977.1 protein_id gnl|my_center|LOCUS_15460 11099 12064 gene locus_tag LOCUS_15470 11099 12064 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106524.1 protein_id gnl|my_center|LOCUS_15470 12069 12980 gene locus_tag LOCUS_15480 12069 12980 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106518.1 protein_id gnl|my_center|LOCUS_15480 13024 15039 gene locus_tag LOCUS_15490 13024 15039 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106517.1 protein_id gnl|my_center|LOCUS_15490 15055 15645 gene locus_tag LOCUS_15500 15055 15645 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268839.1 protein_id gnl|my_center|LOCUS_15500 15638 16666 gene locus_tag LOCUS_15510 15638 16666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838772.1 protein_id gnl|my_center|LOCUS_15510 17484 16672 gene locus_tag LOCUS_15520 17484 16672 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247449.1 protein_id gnl|my_center|LOCUS_15520 18598 17471 gene locus_tag LOCUS_15530 18598 17471 CDS product DUF3182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063834.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence055 501 1673 gene locus_tag LOCUS_15540 501 1673 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113459.1 protein_id gnl|my_center|LOCUS_15540 1673 2380 gene locus_tag LOCUS_15550 gene sfsA 1673 2380 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113458.1 protein_id gnl|my_center|LOCUS_15550 2640 3560 gene locus_tag LOCUS_15560 gene rfbD 2640 3560 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387760.1 protein_id gnl|my_center|LOCUS_15560 3665 4564 gene locus_tag LOCUS_15570 3665 4564 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876994.1 protein_id gnl|my_center|LOCUS_15570 5564 4803 gene locus_tag LOCUS_15580 5564 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477491.1 protein_id gnl|my_center|LOCUS_15580 6591 5644 gene locus_tag LOCUS_15590 6591 5644 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532290.1 protein_id gnl|my_center|LOCUS_15590 6795 8045 gene locus_tag LOCUS_15600 gene cypC 6795 8045 CDS product fatty-acid peroxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246284.1 protein_id gnl|my_center|LOCUS_15600 10880 8067 gene locus_tag LOCUS_15610 gene retS 10880 8067 CDS product hybrid sensor histidine kinase/response regulator RetS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112323.1 protein_id gnl|my_center|LOCUS_15610 12289 10997 gene locus_tag LOCUS_15620 gene purD 12289 10997 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105150.1 protein_id gnl|my_center|LOCUS_15620 14093 12489 gene locus_tag LOCUS_15630 gene purH 14093 12489 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105151.1 protein_id gnl|my_center|LOCUS_15630 14490 14170 gene locus_tag LOCUS_15640 gene fis 14490 14170 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555375.1 protein_id gnl|my_center|LOCUS_15640 15500 14487 gene locus_tag LOCUS_15650 gene dusB 15500 14487 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399694.1 protein_id gnl|my_center|LOCUS_15650 16933 15698 gene locus_tag LOCUS_15660 16933 15698 CDS product DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112325.1 protein_id gnl|my_center|LOCUS_15660 17927 17046 gene locus_tag LOCUS_15670 gene prmA 17927 17046 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112237.1 protein_id gnl|my_center|LOCUS_15670 18916 18077 gene locus_tag LOCUS_15680 18916 18077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence056 1422 412 gene locus_tag LOCUS_15690 gene umuC 1422 412 CDS product translesion error-prone DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122552737.1 protein_id gnl|my_center|LOCUS_15690 1953 2315 gene locus_tag LOCUS_15700 1953 2315 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003465043.1 protein_id gnl|my_center|LOCUS_15700 2339 2902 gene locus_tag LOCUS_15710 2339 2902 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141166.1 protein_id gnl|my_center|LOCUS_15710 4366 3047 gene locus_tag LOCUS_15720 4366 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15720 4724 4903 gene locus_tag LOCUS_15730 4724 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 5788 5988 gene locus_tag LOCUS_15740 5788 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 6535 6284 gene locus_tag LOCUS_15750 6535 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 6953 6522 gene locus_tag LOCUS_15760 6953 6522 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318766.1 protein_id gnl|my_center|LOCUS_15760 7036 7749 gene locus_tag LOCUS_15770 7036 7749 CDS product SOS response-associated peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054994255.1 protein_id gnl|my_center|LOCUS_15770 8126 9019 gene locus_tag LOCUS_15780 8126 9019 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530541.1 protein_id gnl|my_center|LOCUS_15780 9986 9030 gene locus_tag LOCUS_15790 9986 9030 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088295.1 protein_id gnl|my_center|LOCUS_15790 11098 10907 gene locus_tag LOCUS_15800 11098 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 11201 11446 gene locus_tag LOCUS_15810 11201 11446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 12139 11822 gene locus_tag LOCUS_15820 12139 11822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 15285 12163 gene locus_tag LOCUS_15830 15285 12163 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087698.1 protein_id gnl|my_center|LOCUS_15830 16925 15288 gene locus_tag LOCUS_15840 16925 15288 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087697.1 protein_id gnl|my_center|LOCUS_15840 18208 16922 gene locus_tag LOCUS_15850 18208 16922 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550314.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence057 166 1149 gene locus_tag LOCUS_15860 166 1149 CDS product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122374.1 protein_id gnl|my_center|LOCUS_15860 1288 1593 gene locus_tag LOCUS_15870 1288 1593 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104978.1 protein_id gnl|my_center|LOCUS_15870 1905 4376 gene locus_tag LOCUS_15880 1905 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 7057 4457 gene locus_tag LOCUS_15890 7057 4457 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036288.1 protein_id gnl|my_center|LOCUS_15890 8912 7134 gene locus_tag LOCUS_15900 8912 7134 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484240.1 protein_id gnl|my_center|LOCUS_15900 10369 9056 gene locus_tag LOCUS_15910 10369 9056 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185515.1 protein_id gnl|my_center|LOCUS_15910 11728 10421 gene locus_tag LOCUS_15920 11728 10421 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969686.1 protein_id gnl|my_center|LOCUS_15920 12577 11747 gene locus_tag LOCUS_15930 gene fghA 12577 11747 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038485.1 protein_id gnl|my_center|LOCUS_15930 13970 12636 gene locus_tag LOCUS_15940 13970 12636 CDS product DUF3422 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530349.1 protein_id gnl|my_center|LOCUS_15940 14551 14153 gene locus_tag LOCUS_15950 14551 14153 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811632.1 protein_id gnl|my_center|LOCUS_15950 15704 14595 gene locus_tag LOCUS_15960 15704 14595 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400756.1 protein_id gnl|my_center|LOCUS_15960 15988 15764 gene locus_tag LOCUS_15970 15988 15764 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383113.1 protein_id gnl|my_center|LOCUS_15970 16828 16049 gene locus_tag LOCUS_15980 16828 16049 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403965.1 protein_id gnl|my_center|LOCUS_15980 16937 17851 gene locus_tag LOCUS_15990 gene ceoR 16937 17851 CDS product putative multidrug efflux transcriptional regulator CeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188318.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence058 664 3636 gene locus_tag LOCUS_16000 664 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16000 3687 4073 gene locus_tag LOCUS_16010 3687 4073 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_16010 4150 6561 gene locus_tag LOCUS_16020 4150 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16020 6558 6947 gene locus_tag LOCUS_16030 6558 6947 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_16030 6940 8580 gene locus_tag LOCUS_16040 6940 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 8708 11584 gene locus_tag LOCUS_16050 8708 11584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 11581 11970 gene locus_tag LOCUS_16060 11581 11970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 11967 13103 gene locus_tag LOCUS_16070 11967 13103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 13093 14217 gene locus_tag LOCUS_16080 13093 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 14214 15617 gene locus_tag LOCUS_16090 14214 15617 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_16090 17212 15719 gene locus_tag LOCUS_16100 17212 15719 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102988.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence059 <1 1192 gene locus_tag LOCUS_16110 <1 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113905.1:DNA repair protein RecN 1659 1255 gene locus_tag LOCUS_16120 gene fur 1659 1255 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095216.1 protein_id gnl|my_center|LOCUS_16120 1755 2267 gene locus_tag LOCUS_16130 1755 2267 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105026.1 protein_id gnl|my_center|LOCUS_16130 2622 2308 gene locus_tag LOCUS_16140 2622 2308 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095218.1 protein_id gnl|my_center|LOCUS_16140 3049 2615 gene locus_tag LOCUS_16150 3049 2615 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100497.1 protein_id gnl|my_center|LOCUS_16150 3256 3738 gene locus_tag LOCUS_16160 gene smpB 3256 3738 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100496.1 protein_id gnl|my_center|LOCUS_16160 4582 3791 gene locus_tag LOCUS_16170 4582 3791 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095221.1 protein_id gnl|my_center|LOCUS_16170 4852 6546 gene locus_tag LOCUS_16180 4852 6546 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706381.1 protein_id gnl|my_center|LOCUS_16180 6801 7622 gene locus_tag LOCUS_16190 6801 7622 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702609.1 protein_id gnl|my_center|LOCUS_16190 7619 9079 gene locus_tag LOCUS_16200 7619 9079 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706379.1 protein_id gnl|my_center|LOCUS_16200 9076 9747 gene locus_tag LOCUS_16210 9076 9747 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389165.1 protein_id gnl|my_center|LOCUS_16210 9744 12596 gene locus_tag LOCUS_16220 9744 12596 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123510.1 protein_id gnl|my_center|LOCUS_16220 12778 13083 gene locus_tag LOCUS_16230 12778 13083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 13215 13593 gene locus_tag LOCUS_tm00010 13215 13593 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 13641 16133 gene locus_tag LOCUS_16240 13641 16133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 16530 17555 gene locus_tag LOCUS_16250 16530 17555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence060 548 105 gene locus_tag LOCUS_16260 548 105 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095106.1 protein_id gnl|my_center|LOCUS_16260 1380 538 gene locus_tag LOCUS_16270 1380 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 2481 1390 gene locus_tag LOCUS_16280 2481 1390 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109652.1 protein_id gnl|my_center|LOCUS_16280 2785 2471 gene locus_tag LOCUS_16290 2785 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 4102 2798 gene locus_tag LOCUS_16300 4102 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 4189 5904 gene locus_tag LOCUS_16310 4189 5904 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102377.1 protein_id gnl|my_center|LOCUS_16310 6093 5938 gene locus_tag LOCUS_16320 6093 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 6106 6846 gene locus_tag LOCUS_16330 6106 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102379.1 protein_id gnl|my_center|LOCUS_16330 6852 7424 gene locus_tag LOCUS_16340 6852 7424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 7887 7432 gene locus_tag LOCUS_16350 7887 7432 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102387.1 protein_id gnl|my_center|LOCUS_16350 8111 8500 gene locus_tag LOCUS_16360 8111 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109947.1 protein_id gnl|my_center|LOCUS_16360 8700 8503 gene locus_tag LOCUS_16370 8700 8503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 10080 8848 gene locus_tag LOCUS_16380 10080 8848 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112579.1 protein_id gnl|my_center|LOCUS_16380 10204 10590 gene locus_tag LOCUS_16390 gene arsC 10204 10590 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314592.1 protein_id gnl|my_center|LOCUS_16390 10587 11192 gene locus_tag LOCUS_16400 gene wrbA 10587 11192 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363251.1 protein_id gnl|my_center|LOCUS_16400 11185 11595 gene locus_tag LOCUS_16410 11185 11595 CDS product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086072.1 protein_id gnl|my_center|LOCUS_16410 12340 11636 gene locus_tag LOCUS_16420 gene hda 12340 11636 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102398.1 protein_id gnl|my_center|LOCUS_16420 13434 12337 gene locus_tag LOCUS_16430 13434 12337 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_16430 14553 13495 gene locus_tag LOCUS_16440 14553 13495 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268587.1 protein_id gnl|my_center|LOCUS_16440 14896 15954 gene locus_tag LOCUS_16450 gene purM 14896 15954 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381585.1 protein_id gnl|my_center|LOCUS_16450 15954 16601 gene locus_tag LOCUS_16460 gene purN 15954 16601 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268589.1 protein_id gnl|my_center|LOCUS_16460 16610 17320 gene locus_tag LOCUS_16470 16610 17320 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369623.1 protein_id gnl|my_center|LOCUS_16470 17374 18039 gene locus_tag LOCUS_16480 17374 18039 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381486.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence061 2600 3559 gene locus_tag LOCUS_16490 2600 3559 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554476.1 protein_id gnl|my_center|LOCUS_16490 3559 4521 gene locus_tag LOCUS_16500 3559 4521 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376303.1 protein_id gnl|my_center|LOCUS_16500 4518 5012 gene locus_tag LOCUS_16510 4518 5012 CDS product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267200.1 protein_id gnl|my_center|LOCUS_16510 5005 6024 gene locus_tag LOCUS_16520 5005 6024 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_16520 6021 7730 gene locus_tag LOCUS_16530 6021 7730 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107432.1 protein_id gnl|my_center|LOCUS_16530 7727 9355 gene locus_tag LOCUS_16540 7727 9355 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_16540 9492 10709 gene locus_tag LOCUS_16550 9492 10709 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113582.1 protein_id gnl|my_center|LOCUS_16550 10723 11301 gene locus_tag LOCUS_16560 10723 11301 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765699.1 protein_id gnl|my_center|LOCUS_16560 11592 12113 gene locus_tag LOCUS_16570 11592 12113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 12068 12289 gene locus_tag LOCUS_16580 12068 12289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 12495 12938 gene locus_tag LOCUS_16590 12495 12938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 13870 12935 gene locus_tag LOCUS_16600 13870 12935 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899139.1 protein_id gnl|my_center|LOCUS_16600 14221 15432 gene locus_tag LOCUS_16610 14221 15432 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087861.1 protein_id gnl|my_center|LOCUS_16610 15494 17167 gene locus_tag LOCUS_16620 15494 17167 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463440.1 protein_id gnl|my_center|LOCUS_16620 17477 17169 gene locus_tag LOCUS_16630 17477 17169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16630 >Feature sequence062 30 884 gene locus_tag LOCUS_16640 30 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 2131 935 gene locus_tag LOCUS_16650 2131 935 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393654.1 protein_id gnl|my_center|LOCUS_16650 2771 2232 gene locus_tag LOCUS_16660 2771 2232 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372548.1 protein_id gnl|my_center|LOCUS_16660 2902 3768 gene locus_tag LOCUS_16670 2902 3768 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118789.1 protein_id gnl|my_center|LOCUS_16670 3825 4637 gene locus_tag LOCUS_16680 gene mutM 3825 4637 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102876.1 protein_id gnl|my_center|LOCUS_16680 4752 5093 gene locus_tag LOCUS_16690 4752 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084452.1 protein_id gnl|my_center|LOCUS_16690 5197 7032 gene locus_tag LOCUS_16700 5197 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 8707 7016 gene locus_tag LOCUS_16710 gene ggt 8707 7016 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112970.1 protein_id gnl|my_center|LOCUS_16710 9000 8749 gene locus_tag LOCUS_16720 9000 8749 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 protein_id gnl|my_center|LOCUS_16720 9582 9103 gene locus_tag LOCUS_16730 gene coaD 9582 9103 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084466.1 protein_id gnl|my_center|LOCUS_16730 11308 9713 gene locus_tag LOCUS_16740 11308 9713 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 protein_id gnl|my_center|LOCUS_16740 11924 11379 gene locus_tag LOCUS_16750 11924 11379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084486.1 protein_id gnl|my_center|LOCUS_16750 13388 11958 gene locus_tag LOCUS_16760 13388 11958 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102868.1 protein_id gnl|my_center|LOCUS_16760 13590 14261 gene locus_tag LOCUS_16770 13590 14261 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084488.1 protein_id gnl|my_center|LOCUS_16770 15269 14283 gene locus_tag LOCUS_16780 15269 14283 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084490.1 protein_id gnl|my_center|LOCUS_16780 15333 15848 gene locus_tag LOCUS_16790 15333 15848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 16459 15842 gene locus_tag LOCUS_16800 gene rsmD 16459 15842 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003455683.1 protein_id gnl|my_center|LOCUS_16800 <17434 16459 gene locus_tag LOCUS_16810 <17434 16459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112971.1:pitrilysin family protein >Feature sequence063 912 1 gene locus_tag LOCUS_16820 gene lpxC 912 1 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_16820 2209 1028 gene locus_tag LOCUS_16830 gene ftsZ 2209 1028 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094113.1 protein_id gnl|my_center|LOCUS_16830 3514 2258 gene locus_tag LOCUS_16840 gene ftsA 3514 2258 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377649.1 protein_id gnl|my_center|LOCUS_16840 4375 3518 gene locus_tag LOCUS_16850 4375 3518 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340706.1 protein_id gnl|my_center|LOCUS_16850 5323 4379 gene locus_tag LOCUS_16860 5323 4379 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 protein_id gnl|my_center|LOCUS_16860 6777 5320 gene locus_tag LOCUS_16870 gene murC 6777 5320 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 protein_id gnl|my_center|LOCUS_16870 7840 6770 gene locus_tag LOCUS_16880 gene murG 7840 6770 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766568.1 protein_id gnl|my_center|LOCUS_16880 9053 7830 gene locus_tag LOCUS_16890 gene ftsW 9053 7830 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406017.1 protein_id gnl|my_center|LOCUS_16890 10396 9053 gene locus_tag LOCUS_16900 gene murD 10396 9053 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766566.1 protein_id gnl|my_center|LOCUS_16900 11485 10403 gene locus_tag LOCUS_16910 gene mraY 11485 10403 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_16910 12861 11485 gene locus_tag LOCUS_16920 12861 11485 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103103.1 protein_id gnl|my_center|LOCUS_16920 14317 12854 gene locus_tag LOCUS_16930 14317 12854 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112751.1 protein_id gnl|my_center|LOCUS_16930 16044 14317 gene locus_tag LOCUS_16940 gene ftsI 16044 14317 CDS product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_16940 16334 16044 gene locus_tag LOCUS_16950 gene ftsL 16334 16044 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340690.1 protein_id gnl|my_center|LOCUS_16950 17278 16331 gene locus_tag LOCUS_16960 gene rsmH 17278 16331 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110151.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence064 1784 1617 gene locus_tag LOCUS_16970 1784 1617 CDS product DUF2897 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090984.1 protein_id gnl|my_center|LOCUS_16970 1951 2646 gene locus_tag LOCUS_16980 gene pyrF 1951 2646 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090975.1 protein_id gnl|my_center|LOCUS_16980 3707 2703 gene locus_tag LOCUS_16990 3707 2703 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_16990 3925 4686 gene locus_tag LOCUS_17000 3925 4686 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_17000 5919 4732 gene locus_tag LOCUS_17010 5919 4732 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208312417.1 protein_id gnl|my_center|LOCUS_17010 6166 6495 gene locus_tag LOCUS_17020 gene fliE 6166 6495 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086454.1 protein_id gnl|my_center|LOCUS_17020 6509 8293 gene locus_tag LOCUS_17030 gene fliF 6509 8293 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109118.1 protein_id gnl|my_center|LOCUS_17030 8286 9302 gene locus_tag LOCUS_17040 gene fliG 8286 9302 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082212.1 protein_id gnl|my_center|LOCUS_17040 9322 10098 gene locus_tag LOCUS_17050 gene fliH 9322 10098 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082217.1 protein_id gnl|my_center|LOCUS_17050 10088 11446 gene locus_tag LOCUS_17060 gene fliI 10088 11446 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086458.1 protein_id gnl|my_center|LOCUS_17060 11450 11902 gene locus_tag LOCUS_17070 gene fliJ 11450 11902 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082220.1 protein_id gnl|my_center|LOCUS_17070 12165 12470 gene locus_tag LOCUS_17080 gene hsbA 12165 12470 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_17080 12478 14163 gene locus_tag LOCUS_17090 gene hsbR 12478 14163 CDS product two-component system response regulator HsbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 protein_id gnl|my_center|LOCUS_17090 14191 14541 gene locus_tag LOCUS_17100 gene htpB 14191 14541 CDS product two-component system sensor histidine kinase HtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109305.1 protein_id gnl|my_center|LOCUS_17100 14701 15930 gene locus_tag LOCUS_17110 14701 15930 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895568.1 protein_id gnl|my_center|LOCUS_17110 16176 16709 gene locus_tag LOCUS_17120 gene fliL 16176 16709 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence065 <1 897 gene locus_tag LOCUS_17130 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003088524.1:quinoprotein ethanol dehydrogenase 1055 1708 gene locus_tag LOCUS_17140 1055 1708 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088520.1 protein_id gnl|my_center|LOCUS_17140 1845 3161 gene locus_tag LOCUS_17150 1845 3161 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024697807.1 protein_id gnl|my_center|LOCUS_17150 3250 4353 gene locus_tag LOCUS_17160 3250 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 6751 4454 gene locus_tag LOCUS_17170 6751 4454 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038570.1 protein_id gnl|my_center|LOCUS_17170 7738 7079 gene locus_tag LOCUS_17180 7738 7079 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113463.1 protein_id gnl|my_center|LOCUS_17180 9000 7738 gene locus_tag LOCUS_17190 9000 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 9478 9041 gene locus_tag LOCUS_17200 9478 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166954092.1 protein_id gnl|my_center|LOCUS_17200 9844 12018 gene locus_tag LOCUS_17210 9844 12018 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267883.1 protein_id gnl|my_center|LOCUS_17210 12148 13335 gene locus_tag LOCUS_17220 12148 13335 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399360.1 protein_id gnl|my_center|LOCUS_17220 13338 13814 gene locus_tag LOCUS_17230 13338 13814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 13833 14804 gene locus_tag LOCUS_17240 13833 14804 CDS product YVTN family beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066872222.1 protein_id gnl|my_center|LOCUS_17240 14801 15631 gene locus_tag LOCUS_17250 14801 15631 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528736.1 protein_id gnl|my_center|LOCUS_17250 15628 16419 gene locus_tag LOCUS_17260 15628 16419 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088931.1 protein_id gnl|my_center|LOCUS_17260 16523 17086 gene locus_tag LOCUS_17270 16523 17086 CDS product PQQ-dependent catabolism-associated CXXCW motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088934.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence066 904 1398 gene locus_tag LOCUS_17280 904 1398 CDS product Tfp pilus assembly protein FimT/FimU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112829.1 protein_id gnl|my_center|LOCUS_17280 1566 2057 gene locus_tag LOCUS_17290 1566 2057 CDS product Tfp pilus assembly protein FimT/FimU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102598.1 protein_id gnl|my_center|LOCUS_17290 2066 2623 gene locus_tag LOCUS_17300 gene pilV 2066 2623 CDS product type 4a pilus minor pilin PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119423.1 protein_id gnl|my_center|LOCUS_17300 2629 3471 gene locus_tag LOCUS_17310 gene pilW 2629 3471 CDS product type 4a pilus minor pilin PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119422.1 protein_id gnl|my_center|LOCUS_17310 3468 4073 gene locus_tag LOCUS_17320 gene pilX 3468 4073 CDS product type 4a pilus minor pilin PilX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112826.1 protein_id gnl|my_center|LOCUS_17320 4085 7810 gene locus_tag LOCUS_17330 gene pilY1 4085 7810 CDS product type 4a pilus biogenesis protein PilY1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115287.1 protein_id gnl|my_center|LOCUS_17330 7842 8282 gene locus_tag LOCUS_17340 gene pilE 7842 8282 CDS product type 4a pilus minor pilin PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 protein_id gnl|my_center|LOCUS_17340 9318 8374 gene locus_tag LOCUS_17350 gene ispH 9318 8374 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318785.1 protein_id gnl|my_center|LOCUS_17350 9874 9437 gene locus_tag LOCUS_17360 gene fkpB 9874 9437 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102613.1 protein_id gnl|my_center|LOCUS_17360 10370 9867 gene locus_tag LOCUS_17370 gene lspA 10370 9867 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266581.1 protein_id gnl|my_center|LOCUS_17370 13313 10482 gene locus_tag LOCUS_17380 gene ileS 13313 10482 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112822.1 protein_id gnl|my_center|LOCUS_17380 14265 13315 gene locus_tag LOCUS_17390 gene ribF 14265 13315 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102619.1 protein_id gnl|my_center|LOCUS_17390 15897 14350 gene locus_tag LOCUS_17400 gene murJ 15897 14350 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948335.1 protein_id gnl|my_center|LOCUS_17400 16119 16397 gene locus_tag LOCUS_17410 gene rpsT 16119 16397 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094744.1 protein_id gnl|my_center|LOCUS_17410 16951 16487 gene locus_tag LOCUS_17420 16951 16487 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094746.1 protein_id gnl|my_center|LOCUS_17420 >Feature sequence067 1132 380 gene locus_tag LOCUS_17430 gene trmD 1132 380 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119312.1 protein_id gnl|my_center|LOCUS_17430 1665 1138 gene locus_tag LOCUS_17440 gene rimM 1665 1138 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113830.1 protein_id gnl|my_center|LOCUS_17440 1931 1680 gene locus_tag LOCUS_17450 gene rpsP 1931 1680 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092643.1 protein_id gnl|my_center|LOCUS_17450 3502 2126 gene locus_tag LOCUS_17460 gene ffh 3502 2126 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406399.1 protein_id gnl|my_center|LOCUS_17460 3751 4551 gene locus_tag LOCUS_17470 3751 4551 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_17470 4569 5855 gene locus_tag LOCUS_17480 4569 5855 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111904.1 protein_id gnl|my_center|LOCUS_17480 7065 5884 gene locus_tag LOCUS_17490 gene purT 7065 5884 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092658.1 protein_id gnl|my_center|LOCUS_17490 7304 7113 gene locus_tag LOCUS_17500 7304 7113 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266929.1 protein_id gnl|my_center|LOCUS_17500 7822 7301 gene locus_tag LOCUS_17510 7822 7301 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092662.1 protein_id gnl|my_center|LOCUS_17510 8501 7884 gene locus_tag LOCUS_17520 8501 7884 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266927.1 protein_id gnl|my_center|LOCUS_17520 8687 9253 gene locus_tag LOCUS_17530 8687 9253 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_17530 9300 9803 gene locus_tag LOCUS_17540 9300 9803 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092667.1 protein_id gnl|my_center|LOCUS_17540 10156 9839 gene locus_tag LOCUS_17550 10156 9839 CDS product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_17550 14251 10355 gene locus_tag LOCUS_17560 gene purL 14251 10355 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113821.1 protein_id gnl|my_center|LOCUS_17560 14657 14364 gene locus_tag LOCUS_17570 14657 14364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17570 14848 15135 gene locus_tag LOCUS_17580 14848 15135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 16251 15154 gene locus_tag LOCUS_17590 16251 15154 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266808.1 protein_id gnl|my_center|LOCUS_17590 <17012 16256 gene locus_tag LOCUS_17600 <17012 16256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266807.1:amino acid ABC transporter permease >Feature sequence068 <1 741 gene locus_tag LOCUS_17610 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003381585.1:phosphoribosylformylglycinamidine cyclo-ligase 741 1388 gene locus_tag LOCUS_17620 gene purN 741 1388 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268589.1 protein_id gnl|my_center|LOCUS_17620 1397 2107 gene locus_tag LOCUS_17630 1397 2107 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086061.1 protein_id gnl|my_center|LOCUS_17630 2162 2827 gene locus_tag LOCUS_17640 2162 2827 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268696.1 protein_id gnl|my_center|LOCUS_17640 2878 4074 gene locus_tag LOCUS_17650 gene dapC 2878 4074 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103591.1 protein_id gnl|my_center|LOCUS_17650 4276 4115 gene locus_tag LOCUS_17660 4276 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 4536 4291 gene locus_tag LOCUS_17670 4536 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 4667 4996 gene locus_tag LOCUS_17680 4667 4996 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035340.1 protein_id gnl|my_center|LOCUS_17680 5124 5495 gene locus_tag LOCUS_17690 5124 5495 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314287.1 protein_id gnl|my_center|LOCUS_17690 5540 6574 gene locus_tag LOCUS_17700 gene dapD 5540 6574 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266969.1 protein_id gnl|my_center|LOCUS_17700 6646 7851 gene locus_tag LOCUS_17710 6646 7851 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103589.1 protein_id gnl|my_center|LOCUS_17710 7848 8255 gene locus_tag LOCUS_17720 7848 8255 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092439.1 protein_id gnl|my_center|LOCUS_17720 9426 8305 gene locus_tag LOCUS_17730 9426 8305 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 protein_id gnl|my_center|LOCUS_17730 10751 9828 gene locus_tag LOCUS_17740 10751 9828 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103565.1 protein_id gnl|my_center|LOCUS_17740 11398 10748 gene locus_tag LOCUS_17750 11398 10748 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113296.1 protein_id gnl|my_center|LOCUS_17750 11657 11412 gene locus_tag LOCUS_17760 11657 11412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 11656 12186 gene locus_tag LOCUS_17770 11656 12186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114836.1 protein_id gnl|my_center|LOCUS_17770 12471 12205 gene locus_tag LOCUS_17780 12471 12205 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341842.1 protein_id gnl|my_center|LOCUS_17780 12638 13168 gene locus_tag LOCUS_17790 12638 13168 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405774.1 protein_id gnl|my_center|LOCUS_17790 13646 13176 gene locus_tag LOCUS_17800 gene ybaK 13646 13176 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405434.1 protein_id gnl|my_center|LOCUS_17800 13718 15262 gene locus_tag LOCUS_17810 gene glpD 13718 15262 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011913952.1 protein_id gnl|my_center|LOCUS_17810 <16999 15288 gene locus_tag LOCUS_17820 <16999 15288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114925.1:5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase >Feature sequence069 117 536 gene locus_tag LOCUS_17830 117 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 967 1266 gene locus_tag LOCUS_17840 967 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 1710 1486 gene locus_tag LOCUS_17850 1710 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 3380 2001 gene locus_tag LOCUS_17860 3380 2001 CDS product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267055.1 protein_id gnl|my_center|LOCUS_17860 4054 3377 gene locus_tag LOCUS_17870 4054 3377 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267054.1 protein_id gnl|my_center|LOCUS_17870 5140 7170 gene locus_tag LOCUS_17880 5140 7170 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514554.1 protein_id gnl|my_center|LOCUS_17880 7244 7516 gene locus_tag LOCUS_17890 7244 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 7543 7983 gene locus_tag LOCUS_17900 7543 7983 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095106.1 protein_id gnl|my_center|LOCUS_17900 8166 9929 gene locus_tag LOCUS_17910 8166 9929 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105207.1 protein_id gnl|my_center|LOCUS_17910 10575 12356 gene locus_tag LOCUS_17920 10575 12356 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114867.1 protein_id gnl|my_center|LOCUS_17920 12369 12680 gene locus_tag LOCUS_17930 12369 12680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 12670 13830 gene locus_tag LOCUS_17940 12670 13830 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109652.1 protein_id gnl|my_center|LOCUS_17940 13839 14651 gene locus_tag LOCUS_17950 13839 14651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 15309 14854 gene locus_tag LOCUS_17960 15309 14854 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_17960 15914 16207 gene locus_tag LOCUS_17970 15914 16207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 16403 16738 gene locus_tag LOCUS_17980 16403 16738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 >Feature sequence070 79 966 gene locus_tag LOCUS_17990 79 966 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105307.1 protein_id gnl|my_center|LOCUS_17990 1076 2065 gene locus_tag LOCUS_18000 gene moaA 1076 2065 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092949.1 protein_id gnl|my_center|LOCUS_18000 2306 2851 gene locus_tag LOCUS_18010 gene moaB 2306 2851 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091240.1 protein_id gnl|my_center|LOCUS_18010 2848 4080 gene locus_tag LOCUS_18020 2848 4080 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114306.1 protein_id gnl|my_center|LOCUS_18020 4686 4135 gene locus_tag LOCUS_18030 4686 4135 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112597.1 protein_id gnl|my_center|LOCUS_18030 6220 4745 gene locus_tag LOCUS_18040 6220 4745 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406386.1 protein_id gnl|my_center|LOCUS_18040 6906 6214 gene locus_tag LOCUS_18050 6906 6214 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103755.1 protein_id gnl|my_center|LOCUS_18050 7586 6936 gene locus_tag LOCUS_18060 7586 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 protein_id gnl|my_center|LOCUS_18060 8419 7583 gene locus_tag LOCUS_18070 8419 7583 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 protein_id gnl|my_center|LOCUS_18070 9077 8406 gene locus_tag LOCUS_18080 9077 8406 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 protein_id gnl|my_center|LOCUS_18080 10538 9093 gene locus_tag LOCUS_18090 10538 9093 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 protein_id gnl|my_center|LOCUS_18090 11211 10522 gene locus_tag LOCUS_18100 11211 10522 CDS product thermostable hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706992.1 protein_id gnl|my_center|LOCUS_18100 11449 12486 gene locus_tag LOCUS_18110 11449 12486 CDS product SdiA-regulated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105587.1 protein_id gnl|my_center|LOCUS_18110 12571 13254 gene locus_tag LOCUS_18120 12571 13254 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 protein_id gnl|my_center|LOCUS_18120 13244 14512 gene locus_tag LOCUS_18130 13244 14512 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094037.1 protein_id gnl|my_center|LOCUS_18130 14594 15271 gene locus_tag LOCUS_18140 14594 15271 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739535.1 protein_id gnl|my_center|LOCUS_18140 15274 15993 gene locus_tag LOCUS_18150 15274 15993 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405954.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence071 398 3502 gene locus_tag LOCUS_18160 398 3502 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104174.1 protein_id gnl|my_center|LOCUS_18160 3499 4992 gene locus_tag LOCUS_18170 gene opmB 3499 4992 CDS product multidrug efflux RND transporter outer membrane subunit OpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089909.1 protein_id gnl|my_center|LOCUS_18170 6042 5050 gene locus_tag LOCUS_18180 gene dctP 6042 5050 CDS product C4-dicarboxylate TRAP substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105525.1 protein_id gnl|my_center|LOCUS_18180 6729 6370 gene locus_tag LOCUS_18190 6729 6370 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113498.1 protein_id gnl|my_center|LOCUS_18190 7514 6726 gene locus_tag LOCUS_18200 7514 6726 CDS product ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503573.1 protein_id gnl|my_center|LOCUS_18200 9157 7769 gene locus_tag LOCUS_18210 gene oprN 9157 7769 CDS product multidrug efflux RND transporter outer membrane subunit OprN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113303.1 protein_id gnl|my_center|LOCUS_18210 12324 9154 gene locus_tag LOCUS_18220 gene mexF 12324 9154 CDS product multidrug efflux RND transporter permease subunit MexF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089834.1 protein_id gnl|my_center|LOCUS_18220 12890 12423 gene locus_tag LOCUS_18230 12890 12423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18230 13651 12887 gene locus_tag LOCUS_18240 13651 12887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18240 14848 13931 gene locus_tag LOCUS_18250 14848 13931 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347707.1 protein_id gnl|my_center|LOCUS_18250 15108 16124 gene locus_tag LOCUS_18260 gene mexS 15108 16124 CDS product oxidoreductase MexS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113302.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence072 573 2021 gene locus_tag LOCUS_18270 gene xdhA 573 2021 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083347.1 protein_id gnl|my_center|LOCUS_18270 2014 4410 gene locus_tag LOCUS_18280 gene xdhB 2014 4410 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_18280 4512 5372 gene locus_tag LOCUS_18290 gene xdhC 4512 5372 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083344.1 protein_id gnl|my_center|LOCUS_18290 5460 6767 gene locus_tag LOCUS_18300 gene guaD 5460 6767 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114680.1 protein_id gnl|my_center|LOCUS_18300 7636 6764 gene locus_tag LOCUS_18310 7636 6764 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391451.1 protein_id gnl|my_center|LOCUS_18310 8511 7648 gene locus_tag LOCUS_18320 8511 7648 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383760.1 protein_id gnl|my_center|LOCUS_18320 9176 8508 gene locus_tag LOCUS_18330 9176 8508 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816887.1 protein_id gnl|my_center|LOCUS_18330 10180 9425 gene locus_tag LOCUS_18340 10180 9425 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267254.1 protein_id gnl|my_center|LOCUS_18340 10490 11878 gene locus_tag LOCUS_18350 10490 11878 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087209.1 protein_id gnl|my_center|LOCUS_18350 11942 12568 gene locus_tag LOCUS_18360 11942 12568 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070529.1 protein_id gnl|my_center|LOCUS_18360 13167 12814 gene locus_tag LOCUS_18370 gene uraH 13167 12814 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415819.1 protein_id gnl|my_center|LOCUS_18370 13449 14378 gene locus_tag LOCUS_18380 gene puuE 13449 14378 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083336.1 protein_id gnl|my_center|LOCUS_18380 14378 14893 gene locus_tag LOCUS_18390 gene uraD 14378 14893 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083333.1 protein_id gnl|my_center|LOCUS_18390 14969 15964 gene locus_tag LOCUS_18400 gene alc 14969 15964 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267251.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence073 307 885 gene locus_tag LOCUS_18410 307 885 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104746.1 protein_id gnl|my_center|LOCUS_18410 1891 902 gene locus_tag LOCUS_18420 gene sppA 1891 902 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_18420 2561 1875 gene locus_tag LOCUS_18430 2561 1875 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_18430 3507 2554 gene locus_tag LOCUS_18440 gene rluC 3507 2554 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619727.1 protein_id gnl|my_center|LOCUS_18440 4068 7226 gene locus_tag LOCUS_18450 4068 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 8467 7448 gene locus_tag LOCUS_18460 gene murB 8467 7448 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267145.1 protein_id gnl|my_center|LOCUS_18460 8931 8464 gene locus_tag LOCUS_18470 8931 8464 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106924.1 protein_id gnl|my_center|LOCUS_18470 9697 8933 gene locus_tag LOCUS_18480 gene kdsB 9697 8933 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317470.1 protein_id gnl|my_center|LOCUS_18480 9879 9694 gene locus_tag LOCUS_18490 9879 9694 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381112.1 protein_id gnl|my_center|LOCUS_18490 10929 9925 gene locus_tag LOCUS_18500 gene lpxK 10929 9925 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267144.1 protein_id gnl|my_center|LOCUS_18500 11357 10929 gene locus_tag LOCUS_18510 11357 10929 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317468.1 protein_id gnl|my_center|LOCUS_18510 11953 11354 gene locus_tag LOCUS_18520 11953 11354 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245835.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18520 14283 12058 gene locus_tag LOCUS_18530 14283 12058 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267142.1 protein_id gnl|my_center|LOCUS_18530 14428 14943 gene locus_tag LOCUS_18540 14428 14943 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_18540 <15943 14956 gene locus_tag LOCUS_18550 <15943 14956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003405690.1:lipoprotein-releasing ABC transporter permease subunit >Feature sequence074 1742 60 gene locus_tag LOCUS_18560 gene fimL 1742 60 CDS product type IV pilus/biofilm regulator FimL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098159.1 protein_id gnl|my_center|LOCUS_18560 2592 1780 gene locus_tag LOCUS_18570 2592 1780 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087972.1 protein_id gnl|my_center|LOCUS_18570 5021 2769 gene locus_tag LOCUS_18580 gene ldcA 5021 2769 CDS product lysine-specific pyridoxal 5'-phosphate-dependent carboxylase LdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113592.1 protein_id gnl|my_center|LOCUS_18580 5841 5116 gene locus_tag LOCUS_18590 gene dnaQ 5841 5116 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_18590 6311 5856 gene locus_tag LOCUS_18600 gene rnhA 6311 5856 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087954.1 protein_id gnl|my_center|LOCUS_18600 7116 6346 gene locus_tag LOCUS_18610 7116 6346 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104690.1 protein_id gnl|my_center|LOCUS_18610 7278 8057 gene locus_tag LOCUS_18620 gene gloB 7278 8057 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770768.1 protein_id gnl|my_center|LOCUS_18620 8305 9711 gene locus_tag LOCUS_18630 8305 9711 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120244.1 protein_id gnl|my_center|LOCUS_18630 11168 9717 gene locus_tag LOCUS_18640 11168 9717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 11308 13137 gene locus_tag LOCUS_18650 11308 13137 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770766.1 protein_id gnl|my_center|LOCUS_18650 13134 15059 gene locus_tag LOCUS_18660 13134 15059 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104691.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence075 <1 742 gene locus_tag LOCUS_18670 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973524.1:PAS domain-containing protein 926 705 gene locus_tag LOCUS_18680 926 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 2050 923 gene locus_tag LOCUS_18690 2050 923 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810851.1 protein_id gnl|my_center|LOCUS_18690 4257 2050 gene locus_tag LOCUS_18700 4257 2050 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810200.1 protein_id gnl|my_center|LOCUS_18700 4551 5012 gene locus_tag LOCUS_18710 4551 5012 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444185.1 protein_id gnl|my_center|LOCUS_18710 5098 5454 gene locus_tag LOCUS_18720 5098 5454 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 protein_id gnl|my_center|LOCUS_18720 5457 6698 gene locus_tag LOCUS_18730 5457 6698 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082803.1 protein_id gnl|my_center|LOCUS_18730 8171 6828 gene locus_tag LOCUS_18740 8171 6828 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099712.1 protein_id gnl|my_center|LOCUS_18740 9966 8203 gene locus_tag LOCUS_18750 9966 8203 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114131.1 protein_id gnl|my_center|LOCUS_18750 10171 11388 gene locus_tag LOCUS_18760 10171 11388 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_18760 11649 12500 gene locus_tag LOCUS_18770 11649 12500 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_18770 13729 12548 gene locus_tag LOCUS_18780 gene cfaB 13729 12548 CDS product C17 cyclopropane fatty acid synthase CfaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269413.1 protein_id gnl|my_center|LOCUS_18780 13881 14252 gene locus_tag LOCUS_18790 13881 14252 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095286.1 protein_id gnl|my_center|LOCUS_18790 14249 14713 gene locus_tag LOCUS_18800 14249 14713 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102267.1 protein_id gnl|my_center|LOCUS_18800 15097 14780 gene locus_tag LOCUS_18810 15097 14780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 15337 15242 gene locus_tag LOCUS_t00240 15337 15242 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence076 1451 75 gene locus_tag LOCUS_18820 1451 75 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_18820 1989 1444 gene locus_tag LOCUS_18830 1989 1444 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_18830 2285 3391 gene locus_tag LOCUS_18840 gene dctP 2285 3391 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_18840 3896 3471 gene locus_tag LOCUS_18850 3896 3471 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118563.1 protein_id gnl|my_center|LOCUS_18850 4246 3938 gene locus_tag LOCUS_18860 4246 3938 CDS product DUF2388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096280.1 protein_id gnl|my_center|LOCUS_18860 9010 4316 gene locus_tag LOCUS_18870 9010 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 10772 9192 gene locus_tag LOCUS_18880 10772 9192 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986802.1 protein_id gnl|my_center|LOCUS_18880 10968 11702 gene locus_tag LOCUS_18890 10968 11702 CDS product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036974.1 protein_id gnl|my_center|LOCUS_18890 13584 11800 gene locus_tag LOCUS_18900 13584 11800 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_18900 15046 13682 gene locus_tag LOCUS_18910 15046 13682 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114052.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence077 2772 667 gene locus_tag LOCUS_18920 2772 667 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090545.1 protein_id gnl|my_center|LOCUS_18920 4199 2994 gene locus_tag LOCUS_18930 4199 2994 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112926.1 protein_id gnl|my_center|LOCUS_18930 5797 4349 gene locus_tag LOCUS_18940 gene gabD 5797 4349 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 protein_id gnl|my_center|LOCUS_18940 6098 6577 gene locus_tag LOCUS_18950 6098 6577 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566035.1 protein_id gnl|my_center|LOCUS_18950 7309 6614 gene locus_tag LOCUS_18960 7309 6614 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 protein_id gnl|my_center|LOCUS_18960 7579 7655 gene locus_tag LOCUS_t00250 7579 7655 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8204 9103 gene locus_tag LOCUS_18970 8204 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 9100 11097 gene locus_tag LOCUS_18980 9100 11097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 13531 14151 gene locus_tag LOCUS_18990 13531 14151 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552423.1 protein_id gnl|my_center|LOCUS_18990 14979 14533 gene locus_tag LOCUS_19000 14979 14533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence078 431 757 gene locus_tag LOCUS_19010 431 757 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087236.1 protein_id gnl|my_center|LOCUS_19010 837 1436 gene locus_tag LOCUS_19020 gene recR 837 1436 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087237.1 protein_id gnl|my_center|LOCUS_19020 1582 2571 gene locus_tag LOCUS_19030 1582 2571 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930520.1 protein_id gnl|my_center|LOCUS_19030 2674 3420 gene locus_tag LOCUS_19040 2674 3420 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930519.1 protein_id gnl|my_center|LOCUS_19040 3417 4190 gene locus_tag LOCUS_19050 3417 4190 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930521.1 protein_id gnl|my_center|LOCUS_19050 4201 4902 gene locus_tag LOCUS_19060 4201 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 5552 4944 gene locus_tag LOCUS_19070 gene senC 5552 4944 CDS product cytochrome c oxidase copper chaperone SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 protein_id gnl|my_center|LOCUS_19070 6139 5591 gene locus_tag LOCUS_19080 6139 5591 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087259.1 protein_id gnl|my_center|LOCUS_19080 6900 6166 gene locus_tag LOCUS_19090 gene anr 6900 6166 CDS product transcriptional regulator Anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087262.1 protein_id gnl|my_center|LOCUS_19090 8394 7012 gene locus_tag LOCUS_19100 gene hemN 8394 7012 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 protein_id gnl|my_center|LOCUS_19100 8580 9428 gene locus_tag LOCUS_19110 gene nadE 8580 9428 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099998.1 protein_id gnl|my_center|LOCUS_19110 10159 9443 gene locus_tag LOCUS_19120 10159 9443 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_19120 10358 10152 gene locus_tag LOCUS_19130 10358 10152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 12871 10451 gene locus_tag LOCUS_19140 12871 10451 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_19140 13379 12879 gene locus_tag LOCUS_19150 13379 12879 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114667.1 protein_id gnl|my_center|LOCUS_19150 14803 13391 gene locus_tag LOCUS_19160 gene ccoG 14803 13391 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence079 297 1130 gene locus_tag LOCUS_19170 297 1130 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369336.1 protein_id gnl|my_center|LOCUS_19170 1169 2272 gene locus_tag LOCUS_19180 gene ugpC 1169 2272 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267680.1 protein_id gnl|my_center|LOCUS_19180 2376 3854 gene locus_tag LOCUS_19190 2376 3854 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267679.1 protein_id gnl|my_center|LOCUS_19190 3865 5388 gene locus_tag LOCUS_19200 gene xylB 3865 5388 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762617.1 protein_id gnl|my_center|LOCUS_19200 6706 5480 gene locus_tag LOCUS_19210 6706 5480 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089998.1 protein_id gnl|my_center|LOCUS_19210 6853 7764 gene locus_tag LOCUS_19220 6853 7764 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090000.1 protein_id gnl|my_center|LOCUS_19220 8808 7789 gene locus_tag LOCUS_19230 8808 7789 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765154.1 protein_id gnl|my_center|LOCUS_19230 9883 8867 gene locus_tag LOCUS_19240 9883 8867 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401457.1 protein_id gnl|my_center|LOCUS_19240 11222 9945 gene locus_tag LOCUS_19250 11222 9945 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243758.1 protein_id gnl|my_center|LOCUS_19250 12403 11273 gene locus_tag LOCUS_19260 12403 11273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 12581 12859 gene locus_tag LOCUS_19270 12581 12859 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003373489.1 protein_id gnl|my_center|LOCUS_19270 13986 12847 gene locus_tag LOCUS_19280 gene zapE 13986 12847 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111446.1 protein_id gnl|my_center|LOCUS_19280 14927 14019 gene locus_tag LOCUS_19290 14927 14019 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095930.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence080 1962 487 gene locus_tag LOCUS_19300 1962 487 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582707.1 protein_id gnl|my_center|LOCUS_19300 2498 1986 gene locus_tag LOCUS_19310 2498 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 3544 2558 gene locus_tag LOCUS_19320 3544 2558 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807883.1 protein_id gnl|my_center|LOCUS_19320 4882 3650 gene locus_tag LOCUS_19330 4882 3650 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206431.1 protein_id gnl|my_center|LOCUS_19330 6156 4954 gene locus_tag LOCUS_19340 6156 4954 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206435.1 protein_id gnl|my_center|LOCUS_19340 7709 6180 gene locus_tag LOCUS_19350 7709 6180 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114595.1 protein_id gnl|my_center|LOCUS_19350 8497 7712 gene locus_tag LOCUS_19360 8497 7712 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114596.1 protein_id gnl|my_center|LOCUS_19360 8747 9595 gene locus_tag LOCUS_19370 8747 9595 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097851.1 protein_id gnl|my_center|LOCUS_19370 9660 10814 gene locus_tag LOCUS_19380 9660 10814 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206430.1 protein_id gnl|my_center|LOCUS_19380 11280 13070 gene locus_tag LOCUS_19390 11280 13070 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720836.1 protein_id gnl|my_center|LOCUS_19390 13163 14440 gene locus_tag LOCUS_19400 13163 14440 CDS product bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114564.1 protein_id gnl|my_center|LOCUS_19400 14509 14946 gene locus_tag LOCUS_19410 gene trxC 14509 14946 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence081 1257 49 gene locus_tag LOCUS_19420 gene coaBC 1257 49 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114358.1 protein_id gnl|my_center|LOCUS_19420 1395 2069 gene locus_tag LOCUS_19430 gene radC 1395 2069 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114357.1 protein_id gnl|my_center|LOCUS_19430 3404 2076 gene locus_tag LOCUS_19440 3404 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 3836 3408 gene locus_tag LOCUS_19450 3836 3408 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073919.1 protein_id gnl|my_center|LOCUS_19450 3951 5474 gene locus_tag LOCUS_19460 3951 5474 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114595.1 protein_id gnl|my_center|LOCUS_19460 5636 7198 gene locus_tag LOCUS_19470 5636 7198 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114989.1 protein_id gnl|my_center|LOCUS_19470 7300 7824 gene locus_tag LOCUS_19480 7300 7824 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403937.1 protein_id gnl|my_center|LOCUS_19480 8568 7831 gene locus_tag LOCUS_19490 8568 7831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112930.1 protein_id gnl|my_center|LOCUS_19490 10318 8771 gene locus_tag LOCUS_19500 10318 8771 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010208311.1 protein_id gnl|my_center|LOCUS_19500 11713 10379 gene locus_tag LOCUS_19510 11713 10379 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114353.1 protein_id gnl|my_center|LOCUS_19510 12305 11817 gene locus_tag LOCUS_19520 gene dadR 12305 11817 CDS product transcriptional regulator DadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096535.1 protein_id gnl|my_center|LOCUS_19520 12453 13751 gene locus_tag LOCUS_19530 gene dadA 12453 13751 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403947.1 protein_id gnl|my_center|LOCUS_19530 13771 14100 gene locus_tag LOCUS_19540 13771 14100 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098273.1 protein_id gnl|my_center|LOCUS_19540 14213 14761 gene locus_tag LOCUS_19550 14213 14761 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096513.1 protein_id gnl|my_center|LOCUS_19550 >Feature sequence082 <1 2740 gene locus_tag LOCUS_19560 <1 2740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268160.1:indolepyruvate ferredoxin oxidoreductase family protein 2860 3954 gene locus_tag LOCUS_19570 2860 3954 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072585.1 protein_id gnl|my_center|LOCUS_19570 4083 5492 gene locus_tag LOCUS_19580 4083 5492 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 protein_id gnl|my_center|LOCUS_19580 5902 6987 gene locus_tag LOCUS_19590 gene hppD 5902 6987 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106569.1 protein_id gnl|my_center|LOCUS_19590 7145 8284 gene locus_tag LOCUS_19600 7145 8284 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549756.1 protein_id gnl|my_center|LOCUS_19600 8284 9267 gene locus_tag LOCUS_19610 8284 9267 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706476.1 protein_id gnl|my_center|LOCUS_19610 9257 9916 gene locus_tag LOCUS_19620 gene maiA 9257 9916 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071821.1 protein_id gnl|my_center|LOCUS_19620 9998 11458 gene locus_tag LOCUS_19630 9998 11458 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 protein_id gnl|my_center|LOCUS_19630 11590 13533 gene locus_tag LOCUS_19640 gene pctA 11590 13533 CDS product methyl-accepting chemotaxis protein PctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148125.1 protein_id gnl|my_center|LOCUS_19640 13655 14338 gene locus_tag LOCUS_19650 13655 14338 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378111.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence083 2178 1942 gene locus_tag LOCUS_19660 2178 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2059 2757 gene locus_tag LOCUS_19670 2059 2757 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813954.1 protein_id gnl|my_center|LOCUS_19670 4033 2780 gene locus_tag LOCUS_19680 gene nhaD 4033 2780 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721316.1 protein_id gnl|my_center|LOCUS_19680 4745 4221 gene locus_tag LOCUS_19690 4745 4221 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369637.1 protein_id gnl|my_center|LOCUS_19690 5454 4822 gene locus_tag LOCUS_19700 5454 4822 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268584.1 protein_id gnl|my_center|LOCUS_19700 6286 5522 gene locus_tag LOCUS_19710 6286 5522 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112457.1 protein_id gnl|my_center|LOCUS_19710 6688 6392 gene locus_tag LOCUS_19720 6688 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 7975 6833 gene locus_tag LOCUS_19730 gene cydB 7975 6833 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206958.1 protein_id gnl|my_center|LOCUS_19730 9617 7986 gene locus_tag LOCUS_19740 9617 7986 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206957.1 protein_id gnl|my_center|LOCUS_19740 9793 9614 gene locus_tag LOCUS_19750 9793 9614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 10688 10137 gene locus_tag LOCUS_19760 10688 10137 CDS product putative natural product biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007249561.1 protein_id gnl|my_center|LOCUS_19760 11158 10793 gene locus_tag LOCUS_19770 11158 10793 CDS product DUF2946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104226.1 protein_id gnl|my_center|LOCUS_19770 11888 11217 gene locus_tag LOCUS_19780 11888 11217 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082464.1 protein_id gnl|my_center|LOCUS_19780 13106 12030 gene locus_tag LOCUS_19790 13106 12030 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114000.1 protein_id gnl|my_center|LOCUS_19790 13561 13373 gene locus_tag LOCUS_19800 13561 13373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 <14456 13662 gene locus_tag LOCUS_19810 <14456 13662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003082462.1:tRNA 2-thiocytidine(32) synthetase TtcA >Feature sequence084 904 2229 gene locus_tag LOCUS_19820 904 2229 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114319.1 protein_id gnl|my_center|LOCUS_19820 2291 2611 gene locus_tag LOCUS_19830 2291 2611 CDS product DUF2845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003141121.1 protein_id gnl|my_center|LOCUS_19830 3273 2686 gene locus_tag LOCUS_19840 3273 2686 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114018.1 protein_id gnl|my_center|LOCUS_19840 3767 3375 gene locus_tag LOCUS_19850 3767 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19850 4405 5427 gene locus_tag LOCUS_19860 gene adhP 4405 5427 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 protein_id gnl|my_center|LOCUS_19860 6738 5455 gene locus_tag LOCUS_19870 6738 5455 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202907611.1 protein_id gnl|my_center|LOCUS_19870 7678 6758 gene locus_tag LOCUS_19880 7678 6758 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399927.1 protein_id gnl|my_center|LOCUS_19880 7749 8303 gene locus_tag LOCUS_19890 7749 8303 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399930.1 protein_id gnl|my_center|LOCUS_19890 8341 9249 gene locus_tag LOCUS_19900 gene tesB 8341 9249 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093084.1 protein_id gnl|my_center|LOCUS_19900 9246 9836 gene locus_tag LOCUS_19910 9246 9836 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114316.1 protein_id gnl|my_center|LOCUS_19910 10793 9936 gene locus_tag LOCUS_19920 10793 9936 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397257.1 protein_id gnl|my_center|LOCUS_19920 11346 10912 gene locus_tag LOCUS_19930 11346 10912 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095106.1 protein_id gnl|my_center|LOCUS_19930 11538 12077 gene locus_tag LOCUS_19940 11538 12077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 12776 12081 gene locus_tag LOCUS_19950 gene dnr 12776 12081 CDS product transcriptional regulator Dnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_19950 13658 12873 gene locus_tag LOCUS_19960 13658 12873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 <14437 13825 gene locus_tag LOCUS_19970 <14437 13825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092968.1:two-component system response regulator NarL >Feature sequence085 303 1076 gene locus_tag LOCUS_19980 gene glcC 303 1076 CDS product transcriptional regulator GlcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115387.1 protein_id gnl|my_center|LOCUS_19980 1185 1739 gene locus_tag LOCUS_19990 1185 1739 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105520.1 protein_id gnl|my_center|LOCUS_19990 1781 2674 gene locus_tag LOCUS_20000 gene ubiA 1781 2674 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245012.1 protein_id gnl|my_center|LOCUS_20000 2794 3483 gene locus_tag LOCUS_20010 gene phoB 2794 3483 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383141.1 protein_id gnl|my_center|LOCUS_20010 3546 4847 gene locus_tag LOCUS_20020 gene phoR 3546 4847 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121316.1 protein_id gnl|my_center|LOCUS_20020 4948 6291 gene locus_tag LOCUS_20030 4948 6291 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114376.1 protein_id gnl|my_center|LOCUS_20030 6465 7226 gene locus_tag LOCUS_20040 6465 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 8175 7279 gene locus_tag LOCUS_20050 8175 7279 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096656.1 protein_id gnl|my_center|LOCUS_20050 9232 8318 gene locus_tag LOCUS_20060 9232 8318 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768363.1 protein_id gnl|my_center|LOCUS_20060 9541 9326 gene locus_tag LOCUS_20070 9541 9326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 9431 10228 gene locus_tag LOCUS_20080 9431 10228 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095811.1 protein_id gnl|my_center|LOCUS_20080 10632 11837 gene locus_tag LOCUS_20090 10632 11837 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435262.1 protein_id gnl|my_center|LOCUS_20090 11834 12634 gene locus_tag LOCUS_20100 11834 12634 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329982.1 protein_id gnl|my_center|LOCUS_20100 12627 13331 gene locus_tag LOCUS_20110 12627 13331 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528528.1 protein_id gnl|my_center|LOCUS_20110 13331 14218 gene locus_tag LOCUS_20120 13331 14218 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528527.1 protein_id gnl|my_center|LOCUS_20120 >Feature sequence086 <1 649 gene locus_tag LOCUS_20130 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003085806.1:MBL fold metallo-hydrolase 788 1441 gene locus_tag LOCUS_20140 788 1441 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369222.1 protein_id gnl|my_center|LOCUS_20140 1589 5308 gene locus_tag LOCUS_20150 1589 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 5435 7558 gene locus_tag LOCUS_20160 5435 7558 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762944.1 protein_id gnl|my_center|LOCUS_20160 8471 7563 gene locus_tag LOCUS_20170 8471 7563 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_20170 10699 8603 gene locus_tag LOCUS_20180 gene pta 10699 8603 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114221.1 protein_id gnl|my_center|LOCUS_20180 12049 10862 gene locus_tag LOCUS_20190 12049 10862 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085814.1 protein_id gnl|my_center|LOCUS_20190 12289 12774 gene locus_tag LOCUS_20200 12289 12774 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406868.1 protein_id gnl|my_center|LOCUS_20200 12889 13371 gene locus_tag LOCUS_20210 12889 13371 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109429.1 protein_id gnl|my_center|LOCUS_20210 13511 14152 gene locus_tag LOCUS_20220 13511 14152 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085819.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence087 576 1196 gene locus_tag LOCUS_20230 576 1196 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723214.1 protein_id gnl|my_center|LOCUS_20230 1340 1633 gene locus_tag LOCUS_20240 1340 1633 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223228.1 protein_id gnl|my_center|LOCUS_20240 1729 2133 gene locus_tag LOCUS_20250 1729 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 4074 2257 gene locus_tag LOCUS_20260 4074 2257 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948377.1 protein_id gnl|my_center|LOCUS_20260 4298 4804 gene locus_tag LOCUS_20270 4298 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 5252 4860 gene locus_tag LOCUS_20280 5252 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 6261 5431 gene locus_tag LOCUS_20290 6261 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 7338 6496 gene locus_tag LOCUS_20300 gene yghU 7338 6496 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769036.1 protein_id gnl|my_center|LOCUS_20300 7593 7808 gene locus_tag LOCUS_20310 7593 7808 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318455.1 protein_id gnl|my_center|LOCUS_20310 9224 7860 gene locus_tag LOCUS_20320 9224 7860 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267596.1 protein_id gnl|my_center|LOCUS_20320 10343 9345 gene locus_tag LOCUS_20330 10343 9345 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768139.1 protein_id gnl|my_center|LOCUS_20330 10830 10417 gene locus_tag LOCUS_20340 10830 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420384.1 protein_id gnl|my_center|LOCUS_20340 11291 10923 gene locus_tag LOCUS_20350 11291 10923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083614.1 protein_id gnl|my_center|LOCUS_20350 11493 12551 gene locus_tag LOCUS_20360 11493 12551 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118564.1 protein_id gnl|my_center|LOCUS_20360 12767 13936 gene locus_tag LOCUS_20370 12767 13936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 >Feature sequence088 <1 1371 gene locus_tag LOCUS_20380 <1 1371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103073.1:sodium/proline symporter PutP 2350 1535 gene locus_tag LOCUS_20390 2350 1535 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267531.1 protein_id gnl|my_center|LOCUS_20390 2487 3401 gene locus_tag LOCUS_20400 gene pcaQ 2487 3401 CDS product pca operon transcription factor PcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765677.1 protein_id gnl|my_center|LOCUS_20400 3512 4231 gene locus_tag LOCUS_20410 gene pcaH 3512 4231 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366939.1 protein_id gnl|my_center|LOCUS_20410 4244 4849 gene locus_tag LOCUS_20420 gene pcaG 4244 4849 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112645.1 protein_id gnl|my_center|LOCUS_20420 4839 5933 gene locus_tag LOCUS_20430 gene zapE 4839 5933 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447983.1 protein_id gnl|my_center|LOCUS_20430 5944 6873 gene locus_tag LOCUS_20440 5944 6873 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531656.1 protein_id gnl|my_center|LOCUS_20440 6975 7784 gene locus_tag LOCUS_20450 6975 7784 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083866.1 protein_id gnl|my_center|LOCUS_20450 7976 8833 gene locus_tag LOCUS_20460 7976 8833 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_20460 8833 9615 gene locus_tag LOCUS_20470 8833 9615 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084062.1 protein_id gnl|my_center|LOCUS_20470 9612 10817 gene locus_tag LOCUS_20480 gene pcaF 9612 10817 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101891.1 protein_id gnl|my_center|LOCUS_20480 11041 12402 gene locus_tag LOCUS_20490 11041 12402 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765672.1 protein_id gnl|my_center|LOCUS_20490 12411 13199 gene locus_tag LOCUS_20500 gene pcaD 12411 13199 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084070.1 protein_id gnl|my_center|LOCUS_20500 13296 13694 gene locus_tag LOCUS_20510 gene pcaC 13296 13694 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315610.1 protein_id gnl|my_center|LOCUS_20510 13987 13914 gene locus_tag LOCUS_t00260 13987 13914 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence089 1155 10 gene locus_tag LOCUS_20520 gene rodA 1155 10 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114090.1 protein_id gnl|my_center|LOCUS_20520 3041 1152 gene locus_tag LOCUS_20530 gene mrdA 3041 1152 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_20530 3527 3060 gene locus_tag LOCUS_20540 gene rlmH 3527 3060 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093193.1 protein_id gnl|my_center|LOCUS_20540 3890 3531 gene locus_tag LOCUS_20550 gene rsfS 3890 3531 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_20550 4565 3906 gene locus_tag LOCUS_20560 gene nadD 4565 3906 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161458274.1 protein_id gnl|my_center|LOCUS_20560 5830 4565 gene locus_tag LOCUS_20570 5830 4565 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_20570 6046 7365 gene locus_tag LOCUS_20580 6046 7365 CDS product bifunctional DedA family/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100297.1 protein_id gnl|my_center|LOCUS_20580 7966 7382 gene locus_tag LOCUS_20590 7966 7382 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093212.1 protein_id gnl|my_center|LOCUS_20590 8696 7977 gene locus_tag LOCUS_20600 8696 7977 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114086.1 protein_id gnl|my_center|LOCUS_20600 9055 8693 gene locus_tag LOCUS_20610 9055 8693 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122011.1 protein_id gnl|my_center|LOCUS_20610 9260 9715 gene locus_tag LOCUS_20620 9260 9715 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093220.1 protein_id gnl|my_center|LOCUS_20620 9793 11466 gene locus_tag LOCUS_20630 9793 11466 CDS product C13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770114.1 protein_id gnl|my_center|LOCUS_20630 11486 12127 gene locus_tag LOCUS_20640 11486 12127 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770116.1 protein_id gnl|my_center|LOCUS_20640 12776 12234 gene locus_tag LOCUS_20650 gene orn 12776 12234 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095671.1 protein_id gnl|my_center|LOCUS_20650 13608 12805 gene locus_tag LOCUS_20660 13608 12805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence090 302 1249 gene locus_tag LOCUS_20670 gene trxB 302 1249 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097640.1 protein_id gnl|my_center|LOCUS_20670 1295 1975 gene locus_tag LOCUS_20680 gene aat 1295 1975 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405081.1 protein_id gnl|my_center|LOCUS_20680 2028 2735 gene locus_tag LOCUS_20690 2028 2735 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767401.1 protein_id gnl|my_center|LOCUS_20690 2833 3051 gene locus_tag LOCUS_20700 gene infA 2833 3051 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553999.1 protein_id gnl|my_center|LOCUS_20700 5445 3175 gene locus_tag LOCUS_20710 gene clpA 5445 3175 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104508.1 protein_id gnl|my_center|LOCUS_20710 5978 5475 gene locus_tag LOCUS_20720 5978 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 6056 6319 gene locus_tag LOCUS_20730 gene cspD 6056 6319 CDS product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090435.1 protein_id gnl|my_center|LOCUS_20730 7635 6379 gene locus_tag LOCUS_20740 gene icd 7635 6379 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090436.1 protein_id gnl|my_center|LOCUS_20740 7991 10219 gene locus_tag LOCUS_20750 7991 10219 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113369.1 protein_id gnl|my_center|LOCUS_20750 10324 10764 gene locus_tag LOCUS_20760 10324 10764 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_20760 10832 11959 gene locus_tag LOCUS_20770 gene mnmA 10832 11959 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268273.1 protein_id gnl|my_center|LOCUS_20770 11956 12594 gene locus_tag LOCUS_20780 gene hflD 11956 12594 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090440.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence091 517 197 gene locus_tag LOCUS_20790 517 197 CDS product DUF2388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096910.1 protein_id gnl|my_center|LOCUS_20790 856 560 gene locus_tag LOCUS_20800 856 560 CDS product DUF2388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105515.1 protein_id gnl|my_center|LOCUS_20800 1282 965 gene locus_tag LOCUS_20810 1282 965 CDS product DUF2388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096907.1 protein_id gnl|my_center|LOCUS_20810 1589 1389 gene locus_tag LOCUS_20820 1589 1389 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096877.1 protein_id gnl|my_center|LOCUS_20820 2543 1743 gene locus_tag LOCUS_20830 2543 1743 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266540.1 protein_id gnl|my_center|LOCUS_20830 2632 3621 gene locus_tag LOCUS_20840 2632 3621 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100363.1 protein_id gnl|my_center|LOCUS_20840 3743 4333 gene locus_tag LOCUS_20850 3743 4333 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113351.1 protein_id gnl|my_center|LOCUS_20850 5840 4404 gene locus_tag LOCUS_20860 5840 4404 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083975.1 protein_id gnl|my_center|LOCUS_20860 6161 5844 gene locus_tag LOCUS_20870 6161 5844 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083974.1 protein_id gnl|my_center|LOCUS_20870 7296 6175 gene locus_tag LOCUS_20880 7296 6175 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112662.1 protein_id gnl|my_center|LOCUS_20880 7816 9330 gene locus_tag LOCUS_20890 gene xcpR 7816 9330 CDS product GspE family T2SS ATPase variant XcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091377.1 protein_id gnl|my_center|LOCUS_20890 9481 10695 gene locus_tag LOCUS_20900 gene xcpS 9481 10695 CDS product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 protein_id gnl|my_center|LOCUS_20900 10701 11141 gene locus_tag LOCUS_20910 gene xcpT 10701 11141 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_20910 11145 11714 gene locus_tag LOCUS_20920 gene xcpU 11145 11714 CDS product GspH family T2SS minor pseudopilin variant XcpU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103530.1 protein_id gnl|my_center|LOCUS_20920 11711 12127 gene locus_tag LOCUS_20930 gene xcpV 11711 12127 CDS product GspI family T2SS minor pseudopilin variant XcpV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103528.1 protein_id gnl|my_center|LOCUS_20930 12127 12840 gene locus_tag LOCUS_20940 gene xcpW 12127 12840 CDS product GspJ family T2SS minor pseudopilin variant XcpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110067.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence092 3282 679 gene locus_tag LOCUS_20950 gene acnD 3282 679 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477783.1 protein_id gnl|my_center|LOCUS_20950 4486 3359 gene locus_tag LOCUS_20960 gene prpC 4486 3359 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103050.1 protein_id gnl|my_center|LOCUS_20960 5470 4583 gene locus_tag LOCUS_20970 gene prpB 5470 4583 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103044.1 protein_id gnl|my_center|LOCUS_20970 6192 5467 gene locus_tag LOCUS_20980 6192 5467 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267425.1 protein_id gnl|my_center|LOCUS_20980 6459 6995 gene locus_tag LOCUS_20990 6459 6995 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267424.1 protein_id gnl|my_center|LOCUS_20990 7001 8527 gene locus_tag LOCUS_21000 7001 8527 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765727.1 protein_id gnl|my_center|LOCUS_21000 8531 9514 gene locus_tag LOCUS_21010 8531 9514 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087807.1 protein_id gnl|my_center|LOCUS_21010 9565 10911 gene locus_tag LOCUS_21020 gene pabB 9565 10911 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765730.1 protein_id gnl|my_center|LOCUS_21020 11569 10952 gene locus_tag LOCUS_21030 gene thrH 11569 10952 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765732.1 protein_id gnl|my_center|LOCUS_21030 11761 12495 gene locus_tag LOCUS_21040 11761 12495 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895583.1 protein_id gnl|my_center|LOCUS_21040 13538 12564 gene locus_tag LOCUS_21050 gene cysB 13538 12564 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_21050 >Feature sequence093 1088 273 gene locus_tag LOCUS_21060 1088 273 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 protein_id gnl|my_center|LOCUS_21060 2980 1511 gene locus_tag LOCUS_21070 2980 1511 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267410.1 protein_id gnl|my_center|LOCUS_21070 3893 3087 gene locus_tag LOCUS_21080 3893 3087 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114747.1 protein_id gnl|my_center|LOCUS_21080 4066 5481 gene locus_tag LOCUS_21090 4066 5481 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114749.1 protein_id gnl|my_center|LOCUS_21090 6494 5487 gene locus_tag LOCUS_21100 6494 5487 CDS product lipase secretion chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117631.1 protein_id gnl|my_center|LOCUS_21100 7493 6558 gene locus_tag LOCUS_21110 gene lipA 7493 6558 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090955.1 protein_id gnl|my_center|LOCUS_21110 8303 7806 gene locus_tag LOCUS_21120 gene greB 8303 7806 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090951.1 protein_id gnl|my_center|LOCUS_21120 10848 8344 gene locus_tag LOCUS_21130 10848 8344 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765750.1 protein_id gnl|my_center|LOCUS_21130 11531 10845 gene locus_tag LOCUS_21140 11531 10845 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_21140 11543 12148 gene locus_tag LOCUS_21150 11543 12148 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103924.1 protein_id gnl|my_center|LOCUS_21150 12192 12473 gene locus_tag LOCUS_21160 12192 12473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090947.1 protein_id gnl|my_center|LOCUS_21160 12542 13507 gene locus_tag LOCUS_21170 12542 13507 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267417.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence094 <1 1192 gene locus_tag LOCUS_21180 <1 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114121.1:diguanylate cyclase DgcP 1324 2112 gene locus_tag LOCUS_21190 gene ampDh2 1324 2112 CDS product N-acetylmuramoyl-L-alanine amidase AmpDh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096970.1 protein_id gnl|my_center|LOCUS_21190 2519 2115 gene locus_tag LOCUS_21200 2519 2115 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640167.1 protein_id gnl|my_center|LOCUS_21200 4331 2544 gene locus_tag LOCUS_21210 4331 2544 CDS product KinB sensor domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266285.1 protein_id gnl|my_center|LOCUS_21210 3651 3745 gene locus_tag LOCUS_t00270 3651 3745 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5674 4328 gene locus_tag LOCUS_21220 gene algB 5674 4328 CDS product sigma-54-dependent response regulator transcription factor AlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318895.1 protein_id gnl|my_center|LOCUS_21220 5979 6410 gene locus_tag LOCUS_21230 5979 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 6590 6826 gene locus_tag LOCUS_21240 6590 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 6938 7108 gene locus_tag LOCUS_21250 6938 7108 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096961.1 protein_id gnl|my_center|LOCUS_21250 7504 8733 gene locus_tag LOCUS_21260 7504 8733 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102844.1 protein_id gnl|my_center|LOCUS_21260 11379 8830 gene locus_tag LOCUS_21270 11379 8830 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704330.1 protein_id gnl|my_center|LOCUS_21270 12463 11498 gene locus_tag LOCUS_21280 12463 11498 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349123.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence095 125 1036 gene locus_tag LOCUS_21290 gene era 125 1036 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085566.1 protein_id gnl|my_center|LOCUS_21290 1064 1774 gene locus_tag LOCUS_21300 gene recO 1064 1774 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101972.1 protein_id gnl|my_center|LOCUS_21300 1767 2513 gene locus_tag LOCUS_21310 gene pdxJ 1767 2513 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764769.1 protein_id gnl|my_center|LOCUS_21310 2776 2570 gene locus_tag LOCUS_21320 2776 2570 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632579.1 protein_id gnl|my_center|LOCUS_21320 3711 2761 gene locus_tag LOCUS_21330 3711 2761 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531163.1 protein_id gnl|my_center|LOCUS_21330 3850 4122 gene locus_tag LOCUS_21340 3850 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 5104 4142 gene locus_tag LOCUS_21350 gene cmoB 5104 4142 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764771.1 protein_id gnl|my_center|LOCUS_21350 5931 5101 gene locus_tag LOCUS_21360 gene cmoA 5931 5101 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764772.1 protein_id gnl|my_center|LOCUS_21360 6314 5910 gene locus_tag LOCUS_21370 6314 5910 CDS product protease inhibitor I42 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764773.1 protein_id gnl|my_center|LOCUS_21370 8818 6443 gene locus_tag LOCUS_21380 gene lon 8818 6443 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101982.1 protein_id gnl|my_center|LOCUS_21380 8975 9730 gene locus_tag LOCUS_21390 8975 9730 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085585.1 protein_id gnl|my_center|LOCUS_21390 9994 13155 gene locus_tag LOCUS_21400 gene putA 9994 13155 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114187.1 protein_id gnl|my_center|LOCUS_21400 >Feature sequence096 330 1559 gene locus_tag LOCUS_21410 330 1559 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083321.1 protein_id gnl|my_center|LOCUS_21410 2010 4754 gene locus_tag LOCUS_21420 2010 4754 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 protein_id gnl|my_center|LOCUS_21420 5246 6055 gene locus_tag LOCUS_21430 5246 6055 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423373.1 protein_id gnl|my_center|LOCUS_21430 6724 6146 gene locus_tag LOCUS_21440 6724 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21440 8079 6688 gene locus_tag LOCUS_21450 8079 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21450 8303 8923 gene locus_tag LOCUS_21460 8303 8923 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376205.1 protein_id gnl|my_center|LOCUS_21460 9047 10675 gene locus_tag LOCUS_21470 9047 10675 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205911.1 protein_id gnl|my_center|LOCUS_21470 10672 11787 gene locus_tag LOCUS_21480 10672 11787 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969064.1 protein_id gnl|my_center|LOCUS_21480 11784 13181 gene locus_tag LOCUS_21490 11784 13181 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705601.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence097 131 1195 gene locus_tag LOCUS_21500 gene fba 131 1195 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084964.1 protein_id gnl|my_center|LOCUS_21500 1637 1257 gene locus_tag LOCUS_21510 1637 1257 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318062.1 protein_id gnl|my_center|LOCUS_21510 1826 2533 gene locus_tag LOCUS_21520 1826 2533 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266341.1 protein_id gnl|my_center|LOCUS_21520 2705 2983 gene locus_tag LOCUS_21530 2705 2983 CDS product DUF3509 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315128.1 protein_id gnl|my_center|LOCUS_21530 3074 3547 gene locus_tag LOCUS_21540 3074 3547 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113663.1 protein_id gnl|my_center|LOCUS_21540 3750 6005 gene locus_tag LOCUS_21550 3750 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 6137 6460 gene locus_tag LOCUS_21560 6137 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 6517 6699 gene locus_tag LOCUS_21570 6517 6699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 7904 6720 gene locus_tag LOCUS_21580 7904 6720 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266455.1 protein_id gnl|my_center|LOCUS_21580 8039 8803 gene locus_tag LOCUS_21590 8039 8803 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266453.1 protein_id gnl|my_center|LOCUS_21590 10983 8800 gene locus_tag LOCUS_21600 gene yccS 10983 8800 CDS product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113274.1 protein_id gnl|my_center|LOCUS_21600 12495 11113 gene locus_tag LOCUS_21610 gene dbpA 12495 11113 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113273.1 protein_id gnl|my_center|LOCUS_21610 12674 13183 gene locus_tag LOCUS_21620 12674 13183 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402218.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence098 1893 940 gene locus_tag LOCUS_21630 1893 940 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109534.1 protein_id gnl|my_center|LOCUS_21630 2215 3894 gene locus_tag LOCUS_21640 2215 3894 CDS product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104314.1 protein_id gnl|my_center|LOCUS_21640 4243 5298 gene locus_tag LOCUS_21650 4243 5298 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_21650 5345 5872 gene locus_tag LOCUS_21660 5345 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 5869 7191 gene locus_tag LOCUS_21670 5869 7191 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_21670 7424 8428 gene locus_tag LOCUS_21680 gene dusA 7424 8428 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104050.1 protein_id gnl|my_center|LOCUS_21680 8560 9486 gene locus_tag LOCUS_21690 gene tal 8560 9486 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090868.1 protein_id gnl|my_center|LOCUS_21690 9976 9494 gene locus_tag LOCUS_21700 9976 9494 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104052.1 protein_id gnl|my_center|LOCUS_21700 11157 9973 gene locus_tag LOCUS_21710 11157 9973 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407019.1 protein_id gnl|my_center|LOCUS_21710 11351 11650 gene locus_tag LOCUS_21720 11351 11650 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382960.1 protein_id gnl|my_center|LOCUS_21720 12397 11696 gene locus_tag LOCUS_21730 12397 11696 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267309.1 protein_id gnl|my_center|LOCUS_21730 12612 12878 gene locus_tag LOCUS_21740 12612 12878 CDS product DUF4404 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090878.1 protein_id gnl|my_center|LOCUS_21740 <13455 12915 gene locus_tag LOCUS_21750 <13455 12915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114774.1:NADPH-dependent 7-cyano-7-deazaguanine reductase QueF >Feature sequence099 1181 366 gene locus_tag LOCUS_21760 1181 366 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038483.1 protein_id gnl|my_center|LOCUS_21760 2000 1290 gene locus_tag LOCUS_21770 2000 1290 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114086.1 protein_id gnl|my_center|LOCUS_21770 2362 1997 gene locus_tag LOCUS_21780 2362 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2663 4081 gene locus_tag LOCUS_21790 gene ccoG 2663 4081 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895670.1 protein_id gnl|my_center|LOCUS_21790 4089 5525 gene locus_tag LOCUS_21800 gene mapR 4089 5525 CDS product GntR family transcriptional regulator MpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113004.1 protein_id gnl|my_center|LOCUS_21800 6875 5535 gene locus_tag LOCUS_21810 6875 5535 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071311.1 protein_id gnl|my_center|LOCUS_21810 7776 7009 gene locus_tag LOCUS_21820 7776 7009 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113964.1 protein_id gnl|my_center|LOCUS_21820 8390 7797 gene locus_tag LOCUS_21830 8390 7797 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113966.1 protein_id gnl|my_center|LOCUS_21830 8524 9084 gene locus_tag LOCUS_21840 8524 9084 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109619.1 protein_id gnl|my_center|LOCUS_21840 12191 9120 gene locus_tag LOCUS_21850 12191 9120 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698545.1 protein_id gnl|my_center|LOCUS_21850 <13377 12197 gene locus_tag LOCUS_21860 <13377 12197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113855.1:multidrug efflux RND transporter periplasmic adaptor subunit MexJ >Feature sequence100 144 1067 gene locus_tag LOCUS_21870 144 1067 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_21870 1064 1795 gene locus_tag LOCUS_21880 1064 1795 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_21880 1805 3640 gene locus_tag LOCUS_21890 1805 3640 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_21890 3841 4050 gene locus_tag LOCUS_21900 3841 4050 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_21900 4550 4179 gene locus_tag LOCUS_21910 4550 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082373.1 protein_id gnl|my_center|LOCUS_21910 5416 4610 gene locus_tag LOCUS_21920 5416 4610 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406286.1 protein_id gnl|my_center|LOCUS_21920 6558 5410 gene locus_tag LOCUS_21930 gene dapE 6558 5410 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082377.1 protein_id gnl|my_center|LOCUS_21930 6687 7496 gene locus_tag LOCUS_21940 gene tcdA 6687 7496 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112469.1 protein_id gnl|my_center|LOCUS_21940 7665 8969 gene locus_tag LOCUS_21950 gene oprO 7665 8969 CDS product outer membrane porin OprO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104423.1 protein_id gnl|my_center|LOCUS_21950 9055 10185 gene locus_tag LOCUS_21960 9055 10185 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114811.1 protein_id gnl|my_center|LOCUS_21960 10616 10194 gene locus_tag LOCUS_21970 10616 10194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 11268 10714 gene locus_tag LOCUS_21980 11268 10714 CDS product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764969.1 protein_id gnl|my_center|LOCUS_21980 12205 11297 gene locus_tag LOCUS_21990 12205 11297 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402385.1 protein_id gnl|my_center|LOCUS_21990 12113 12586 gene locus_tag LOCUS_22000 12113 12586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 13048 12617 gene locus_tag LOCUS_22010 13048 12617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence101 <1 1182 gene locus_tag LOCUS_22020 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112508.1:flagellar assembly peptidoglycan hydrolase FlgJ 1186 3201 gene locus_tag LOCUS_22030 gene flgK 1186 3201 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112507.1 protein_id gnl|my_center|LOCUS_22030 3213 4478 gene locus_tag LOCUS_22040 gene flgL 3213 4478 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112506.1 protein_id gnl|my_center|LOCUS_22040 4600 4917 gene locus_tag LOCUS_22050 4600 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 5294 5734 gene locus_tag LOCUS_22060 5294 5734 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770452.1 protein_id gnl|my_center|LOCUS_22060 5902 6228 gene locus_tag LOCUS_22070 5902 6228 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267116.1 protein_id gnl|my_center|LOCUS_22070 6225 6593 gene locus_tag LOCUS_22080 6225 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430937.1 protein_id gnl|my_center|LOCUS_22080 6593 7060 gene locus_tag LOCUS_22090 6593 7060 CDS product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114794.1 protein_id gnl|my_center|LOCUS_22090 8820 7027 gene locus_tag LOCUS_22100 8820 7027 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770458.1 protein_id gnl|my_center|LOCUS_22100 10938 8914 gene locus_tag LOCUS_22110 10938 8914 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_22110 11177 12139 gene locus_tag LOCUS_22120 11177 12139 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114796.1 protein_id gnl|my_center|LOCUS_22120 <13134 12189 gene locus_tag LOCUS_22130 <13134 12189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267127.1:M18 family aminopeptidase >Feature sequence102 44 649 gene locus_tag LOCUS_22140 44 649 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_22140 2634 667 gene locus_tag LOCUS_22150 2634 667 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115754.1 protein_id gnl|my_center|LOCUS_22150 3538 2702 gene locus_tag LOCUS_22160 3538 2702 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112483.1 protein_id gnl|my_center|LOCUS_22160 3690 4091 gene locus_tag LOCUS_22170 3690 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093424.1 protein_id gnl|my_center|LOCUS_22170 4250 5284 gene locus_tag LOCUS_22180 4250 5284 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531377.1 protein_id gnl|my_center|LOCUS_22180 5432 7429 gene locus_tag LOCUS_22190 5432 7429 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268217.1 protein_id gnl|my_center|LOCUS_22190 9237 7531 gene locus_tag LOCUS_22200 9237 7531 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425021.1 protein_id gnl|my_center|LOCUS_22200 9457 10050 gene locus_tag LOCUS_22210 9457 10050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 10779 10054 gene locus_tag LOCUS_22220 10779 10054 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267639.1 protein_id gnl|my_center|LOCUS_22220 10870 11664 gene locus_tag LOCUS_22230 10870 11664 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963355.1 protein_id gnl|my_center|LOCUS_22230 12142 11705 gene locus_tag LOCUS_22240 12142 11705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 >Feature sequence103 16 831 gene locus_tag LOCUS_22250 gene suhB 16 831 CDS product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092845.1 protein_id gnl|my_center|LOCUS_22250 1423 890 gene locus_tag LOCUS_22260 1423 890 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092848.1 protein_id gnl|my_center|LOCUS_22260 2412 1501 gene locus_tag LOCUS_22270 gene secF 2412 1501 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380592.1 protein_id gnl|my_center|LOCUS_22270 4293 2425 gene locus_tag LOCUS_22280 gene secD 4293 2425 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100609.1 protein_id gnl|my_center|LOCUS_22280 4687 4358 gene locus_tag LOCUS_22290 gene yajC 4687 4358 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092856.1 protein_id gnl|my_center|LOCUS_22290 5863 4730 gene locus_tag LOCUS_22300 gene tgt 5863 4730 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100607.1 protein_id gnl|my_center|LOCUS_22300 6909 5860 gene locus_tag LOCUS_22310 gene queA 6909 5860 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113798.1 protein_id gnl|my_center|LOCUS_22310 7021 7107 gene locus_tag LOCUS_t00280 7021 7107 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7506 7718 gene locus_tag LOCUS_22320 7506 7718 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365337.1 protein_id gnl|my_center|LOCUS_22320 7816 8313 gene locus_tag LOCUS_22330 7816 8313 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_22330 9454 8393 gene locus_tag LOCUS_22340 gene lptG 9454 8393 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092863.1 protein_id gnl|my_center|LOCUS_22340 10568 9447 gene locus_tag LOCUS_22350 gene lptF 10568 9447 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_22350 10823 12313 gene locus_tag LOCUS_22360 10823 12313 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092867.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence104 203 2176 gene locus_tag LOCUS_22370 203 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 3282 2203 gene locus_tag LOCUS_22380 3282 2203 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525362.1 protein_id gnl|my_center|LOCUS_22380 3379 4671 gene locus_tag LOCUS_22390 3379 4671 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528286.1 protein_id gnl|my_center|LOCUS_22390 5339 4722 gene locus_tag LOCUS_22400 5339 4722 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406246.1 protein_id gnl|my_center|LOCUS_22400 6110 5358 gene locus_tag LOCUS_22410 6110 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 6730 6107 gene locus_tag LOCUS_22420 6730 6107 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350422.1 protein_id gnl|my_center|LOCUS_22420 7724 6777 gene locus_tag LOCUS_22430 7724 6777 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092132.1 protein_id gnl|my_center|LOCUS_22430 7826 8839 gene locus_tag LOCUS_22440 7826 8839 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770073.1 protein_id gnl|my_center|LOCUS_22440 10080 8857 gene locus_tag LOCUS_22450 10080 8857 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084679.1 protein_id gnl|my_center|LOCUS_22450 11327 10146 gene locus_tag LOCUS_22460 11327 10146 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 protein_id gnl|my_center|LOCUS_22460 11503 12405 gene locus_tag LOCUS_22470 11503 12405 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084684.1 protein_id gnl|my_center|LOCUS_22470 >Feature sequence105 235 2310 gene locus_tag LOCUS_22480 235 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 4003 2321 gene locus_tag LOCUS_22490 4003 2321 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103012.1 protein_id gnl|my_center|LOCUS_22490 4739 4110 gene locus_tag LOCUS_22500 4739 4110 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406892.1 protein_id gnl|my_center|LOCUS_22500 4811 5770 gene locus_tag LOCUS_22510 4811 5770 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_22510 5842 6840 gene locus_tag LOCUS_22520 5842 6840 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099371.1 protein_id gnl|my_center|LOCUS_22520 7102 7689 gene locus_tag LOCUS_22530 7102 7689 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094926.1 protein_id gnl|my_center|LOCUS_22530 7774 8217 gene locus_tag LOCUS_22540 7774 8217 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114708.1 protein_id gnl|my_center|LOCUS_22540 9056 8238 gene locus_tag LOCUS_22550 9056 8238 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099360.1 protein_id gnl|my_center|LOCUS_22550 9186 11342 gene locus_tag LOCUS_22560 9186 11342 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099358.1 protein_id gnl|my_center|LOCUS_22560 11946 11329 gene locus_tag LOCUS_22570 11946 11329 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266751.1 protein_id gnl|my_center|LOCUS_22570 12218 11958 gene locus_tag LOCUS_22580 12218 11958 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094943.1 protein_id gnl|my_center|LOCUS_22580 12400 12218 gene locus_tag LOCUS_22590 12400 12218 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094945.1 protein_id gnl|my_center|LOCUS_22590 >Feature sequence106 1036 1455 gene locus_tag LOCUS_22600 1036 1455 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721969.1 protein_id gnl|my_center|LOCUS_22600 1529 2773 gene locus_tag LOCUS_22610 1529 2773 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707414.1 protein_id gnl|my_center|LOCUS_22610 2891 3718 gene locus_tag LOCUS_22620 2891 3718 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208648.1 protein_id gnl|my_center|LOCUS_22620 3787 4563 gene locus_tag LOCUS_22630 gene deoC 3787 4563 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071446.1 protein_id gnl|my_center|LOCUS_22630 4565 5884 gene locus_tag LOCUS_22640 gene deoA 4565 5884 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529628.1 protein_id gnl|my_center|LOCUS_22640 5881 7125 gene locus_tag LOCUS_22650 gene deoB 5881 7125 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815520.1 protein_id gnl|my_center|LOCUS_22650 7128 7847 gene locus_tag LOCUS_22660 gene deoD 7128 7847 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224891.1 protein_id gnl|my_center|LOCUS_22660 7954 9276 gene locus_tag LOCUS_22670 7954 9276 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_22670 9395 10015 gene locus_tag LOCUS_22680 9395 10015 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084655.1 protein_id gnl|my_center|LOCUS_22680 11172 10324 gene locus_tag LOCUS_22690 gene metF 11172 10324 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118821.1 protein_id gnl|my_center|LOCUS_22690 <12645 11266 gene locus_tag LOCUS_22700 <12645 11266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003099900.1:adenosylhomocysteinase >Feature sequence107 1366 590 gene locus_tag LOCUS_22710 1366 590 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110878.1 protein_id gnl|my_center|LOCUS_22710 1460 2587 gene locus_tag LOCUS_22720 1460 2587 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112793.1 protein_id gnl|my_center|LOCUS_22720 2584 2961 gene locus_tag LOCUS_22730 2584 2961 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070495.1 protein_id gnl|my_center|LOCUS_22730 3197 3601 gene locus_tag LOCUS_22740 3197 3601 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070496.1 protein_id gnl|my_center|LOCUS_22740 4682 3636 gene locus_tag LOCUS_22750 4682 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 5767 4688 gene locus_tag LOCUS_22760 gene bla 5767 4688 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140598.1 protein_id gnl|my_center|LOCUS_22760 5910 7148 gene locus_tag LOCUS_22770 5910 7148 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112774.1 protein_id gnl|my_center|LOCUS_22770 9561 7360 gene locus_tag LOCUS_22780 9561 7360 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105101.1 protein_id gnl|my_center|LOCUS_22780 10439 9558 gene locus_tag LOCUS_22790 10439 9558 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105102.1 protein_id gnl|my_center|LOCUS_22790 11053 10541 gene locus_tag LOCUS_22800 11053 10541 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105103.1 protein_id gnl|my_center|LOCUS_22800 11783 11178 gene locus_tag LOCUS_22810 11783 11178 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064691.1 protein_id gnl|my_center|LOCUS_22810 12591 11776 gene locus_tag LOCUS_22820 12591 11776 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818502.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence108 1385 1822 gene locus_tag LOCUS_22830 gene pedF 1385 1822 CDS product cytochrome c-550 PedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113462.1 protein_id gnl|my_center|LOCUS_22830 1822 2736 gene locus_tag LOCUS_22840 1822 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 2814 3560 gene locus_tag LOCUS_22850 2814 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 3607 4536 gene locus_tag LOCUS_22860 3607 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 5781 4543 gene locus_tag LOCUS_22870 5781 4543 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064221.1 protein_id gnl|my_center|LOCUS_22870 6061 7836 gene locus_tag LOCUS_22880 6061 7836 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399374.1 protein_id gnl|my_center|LOCUS_22880 8807 7938 gene locus_tag LOCUS_22890 8807 7938 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970101.1 protein_id gnl|my_center|LOCUS_22890 9140 9904 gene locus_tag LOCUS_22900 9140 9904 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178283.1 protein_id gnl|my_center|LOCUS_22900 10766 9972 gene locus_tag LOCUS_22910 gene fabI 10766 9972 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368564.1 protein_id gnl|my_center|LOCUS_22910 12408 10747 gene locus_tag LOCUS_22920 12408 10747 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770761.1 protein_id gnl|my_center|LOCUS_22920 >Feature sequence109 640 1335 gene locus_tag LOCUS_22930 640 1335 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268379.1 protein_id gnl|my_center|LOCUS_22930 2103 1360 gene locus_tag LOCUS_22940 gene eftM 2103 1360 CDS product class I SAM-dependent methyltransferase EftM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112983.1 protein_id gnl|my_center|LOCUS_22940 4024 2246 gene locus_tag LOCUS_22950 gene katG 4024 2246 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640640.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22950 4477 4043 gene locus_tag LOCUS_22960 4477 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22960 4831 5253 gene locus_tag LOCUS_22970 4831 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 5611 6213 gene locus_tag LOCUS_22980 5611 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 6228 6803 gene locus_tag LOCUS_22990 6228 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 7679 6891 gene locus_tag LOCUS_23000 7679 6891 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187753.1 protein_id gnl|my_center|LOCUS_23000 7760 8659 gene locus_tag LOCUS_23010 7760 8659 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082510.1 protein_id gnl|my_center|LOCUS_23010 8943 8695 gene locus_tag LOCUS_23020 8943 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 10037 9033 gene locus_tag LOCUS_23030 10037 9033 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171654.1 protein_id gnl|my_center|LOCUS_23030 10368 11462 gene locus_tag LOCUS_23040 10368 11462 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201417760.1 protein_id gnl|my_center|LOCUS_23040 11875 11732 gene locus_tag LOCUS_23050 11875 11732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 12356 11919 gene locus_tag LOCUS_23060 12356 11919 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530143.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence110 425 240 gene locus_tag LOCUS_23070 425 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 680 468 gene locus_tag LOCUS_23080 680 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 958 1034 gene locus_tag LOCUS_t00290 958 1034 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1876 1133 gene locus_tag LOCUS_23090 gene flgZ 1876 1133 CDS product flagellar brake protein FlgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119635.1 protein_id gnl|my_center|LOCUS_23090 2409 1939 gene locus_tag LOCUS_23100 gene flgN 2409 1939 CDS product flagellar export chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113135.1 protein_id gnl|my_center|LOCUS_23100 2778 2449 gene locus_tag LOCUS_23110 gene flgM 2778 2449 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098742.1 protein_id gnl|my_center|LOCUS_23110 3638 2886 gene locus_tag LOCUS_23120 gene flgA 3638 2886 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268462.1 protein_id gnl|my_center|LOCUS_23120 3713 4645 gene locus_tag LOCUS_23130 3713 4645 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098747.1 protein_id gnl|my_center|LOCUS_23130 4635 5504 gene locus_tag LOCUS_23140 gene cheR 4635 5504 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382687.1 protein_id gnl|my_center|LOCUS_23140 5698 6102 gene locus_tag LOCUS_23150 gene flgB 5698 6102 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082144.1 protein_id gnl|my_center|LOCUS_23150 6114 6557 gene locus_tag LOCUS_23160 gene flgC 6114 6557 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082150.1 protein_id gnl|my_center|LOCUS_23160 6577 7260 gene locus_tag LOCUS_23170 gene flgD 6577 7260 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082153.1 protein_id gnl|my_center|LOCUS_23170 7291 8760 gene locus_tag LOCUS_23180 gene flgE 7291 8760 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082154.1 protein_id gnl|my_center|LOCUS_23180 8958 9698 gene locus_tag LOCUS_23190 gene flgF 8958 9698 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082159.1 protein_id gnl|my_center|LOCUS_23190 9734 10519 gene locus_tag LOCUS_23200 gene flgG 9734 10519 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082164.1 protein_id gnl|my_center|LOCUS_23200 10601 11296 gene locus_tag LOCUS_23210 gene flgH 10601 11296 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082166.1 protein_id gnl|my_center|LOCUS_23210 11311 12411 gene locus_tag LOCUS_23220 11311 12411 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082169.1 protein_id gnl|my_center|LOCUS_23220 >Feature sequence111 633 52 gene locus_tag LOCUS_23230 gene rpoE 633 52 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554912.1 protein_id gnl|my_center|LOCUS_23230 981 2597 gene locus_tag LOCUS_23240 gene nadB 981 2597 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114182.1 protein_id gnl|my_center|LOCUS_23240 3021 2566 gene locus_tag LOCUS_23250 3021 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104913.1 protein_id gnl|my_center|LOCUS_23250 3259 3005 gene locus_tag LOCUS_23260 3259 3005 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085532.1 protein_id gnl|my_center|LOCUS_23260 3406 4353 gene locus_tag LOCUS_23270 3406 4353 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032609198.1 protein_id gnl|my_center|LOCUS_23270 4461 5297 gene locus_tag LOCUS_23280 4461 5297 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_23280 5440 5955 gene locus_tag LOCUS_23290 5440 5955 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401379.1 protein_id gnl|my_center|LOCUS_23290 6687 5992 gene locus_tag LOCUS_23300 gene ung 6687 5992 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106436.1 protein_id gnl|my_center|LOCUS_23300 6938 8182 gene locus_tag LOCUS_23310 6938 8182 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152802079.1 protein_id gnl|my_center|LOCUS_23310 8339 9157 gene locus_tag LOCUS_23320 8339 9157 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085498.1 protein_id gnl|my_center|LOCUS_23320 9191 10297 gene locus_tag LOCUS_23330 9191 10297 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114169.1 protein_id gnl|my_center|LOCUS_23330 10727 10305 gene locus_tag LOCUS_23340 10727 10305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 10960 11544 gene locus_tag LOCUS_23350 gene rsxA 10960 11544 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092041.1 protein_id gnl|my_center|LOCUS_23350 11541 12116 gene locus_tag LOCUS_23360 gene rsxB 11541 12116 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103780.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence112 739 1134 gene locus_tag LOCUS_23370 gene rnpA 739 1134 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100251.1 protein_id gnl|my_center|LOCUS_23370 1127 1372 gene locus_tag LOCUS_23380 gene yidD 1127 1372 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551313.1 protein_id gnl|my_center|LOCUS_23380 1375 3045 gene locus_tag LOCUS_23390 gene yidC 1375 3045 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401421.1 protein_id gnl|my_center|LOCUS_23390 3118 4485 gene locus_tag LOCUS_23400 gene mnmE 3118 4485 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244945.1 protein_id gnl|my_center|LOCUS_23400 4770 7079 gene locus_tag LOCUS_23410 4770 7079 CDS product putative monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942980.1 protein_id gnl|my_center|LOCUS_23410 7076 7477 gene locus_tag LOCUS_23420 7076 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23420 7479 7862 gene locus_tag LOCUS_23430 7479 7862 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316622.1 protein_id gnl|my_center|LOCUS_23430 7859 9379 gene locus_tag LOCUS_23440 7859 9379 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125097.1 protein_id gnl|my_center|LOCUS_23440 9376 9720 gene locus_tag LOCUS_23450 9376 9720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 9723 9983 gene locus_tag LOCUS_23460 9723 9983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 9980 10372 gene locus_tag LOCUS_23470 gene mnhG 9980 10372 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391282.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence113 <1 652 gene locus_tag LOCUS_23480 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003100194.1:glucose-6-phosphate isomerase 781 1656 gene locus_tag LOCUS_23490 781 1656 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113910.1 protein_id gnl|my_center|LOCUS_23490 1718 2734 gene locus_tag LOCUS_23500 1718 2734 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268875.1 protein_id gnl|my_center|LOCUS_23500 2820 3080 gene locus_tag LOCUS_23510 2820 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23510 3144 5708 gene locus_tag LOCUS_23520 3144 5708 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766460.1 protein_id gnl|my_center|LOCUS_23520 5708 6004 gene locus_tag LOCUS_23530 5708 6004 CDS product DUF2845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100541.1 protein_id gnl|my_center|LOCUS_23530 6022 6330 gene locus_tag LOCUS_23540 6022 6330 CDS product DUF2845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100526.1 protein_id gnl|my_center|LOCUS_23540 6762 6397 gene locus_tag LOCUS_23550 6762 6397 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095177.1 protein_id gnl|my_center|LOCUS_23550 9138 7033 gene locus_tag LOCUS_23560 gene pnp 9138 7033 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377508.1 protein_id gnl|my_center|LOCUS_23560 9575 9306 gene locus_tag LOCUS_23570 gene rpsO 9575 9306 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095184.1 protein_id gnl|my_center|LOCUS_23570 10608 9691 gene locus_tag LOCUS_23580 gene truB 10608 9691 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400189.1 protein_id gnl|my_center|LOCUS_23580 11000 10611 gene locus_tag LOCUS_23590 gene rbfA 11000 10611 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095188.1 protein_id gnl|my_center|LOCUS_23590 <12305 11103 gene locus_tag LOCUS_23600 <12305 11103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113908.1:translation initiation factor IF-2 >Feature sequence114 2924 1209 gene locus_tag LOCUS_23610 gene recJ 2924 1209 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_23610 3478 2951 gene locus_tag LOCUS_23620 3478 2951 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197230.1 protein_id gnl|my_center|LOCUS_23620 3659 4408 gene locus_tag LOCUS_23630 3659 4408 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113623.1 protein_id gnl|my_center|LOCUS_23630 4405 5112 gene locus_tag LOCUS_23640 4405 5112 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113622.1 protein_id gnl|my_center|LOCUS_23640 5109 6035 gene locus_tag LOCUS_23650 5109 6035 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147543.1 protein_id gnl|my_center|LOCUS_23650 6041 6838 gene locus_tag LOCUS_23660 6041 6838 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 protein_id gnl|my_center|LOCUS_23660 6946 8166 gene locus_tag LOCUS_23670 6946 8166 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831227.1 protein_id gnl|my_center|LOCUS_23670 8727 8188 gene locus_tag LOCUS_23680 8727 8188 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092594.1 protein_id gnl|my_center|LOCUS_23680 9959 8769 gene locus_tag LOCUS_23690 9959 8769 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966314.1 protein_id gnl|my_center|LOCUS_23690 10218 10436 gene locus_tag LOCUS_23700 10218 10436 CDS product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003350768.1 protein_id gnl|my_center|LOCUS_23700 10629 11099 gene locus_tag LOCUS_23710 gene bfr 10629 11099 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554851.1 protein_id gnl|my_center|LOCUS_23710 11904 11170 gene locus_tag LOCUS_23720 11904 11170 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091600.1 protein_id gnl|my_center|LOCUS_23720 12238 12162 gene locus_tag LOCUS_t00300 12238 12162 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence115 1519 1256 gene locus_tag LOCUS_23730 1519 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092978.1 protein_id gnl|my_center|LOCUS_23730 2596 1895 gene locus_tag LOCUS_23740 2596 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 2773 4347 gene locus_tag LOCUS_23750 2773 4347 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003660.1 protein_id gnl|my_center|LOCUS_23750 4634 6403 gene locus_tag LOCUS_23760 4634 6403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 7410 6979 gene locus_tag LOCUS_23770 7410 6979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 7746 7462 gene locus_tag LOCUS_23780 7746 7462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 8087 9085 gene locus_tag LOCUS_23790 8087 9085 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974005.1 protein_id gnl|my_center|LOCUS_23790 10135 9857 gene locus_tag LOCUS_23800 10135 9857 CDS product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083624.1 protein_id gnl|my_center|LOCUS_23800 <12094 10132 gene locus_tag LOCUS_23810 <12094 10132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114658.1:oligopeptidase A >Feature sequence116 81 5 gene locus_tag LOCUS_t00310 81 5 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 437 141 gene locus_tag LOCUS_23820 437 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 1169 516 gene locus_tag LOCUS_23830 1169 516 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939374.1 protein_id gnl|my_center|LOCUS_23830 3125 1272 gene locus_tag LOCUS_23840 gene rpoD 3125 1272 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411788.1 protein_id gnl|my_center|LOCUS_23840 5142 3193 gene locus_tag LOCUS_23850 gene dnaG 5142 3193 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269141.1 protein_id gnl|my_center|LOCUS_23850 5497 5282 gene locus_tag LOCUS_23860 gene rpsU 5497 5282 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551877.1 protein_id gnl|my_center|LOCUS_23860 5693 6718 gene locus_tag LOCUS_23870 gene tsaD 5693 6718 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109020.1 protein_id gnl|my_center|LOCUS_23870 7303 6734 gene locus_tag LOCUS_23880 gene plsY 7303 6734 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085061.1 protein_id gnl|my_center|LOCUS_23880 7378 7731 gene locus_tag LOCUS_23890 gene folB 7378 7731 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316242.1 protein_id gnl|my_center|LOCUS_23890 7722 8261 gene locus_tag LOCUS_23900 gene folK 7722 8261 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103182.1 protein_id gnl|my_center|LOCUS_23900 9433 8258 gene locus_tag LOCUS_23910 9433 8258 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113214.1 protein_id gnl|my_center|LOCUS_23910 11079 9532 gene locus_tag LOCUS_23920 11079 9532 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103184.1 protein_id gnl|my_center|LOCUS_23920 <12041 11090 gene locus_tag LOCUS_23930 <12041 11090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269137.1:YeaH/YhbH family protein >Feature sequence117 <1 1054 gene locus_tag LOCUS_23940 <1 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268766.1:allophanate hydrolase 1187 2158 gene locus_tag LOCUS_23950 1187 2158 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023619.1 protein_id gnl|my_center|LOCUS_23950 2607 3608 gene locus_tag LOCUS_23960 2607 3608 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392003.1 protein_id gnl|my_center|LOCUS_23960 3654 4676 gene locus_tag LOCUS_23970 3654 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 4678 5466 gene locus_tag LOCUS_23980 4678 5466 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707832.1 protein_id gnl|my_center|LOCUS_23980 5466 6221 gene locus_tag LOCUS_23990 gene fabG 5466 6221 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_23990 6218 7102 gene locus_tag LOCUS_24000 6218 7102 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_24000 7099 7860 gene locus_tag LOCUS_24010 7099 7860 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067911.1 protein_id gnl|my_center|LOCUS_24010 7857 8516 gene locus_tag LOCUS_24020 7857 8516 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615650.1 protein_id gnl|my_center|LOCUS_24020 8566 9375 gene locus_tag LOCUS_24030 8566 9375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 9372 10250 gene locus_tag LOCUS_24040 9372 10250 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140177.1 protein_id gnl|my_center|LOCUS_24040 10253 11092 gene locus_tag LOCUS_24050 10253 11092 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094604.1 protein_id gnl|my_center|LOCUS_24050 <11989 11096 gene locus_tag LOCUS_24060 <11989 11096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142495.1:alpha/beta fold hydrolase >Feature sequence118 2904 754 gene locus_tag LOCUS_24070 2904 754 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 protein_id gnl|my_center|LOCUS_24070 3241 3086 gene locus_tag LOCUS_24080 gene rpmG 3241 3086 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551515.1 protein_id gnl|my_center|LOCUS_24080 3489 3253 gene locus_tag LOCUS_24090 gene rpmB 3489 3253 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096556.1 protein_id gnl|my_center|LOCUS_24090 5405 3786 gene locus_tag LOCUS_24100 gene fadD2 5405 3786 CDS product long-chain-fatty-acid--CoA ligase FadD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091644.1 protein_id gnl|my_center|LOCUS_24100 5575 6360 gene locus_tag LOCUS_24110 5575 6360 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181512989.1 protein_id gnl|my_center|LOCUS_24110 6942 6364 gene locus_tag LOCUS_24120 6942 6364 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098179.1 protein_id gnl|my_center|LOCUS_24120 7041 7925 gene locus_tag LOCUS_24130 7041 7925 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087999.1 protein_id gnl|my_center|LOCUS_24130 8067 9425 gene locus_tag LOCUS_24140 8067 9425 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 protein_id gnl|my_center|LOCUS_24140 10731 9589 gene locus_tag LOCUS_24150 gene pimD 10731 9589 CDS product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 protein_id gnl|my_center|LOCUS_24150 <11736 10744 gene locus_tag LOCUS_24160 <11736 10744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185551.1:acyl-CoA dehydrogenase family protein >Feature sequence119 552 25 gene locus_tag LOCUS_24170 552 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 1710 601 gene locus_tag LOCUS_24180 gene potA 1710 601 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085109.1 protein_id gnl|my_center|LOCUS_24180 2488 1859 gene locus_tag LOCUS_24190 2488 1859 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085103.1 protein_id gnl|my_center|LOCUS_24190 3825 2485 gene locus_tag LOCUS_24200 3825 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24200 4777 3740 gene locus_tag LOCUS_24210 4777 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24210 4667 4894 gene locus_tag LOCUS_24220 4667 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 4999 6006 gene locus_tag LOCUS_24230 4999 6006 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099546.1 protein_id gnl|my_center|LOCUS_24230 6779 6012 gene locus_tag LOCUS_24240 6779 6012 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103191.1 protein_id gnl|my_center|LOCUS_24240 7452 6781 gene locus_tag LOCUS_24250 7452 6781 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463963.1 protein_id gnl|my_center|LOCUS_24250 8507 7449 gene locus_tag LOCUS_24260 gene amgK 8507 7449 CDS product N-acetylmuramate/N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113208.1 protein_id gnl|my_center|LOCUS_24260 8598 11378 gene locus_tag LOCUS_24270 8598 11378 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269131.1 protein_id gnl|my_center|LOCUS_24270 >Feature sequence120 1325 528 gene locus_tag LOCUS_24280 gene fdhD 1325 528 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100044.1 protein_id gnl|my_center|LOCUS_24280 2320 1433 gene locus_tag LOCUS_24290 2320 1433 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100042.1 protein_id gnl|my_center|LOCUS_24290 3408 2371 gene locus_tag LOCUS_24300 3408 2371 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104456.1 protein_id gnl|my_center|LOCUS_24300 4330 3416 gene locus_tag LOCUS_24310 4330 3416 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104455.1 protein_id gnl|my_center|LOCUS_24310 5411 7894 gene locus_tag LOCUS_24320 5411 7894 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104454.1 protein_id gnl|my_center|LOCUS_24320 7969 9885 gene locus_tag LOCUS_24330 7969 9885 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104453.1 protein_id gnl|my_center|LOCUS_24330 9952 10665 gene locus_tag LOCUS_24340 gene tolQ 9952 10665 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245914.1 protein_id gnl|my_center|LOCUS_24340 10677 11141 gene locus_tag LOCUS_24350 gene tolR 10677 11141 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770871.1 protein_id gnl|my_center|LOCUS_24350 >Feature sequence121 1689 7 gene locus_tag LOCUS_24360 gene rpsA 1689 7 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 protein_id gnl|my_center|LOCUS_24360 2569 1880 gene locus_tag LOCUS_24370 gene cmk 2569 1880 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616463.1 protein_id gnl|my_center|LOCUS_24370 4809 2566 gene locus_tag LOCUS_24380 4809 2566 CDS product bifunctional prephenate dehydrogenase/3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207213.1 protein_id gnl|my_center|LOCUS_24380 5915 4806 gene locus_tag LOCUS_24390 gene hisC 5915 4806 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_24390 7094 5997 gene locus_tag LOCUS_24400 gene pheA 7094 5997 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091446.1 protein_id gnl|my_center|LOCUS_24400 8179 7094 gene locus_tag LOCUS_24410 gene serC 8179 7094 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_24410 11106 8299 gene locus_tag LOCUS_24420 gene gyrA 11106 8299 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091448.1 protein_id gnl|my_center|LOCUS_24420 >Feature sequence122 859 122 gene locus_tag LOCUS_24430 gene pgeF 859 122 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266592.1 protein_id gnl|my_center|LOCUS_24430 1830 856 gene locus_tag LOCUS_24440 gene rluD 1830 856 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381266.1 protein_id gnl|my_center|LOCUS_24440 2036 1848 gene locus_tag LOCUS_24450 2036 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 2035 3024 gene locus_tag LOCUS_24460 2035 3024 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102590.1 protein_id gnl|my_center|LOCUS_24460 3146 3379 gene locus_tag LOCUS_24470 3146 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 3369 4961 gene locus_tag LOCUS_24480 gene pilS 3369 4961 CDS product two-component system sensor histidine kinase PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094692.1 protein_id gnl|my_center|LOCUS_24480 5038 6429 gene locus_tag LOCUS_24490 gene pilR 5038 6429 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_24490 7531 6473 gene locus_tag LOCUS_24500 7531 6473 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_24500 7749 9344 gene locus_tag LOCUS_24510 gene gcbA 7749 9344 CDS product diguanylate cyclase GcbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106227.1 protein_id gnl|my_center|LOCUS_24510 9472 11433 gene locus_tag LOCUS_24520 gene ctpL 9472 11433 CDS product methyl-accepting chemotaxis protein CtpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112328.1 protein_id gnl|my_center|LOCUS_24520 >Feature sequence123 <1 1158 gene locus_tag LOCUS_24530 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005769135.1:lactonase family protein 1489 1274 gene locus_tag LOCUS_24540 1489 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 1677 3098 gene locus_tag LOCUS_24550 1677 3098 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269426.1 protein_id gnl|my_center|LOCUS_24550 3122 4069 gene locus_tag LOCUS_24560 3122 4069 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113669.1 protein_id gnl|my_center|LOCUS_24560 5072 4140 gene locus_tag LOCUS_24570 5072 4140 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039561.1 protein_id gnl|my_center|LOCUS_24570 5709 5191 gene locus_tag LOCUS_24580 5709 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525009.1 protein_id gnl|my_center|LOCUS_24580 6942 5770 gene locus_tag LOCUS_24590 6942 5770 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525010.1 protein_id gnl|my_center|LOCUS_24590 7986 7126 gene locus_tag LOCUS_24600 7986 7126 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 protein_id gnl|my_center|LOCUS_24600 8118 9038 gene locus_tag LOCUS_24610 gene oxyR 8118 9038 CDS product oxidative stress transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096622.1 protein_id gnl|my_center|LOCUS_24610 9043 11115 gene locus_tag LOCUS_24620 gene recG 9043 11115 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096624.1 protein_id gnl|my_center|LOCUS_24620 >Feature sequence124 679 254 gene locus_tag LOCUS_24630 679 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 1052 696 gene locus_tag LOCUS_24640 1052 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 2007 1033 gene locus_tag LOCUS_24650 2007 1033 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035969.1 protein_id gnl|my_center|LOCUS_24650 3145 2204 gene locus_tag LOCUS_24660 3145 2204 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418432.1 protein_id gnl|my_center|LOCUS_24660 3833 3273 gene locus_tag LOCUS_24670 3833 3273 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106283.1 protein_id gnl|my_center|LOCUS_24670 5120 3867 gene locus_tag LOCUS_24680 5120 3867 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_24680 5274 5978 gene locus_tag LOCUS_24690 5274 5978 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769371.1 protein_id gnl|my_center|LOCUS_24690 8138 6069 gene locus_tag LOCUS_24700 gene piuA 8138 6069 CDS product TonB-dependent siderophore receptor PiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 protein_id gnl|my_center|LOCUS_24700 9595 8432 gene locus_tag LOCUS_24710 9595 8432 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368674.1 protein_id gnl|my_center|LOCUS_24710 >Feature sequence125 1601 783 gene locus_tag LOCUS_24720 1601 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189747.1 protein_id gnl|my_center|LOCUS_24720 2730 1609 gene locus_tag LOCUS_24730 gene yejK 2730 1609 CDS product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266815.1 protein_id gnl|my_center|LOCUS_24730 2776 3318 gene locus_tag LOCUS_24740 2776 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 3258 3668 gene locus_tag LOCUS_24750 3258 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 3770 4981 gene locus_tag LOCUS_24760 3770 4981 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 protein_id gnl|my_center|LOCUS_24760 4981 5103 gene locus_tag LOCUS_24770 4981 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 5417 5608 gene locus_tag LOCUS_24780 5417 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 6622 5639 gene locus_tag LOCUS_24790 gene rlmF 6622 5639 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092887.1 protein_id gnl|my_center|LOCUS_24790 7849 6680 gene locus_tag LOCUS_24800 7849 6680 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532852.1 protein_id gnl|my_center|LOCUS_24800 9773 7947 gene locus_tag LOCUS_24810 9773 7947 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113792.1 protein_id gnl|my_center|LOCUS_24810 10075 9779 gene locus_tag LOCUS_24820 10075 9779 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266452.1 protein_id gnl|my_center|LOCUS_24820 <11263 10133 gene locus_tag LOCUS_24830 <11263 10133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966224.1:sodium:proton antiporter NhaD >Feature sequence126 <1 810 gene locus_tag LOCUS_24840 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114060.1:acyl-CoA dehydrogenase C-terminal domain-containing protein 835 1998 gene locus_tag LOCUS_24850 835 1998 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114061.1 protein_id gnl|my_center|LOCUS_24850 2037 2468 gene locus_tag LOCUS_24860 2037 2468 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114062.1 protein_id gnl|my_center|LOCUS_24860 3043 2579 gene locus_tag LOCUS_24870 3043 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 4051 3206 gene locus_tag LOCUS_24880 gene fdhD 4051 3206 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769867.1 protein_id gnl|my_center|LOCUS_24880 6705 4150 gene locus_tag LOCUS_24890 6705 4150 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268496.1 protein_id gnl|my_center|LOCUS_24890 7552 6872 gene locus_tag LOCUS_24900 gene yrfG 7552 6872 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343604.1 protein_id gnl|my_center|LOCUS_24900 7668 8234 gene locus_tag LOCUS_24910 gene nudE 7668 8234 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114066.1 protein_id gnl|my_center|LOCUS_24910 8231 9049 gene locus_tag LOCUS_24920 gene cysQ 8231 9049 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114067.1 protein_id gnl|my_center|LOCUS_24920 9561 9109 gene locus_tag LOCUS_24930 9561 9109 CDS product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269323.1 protein_id gnl|my_center|LOCUS_24930 10178 9741 gene locus_tag LOCUS_24940 10178 9741 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123521.1 protein_id gnl|my_center|LOCUS_24940 >Feature sequence127 973 104 gene locus_tag LOCUS_24950 gene ntrB 973 104 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085588.1 protein_id gnl|my_center|LOCUS_24950 2331 1000 gene locus_tag LOCUS_24960 2331 1000 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085587.1 protein_id gnl|my_center|LOCUS_24960 2512 2427 gene locus_tag LOCUS_t00320 2512 2427 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3976 2690 gene locus_tag LOCUS_24970 gene nasR 3976 2690 CDS product nitrate regulatory protein NasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705088.1 protein_id gnl|my_center|LOCUS_24970 4121 4714 gene locus_tag LOCUS_24980 gene hisB 4121 4714 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551454.1 protein_id gnl|my_center|LOCUS_24980 4714 5352 gene locus_tag LOCUS_24990 gene hisH 4714 5352 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121251.1 protein_id gnl|my_center|LOCUS_24990 5353 5613 gene locus_tag LOCUS_25000 5353 5613 CDS product DUF2164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397145.1 protein_id gnl|my_center|LOCUS_25000 5650 6393 gene locus_tag LOCUS_25010 gene hisA 5650 6393 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106336.1 protein_id gnl|my_center|LOCUS_25010 6490 7260 gene locus_tag LOCUS_25020 gene hisF 6490 7260 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106334.1 protein_id gnl|my_center|LOCUS_25020 7341 8087 gene locus_tag LOCUS_25030 7341 8087 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106330.1 protein_id gnl|my_center|LOCUS_25030 8318 9064 gene locus_tag LOCUS_25040 8318 9064 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096075.1 protein_id gnl|my_center|LOCUS_25040 9865 9068 gene locus_tag LOCUS_25050 9865 9068 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407320.1 protein_id gnl|my_center|LOCUS_25050 <11176 9862 gene locus_tag LOCUS_25060 <11176 9862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096067.1:proteolytic complex protein CptA >Feature sequence128 1450 635 gene locus_tag LOCUS_25070 1450 635 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102209.1 protein_id gnl|my_center|LOCUS_25070 3104 1818 gene locus_tag LOCUS_25080 3104 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25080 3685 3152 gene locus_tag LOCUS_25090 3685 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 4706 3876 gene locus_tag LOCUS_25100 4706 3876 CDS product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421307.1 protein_id gnl|my_center|LOCUS_25100 5144 4728 gene locus_tag LOCUS_25110 5144 4728 CDS product curli assembly protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421309.1 protein_id gnl|my_center|LOCUS_25110 5524 5141 gene locus_tag LOCUS_25120 gene csgE 5524 5141 CDS product curli production assembly/transport protein CsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833307.1 protein_id gnl|my_center|LOCUS_25120 6168 5521 gene locus_tag LOCUS_25130 6168 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 6380 7015 gene locus_tag LOCUS_25140 6380 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 7056 7544 gene locus_tag LOCUS_25150 7056 7544 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808385.1 protein_id gnl|my_center|LOCUS_25150 7639 8613 gene locus_tag LOCUS_25160 7639 8613 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969690.1 protein_id gnl|my_center|LOCUS_25160 9549 8623 gene locus_tag LOCUS_25170 gene metR 9549 8623 CDS product transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092181.1 protein_id gnl|my_center|LOCUS_25170 10294 9704 gene locus_tag LOCUS_25180 10294 9704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 >Feature sequence129 603 316 gene locus_tag LOCUS_25190 603 316 CDS product PA4642 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094960.1 protein_id gnl|my_center|LOCUS_25190 797 2527 gene locus_tag LOCUS_25200 gene dauA 797 2527 CDS product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817880.1 protein_id gnl|my_center|LOCUS_25200 3484 2573 gene locus_tag LOCUS_25210 3484 2573 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111019.1 protein_id gnl|my_center|LOCUS_25210 4206 4793 gene locus_tag LOCUS_25220 4206 4793 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_25220 5158 5652 gene locus_tag LOCUS_25230 5158 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 5743 6228 gene locus_tag LOCUS_25240 5743 6228 CDS product calcium/calmodulin-dependent protein kinase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038300.1 protein_id gnl|my_center|LOCUS_25240 6385 7407 gene locus_tag LOCUS_25250 6385 7407 CDS product DUF5924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114118.1 protein_id gnl|my_center|LOCUS_25250 7466 7984 gene locus_tag LOCUS_25260 7466 7984 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064951.1 protein_id gnl|my_center|LOCUS_25260 8015 9358 gene locus_tag LOCUS_25270 8015 9358 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268583.1 protein_id gnl|my_center|LOCUS_25270 9416 9757 gene locus_tag LOCUS_25280 gene osmE 9416 9757 CDS product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095488.1 protein_id gnl|my_center|LOCUS_25280 9809 10207 gene locus_tag LOCUS_25290 9809 10207 CDS product Rho termination factor N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095492.1 protein_id gnl|my_center|LOCUS_25290 10207 10356 gene locus_tag LOCUS_25300 10207 10356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 10433 10966 gene locus_tag LOCUS_25310 10433 10966 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376387.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence130 66 704 gene locus_tag LOCUS_25320 gene clpP 66 704 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098129.1 protein_id gnl|my_center|LOCUS_25320 802 2082 gene locus_tag LOCUS_25330 gene clpX 802 2082 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770751.1 protein_id gnl|my_center|LOCUS_25330 2215 4611 gene locus_tag LOCUS_25340 gene lon 2215 4611 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087926.1 protein_id gnl|my_center|LOCUS_25340 4742 5014 gene locus_tag LOCUS_25350 gene hupB 4742 5014 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087931.1 protein_id gnl|my_center|LOCUS_25350 5220 7076 gene locus_tag LOCUS_25360 5220 7076 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098131.1 protein_id gnl|my_center|LOCUS_25360 6894 6805 gene locus_tag LOCUS_t00330 6894 6805 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7898 7173 gene locus_tag LOCUS_25370 7898 7173 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110633.1 protein_id gnl|my_center|LOCUS_25370 9111 8011 gene locus_tag LOCUS_25380 gene serC 9111 8011 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404933.1 protein_id gnl|my_center|LOCUS_25380 9595 9092 gene locus_tag LOCUS_25390 9595 9092 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_25390 10836 9679 gene locus_tag LOCUS_25400 gene pqqE 10836 9679 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206724.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence131 1465 3027 gene locus_tag LOCUS_25410 1465 3027 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095088.1 protein_id gnl|my_center|LOCUS_25410 3100 3882 gene locus_tag LOCUS_25420 3100 3882 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943419.1 protein_id gnl|my_center|LOCUS_25420 3901 4164 gene locus_tag LOCUS_25430 3901 4164 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095094.1 protein_id gnl|my_center|LOCUS_25430 4277 5074 gene locus_tag LOCUS_25440 gene cbpA 4277 5074 CDS product cAMP-binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095096.1 protein_id gnl|my_center|LOCUS_25440 6180 5296 gene locus_tag LOCUS_25450 6180 5296 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 protein_id gnl|my_center|LOCUS_25450 6959 6192 gene locus_tag LOCUS_25460 6959 6192 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095098.1 protein_id gnl|my_center|LOCUS_25460 7996 6959 gene locus_tag LOCUS_25470 7996 6959 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121063.1 protein_id gnl|my_center|LOCUS_25470 8129 8464 gene locus_tag LOCUS_25480 8129 8464 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895682.1 protein_id gnl|my_center|LOCUS_25480 8526 10298 gene locus_tag LOCUS_25490 8526 10298 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105207.1 protein_id gnl|my_center|LOCUS_25490 >Feature sequence132 758 138 gene locus_tag LOCUS_25500 758 138 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552423.1 protein_id gnl|my_center|LOCUS_25500 997 1602 gene locus_tag LOCUS_25510 997 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 2728 1766 gene locus_tag LOCUS_25520 2728 1766 CDS product SdiA-regulated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105587.1 protein_id gnl|my_center|LOCUS_25520 3120 2767 gene locus_tag LOCUS_25530 3120 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 3978 3127 gene locus_tag LOCUS_25540 3978 3127 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_25540 5479 3992 gene locus_tag LOCUS_25550 5479 3992 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104449.1 protein_id gnl|my_center|LOCUS_25550 6890 5826 gene locus_tag LOCUS_25560 6890 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336816.1 protein_id gnl|my_center|LOCUS_25560 7142 6894 gene locus_tag LOCUS_25570 7142 6894 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802828.1 protein_id gnl|my_center|LOCUS_25570 9040 7139 gene locus_tag LOCUS_25580 9040 7139 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336813.1 protein_id gnl|my_center|LOCUS_25580 10600 9062 gene locus_tag LOCUS_25590 10600 9062 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336811.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence133 1408 554 gene locus_tag LOCUS_25600 1408 554 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092000.1 protein_id gnl|my_center|LOCUS_25600 2553 1498 gene locus_tag LOCUS_25610 2553 1498 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410204.1 protein_id gnl|my_center|LOCUS_25610 4472 2802 gene locus_tag LOCUS_25620 gene leuA 4472 2802 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113805.1 protein_id gnl|my_center|LOCUS_25620 4764 5168 gene locus_tag LOCUS_25630 4764 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 5219 7414 gene locus_tag LOCUS_25640 5219 7414 CDS product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119294.1 protein_id gnl|my_center|LOCUS_25640 8883 7582 gene locus_tag LOCUS_25650 8883 7582 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268659.1 protein_id gnl|my_center|LOCUS_25650 9505 8963 gene locus_tag LOCUS_25660 9505 8963 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 protein_id gnl|my_center|LOCUS_25660 10349 9525 gene locus_tag LOCUS_25670 10349 9525 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771007.1 protein_id gnl|my_center|LOCUS_25670 10685 10443 gene locus_tag LOCUS_25680 10685 10443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 >Feature sequence134 417 193 gene locus_tag LOCUS_25690 417 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 416 2593 gene locus_tag LOCUS_25700 gene rlmKL 416 2593 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017709633.1 protein_id gnl|my_center|LOCUS_25700 3998 2616 gene locus_tag LOCUS_25710 gene dacB 3998 2616 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765687.1 protein_id gnl|my_center|LOCUS_25710 4339 4683 gene locus_tag LOCUS_25720 4339 4683 CDS product 50S ribosome-binding protein YggL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346101.1 protein_id gnl|my_center|LOCUS_25720 5761 4667 gene locus_tag LOCUS_25730 5761 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 7097 5766 gene locus_tag LOCUS_25740 7097 5766 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091265.1 protein_id gnl|my_center|LOCUS_25740 7562 7263 gene locus_tag LOCUS_25750 7562 7263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 7939 7559 gene locus_tag LOCUS_25760 7939 7559 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091263.1 protein_id gnl|my_center|LOCUS_25760 8358 7957 gene locus_tag LOCUS_25770 8358 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 9932 8673 gene locus_tag LOCUS_25780 gene opdQ 9932 8673 CDS product porin OpdQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091257.1 protein_id gnl|my_center|LOCUS_25780 10314 10550 gene locus_tag LOCUS_25790 10314 10550 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119787.1 protein_id gnl|my_center|LOCUS_25790 10730 10654 gene locus_tag LOCUS_t00340 10730 10654 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence135 669 1202 gene locus_tag LOCUS_25800 669 1202 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813582.1 protein_id gnl|my_center|LOCUS_25800 1202 1540 gene locus_tag LOCUS_25810 1202 1540 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198127.1 protein_id gnl|my_center|LOCUS_25810 1560 2417 gene locus_tag LOCUS_25820 1560 2417 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813578.1 protein_id gnl|my_center|LOCUS_25820 2414 3787 gene locus_tag LOCUS_25830 2414 3787 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198129.1 protein_id gnl|my_center|LOCUS_25830 4603 3908 gene locus_tag LOCUS_25840 4603 3908 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114930.1 protein_id gnl|my_center|LOCUS_25840 4755 4600 gene locus_tag LOCUS_25850 4755 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 6846 4828 gene locus_tag LOCUS_25860 6846 4828 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111559.1 protein_id gnl|my_center|LOCUS_25860 7078 7755 gene locus_tag LOCUS_25870 gene dnr 7078 7755 CDS product transcriptional regulator Dnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_25870 7804 8187 gene locus_tag LOCUS_25880 gene anvM 7804 8187 CDS product anaerobic/virulence modulator AnvM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092971.1 protein_id gnl|my_center|LOCUS_25880 8821 8327 gene locus_tag LOCUS_25890 8821 8327 CDS product phosphatidic acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104247.1 protein_id gnl|my_center|LOCUS_25890 9705 8815 gene locus_tag LOCUS_25900 9705 8815 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110916.1 protein_id gnl|my_center|LOCUS_25900 10715 9720 gene locus_tag LOCUS_25910 10715 9720 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093020.1 protein_id gnl|my_center|LOCUS_25910 >Feature sequence136 114 899 gene locus_tag LOCUS_25920 114 899 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114823.1 protein_id gnl|my_center|LOCUS_25920 901 1839 gene locus_tag LOCUS_25930 901 1839 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114822.1 protein_id gnl|my_center|LOCUS_25930 1836 2462 gene locus_tag LOCUS_25940 1836 2462 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109195.1 protein_id gnl|my_center|LOCUS_25940 2579 3655 gene locus_tag LOCUS_25950 2579 3655 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099200.1 protein_id gnl|my_center|LOCUS_25950 3652 6396 gene locus_tag LOCUS_25960 gene rbbA 3652 6396 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114043.1 protein_id gnl|my_center|LOCUS_25960 6398 7513 gene locus_tag LOCUS_25970 6398 7513 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099197.1 protein_id gnl|my_center|LOCUS_25970 7710 8780 gene locus_tag LOCUS_25980 gene rfbB 7710 8780 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269320.1 protein_id gnl|my_center|LOCUS_25980 8777 9649 gene locus_tag LOCUS_25990 gene rfbA 8777 9649 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103413.1 protein_id gnl|my_center|LOCUS_25990 9646 10191 gene locus_tag LOCUS_26000 gene rfbC 9646 10191 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence137 1908 2897 gene locus_tag LOCUS_26010 gene cra 1908 2897 CDS product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104372.1 protein_id gnl|my_center|LOCUS_26010 2964 3269 gene locus_tag LOCUS_26020 2964 3269 CDS product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770099.1 protein_id gnl|my_center|LOCUS_26020 3350 4015 gene locus_tag LOCUS_26030 3350 4015 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407968.1 protein_id gnl|my_center|LOCUS_26030 4034 4642 gene locus_tag LOCUS_26040 4034 4642 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103259.1 protein_id gnl|my_center|LOCUS_26040 4716 5273 gene locus_tag LOCUS_26050 4716 5273 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103258.1 protein_id gnl|my_center|LOCUS_26050 5359 5808 gene locus_tag LOCUS_26060 5359 5808 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095321.1 protein_id gnl|my_center|LOCUS_26060 6765 5830 gene locus_tag LOCUS_26070 6765 5830 CDS product SdiA-regulated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105587.1 protein_id gnl|my_center|LOCUS_26070 7099 6848 gene locus_tag LOCUS_26080 7099 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 6989 7282 gene locus_tag LOCUS_26090 6989 7282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555356.1 protein_id gnl|my_center|LOCUS_26090 7379 8752 gene locus_tag LOCUS_26100 7379 8752 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112342.1 protein_id gnl|my_center|LOCUS_26100 8755 9213 gene locus_tag LOCUS_26110 8755 9213 CDS product DUF2214 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112336.1 protein_id gnl|my_center|LOCUS_26110 <10631 9227 gene locus_tag LOCUS_26120 <10631 9227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095365.1:arginine decarboxylase >Feature sequence138 1030 200 gene locus_tag LOCUS_26130 gene mazG 1030 200 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103676.1 protein_id gnl|my_center|LOCUS_26130 3456 1213 gene locus_tag LOCUS_26140 gene relA 3456 1213 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_26140 4914 3562 gene locus_tag LOCUS_26150 gene rlmD 4914 3562 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102417.1 protein_id gnl|my_center|LOCUS_26150 5859 4957 gene locus_tag LOCUS_26160 gene cysM 5859 4957 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_26160 6855 5962 gene locus_tag LOCUS_26170 6855 5962 CDS product HTH-type transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523490.1 protein_id gnl|my_center|LOCUS_26170 6960 7619 gene locus_tag LOCUS_26180 6960 7619 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188612.1 protein_id gnl|my_center|LOCUS_26180 7716 10478 gene locus_tag LOCUS_26190 7716 10478 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268595.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence139 114 1235 gene locus_tag LOCUS_26200 114 1235 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109898.1 protein_id gnl|my_center|LOCUS_26200 1235 2290 gene locus_tag LOCUS_26210 1235 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114898.1 protein_id gnl|my_center|LOCUS_26210 2312 3274 gene locus_tag LOCUS_26220 2312 3274 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114548.1 protein_id gnl|my_center|LOCUS_26220 3328 4194 gene locus_tag LOCUS_26230 3328 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 4225 5346 gene locus_tag LOCUS_26240 4225 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 5897 5298 gene locus_tag LOCUS_26250 5897 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114545.1 protein_id gnl|my_center|LOCUS_26250 6025 7191 gene locus_tag LOCUS_26260 6025 7191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 7205 9022 gene locus_tag LOCUS_26270 gene msbA 7205 9022 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114544.1 protein_id gnl|my_center|LOCUS_26270 >Feature sequence140 2056 1667 gene locus_tag LOCUS_26280 gene gcvH 2056 1667 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114050.1 protein_id gnl|my_center|LOCUS_26280 3191 2109 gene locus_tag LOCUS_26290 gene gcvT 3191 2109 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114049.1 protein_id gnl|my_center|LOCUS_26290 5019 3403 gene locus_tag LOCUS_26300 5019 3403 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103094.1 protein_id gnl|my_center|LOCUS_26300 6130 5129 gene locus_tag LOCUS_26310 6130 5129 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096289.1 protein_id gnl|my_center|LOCUS_26310 7461 6241 gene locus_tag LOCUS_26320 7461 6241 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266320.1 protein_id gnl|my_center|LOCUS_26320 7949 7461 gene locus_tag LOCUS_26330 7949 7461 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099189.1 protein_id gnl|my_center|LOCUS_26330 9153 7975 gene locus_tag LOCUS_26340 gene ubiH 9153 7975 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105379.1 protein_id gnl|my_center|LOCUS_26340 <10468 9153 gene locus_tag LOCUS_26350 <10468 9153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114045.1:Xaa-Pro aminopeptidase >Feature sequence141 3878 1140 gene locus_tag LOCUS_26360 gene secA 3878 1140 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112752.1 protein_id gnl|my_center|LOCUS_26360 4149 4604 gene locus_tag LOCUS_26370 4149 4604 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313540.1 protein_id gnl|my_center|LOCUS_26370 4724 5188 gene locus_tag LOCUS_26380 4724 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092973.1 protein_id gnl|my_center|LOCUS_26380 5274 5528 gene locus_tag LOCUS_26390 5274 5528 CDS product YebG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091854.1 protein_id gnl|my_center|LOCUS_26390 5670 5909 gene locus_tag LOCUS_26400 5670 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 8675 6060 gene locus_tag LOCUS_26410 8675 6060 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114487.1 protein_id gnl|my_center|LOCUS_26410 10235 8934 gene locus_tag LOCUS_26420 10235 8934 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114488.1 protein_id gnl|my_center|LOCUS_26420 >Feature sequence142 438 620 gene locus_tag LOCUS_26430 gene rpmF 438 620 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091143.1 protein_id gnl|my_center|LOCUS_26430 624 1694 gene locus_tag LOCUS_26440 gene plsX 624 1694 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071533934.1 protein_id gnl|my_center|LOCUS_26440 1756 2694 gene locus_tag LOCUS_26450 gene fabD 1756 2694 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147872.1 protein_id gnl|my_center|LOCUS_26450 2709 3452 gene locus_tag LOCUS_26460 gene fabG 2709 3452 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091137.1 protein_id gnl|my_center|LOCUS_26460 3646 3882 gene locus_tag LOCUS_26470 gene acpP 3646 3882 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091135.1 protein_id gnl|my_center|LOCUS_26470 4047 5291 gene locus_tag LOCUS_26480 gene fabF 4047 5291 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390862.1 protein_id gnl|my_center|LOCUS_26480 5303 6109 gene locus_tag LOCUS_26490 gene pabC 5303 6109 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_26490 6106 7176 gene locus_tag LOCUS_26500 gene mltG 6106 7176 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770618.1 protein_id gnl|my_center|LOCUS_26500 7173 7805 gene locus_tag LOCUS_26510 gene tmk 7173 7805 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091125.1 protein_id gnl|my_center|LOCUS_26510 7798 8784 gene locus_tag LOCUS_26520 7798 8784 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267154.1 protein_id gnl|my_center|LOCUS_26520 8816 9172 gene locus_tag LOCUS_26530 8816 9172 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_26530 9286 10071 gene locus_tag LOCUS_26540 9286 10071 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091117.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence143 584 4132 gene locus_tag LOCUS_26550 gene recB 584 4132 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942181.1 protein_id gnl|my_center|LOCUS_26550 4203 6053 gene locus_tag LOCUS_26560 gene recD 4203 6053 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155175.1 protein_id gnl|my_center|LOCUS_26560 6184 6627 gene locus_tag LOCUS_26570 6184 6627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 7536 6628 gene locus_tag LOCUS_26580 7536 6628 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096914.1 protein_id gnl|my_center|LOCUS_26580 7709 8902 gene locus_tag LOCUS_26590 7709 8902 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098203.1 protein_id gnl|my_center|LOCUS_26590 9314 8913 gene locus_tag LOCUS_26600 9314 8913 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096677.1 protein_id gnl|my_center|LOCUS_26600 >Feature sequence144 190 1335 gene locus_tag LOCUS_26610 gene pilU 190 1335 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_26610 2165 1332 gene locus_tag LOCUS_26620 2165 1332 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104114.1 protein_id gnl|my_center|LOCUS_26620 3391 2165 gene locus_tag LOCUS_26630 3391 2165 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405604.1 protein_id gnl|my_center|LOCUS_26630 3515 3910 gene locus_tag LOCUS_26640 3515 3910 CDS product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084560.1 protein_id gnl|my_center|LOCUS_26640 5242 3968 gene locus_tag LOCUS_26650 5242 3968 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266429.1 protein_id gnl|my_center|LOCUS_26650 6258 5242 gene locus_tag LOCUS_26660 6258 5242 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736952.1 protein_id gnl|my_center|LOCUS_26660 6827 6312 gene locus_tag LOCUS_26670 gene pyrR 6827 6312 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 protein_id gnl|my_center|LOCUS_26670 7267 6845 gene locus_tag LOCUS_26680 gene ruvX 7267 6845 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084575.1 protein_id gnl|my_center|LOCUS_26680 7839 7270 gene locus_tag LOCUS_26690 7839 7270 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100947.1 protein_id gnl|my_center|LOCUS_26690 8798 7905 gene locus_tag LOCUS_26700 8798 7905 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_26700 9836 8886 gene locus_tag LOCUS_26710 gene gshB 9836 8886 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100943.1 protein_id gnl|my_center|LOCUS_26710 >Feature sequence145 77 346 gene locus_tag LOCUS_26720 77 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315350.1 protein_id gnl|my_center|LOCUS_26720 489 770 gene locus_tag LOCUS_26730 489 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 864 1556 gene locus_tag LOCUS_26740 864 1556 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171029.1 protein_id gnl|my_center|LOCUS_26740 1661 1825 gene locus_tag LOCUS_26750 1661 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 1882 2979 gene locus_tag LOCUS_26760 1882 2979 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113726.1 protein_id gnl|my_center|LOCUS_26760 3954 2998 gene locus_tag LOCUS_26770 3954 2998 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_26770 4940 3957 gene locus_tag LOCUS_26780 4940 3957 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266692.1 protein_id gnl|my_center|LOCUS_26780 5672 5088 gene locus_tag LOCUS_26790 gene nfuA 5672 5088 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553665.1 protein_id gnl|my_center|LOCUS_26790 8072 5796 gene locus_tag LOCUS_26800 8072 5796 CDS product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113604.1 protein_id gnl|my_center|LOCUS_26800 >Feature sequence146 <1 1113 gene locus_tag LOCUS_26810 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112888.1:molybdopterin oxidoreductase family protein 1310 1050 gene locus_tag LOCUS_26820 1310 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 1207 2316 gene locus_tag LOCUS_26830 1207 2316 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113836.1 protein_id gnl|my_center|LOCUS_26830 2351 3067 gene locus_tag LOCUS_26840 2351 3067 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765900.1 protein_id gnl|my_center|LOCUS_26840 3175 4287 gene locus_tag LOCUS_26850 gene prfB 3175 4287 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895661.1 protein_id gnl|my_center|LOCUS_26850 4351 5853 gene locus_tag LOCUS_26860 gene lysS 4351 5853 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266952.1 protein_id gnl|my_center|LOCUS_26860 5944 7239 gene locus_tag LOCUS_26870 5944 7239 CDS product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092515.1 protein_id gnl|my_center|LOCUS_26870 7283 7522 gene locus_tag LOCUS_26880 7283 7522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26880 7519 7941 gene locus_tag LOCUS_26890 7519 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26890 7999 8745 gene locus_tag LOCUS_26900 7999 8745 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113847.1 protein_id gnl|my_center|LOCUS_26900 8806 9132 gene locus_tag LOCUS_26910 8806 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092509.1 protein_id gnl|my_center|LOCUS_26910 <10010 9218 gene locus_tag LOCUS_26920 <10010 9218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266956.1:OmpA family protein >Feature sequence147 1617 2333 gene locus_tag LOCUS_26930 1617 2333 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082360.1 protein_id gnl|my_center|LOCUS_26930 2345 3946 gene locus_tag LOCUS_26940 2345 3946 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268603.1 protein_id gnl|my_center|LOCUS_26940 6516 4072 gene locus_tag LOCUS_26950 6516 4072 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104757.1 protein_id gnl|my_center|LOCUS_26950 7768 6629 gene locus_tag LOCUS_26960 7768 6629 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456065.1 protein_id gnl|my_center|LOCUS_26960 8252 7896 gene locus_tag LOCUS_26970 8252 7896 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219522.1 protein_id gnl|my_center|LOCUS_26970 8445 8287 gene locus_tag LOCUS_26980 8445 8287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 8612 9124 gene locus_tag LOCUS_26990 8612 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 9573 9145 gene locus_tag LOCUS_27000 9573 9145 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407498.1 protein_id gnl|my_center|LOCUS_27000 9845 9756 gene locus_tag LOCUS_t00350 9845 9756 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence148 900 1406 gene locus_tag LOCUS_27010 900 1406 CDS product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314637.1 protein_id gnl|my_center|LOCUS_27010 1418 1714 gene locus_tag LOCUS_27020 1418 1714 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404250.1 protein_id gnl|my_center|LOCUS_27020 1841 2776 gene locus_tag LOCUS_27030 1841 2776 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085861.1 protein_id gnl|my_center|LOCUS_27030 2823 3452 gene locus_tag LOCUS_27040 2823 3452 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103690.1 protein_id gnl|my_center|LOCUS_27040 3445 5223 gene locus_tag LOCUS_27050 3445 5223 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085865.1 protein_id gnl|my_center|LOCUS_27050 5397 7349 gene locus_tag LOCUS_27060 5397 7349 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105342.1 protein_id gnl|my_center|LOCUS_27060 8428 7391 gene locus_tag LOCUS_27070 8428 7391 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448174.1 protein_id gnl|my_center|LOCUS_27070 8564 8977 gene locus_tag LOCUS_27080 gene arfB 8564 8977 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767723.1 protein_id gnl|my_center|LOCUS_27080 <9834 8980 gene locus_tag LOCUS_27090 <9834 8980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038149.1:MFS transporter >Feature sequence149 381 725 gene locus_tag LOCUS_27100 381 725 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317410.1 protein_id gnl|my_center|LOCUS_27100 1180 749 gene locus_tag LOCUS_27110 1180 749 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770721.1 protein_id gnl|my_center|LOCUS_27110 1314 1754 gene locus_tag LOCUS_27120 1314 1754 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526443.1 protein_id gnl|my_center|LOCUS_27120 1998 2546 gene locus_tag LOCUS_27130 1998 2546 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002690264.1 protein_id gnl|my_center|LOCUS_27130 2553 3344 gene locus_tag LOCUS_27140 2553 3344 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002690262.1 protein_id gnl|my_center|LOCUS_27140 3899 3411 gene locus_tag LOCUS_27150 3899 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 6131 4194 gene locus_tag LOCUS_27160 6131 4194 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490750.1 protein_id gnl|my_center|LOCUS_27160 6287 7147 gene locus_tag LOCUS_27170 6287 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 7289 7152 gene locus_tag LOCUS_27180 7289 7152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 8838 7840 gene locus_tag LOCUS_27190 gene rpoS 8838 7840 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113871.1 protein_id gnl|my_center|LOCUS_27190 9764 8937 gene locus_tag LOCUS_27200 9764 8937 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115226.1 protein_id gnl|my_center|LOCUS_27200 >Feature sequence150 1003 5 gene locus_tag LOCUS_27210 1003 5 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112794.1 protein_id gnl|my_center|LOCUS_27210 2366 1371 gene locus_tag LOCUS_27220 2366 1371 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112794.1 protein_id gnl|my_center|LOCUS_27220 2722 3723 gene locus_tag LOCUS_27230 2722 3723 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063174092.1 protein_id gnl|my_center|LOCUS_27230 3773 5149 gene locus_tag LOCUS_27240 3773 5149 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 protein_id gnl|my_center|LOCUS_27240 5306 9472 gene locus_tag LOCUS_27250 5306 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence151 215 6 gene locus_tag LOCUS_27260 215 6 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554837.1 protein_id gnl|my_center|LOCUS_27260 543 1109 gene locus_tag LOCUS_27270 gene dcd 543 1109 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554836.1 protein_id gnl|my_center|LOCUS_27270 1767 1171 gene locus_tag LOCUS_27280 1767 1171 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082412.1 protein_id gnl|my_center|LOCUS_27280 2266 1778 gene locus_tag LOCUS_27290 2266 1778 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082414.1 protein_id gnl|my_center|LOCUS_27290 4782 2278 gene locus_tag LOCUS_27300 gene napA 4782 2278 CDS product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895543.1 protein_id gnl|my_center|LOCUS_27300 5036 4782 gene locus_tag LOCUS_27310 5036 4782 CDS product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082422.1 protein_id gnl|my_center|LOCUS_27310 5275 5096 gene locus_tag LOCUS_27320 gene napE 5275 5096 CDS product periplasmic nitrate reductase, NapE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082429.1 protein_id gnl|my_center|LOCUS_27320 5460 6635 gene locus_tag LOCUS_27330 5460 6635 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095819.1 protein_id gnl|my_center|LOCUS_27330 7145 6651 gene locus_tag LOCUS_27340 7145 6651 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082453.1 protein_id gnl|my_center|LOCUS_27340 7910 7209 gene locus_tag LOCUS_27350 7910 7209 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 protein_id gnl|my_center|LOCUS_27350 8672 8073 gene locus_tag LOCUS_27360 8672 8073 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 protein_id gnl|my_center|LOCUS_27360 9405 8812 gene locus_tag LOCUS_27370 9405 8812 CDS product DNA-J related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112460.1 protein_id gnl|my_center|LOCUS_27370 >Feature sequence152 148 2712 gene locus_tag LOCUS_27380 gene clpB 148 2712 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094682.1 protein_id gnl|my_center|LOCUS_27380 2900 2975 gene locus_tag LOCUS_t00360 2900 2975 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2985 3061 gene locus_tag LOCUS_t00370 2985 3061 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3067 3142 gene locus_tag LOCUS_t00380 3067 3142 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4555 3260 gene locus_tag LOCUS_27390 4555 3260 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112837.1 protein_id gnl|my_center|LOCUS_27390 4782 4609 gene locus_tag LOCUS_27400 4782 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 7157 4899 gene locus_tag LOCUS_27410 7157 4899 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112843.1 protein_id gnl|my_center|LOCUS_27410 7584 8432 gene locus_tag LOCUS_27420 gene nadC 7584 8432 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_27420 8901 8473 gene locus_tag LOCUS_27430 8901 8473 CDS product YhcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094304.1 protein_id gnl|my_center|LOCUS_27430 >Feature sequence153 <1 613 gene locus_tag LOCUS_27440 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003098180.1:nitrite/sulfite reductase 597 1097 gene locus_tag LOCUS_27450 597 1097 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762572.1 protein_id gnl|my_center|LOCUS_27450 2357 1365 gene locus_tag LOCUS_27460 2357 1365 CDS product YhdH/YhfP family quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_27460 3394 2372 gene locus_tag LOCUS_27470 gene sohB 3394 2372 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087997.1 protein_id gnl|my_center|LOCUS_27470 3574 4272 gene locus_tag LOCUS_27480 3574 4272 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_27480 4332 4646 gene locus_tag LOCUS_27490 4332 4646 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382829.1 protein_id gnl|my_center|LOCUS_27490 4854 5921 gene locus_tag LOCUS_27500 4854 5921 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_27500 5978 6745 gene locus_tag LOCUS_27510 5978 6745 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087987.1 protein_id gnl|my_center|LOCUS_27510 7453 6803 gene locus_tag LOCUS_27520 7453 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113597.1 protein_id gnl|my_center|LOCUS_27520 7648 8433 gene locus_tag LOCUS_27530 7648 8433 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113596.1 protein_id gnl|my_center|LOCUS_27530 9231 8401 gene locus_tag LOCUS_27540 gene nudC 9231 8401 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113595.1 protein_id gnl|my_center|LOCUS_27540 9605 9231 gene locus_tag LOCUS_27550 9605 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 >Feature sequence154 930 292 gene locus_tag LOCUS_27560 930 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 1064 1564 gene locus_tag LOCUS_27570 1064 1564 CDS product DUF6231 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112524.1 protein_id gnl|my_center|LOCUS_27570 1566 2051 gene locus_tag LOCUS_27580 1566 2051 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268706.1 protein_id gnl|my_center|LOCUS_27580 2888 2112 gene locus_tag LOCUS_27590 gene fpr 2888 2112 CDS product ferredoxin-NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554680.1 protein_id gnl|my_center|LOCUS_27590 3001 3927 gene locus_tag LOCUS_27600 3001 3927 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003339525.1 protein_id gnl|my_center|LOCUS_27600 4524 3946 gene locus_tag LOCUS_27610 4524 3946 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092229.1 protein_id gnl|my_center|LOCUS_27610 4841 5752 gene locus_tag LOCUS_27620 4841 5752 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119360.1 protein_id gnl|my_center|LOCUS_27620 6476 5757 gene locus_tag LOCUS_27630 6476 5757 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098478.1 protein_id gnl|my_center|LOCUS_27630 6602 6997 gene locus_tag LOCUS_27640 6602 6997 CDS product quorum-sensing-regulated virulence factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092248.1 protein_id gnl|my_center|LOCUS_27640 9469 7052 gene locus_tag LOCUS_27650 9469 7052 CDS product phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113876.1 protein_id gnl|my_center|LOCUS_27650 >Feature sequence155 1482 145 gene locus_tag LOCUS_27660 gene glmM 1482 145 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268883.1 protein_id gnl|my_center|LOCUS_27660 2344 1493 gene locus_tag LOCUS_27670 gene folP 2344 1493 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113907.1 protein_id gnl|my_center|LOCUS_27670 4435 2513 gene locus_tag LOCUS_27680 gene ftsH 4435 2513 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095200.1 protein_id gnl|my_center|LOCUS_27680 5041 5352 gene locus_tag LOCUS_27690 gene yhbY 5041 5352 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095204.1 protein_id gnl|my_center|LOCUS_27690 5815 5384 gene locus_tag LOCUS_27700 5815 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113906.1 protein_id gnl|my_center|LOCUS_27700 6269 5793 gene locus_tag LOCUS_27710 gene greA 6269 5793 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095206.1 protein_id gnl|my_center|LOCUS_27710 9487 6266 gene locus_tag LOCUS_27720 gene carB 9487 6266 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095207.1 protein_id gnl|my_center|LOCUS_27720 >Feature sequence156 301 1821 gene locus_tag LOCUS_27730 301 1821 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118247.1 protein_id gnl|my_center|LOCUS_27730 2020 3468 gene locus_tag LOCUS_27740 gene eat 2020 3468 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114906.1 protein_id gnl|my_center|LOCUS_27740 3480 4871 gene locus_tag LOCUS_27750 3480 4871 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093232.1 protein_id gnl|my_center|LOCUS_27750 4993 5775 gene locus_tag LOCUS_27760 gene eutC 4993 5775 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114907.1 protein_id gnl|my_center|LOCUS_27760 7353 5782 gene locus_tag LOCUS_27770 7353 5782 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110915.1 protein_id gnl|my_center|LOCUS_27770 7867 7439 gene locus_tag LOCUS_27780 7867 7439 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172160.1 protein_id gnl|my_center|LOCUS_27780 8071 8883 gene locus_tag LOCUS_27790 8071 8883 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093244.1 protein_id gnl|my_center|LOCUS_27790 >Feature sequence157 284 1543 gene locus_tag LOCUS_27800 gene rho 284 1543 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096334.1 protein_id gnl|my_center|LOCUS_27800 1667 3133 gene locus_tag LOCUS_27810 gene ubiD 1667 3133 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096332.1 protein_id gnl|my_center|LOCUS_27810 3207 4178 gene locus_tag LOCUS_27820 3207 4178 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096331.1 protein_id gnl|my_center|LOCUS_27820 4899 4234 gene locus_tag LOCUS_27830 4899 4234 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621218.1 protein_id gnl|my_center|LOCUS_27830 6639 4900 gene locus_tag LOCUS_27840 gene argS 6639 4900 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105333.1 protein_id gnl|my_center|LOCUS_27840 8976 6754 gene locus_tag LOCUS_27850 8976 6754 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105332.1 protein_id gnl|my_center|LOCUS_27850 9171 9383 gene locus_tag LOCUS_27860 gene rpmE 9171 9383 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095846.1 protein_id gnl|my_center|LOCUS_27860 >Feature sequence158 <1 954 gene locus_tag LOCUS_27870 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003097340.1:tryptophan synthase subunit beta 951 1760 gene locus_tag LOCUS_27880 gene trpA 951 1760 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115801.1 protein_id gnl|my_center|LOCUS_27880 2145 3125 gene locus_tag LOCUS_27890 2145 3125 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103268.1 protein_id gnl|my_center|LOCUS_27890 3118 3867 gene locus_tag LOCUS_27900 3118 3867 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523228.1 protein_id gnl|my_center|LOCUS_27900 3918 4895 gene locus_tag LOCUS_27910 3918 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 4900 5703 gene locus_tag LOCUS_27920 4900 5703 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818996.1 protein_id gnl|my_center|LOCUS_27920 5690 6484 gene locus_tag LOCUS_27930 5690 6484 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384352.1 protein_id gnl|my_center|LOCUS_27930 6521 6991 gene locus_tag LOCUS_27940 6521 6991 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088894.1 protein_id gnl|my_center|LOCUS_27940 7115 7852 gene locus_tag LOCUS_27950 7115 7852 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266249.1 protein_id gnl|my_center|LOCUS_27950 7863 8318 gene locus_tag LOCUS_27960 7863 8318 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256381.1 protein_id gnl|my_center|LOCUS_27960 <9247 8320 gene locus_tag LOCUS_27970 <9247 8320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003118743.1:AraC family transcriptional regulator CmrA >Feature sequence159 677 1180 gene locus_tag LOCUS_27980 677 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 1230 2807 gene locus_tag LOCUS_27990 1230 2807 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531851.1 protein_id gnl|my_center|LOCUS_27990 2831 3820 gene locus_tag LOCUS_28000 gene pdhA 2831 3820 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_28000 3850 4935 gene locus_tag LOCUS_28010 3850 4935 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119007.1 protein_id gnl|my_center|LOCUS_28010 4949 5971 gene locus_tag LOCUS_28020 4949 5971 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_28020 5976 6215 gene locus_tag LOCUS_28030 5976 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 6218 6922 gene locus_tag LOCUS_28040 6218 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 6919 7686 gene locus_tag LOCUS_28050 6919 7686 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110110.1 protein_id gnl|my_center|LOCUS_28050 >Feature sequence160 432 211 gene locus_tag LOCUS_28060 432 211 CDS product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091247.1 protein_id gnl|my_center|LOCUS_28060 749 1078 gene locus_tag LOCUS_28070 749 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 1289 2317 gene locus_tag LOCUS_28080 1289 2317 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101284.1 protein_id gnl|my_center|LOCUS_28080 2705 2388 gene locus_tag LOCUS_28090 2705 2388 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267468.1 protein_id gnl|my_center|LOCUS_28090 2910 3311 gene locus_tag LOCUS_28100 2910 3311 CDS product PA2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090843.1 protein_id gnl|my_center|LOCUS_28100 3371 4267 gene locus_tag LOCUS_28110 3371 4267 CDS product PA2778 family cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 protein_id gnl|my_center|LOCUS_28110 5547 4264 gene locus_tag LOCUS_28120 5547 4264 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114430.1 protein_id gnl|my_center|LOCUS_28120 5716 5792 gene locus_tag LOCUS_t00390 5716 5792 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6019 7941 gene locus_tag LOCUS_28130 gene thrS 6019 7941 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090677.1 protein_id gnl|my_center|LOCUS_28130 7959 8492 gene locus_tag LOCUS_28140 gene infC 7959 8492 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119938.1 protein_id gnl|my_center|LOCUS_28140 8552 8746 gene locus_tag LOCUS_28150 gene rpmI 8552 8746 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553160.1 protein_id gnl|my_center|LOCUS_28150 8774 9130 gene locus_tag LOCUS_28160 gene rplT 8774 9130 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099086.1 protein_id gnl|my_center|LOCUS_28160 >Feature sequence161 193 11 gene locus_tag LOCUS_28170 193 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 1639 257 gene locus_tag LOCUS_28180 1639 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 3184 1928 gene locus_tag LOCUS_28190 gene umuC 3184 1928 CDS product translesion error-prone DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267948.1 protein_id gnl|my_center|LOCUS_28190 3597 3172 gene locus_tag LOCUS_28200 gene umuD 3597 3172 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219995814.1 protein_id gnl|my_center|LOCUS_28200 3687 4394 gene locus_tag LOCUS_28210 3687 4394 CDS product SOS response-associated peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267950.1 protein_id gnl|my_center|LOCUS_28210 4710 4483 gene locus_tag LOCUS_28220 4710 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 4874 4701 gene locus_tag LOCUS_28230 4874 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 5195 5623 gene locus_tag LOCUS_28240 5195 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 6066 5776 gene locus_tag LOCUS_28250 6066 5776 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105091.1 protein_id gnl|my_center|LOCUS_28250 6153 6611 gene locus_tag LOCUS_28260 6153 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 6683 6901 gene locus_tag LOCUS_28270 6683 6901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 7835 6945 gene locus_tag LOCUS_28280 7835 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 7923 9011 gene locus_tag LOCUS_28290 7923 9011 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992495.1 protein_id gnl|my_center|LOCUS_28290 >Feature sequence162 2724 115 gene locus_tag LOCUS_28300 gene acnB 2724 115 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087875.1 protein_id gnl|my_center|LOCUS_28300 3132 3608 gene locus_tag LOCUS_28310 3132 3608 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113583.1 protein_id gnl|my_center|LOCUS_28310 4507 3647 gene locus_tag LOCUS_28320 4507 3647 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087881.1 protein_id gnl|my_center|LOCUS_28320 4684 5289 gene locus_tag LOCUS_28330 gene miaE 4684 5289 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368536.1 protein_id gnl|my_center|LOCUS_28330 6008 5286 gene locus_tag LOCUS_28340 gene lpxH 6008 5286 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113585.1 protein_id gnl|my_center|LOCUS_28340 6509 6015 gene locus_tag LOCUS_28350 6509 6015 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087890.1 protein_id gnl|my_center|LOCUS_28350 6783 8450 gene locus_tag LOCUS_28360 6783 8450 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113586.1 protein_id gnl|my_center|LOCUS_28360 >Feature sequence163 551 1789 gene locus_tag LOCUS_28370 551 1789 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085971.1 protein_id gnl|my_center|LOCUS_28370 1970 2155 gene locus_tag LOCUS_28380 gene csrA 1970 2155 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085981.1 protein_id gnl|my_center|LOCUS_28380 2218 2308 gene locus_tag LOCUS_t00400 2218 2308 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2419 2495 gene locus_tag LOCUS_t00410 2419 2495 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2565 2641 gene locus_tag LOCUS_t00420 2565 2641 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3173 2691 gene locus_tag LOCUS_28390 gene bamE 3173 2691 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245069.1 protein_id gnl|my_center|LOCUS_28390 3503 4945 gene locus_tag LOCUS_28400 gene mgtE 3503 4945 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085996.1 protein_id gnl|my_center|LOCUS_28400 5086 5328 gene locus_tag LOCUS_28410 5086 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 5351 7141 gene locus_tag LOCUS_28420 gene oadA 5351 7141 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_28420 7152 8288 gene locus_tag LOCUS_28430 7152 8288 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_28430 >Feature sequence164 2049 73 gene locus_tag LOCUS_28440 gene narX 2049 73 CDS product two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105296.1 protein_id gnl|my_center|LOCUS_28440 2317 3918 gene locus_tag LOCUS_28450 2317 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 3934 4392 gene locus_tag LOCUS_28460 3934 4392 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929081.1 protein_id gnl|my_center|LOCUS_28460 4407 5894 gene locus_tag LOCUS_28470 4407 5894 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_28470 >Feature sequence165 1829 1566 gene locus_tag LOCUS_28480 gene rpoZ 1829 1566 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096602.1 protein_id gnl|my_center|LOCUS_28480 2569 1949 gene locus_tag LOCUS_28490 gene gmk 2569 1949 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_28490 3494 2631 gene locus_tag LOCUS_28500 3494 2631 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098315.1 protein_id gnl|my_center|LOCUS_28500 3390 3647 gene locus_tag LOCUS_28510 3390 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 3644 4366 gene locus_tag LOCUS_28520 gene rph 3644 4366 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313989.1 protein_id gnl|my_center|LOCUS_28520 4384 4752 gene locus_tag LOCUS_28530 4384 4752 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096590.1 protein_id gnl|my_center|LOCUS_28530 5605 4826 gene locus_tag LOCUS_28540 5605 4826 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098313.1 protein_id gnl|my_center|LOCUS_28540 5691 6332 gene locus_tag LOCUS_28550 gene pyrE 5691 6332 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096586.1 protein_id gnl|my_center|LOCUS_28550 6388 6945 gene locus_tag LOCUS_28560 6388 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003161150.1 protein_id gnl|my_center|LOCUS_28560 7248 8627 gene locus_tag LOCUS_28570 7248 8627 CDS product DUF3360 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217121.1 protein_id gnl|my_center|LOCUS_28570 >Feature sequence166 <1 822 gene locus_tag LOCUS_28580 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092786.1:ribosome biogenesis GTPase Der 1701 907 gene locus_tag LOCUS_28590 gene cysE 1701 907 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004106845.1 protein_id gnl|my_center|LOCUS_28590 1861 3009 gene locus_tag LOCUS_28600 1861 3009 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106648.1 protein_id gnl|my_center|LOCUS_28600 2997 3791 gene locus_tag LOCUS_28610 2997 3791 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106646.1 protein_id gnl|my_center|LOCUS_28610 5125 3788 gene locus_tag LOCUS_28620 5125 3788 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927297.1 protein_id gnl|my_center|LOCUS_28620 5940 5140 gene locus_tag LOCUS_28630 5940 5140 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807015.1 protein_id gnl|my_center|LOCUS_28630 6517 6152 gene locus_tag LOCUS_28640 6517 6152 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420339.1 protein_id gnl|my_center|LOCUS_28640 7208 6522 gene locus_tag LOCUS_28650 7208 6522 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707003.1 protein_id gnl|my_center|LOCUS_28650 7950 7219 gene locus_tag LOCUS_28660 7950 7219 CDS product endonuclease I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099106.1 protein_id gnl|my_center|LOCUS_28660 8908 8051 gene locus_tag LOCUS_28670 8908 8051 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092000.1 protein_id gnl|my_center|LOCUS_28670 >Feature sequence167 287 1183 gene locus_tag LOCUS_28680 gene xerD 287 1183 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_28680 1331 2059 gene locus_tag LOCUS_28690 gene dsbC 1331 2059 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092626.1 protein_id gnl|my_center|LOCUS_28690 2164 2652 gene locus_tag LOCUS_28700 2164 2652 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532155.1 protein_id gnl|my_center|LOCUS_28700 2755 4059 gene locus_tag LOCUS_28710 2755 4059 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_28710 4130 5539 gene locus_tag LOCUS_28720 gene thrC 4130 5539 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113831.1 protein_id gnl|my_center|LOCUS_28720 6314 5640 gene locus_tag LOCUS_28730 gene rnt 6314 5640 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 protein_id gnl|my_center|LOCUS_28730 7354 6311 gene locus_tag LOCUS_28740 gene pyrC 7354 6311 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764852.1 protein_id gnl|my_center|LOCUS_28740 7518 8411 gene locus_tag LOCUS_28750 gene motY 7518 8411 CDS product flagellar protein MotY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104269.1 protein_id gnl|my_center|LOCUS_28750 >Feature sequence168 <1 1023 gene locus_tag LOCUS_28760 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085889.1:alpha/beta-hydrolase family protein 2519 1002 gene locus_tag LOCUS_28770 2519 1002 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114902.1 protein_id gnl|my_center|LOCUS_28770 4564 2525 gene locus_tag LOCUS_28780 4564 2525 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226992700.1 protein_id gnl|my_center|LOCUS_28780 5083 4688 gene locus_tag LOCUS_28790 5083 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 6166 5228 gene locus_tag LOCUS_28800 gene pbpG 6166 5228 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071265.1 protein_id gnl|my_center|LOCUS_28800 6426 6731 gene locus_tag LOCUS_28810 6426 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 6738 7349 gene locus_tag LOCUS_28820 6738 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088985.1 protein_id gnl|my_center|LOCUS_28820 8252 7440 gene locus_tag LOCUS_28830 gene aroE 8252 7440 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266136.1 protein_id gnl|my_center|LOCUS_28830 <8910 8343 gene locus_tag LOCUS_28840 <8910 8343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003097311.1:oxygen-dependent coproporphyrinogen oxidase >Feature sequence169 9 1295 gene locus_tag LOCUS_28850 gene mksB 9 1295 CDS product Mks condensin complex protein MksB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103378.1 protein_id gnl|my_center|LOCUS_28850 1362 2051 gene locus_tag LOCUS_28860 gene mksE 1362 2051 CDS product Mks condensin complex protein MksE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380289.1 protein_id gnl|my_center|LOCUS_28860 2048 4882 gene locus_tag LOCUS_28870 gene mksF 2048 4882 CDS product Mks condensin complex protein MksF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113519.1 protein_id gnl|my_center|LOCUS_28870 7269 4960 gene locus_tag LOCUS_28880 7269 4960 CDS product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107435.1 protein_id gnl|my_center|LOCUS_28880 7885 7262 gene locus_tag LOCUS_28890 7885 7262 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107436.1 protein_id gnl|my_center|LOCUS_28890 8528 7872 gene locus_tag LOCUS_28900 8528 7872 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023187661.1 protein_id gnl|my_center|LOCUS_28900 >Feature sequence170 249 905 gene locus_tag LOCUS_28910 249 905 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084232.1 protein_id gnl|my_center|LOCUS_28910 3656 909 gene locus_tag LOCUS_28920 gene malT 3656 909 CDS product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264940.1 protein_id gnl|my_center|LOCUS_28920 4640 3750 gene locus_tag LOCUS_28930 gene malG 4640 3750 CDS product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299600.1 protein_id gnl|my_center|LOCUS_28930 6183 4651 gene locus_tag LOCUS_28940 gene malF 6183 4651 CDS product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705559.1 protein_id gnl|my_center|LOCUS_28940 7471 6284 gene locus_tag LOCUS_28950 gene malE 7471 6284 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705558.1 protein_id gnl|my_center|LOCUS_28950 >Feature sequence171 870 2120 gene locus_tag LOCUS_28960 870 2120 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269234.1 protein_id gnl|my_center|LOCUS_28960 2162 3469 gene locus_tag LOCUS_28970 2162 3469 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269235.1 protein_id gnl|my_center|LOCUS_28970 3489 6653 gene locus_tag LOCUS_28980 3489 6653 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103123.1 protein_id gnl|my_center|LOCUS_28980 7111 6881 gene locus_tag LOCUS_28990 7111 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 7512 8432 gene locus_tag LOCUS_29000 7512 8432 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122027.1 protein_id gnl|my_center|LOCUS_29000 >Feature sequence172 <1 1026 gene locus_tag LOCUS_29010 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104155.1:hybrid sensor histidine kinase/response regulator 2515 1055 gene locus_tag LOCUS_29020 2515 1055 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114563.1 protein_id gnl|my_center|LOCUS_29020 5897 2607 gene locus_tag LOCUS_29030 gene mscK 5897 2607 CDS product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463895.1 protein_id gnl|my_center|LOCUS_29030 7769 6024 gene locus_tag LOCUS_29040 7769 6024 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114562.1 protein_id gnl|my_center|LOCUS_29040 8826 7903 gene locus_tag LOCUS_29050 8826 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 >Feature sequence173 393 172 gene locus_tag LOCUS_29060 393 172 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082243.1 protein_id gnl|my_center|LOCUS_29060 1059 478 gene locus_tag LOCUS_29070 1059 478 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120861.1 protein_id gnl|my_center|LOCUS_29070 2272 1115 gene locus_tag LOCUS_29080 2272 1115 CDS product phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268810.1 protein_id gnl|my_center|LOCUS_29080 3417 2536 gene locus_tag LOCUS_29090 3417 2536 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093969.1 protein_id gnl|my_center|LOCUS_29090 3589 4332 gene locus_tag LOCUS_29100 gene olsB 3589 4332 CDS product L-ornithine N(alpha)-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093970.1 protein_id gnl|my_center|LOCUS_29100 4333 5106 gene locus_tag LOCUS_29110 4333 5106 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268813.1 protein_id gnl|my_center|LOCUS_29110 5145 5714 gene locus_tag LOCUS_29120 5145 5714 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768620.1 protein_id gnl|my_center|LOCUS_29120 6503 5727 gene locus_tag LOCUS_29130 6503 5727 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114490.1 protein_id gnl|my_center|LOCUS_29130 7062 6610 gene locus_tag LOCUS_29140 7062 6610 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102319.1 protein_id gnl|my_center|LOCUS_29140 7279 7905 gene locus_tag LOCUS_29150 7279 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 7972 8676 gene locus_tag LOCUS_29160 gene folM 7972 8676 CDS product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091895.1 protein_id gnl|my_center|LOCUS_29160 >Feature sequence174 82 1077 gene locus_tag LOCUS_29170 gene moaA 82 1077 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083204.1 protein_id gnl|my_center|LOCUS_29170 1312 4800 gene locus_tag LOCUS_29180 gene smc 1312 4800 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104654.1 protein_id gnl|my_center|LOCUS_29180 4983 5816 gene locus_tag LOCUS_29190 gene zipA 4983 5816 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083352.1 protein_id gnl|my_center|LOCUS_29190 6106 8481 gene locus_tag LOCUS_29200 gene ligA 6106 8481 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114675.1 protein_id gnl|my_center|LOCUS_29200 >Feature sequence175 16 405 gene locus_tag LOCUS_29210 gene rpsK 16 405 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093689.1 protein_id gnl|my_center|LOCUS_29210 423 1043 gene locus_tag LOCUS_29220 gene rpsD 423 1043 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555465.1 protein_id gnl|my_center|LOCUS_29220 1066 2067 gene locus_tag LOCUS_29230 gene rpoA 1066 2067 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093675.1 protein_id gnl|my_center|LOCUS_29230 2113 2502 gene locus_tag LOCUS_29240 gene rplQ 2113 2502 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093672.1 protein_id gnl|my_center|LOCUS_29240 2665 4122 gene locus_tag LOCUS_29250 2665 4122 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269092.1 protein_id gnl|my_center|LOCUS_29250 7026 4189 gene locus_tag LOCUS_29260 gene uvrA 7026 4189 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093663.1 protein_id gnl|my_center|LOCUS_29260 7158 8525 gene locus_tag LOCUS_29270 7158 8525 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400420.1 protein_id gnl|my_center|LOCUS_29270 >Feature sequence176 763 95 gene locus_tag LOCUS_29280 gene nqrD 763 95 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119802.1 protein_id gnl|my_center|LOCUS_29280 1560 766 gene locus_tag LOCUS_29290 1560 766 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 protein_id gnl|my_center|LOCUS_29290 2764 1553 gene locus_tag LOCUS_29300 2764 1553 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 protein_id gnl|my_center|LOCUS_29300 4078 2768 gene locus_tag LOCUS_29310 4078 2768 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113983.1 protein_id gnl|my_center|LOCUS_29310 5892 4441 gene locus_tag LOCUS_29320 5892 4441 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119798.1 protein_id gnl|my_center|LOCUS_29320 >Feature sequence177 907 1302 gene locus_tag LOCUS_29330 907 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 1586 1350 gene locus_tag LOCUS_29340 1586 1350 CDS product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771165.1 protein_id gnl|my_center|LOCUS_29340 1703 2635 gene locus_tag LOCUS_29350 1703 2635 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973525.1 protein_id gnl|my_center|LOCUS_29350 3870 2662 gene locus_tag LOCUS_29360 3870 2662 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_29360 5670 4174 gene locus_tag LOCUS_29370 gene dgt 5670 4174 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112492.1 protein_id gnl|my_center|LOCUS_29370 5777 5965 gene locus_tag LOCUS_29380 5777 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 5974 6663 gene locus_tag LOCUS_29390 5974 6663 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037009.1 protein_id gnl|my_center|LOCUS_29390 6901 7035 gene locus_tag LOCUS_29400 6901 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 7958 7074 gene locus_tag LOCUS_29410 7958 7074 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189104.1 protein_id gnl|my_center|LOCUS_29410 >Feature sequence178 242 1357 gene locus_tag LOCUS_29420 gene malK 242 1357 CDS product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179177.1 protein_id gnl|my_center|LOCUS_29420 3661 1430 gene locus_tag LOCUS_29430 3661 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 4442 3828 gene locus_tag LOCUS_29440 4442 3828 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942192.1 protein_id gnl|my_center|LOCUS_29440 4689 5144 gene locus_tag LOCUS_29450 4689 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 6283 5747 gene locus_tag LOCUS_29460 6283 5747 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102950.1 protein_id gnl|my_center|LOCUS_29460 7633 8037 gene locus_tag LOCUS_29470 7633 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 8037 8351 gene locus_tag LOCUS_29480 8037 8351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 >Feature sequence179 392 3337 gene locus_tag LOCUS_29490 gene glnE 392 3337 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266458.1 protein_id gnl|my_center|LOCUS_29490 3386 4309 gene locus_tag LOCUS_29500 gene ilvE 3386 4309 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_29500 4388 5422 gene locus_tag LOCUS_29510 gene waaF 4388 5422 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109905.1 protein_id gnl|my_center|LOCUS_29510 5423 6424 gene locus_tag LOCUS_29520 gene waaC 5423 6424 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095779.1 protein_id gnl|my_center|LOCUS_29520 6424 7545 gene locus_tag LOCUS_29530 6424 7545 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114554.1 protein_id gnl|my_center|LOCUS_29530 7586 8392 gene locus_tag LOCUS_29540 gene rfaP 7586 8392 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114553.1 protein_id gnl|my_center|LOCUS_29540 >Feature sequence180 890 336 gene locus_tag LOCUS_29550 890 336 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266415.1 protein_id gnl|my_center|LOCUS_29550 1054 2460 gene locus_tag LOCUS_29560 1054 2460 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106128.1 protein_id gnl|my_center|LOCUS_29560 2547 3263 gene locus_tag LOCUS_29570 2547 3263 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106127.1 protein_id gnl|my_center|LOCUS_29570 3747 3277 gene locus_tag LOCUS_29580 3747 3277 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114895.1 protein_id gnl|my_center|LOCUS_29580 4796 3744 gene locus_tag LOCUS_29590 4796 3744 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118811.1 protein_id gnl|my_center|LOCUS_29590 <8424 4789 gene locus_tag LOCUS_29600 <8424 4789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114893.1:chemotaxis signal transduction system protein ChpA >Feature sequence181 2183 4330 gene locus_tag LOCUS_29610 gene fadB 2183 4330 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091204.1 protein_id gnl|my_center|LOCUS_29610 4349 5524 gene locus_tag LOCUS_29620 gene fadA 4349 5524 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113978.1 protein_id gnl|my_center|LOCUS_29620 5659 5892 gene locus_tag LOCUS_29630 5659 5892 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380890.1 protein_id gnl|my_center|LOCUS_29630 >Feature sequence182 599 144 gene locus_tag LOCUS_29640 599 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 1646 849 gene locus_tag LOCUS_29650 1646 849 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267408.1 protein_id gnl|my_center|LOCUS_29650 3765 1765 gene locus_tag LOCUS_29660 gene tgpA 3765 1765 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_29660 4718 3762 gene locus_tag LOCUS_29670 4718 3762 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765784.1 protein_id gnl|my_center|LOCUS_29670 5676 4759 gene locus_tag LOCUS_29680 5676 4759 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_29680 6233 5955 gene locus_tag LOCUS_29690 6233 5955 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316607.1 protein_id gnl|my_center|LOCUS_29690 7368 6262 gene locus_tag LOCUS_29700 gene mnmH 7368 6262 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266576.1 protein_id gnl|my_center|LOCUS_29700 8402 7368 gene locus_tag LOCUS_29710 gene selD 8402 7368 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103287.1 protein_id gnl|my_center|LOCUS_29710 >Feature sequence183 <1 822 gene locus_tag LOCUS_29720 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003084073.1:LysR family transcriptional regulator 880 1398 gene locus_tag LOCUS_29730 880 1398 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706999.1 protein_id gnl|my_center|LOCUS_29730 2353 1412 gene locus_tag LOCUS_29740 2353 1412 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104060.1 protein_id gnl|my_center|LOCUS_29740 2560 4011 gene locus_tag LOCUS_29750 2560 4011 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766752.1 protein_id gnl|my_center|LOCUS_29750 4129 4521 gene locus_tag LOCUS_29760 4129 4521 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057679135.1 protein_id gnl|my_center|LOCUS_29760 6283 4613 gene locus_tag LOCUS_29770 gene ggt 6283 4613 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086881.1 protein_id gnl|my_center|LOCUS_29770 7410 6400 gene locus_tag LOCUS_29780 7410 6400 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365244.1 protein_id gnl|my_center|LOCUS_29780 >Feature sequence184 7 1056 gene locus_tag LOCUS_29790 gene rlmM 7 1056 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268413.1 protein_id gnl|my_center|LOCUS_29790 1129 1380 gene locus_tag LOCUS_29800 gene tusA 1129 1380 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105999.1 protein_id gnl|my_center|LOCUS_29800 2264 1410 gene locus_tag LOCUS_29810 2264 1410 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533219.1 protein_id gnl|my_center|LOCUS_29810 2614 2255 gene locus_tag LOCUS_29820 2614 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 5142 2614 gene locus_tag LOCUS_29830 gene ctaD 5142 2614 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339037.1 protein_id gnl|my_center|LOCUS_29830 6029 5139 gene locus_tag LOCUS_29840 6029 5139 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975791.1 protein_id gnl|my_center|LOCUS_29840 6177 6656 gene locus_tag LOCUS_29850 6177 6656 CDS product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929265.1 protein_id gnl|my_center|LOCUS_29850 7172 6759 gene locus_tag LOCUS_29860 7172 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 8129 7278 gene locus_tag LOCUS_29870 8129 7278 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083179.1 protein_id gnl|my_center|LOCUS_29870 >Feature sequence185 483 1238 gene locus_tag LOCUS_29880 483 1238 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096156.1 protein_id gnl|my_center|LOCUS_29880 1303 1998 gene locus_tag LOCUS_29890 1303 1998 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105443.1 protein_id gnl|my_center|LOCUS_29890 1995 2684 gene locus_tag LOCUS_29900 1995 2684 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318320.1 protein_id gnl|my_center|LOCUS_29900 2785 3687 gene locus_tag LOCUS_29910 2785 3687 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105527.1 protein_id gnl|my_center|LOCUS_29910 3850 4074 gene locus_tag LOCUS_29920 3850 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 4155 5102 gene locus_tag LOCUS_29930 4155 5102 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105301.1 protein_id gnl|my_center|LOCUS_29930 6478 5219 gene locus_tag LOCUS_29940 6478 5219 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039905.1 protein_id gnl|my_center|LOCUS_29940 <8256 6866 gene locus_tag LOCUS_29950 <8256 6866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115040.1:methyl-accepting chemotaxis protein >Feature sequence186 2095 1250 gene locus_tag LOCUS_29960 gene kdsA 2095 1250 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092365.1 protein_id gnl|my_center|LOCUS_29960 3723 2092 gene locus_tag LOCUS_29970 3723 2092 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 protein_id gnl|my_center|LOCUS_29970 5180 3891 gene locus_tag LOCUS_29980 gene tilS 5180 3891 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266981.1 protein_id gnl|my_center|LOCUS_29980 6256 5306 gene locus_tag LOCUS_29990 gene accA 6256 5306 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377825.1 protein_id gnl|my_center|LOCUS_29990 <8112 6441 gene locus_tag LOCUS_30000 <8112 6441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003098578.1:DNA polymerase III subunit alpha >Feature sequence187 179 1015 gene locus_tag LOCUS_30010 gene trmJ 179 1015 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113799.1 protein_id gnl|my_center|LOCUS_30010 1015 1791 gene locus_tag LOCUS_30020 gene cysE 1015 1791 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_30020 1956 2447 gene locus_tag LOCUS_30030 gene iscR 1956 2447 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 protein_id gnl|my_center|LOCUS_30030 2479 3693 gene locus_tag LOCUS_30040 2479 3693 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365095.1 protein_id gnl|my_center|LOCUS_30040 3737 4123 gene locus_tag LOCUS_30050 gene iscU 3737 4123 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552476.1 protein_id gnl|my_center|LOCUS_30050 4136 4459 gene locus_tag LOCUS_30060 gene iscA 4136 4459 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100617.1 protein_id gnl|my_center|LOCUS_30060 4467 4988 gene locus_tag LOCUS_30070 gene hscB 4467 4988 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165441213.1 protein_id gnl|my_center|LOCUS_30070 5028 6890 gene locus_tag LOCUS_30080 gene hscA 5028 6890 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100622.1 protein_id gnl|my_center|LOCUS_30080 6896 7234 gene locus_tag LOCUS_30090 gene fdx 6896 7234 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092818.1 protein_id gnl|my_center|LOCUS_30090 7245 7445 gene locus_tag LOCUS_30100 gene iscX 7245 7445 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092814.1 protein_id gnl|my_center|LOCUS_30100 >Feature sequence188 1572 301 gene locus_tag LOCUS_30110 1572 301 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114300.1 protein_id gnl|my_center|LOCUS_30110 2791 1901 gene locus_tag LOCUS_30120 2791 1901 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105826.1 protein_id gnl|my_center|LOCUS_30120 3646 2864 gene locus_tag LOCUS_30130 gene hyi 3646 2864 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087181.1 protein_id gnl|my_center|LOCUS_30130 5601 3820 gene locus_tag LOCUS_30140 gene gcl 5601 3820 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527189.1 protein_id gnl|my_center|LOCUS_30140 5854 6762 gene locus_tag LOCUS_30150 5854 6762 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521296.1 protein_id gnl|my_center|LOCUS_30150 7178 6768 gene locus_tag LOCUS_30160 gene uraH 7178 6768 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167347.1 protein_id gnl|my_center|LOCUS_30160 7698 7195 gene locus_tag LOCUS_30170 7698 7195 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207181.1 protein_id gnl|my_center|LOCUS_30170 >Feature sequence189 178 3831 gene locus_tag LOCUS_30180 178 3831 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104711.1 protein_id gnl|my_center|LOCUS_30180 4254 6119 gene locus_tag LOCUS_30190 gene btuB 4254 6119 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_30190 6939 6139 gene locus_tag LOCUS_30200 6939 6139 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102817.1 protein_id gnl|my_center|LOCUS_30200 7346 6939 gene locus_tag LOCUS_30210 7346 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102818.1 protein_id gnl|my_center|LOCUS_30210 7960 7343 gene locus_tag LOCUS_30220 gene ribA 7960 7343 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110510.1 protein_id gnl|my_center|LOCUS_30220 >Feature sequence190 866 153 gene locus_tag LOCUS_30230 gene pgl 866 153 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266837.1 protein_id gnl|my_center|LOCUS_30230 2322 853 gene locus_tag LOCUS_30240 gene zwf 2322 853 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266836.1 protein_id gnl|my_center|LOCUS_30240 2493 3362 gene locus_tag LOCUS_30250 2493 3362 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375897.1 protein_id gnl|my_center|LOCUS_30250 4389 3430 gene locus_tag LOCUS_30260 4389 3430 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764052.1 protein_id gnl|my_center|LOCUS_30260 6212 4386 gene locus_tag LOCUS_30270 gene edd 6212 4386 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406660.1 protein_id gnl|my_center|LOCUS_30270 6561 6310 gene locus_tag LOCUS_30280 6561 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 <7980 6787 gene locus_tag LOCUS_30290 <7980 6787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269218.1:multidrug transporter subunit MdtD >Feature sequence191 218 1204 gene locus_tag LOCUS_30300 218 1204 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087542.1 protein_id gnl|my_center|LOCUS_30300 2312 1218 gene locus_tag LOCUS_30310 2312 1218 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114591.1 protein_id gnl|my_center|LOCUS_30310 3201 2398 gene locus_tag LOCUS_30320 3201 2398 CDS product DUF4892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054081893.1 protein_id gnl|my_center|LOCUS_30320 4285 3434 gene locus_tag LOCUS_30330 4285 3434 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 protein_id gnl|my_center|LOCUS_30330 5100 4288 gene locus_tag LOCUS_30340 5100 4288 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087496.1 protein_id gnl|my_center|LOCUS_30340 5674 5231 gene locus_tag LOCUS_30350 5674 5231 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087490.1 protein_id gnl|my_center|LOCUS_30350 6209 5751 gene locus_tag LOCUS_30360 gene sixA 6209 5751 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769602.1 protein_id gnl|my_center|LOCUS_30360 6568 6206 gene locus_tag LOCUS_30370 6568 6206 CDS product DUF4389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114251.1 protein_id gnl|my_center|LOCUS_30370 7600 6578 gene locus_tag LOCUS_30380 7600 6578 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267382.1 protein_id gnl|my_center|LOCUS_30380 >Feature sequence192 <1 2676 gene locus_tag LOCUS_30390 <1 2676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:190..192,aa:Sec) note codon on position 64 is selenocysteine opal codon. note partial CDS similar to WP_010895684.1:formate dehydrogenase-N subunit alpha 2676 3614 gene locus_tag LOCUS_30400 gene fdxH 2676 3614 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106793.1 protein_id gnl|my_center|LOCUS_30400 3672 4295 gene locus_tag LOCUS_30410 3672 4295 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095316.1 protein_id gnl|my_center|LOCUS_30410 4422 5339 gene locus_tag LOCUS_30420 gene fdhE 4422 5339 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112347.1 protein_id gnl|my_center|LOCUS_30420 5336 6745 gene locus_tag LOCUS_30430 gene selA 5336 6745 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148232.1 protein_id gnl|my_center|LOCUS_30430 >Feature sequence193 2296 1193 gene locus_tag LOCUS_30440 gene aroB 2296 1193 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765495.1 protein_id gnl|my_center|LOCUS_30440 2865 2320 gene locus_tag LOCUS_30450 gene aroK 2865 2320 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245596.1 protein_id gnl|my_center|LOCUS_30450 4989 2869 gene locus_tag LOCUS_30460 gene pilQ 4989 2869 CDS product type 4a pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114575.1 protein_id gnl|my_center|LOCUS_30460 5570 5043 gene locus_tag LOCUS_30470 gene pilP 5570 5043 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_30470 6193 5567 gene locus_tag LOCUS_30480 gene pilO 6193 5567 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_30480 6762 6190 gene locus_tag LOCUS_30490 gene pilN 6762 6190 CDS product type 4a pilus biogenesis protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_30490 7826 6762 gene locus_tag LOCUS_30500 gene pilM 7826 6762 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110888.1 protein_id gnl|my_center|LOCUS_30500 >Feature sequence194 358 2325 gene locus_tag LOCUS_30510 358 2325 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_30510 2455 3594 gene locus_tag LOCUS_30520 2455 3594 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621066.1 protein_id gnl|my_center|LOCUS_30520 3604 4203 gene locus_tag LOCUS_30530 gene metW 3604 4203 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_30530 4228 4650 gene locus_tag LOCUS_30540 4228 4650 CDS product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707384.1 protein_id gnl|my_center|LOCUS_30540 4647 5240 gene locus_tag LOCUS_30550 gene rdgB 4647 5240 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266424.1 protein_id gnl|my_center|LOCUS_30550 5237 6415 gene locus_tag LOCUS_30560 gene hemW 5237 6415 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114885.1 protein_id gnl|my_center|LOCUS_30560 6425 6748 gene locus_tag LOCUS_30570 6425 6748 CDS product DUF3392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084525.1 protein_id gnl|my_center|LOCUS_30570 7117 6755 gene locus_tag LOCUS_30580 7117 6755 CDS product DUF5064 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090800.1 protein_id gnl|my_center|LOCUS_30580 >Feature sequence195 612 79 gene locus_tag LOCUS_30590 612 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 940 644 gene locus_tag LOCUS_30600 940 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 1642 1920 gene locus_tag LOCUS_30610 1642 1920 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015547.1 protein_id gnl|my_center|LOCUS_30610 1947 2810 gene locus_tag LOCUS_30620 1947 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30620 4423 2702 gene locus_tag LOCUS_30630 4423 2702 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123069.1 protein_id gnl|my_center|LOCUS_30630 4648 5115 gene locus_tag LOCUS_30640 4648 5115 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705668.1 protein_id gnl|my_center|LOCUS_30640 5340 7217 gene locus_tag LOCUS_30650 5340 7217 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015482.1 protein_id gnl|my_center|LOCUS_30650 >Feature sequence196 1021 158 gene locus_tag LOCUS_30660 gene rsmI 1021 158 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120901.1 protein_id gnl|my_center|LOCUS_30660 1358 1152 gene locus_tag LOCUS_30670 1358 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 1266 2945 gene locus_tag LOCUS_30680 1266 2945 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268851.1 protein_id gnl|my_center|LOCUS_30680 2945 3307 gene locus_tag LOCUS_30690 2945 3307 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024665649.1 protein_id gnl|my_center|LOCUS_30690 3420 4013 gene locus_tag LOCUS_30700 3420 4013 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418801.1 protein_id gnl|my_center|LOCUS_30700 4010 4588 gene locus_tag LOCUS_30710 4010 4588 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406039.1 protein_id gnl|my_center|LOCUS_30710 5034 4627 gene locus_tag LOCUS_30720 5034 4627 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094153.1 protein_id gnl|my_center|LOCUS_30720 5664 5047 gene locus_tag LOCUS_30730 5664 5047 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094155.1 protein_id gnl|my_center|LOCUS_30730 6527 5748 gene locus_tag LOCUS_30740 6527 5748 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094157.1 protein_id gnl|my_center|LOCUS_30740 7738 6527 gene locus_tag LOCUS_30750 7738 6527 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_30750 >Feature sequence197 1593 2621 gene locus_tag LOCUS_30760 gene ccpA 1593 2621 CDS product cytochrome-c peroxidase CcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094815.1 protein_id gnl|my_center|LOCUS_30760 3080 2670 gene locus_tag LOCUS_30770 gene mscL 3080 2670 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399960.1 protein_id gnl|my_center|LOCUS_30770 3300 3569 gene locus_tag LOCUS_30780 3300 3569 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104887.1 protein_id gnl|my_center|LOCUS_30780 4061 3627 gene locus_tag LOCUS_30790 4061 3627 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112796.1 protein_id gnl|my_center|LOCUS_30790 4178 5539 gene locus_tag LOCUS_30800 gene radA 4178 5539 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094867.1 protein_id gnl|my_center|LOCUS_30800 5911 5543 gene locus_tag LOCUS_30810 5911 5543 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770186.1 protein_id gnl|my_center|LOCUS_30810 6429 5968 gene locus_tag LOCUS_30820 6429 5968 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142456.1 protein_id gnl|my_center|LOCUS_30820 <7778 6570 gene locus_tag LOCUS_30830 <7778 6570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112798.1:serine hydroxymethyltransferase >Feature sequence198 766 89 gene locus_tag LOCUS_30840 gene phoP 766 89 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082436.1 protein_id gnl|my_center|LOCUS_30840 1446 841 gene locus_tag LOCUS_30850 1446 841 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082431.1 protein_id gnl|my_center|LOCUS_30850 1978 1580 gene locus_tag LOCUS_30860 1978 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 2913 2032 gene locus_tag LOCUS_30870 2913 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30870 3422 2931 gene locus_tag LOCUS_30880 gene csgB 3422 2931 CDS product curli minor subunit CsgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097170.1 protein_id gnl|my_center|LOCUS_30880 4274 3618 gene locus_tag LOCUS_30890 4274 3618 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707638.1 protein_id gnl|my_center|LOCUS_30890 4465 6177 gene locus_tag LOCUS_30900 4465 6177 CDS product OPT family oligopeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266869.1 protein_id gnl|my_center|LOCUS_30900 6247 7317 gene locus_tag LOCUS_30910 6247 7317 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404394.1 protein_id gnl|my_center|LOCUS_30910 >Feature sequence199 948 2810 gene locus_tag LOCUS_30920 948 2810 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895689.1 protein_id gnl|my_center|LOCUS_30920 3892 2798 gene locus_tag LOCUS_30930 gene alr 3892 2798 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112284.1 protein_id gnl|my_center|LOCUS_30930 5393 3999 gene locus_tag LOCUS_30940 gene dnaB 5393 3999 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380723.1 protein_id gnl|my_center|LOCUS_30940 5944 5498 gene locus_tag LOCUS_30950 gene rplI 5944 5498 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317208.1 protein_id gnl|my_center|LOCUS_30950 6859 5966 gene locus_tag LOCUS_30960 6859 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407837.1 protein_id gnl|my_center|LOCUS_30960 7124 6894 gene locus_tag LOCUS_30970 gene rpsR 7124 6894 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_30970 7569 7153 gene locus_tag LOCUS_30980 gene rpsF 7569 7153 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551828.1 protein_id gnl|my_center|LOCUS_30980 >Feature sequence200 3349 1661 gene locus_tag LOCUS_30990 gene fadD2 3349 1661 CDS product long-chain-fatty-acid--CoA ligase FadD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091644.1 protein_id gnl|my_center|LOCUS_30990 3623 4093 gene locus_tag LOCUS_31000 3623 4093 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402365.1 protein_id gnl|my_center|LOCUS_31000 4330 7449 gene locus_tag LOCUS_31010 gene pulA 4330 7449 CDS product pullulanase-type alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482097.1 protein_id gnl|my_center|LOCUS_31010 >Feature sequence201 <1 1044 gene locus_tag LOCUS_31020 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113605.1:MFS transporter 1441 1067 gene locus_tag LOCUS_31030 1441 1067 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974894.1 protein_id gnl|my_center|LOCUS_31030 2258 1548 gene locus_tag LOCUS_31040 gene rutR 2258 1548 CDS product pyrimidine utilization regulatory protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266761.1 protein_id gnl|my_center|LOCUS_31040 2552 3640 gene locus_tag LOCUS_31050 gene rutA 2552 3640 CDS product pyrimidine utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408718.1 protein_id gnl|my_center|LOCUS_31050 3640 4386 gene locus_tag LOCUS_31060 gene rutB 3640 4386 CDS product pyrimidine utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103446.1 protein_id gnl|my_center|LOCUS_31060 4466 4852 gene locus_tag LOCUS_31070 gene rutC 4466 4852 CDS product pyrimidine utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552194.1 protein_id gnl|my_center|LOCUS_31070 4916 5713 gene locus_tag LOCUS_31080 gene rutD 4916 5713 CDS product pyrimidine utilization protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103445.1 protein_id gnl|my_center|LOCUS_31080 5724 6314 gene locus_tag LOCUS_31090 5724 6314 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972362.1 protein_id gnl|my_center|LOCUS_31090 6328 6855 gene locus_tag LOCUS_31100 gene rutF 6328 6855 CDS product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103444.1 protein_id gnl|my_center|LOCUS_31100 7029 7433 gene locus_tag LOCUS_31110 gene dksA 7029 7433 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097086.1 protein_id gnl|my_center|LOCUS_31110 >Feature sequence202 64 489 gene locus_tag LOCUS_31120 64 489 CDS product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098270.1 protein_id gnl|my_center|LOCUS_31120 623 1159 gene locus_tag LOCUS_31130 623 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972731.1 protein_id gnl|my_center|LOCUS_31130 1749 1177 gene locus_tag LOCUS_31140 1749 1177 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110452.1 protein_id gnl|my_center|LOCUS_31140 2470 1886 gene locus_tag LOCUS_31150 2470 1886 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_31150 4099 2480 gene locus_tag LOCUS_31160 4099 2480 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096667.1 protein_id gnl|my_center|LOCUS_31160 5637 4102 gene locus_tag LOCUS_31170 5637 4102 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261594.1 protein_id gnl|my_center|LOCUS_31170 5824 6834 gene locus_tag LOCUS_31180 gene gap 5824 6834 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444943.1 protein_id gnl|my_center|LOCUS_31180 6831 7418 gene locus_tag LOCUS_31190 6831 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 >Feature sequence203 237 911 gene locus_tag LOCUS_31200 gene cas5c 237 911 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 protein_id gnl|my_center|LOCUS_31200 908 2695 gene locus_tag LOCUS_31210 gene cas8c 908 2695 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388585.1 protein_id gnl|my_center|LOCUS_31210 2692 3561 gene locus_tag LOCUS_31220 gene cas7c 2692 3561 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_31220 3581 4213 gene locus_tag LOCUS_31230 gene cas4 3581 4213 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176710.1 protein_id gnl|my_center|LOCUS_31230 4217 5257 gene locus_tag LOCUS_31240 gene cas1c 4217 5257 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388588.1 protein_id gnl|my_center|LOCUS_31240 5270 5557 gene locus_tag LOCUS_31250 gene cas2 5270 5557 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_31250 5738 7425 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcgccccacgcgggcgcgtggattgaaac >Feature sequence204 1560 295 gene locus_tag LOCUS_31260 gene opdQ 1560 295 CDS product porin OpdQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091257.1 protein_id gnl|my_center|LOCUS_31260 2275 1670 gene locus_tag LOCUS_31270 2275 1670 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086598.1 protein_id gnl|my_center|LOCUS_31270 4015 2333 gene locus_tag LOCUS_31280 4015 2333 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113337.1 protein_id gnl|my_center|LOCUS_31280 5318 4296 gene locus_tag LOCUS_31290 5318 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 5639 6802 gene locus_tag LOCUS_31300 5639 6802 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267707.1 protein_id gnl|my_center|LOCUS_31300 >Feature sequence205 1500 64 gene locus_tag LOCUS_31310 1500 64 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198702760.1 protein_id gnl|my_center|LOCUS_31310 1967 1497 gene locus_tag LOCUS_31320 gene tsaE 1967 1497 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106408.1 protein_id gnl|my_center|LOCUS_31320 3445 1955 gene locus_tag LOCUS_31330 3445 1955 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105241.1 protein_id gnl|my_center|LOCUS_31330 3519 4592 gene locus_tag LOCUS_31340 gene queG 3519 4592 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_31340 6443 4602 gene locus_tag LOCUS_31350 gene ftsH 6443 4602 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 protein_id gnl|my_center|LOCUS_31350 6836 6537 gene locus_tag LOCUS_31360 6836 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 7458 6829 gene locus_tag LOCUS_31370 gene ubiX 7458 6829 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 protein_id gnl|my_center|LOCUS_31370 >Feature sequence206 1570 146 gene locus_tag LOCUS_31380 gene ccoN 1570 146 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_31380 1633 2325 gene locus_tag LOCUS_31390 1633 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105994.1 protein_id gnl|my_center|LOCUS_31390 3934 2366 gene locus_tag LOCUS_31400 3934 2366 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087330.1 protein_id gnl|my_center|LOCUS_31400 6959 4284 gene locus_tag LOCUS_31410 gene acnA 6959 4284 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105996.1 protein_id gnl|my_center|LOCUS_31410 >Feature sequence207 494 1468 gene locus_tag LOCUS_31420 494 1468 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085519.1 protein_id gnl|my_center|LOCUS_31420 1547 1990 gene locus_tag LOCUS_31430 1547 1990 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114175.1 protein_id gnl|my_center|LOCUS_31430 1992 3506 gene locus_tag LOCUS_31440 1992 3506 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114173.1 protein_id gnl|my_center|LOCUS_31440 3508 4530 gene locus_tag LOCUS_31450 3508 4530 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114172.1 protein_id gnl|my_center|LOCUS_31450 6206 4527 gene locus_tag LOCUS_31460 6206 4527 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266164.1 protein_id gnl|my_center|LOCUS_31460 7229 6342 gene locus_tag LOCUS_31470 7229 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 >Feature sequence208 198 560 gene locus_tag LOCUS_31480 198 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31480 560 1840 gene locus_tag LOCUS_31490 560 1840 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404808.1 protein_id gnl|my_center|LOCUS_31490 1992 2897 gene locus_tag LOCUS_31500 1992 2897 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103396.1 protein_id gnl|my_center|LOCUS_31500 3698 2946 gene locus_tag LOCUS_31510 3698 2946 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243745.1 protein_id gnl|my_center|LOCUS_31510 5419 3812 gene locus_tag LOCUS_31520 gene treF 5419 3812 CDS product alpha,alpha-trehalase TreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934251.1 protein_id gnl|my_center|LOCUS_31520 6183 5416 gene locus_tag LOCUS_31530 6183 5416 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547434.1 protein_id gnl|my_center|LOCUS_31530 6388 7278 gene locus_tag LOCUS_31540 gene rarD 6388 7278 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103301.1 protein_id gnl|my_center|LOCUS_31540 >Feature sequence209 589 185 gene locus_tag LOCUS_31550 589 185 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097819.1 protein_id gnl|my_center|LOCUS_31550 682 1875 gene locus_tag LOCUS_31560 682 1875 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114606.1 protein_id gnl|my_center|LOCUS_31560 1922 2524 gene locus_tag LOCUS_31570 1922 2524 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097816.1 protein_id gnl|my_center|LOCUS_31570 3113 2568 gene locus_tag LOCUS_31580 gene folE 3113 2568 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087639.1 protein_id gnl|my_center|LOCUS_31580 3772 3212 gene locus_tag LOCUS_31590 3772 3212 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087642.1 protein_id gnl|my_center|LOCUS_31590 4426 3830 gene locus_tag LOCUS_31600 4426 3830 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103179.1 protein_id gnl|my_center|LOCUS_31600 4729 5652 gene locus_tag LOCUS_31610 gene prmB 4729 5652 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087648.1 protein_id gnl|my_center|LOCUS_31610 5886 5689 gene locus_tag LOCUS_31620 5886 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 5861 7330 gene locus_tag LOCUS_31630 gene zwf 5861 7330 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266836.1 protein_id gnl|my_center|LOCUS_31630 >Feature sequence210 1333 344 gene locus_tag LOCUS_31640 1333 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 1673 1374 gene locus_tag LOCUS_31650 1673 1374 CDS product DUF1883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122824.1 protein_id gnl|my_center|LOCUS_31650 2113 3261 gene locus_tag LOCUS_31660 2113 3261 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403811.1 protein_id gnl|my_center|LOCUS_31660 3284 4312 gene locus_tag LOCUS_31670 3284 4312 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088017.1 protein_id gnl|my_center|LOCUS_31670 4404 5714 gene locus_tag LOCUS_31680 4404 5714 CDS product leucine-rich repeat-containing protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895623.1 protein_id gnl|my_center|LOCUS_31680 5743 6192 gene locus_tag LOCUS_31690 5743 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261145.1 protein_id gnl|my_center|LOCUS_31690 6344 6874 gene locus_tag LOCUS_31700 6344 6874 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526659.1 protein_id gnl|my_center|LOCUS_31700 7002 7217 gene locus_tag LOCUS_31710 7002 7217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 >Feature sequence211 80 667 gene locus_tag LOCUS_31720 gene mucA 80 667 CDS product anti-sigma factor MucA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101958.1 protein_id gnl|my_center|LOCUS_31720 676 1620 gene locus_tag LOCUS_31730 gene mucB 676 1620 CDS product sigma factor AlgU regulator MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101960.1 protein_id gnl|my_center|LOCUS_31730 1617 2069 gene locus_tag LOCUS_31740 gene mucC 1617 2069 CDS product alginate biosynthesis regulator MucC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110245.1 protein_id gnl|my_center|LOCUS_31740 2105 3526 gene locus_tag LOCUS_31750 2105 3526 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764764.1 protein_id gnl|my_center|LOCUS_31750 3706 5505 gene locus_tag LOCUS_31760 gene lepA 3706 5505 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739190.1 protein_id gnl|my_center|LOCUS_31760 5507 6361 gene locus_tag LOCUS_31770 gene lepB 5507 6361 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090229819.1 protein_id gnl|my_center|LOCUS_31770 6454 6831 gene locus_tag LOCUS_31780 6454 6831 CDS product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085562.1 protein_id gnl|my_center|LOCUS_31780 >Feature sequence212 <1 1678 gene locus_tag LOCUS_31790 <1 1678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266976.1:outer membrane protein assembly factor BamA 1727 2230 gene locus_tag LOCUS_31800 1727 2230 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554721.1 protein_id gnl|my_center|LOCUS_31800 2232 3290 gene locus_tag LOCUS_31810 gene lpxD 2232 3290 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_31810 3392 3832 gene locus_tag LOCUS_31820 gene fabZ 3392 3832 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092375.1 protein_id gnl|my_center|LOCUS_31820 3829 4605 gene locus_tag LOCUS_31830 gene lpxA 3829 4605 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092373.1 protein_id gnl|my_center|LOCUS_31830 4756 4595 gene locus_tag LOCUS_31840 4756 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 4736 5740 gene locus_tag LOCUS_31850 gene lpxB 4736 5740 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103595.1 protein_id gnl|my_center|LOCUS_31850 5740 6378 gene locus_tag LOCUS_31860 gene rnhB 5740 6378 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_31860 >Feature sequence213 <1 529 gene locus_tag LOCUS_31870 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005616372.1:DUF2058 domain-containing protein 2195 861 gene locus_tag LOCUS_31880 2195 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 2397 2630 gene locus_tag LOCUS_31890 2397 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 3297 2608 gene locus_tag LOCUS_31900 gene pdeM 3297 2608 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_31900 5950 3329 gene locus_tag LOCUS_31910 5950 3329 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_31910 <7450 5947 gene locus_tag LOCUS_31920 <7450 5947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268710.1:ATP-dependent DNA ligase >Feature sequence214 38 703 gene locus_tag LOCUS_31930 gene agmR 38 703 CDS product response regulator AgmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107754.1 protein_id gnl|my_center|LOCUS_31930 2125 728 gene locus_tag LOCUS_31940 gene cysG 2125 728 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405073.1 protein_id gnl|my_center|LOCUS_31940 3529 2249 gene locus_tag LOCUS_31950 gene serS 3529 2249 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097631.1 protein_id gnl|my_center|LOCUS_31950 3976 3602 gene locus_tag LOCUS_31960 gene crcB 3976 3602 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104506.1 protein_id gnl|my_center|LOCUS_31960 5298 3973 gene locus_tag LOCUS_31970 5298 3973 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_31970 6019 5372 gene locus_tag LOCUS_31980 gene lolA 6019 5372 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090414.1 protein_id gnl|my_center|LOCUS_31980 <7443 6016 gene locus_tag LOCUS_31990 <7443 6016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895627.1:DNA translocase FtsK >Feature sequence215 190 657 gene locus_tag LOCUS_32000 190 657 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705323.1 protein_id gnl|my_center|LOCUS_32000 734 1303 gene locus_tag LOCUS_32010 734 1303 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170245.1 protein_id gnl|my_center|LOCUS_32010 1346 2128 gene locus_tag LOCUS_32020 gene blaOXA 1346 2128 CDS product OXA-48 family carbapenem-hydrolyzing class D beta-lactamase OXA-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071128.1 protein_id gnl|my_center|LOCUS_32020 2196 2900 gene locus_tag LOCUS_32030 2196 2900 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140539.1 protein_id gnl|my_center|LOCUS_32030 2866 3234 gene locus_tag LOCUS_32040 2866 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 3307 3720 gene locus_tag LOCUS_32050 3307 3720 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530539.1 protein_id gnl|my_center|LOCUS_32050 3866 6367 gene locus_tag LOCUS_32060 gene plsB 3866 6367 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266965.1 protein_id gnl|my_center|LOCUS_32060 6789 6325 gene locus_tag LOCUS_32070 6789 6325 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706840.1 protein_id gnl|my_center|LOCUS_32070 >Feature sequence216 61 1026 gene locus_tag LOCUS_32080 gene pstS 61 1026 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_32080 1188 3464 gene locus_tag LOCUS_32090 1188 3464 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418856.1 protein_id gnl|my_center|LOCUS_32090 3492 5162 gene locus_tag LOCUS_32100 gene pstA 3492 5162 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_32100 5264 6091 gene locus_tag LOCUS_32110 gene pstB 5264 6091 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_32110 6238 6966 gene locus_tag LOCUS_32120 gene phoU 6238 6966 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096661.1 protein_id gnl|my_center|LOCUS_32120 >Feature sequence217 200 275 gene locus_tag LOCUS_t00430 200 275 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 318 686 gene locus_tag LOCUS_32130 gene secE 318 686 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555502.1 protein_id gnl|my_center|LOCUS_32130 696 1229 gene locus_tag LOCUS_32140 gene nusG 696 1229 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317113.1 protein_id gnl|my_center|LOCUS_32140 1340 1771 gene locus_tag LOCUS_32150 gene rplK 1340 1771 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093751.1 protein_id gnl|my_center|LOCUS_32150 1771 2466 gene locus_tag LOCUS_32160 gene rplA 1771 2466 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093749.1 protein_id gnl|my_center|LOCUS_32160 2676 3176 gene locus_tag LOCUS_32170 gene rplJ 2676 3176 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093748.1 protein_id gnl|my_center|LOCUS_32170 3257 3625 gene locus_tag LOCUS_32180 gene rplL 3257 3625 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093747.1 protein_id gnl|my_center|LOCUS_32180 >Feature sequence218 <1 829 gene locus_tag LOCUS_32190 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103038.1:diaminopimelate epimerase 826 1518 gene locus_tag LOCUS_32200 826 1518 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_32200 1575 2474 gene locus_tag LOCUS_32210 gene xerC 1575 2474 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246535.1 protein_id gnl|my_center|LOCUS_32210 2471 3172 gene locus_tag LOCUS_32220 2471 3172 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768510.1 protein_id gnl|my_center|LOCUS_32220 3571 3242 gene locus_tag LOCUS_32230 gene sutA 3571 3242 CDS product transcriptional regulator SutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098240.1 protein_id gnl|my_center|LOCUS_32230 4074 3649 gene locus_tag LOCUS_32240 4074 3649 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318084.1 protein_id gnl|my_center|LOCUS_32240 5426 4176 gene locus_tag LOCUS_32250 5426 4176 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071065.1 protein_id gnl|my_center|LOCUS_32250 6823 5543 gene locus_tag LOCUS_32260 6823 5543 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739890.1 protein_id gnl|my_center|LOCUS_32260 7236 6898 gene locus_tag LOCUS_32270 gene glnK 7236 6898 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_32270 >Feature sequence219 216 1505 gene locus_tag LOCUS_32280 216 1505 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269168.1 protein_id gnl|my_center|LOCUS_32280 1644 3422 gene locus_tag LOCUS_32290 1644 3422 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113245.1 protein_id gnl|my_center|LOCUS_32290 4477 3830 gene locus_tag LOCUS_32300 gene msrA 4477 3830 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095789.1 protein_id gnl|my_center|LOCUS_32300 <7265 4580 gene locus_tag LOCUS_32310 <7265 4580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114559.1:phosphodiesterase DipA >Feature sequence220 <1 969 gene locus_tag LOCUS_32320 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115345.1:peptidylprolyl isomerase 1079 2068 gene locus_tag LOCUS_32330 gene pdxA 1079 2068 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109023.1 protein_id gnl|my_center|LOCUS_32330 2100 2996 gene locus_tag LOCUS_32340 gene rsmA 2100 2996 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269133.1 protein_id gnl|my_center|LOCUS_32340 3030 3413 gene locus_tag LOCUS_32350 gene apaG 3030 3413 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768068.1 protein_id gnl|my_center|LOCUS_32350 3410 4237 gene locus_tag LOCUS_32360 3410 4237 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113213.1 protein_id gnl|my_center|LOCUS_32360 4234 4563 gene locus_tag LOCUS_32370 gene glpE 4234 4563 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085081.1 protein_id gnl|my_center|LOCUS_32370 4835 6757 gene locus_tag LOCUS_32380 4835 6757 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316247.1 protein_id gnl|my_center|LOCUS_32380 >Feature sequence221 <1 633 gene locus_tag LOCUS_32390 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003083052.1:flagellar type III secretion system pore protein FliP 646 915 gene locus_tag LOCUS_32400 gene fliQ 646 915 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083053.1 protein_id gnl|my_center|LOCUS_32400 920 1696 gene locus_tag LOCUS_32410 gene fliR 920 1696 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114278.1 protein_id gnl|my_center|LOCUS_32410 1730 2866 gene locus_tag LOCUS_32420 gene flhB 1730 2866 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_32420 3427 2906 gene locus_tag LOCUS_32430 3427 2906 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266857.1 protein_id gnl|my_center|LOCUS_32430 3646 5766 gene locus_tag LOCUS_32440 gene flhA 3646 5766 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_32440 5782 7074 gene locus_tag LOCUS_32450 gene flhF 5782 7074 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114281.1 protein_id gnl|my_center|LOCUS_32450 >Feature sequence222 4070 522 gene locus_tag LOCUS_32460 4070 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 4872 4174 gene locus_tag LOCUS_32470 gene urtE 4872 4174 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763108.1 protein_id gnl|my_center|LOCUS_32470 5855 5004 gene locus_tag LOCUS_32480 gene urtD 5855 5004 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376420.1 protein_id gnl|my_center|LOCUS_32480 6931 5852 gene locus_tag LOCUS_32490 gene urtC 6931 5852 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105220.1 protein_id gnl|my_center|LOCUS_32490 >Feature sequence223 1371 892 gene locus_tag LOCUS_32500 1371 892 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555745.1 protein_id gnl|my_center|LOCUS_32500 1565 2218 gene locus_tag LOCUS_32510 1565 2218 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110585.1 protein_id gnl|my_center|LOCUS_32510 2698 2231 gene locus_tag LOCUS_32520 2698 2231 CDS product DUF2269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947031.1 protein_id gnl|my_center|LOCUS_32520 3843 2695 gene locus_tag LOCUS_32530 3843 2695 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112959.1 protein_id gnl|my_center|LOCUS_32530 4394 3966 gene locus_tag LOCUS_32540 4394 3966 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112958.1 protein_id gnl|my_center|LOCUS_32540 5928 4414 gene locus_tag LOCUS_32550 gene ilvA 5928 4414 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269260.1 protein_id gnl|my_center|LOCUS_32550 6095 6766 gene locus_tag LOCUS_32560 gene rpiA 6095 6766 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247432.1 protein_id gnl|my_center|LOCUS_32560 >Feature sequence224 110 550 gene locus_tag LOCUS_32570 110 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 741 995 gene locus_tag LOCUS_32580 741 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 2015 1851 gene locus_tag LOCUS_32590 2015 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 3303 2032 gene locus_tag LOCUS_32600 3303 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 3502 3317 gene locus_tag LOCUS_32610 3502 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 5686 3518 gene locus_tag LOCUS_32620 5686 3518 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218177.1 protein_id gnl|my_center|LOCUS_32620 <7142 5683 gene locus_tag LOCUS_32630 <7142 5683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000937974.1:DEAD/DEAH box helicase >Feature sequence225 <1 556 gene locus_tag LOCUS_32640 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003097280.1:DNA-3-methyladenine glycosylase I 656 1543 gene locus_tag LOCUS_32650 656 1543 CDS product lysophospholipid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401447.1 protein_id gnl|my_center|LOCUS_32650 1578 1844 gene locus_tag LOCUS_32660 1578 1844 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114645.1 protein_id gnl|my_center|LOCUS_32660 2170 1853 gene locus_tag LOCUS_32670 2170 1853 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120685.1 protein_id gnl|my_center|LOCUS_32670 3157 2318 gene locus_tag LOCUS_32680 gene ehuA 3157 2318 CDS product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209942632.1 protein_id gnl|my_center|LOCUS_32680 3813 3154 gene locus_tag LOCUS_32690 gene ehuD 3813 3154 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812579.1 protein_id gnl|my_center|LOCUS_32690 4469 3810 gene locus_tag LOCUS_32700 gene ehuC 4469 3810 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459281.1 protein_id gnl|my_center|LOCUS_32700 5446 4589 gene locus_tag LOCUS_32710 gene ehuB 5446 4589 CDS product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064045.1 protein_id gnl|my_center|LOCUS_32710 <7115 5786 gene locus_tag LOCUS_32720 <7115 5786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003107053.1:Trk system potassium transporter TrkA >Feature sequence226 3128 567 gene locus_tag LOCUS_32730 3128 567 CDS product CHASE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122292.1 protein_id gnl|my_center|LOCUS_32730 5237 3309 gene locus_tag LOCUS_32740 5237 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 6090 5362 gene locus_tag LOCUS_32750 gene mtgA 6090 5362 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402232.1 protein_id gnl|my_center|LOCUS_32750 6158 6532 gene locus_tag LOCUS_32760 6158 6532 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 protein_id gnl|my_center|LOCUS_32760 6620 6820 gene locus_tag LOCUS_32770 gene thiS 6620 6820 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_32770 >Feature sequence227 2517 145 gene locus_tag LOCUS_32780 2517 145 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533185.1 protein_id gnl|my_center|LOCUS_32780 3089 2607 gene locus_tag LOCUS_32790 3089 2607 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105425.1 protein_id gnl|my_center|LOCUS_32790 3142 3534 gene locus_tag LOCUS_32800 3142 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114476.1 protein_id gnl|my_center|LOCUS_32800 5054 3618 gene locus_tag LOCUS_32810 gene ntrC 5054 3618 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_32810 6133 5051 gene locus_tag LOCUS_32820 gene glnL 6133 5051 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555720.1 protein_id gnl|my_center|LOCUS_32820 6932 6303 gene locus_tag LOCUS_32830 6932 6303 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103113.1 protein_id gnl|my_center|LOCUS_32830 >Feature sequence228 1357 929 gene locus_tag LOCUS_32840 gene hemJ 1357 929 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113170.1 protein_id gnl|my_center|LOCUS_32840 1487 2521 gene locus_tag LOCUS_32850 gene argC 1487 2521 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113169.1 protein_id gnl|my_center|LOCUS_32850 2632 2982 gene locus_tag LOCUS_32860 gene erpA 2632 2982 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551953.1 protein_id gnl|my_center|LOCUS_32860 4132 3041 gene locus_tag LOCUS_32870 4132 3041 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269098.1 protein_id gnl|my_center|LOCUS_32870 5541 4135 gene locus_tag LOCUS_32880 5541 4135 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767873.1 protein_id gnl|my_center|LOCUS_32880 5702 6919 gene locus_tag LOCUS_32890 gene tyrS 5702 6919 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113167.1 protein_id gnl|my_center|LOCUS_32890 >Feature sequence229 <1 1356 gene locus_tag LOCUS_32900 <1 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007245717.1:DEAD/DEAH box helicase 1670 1374 gene locus_tag LOCUS_32910 1670 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 1813 2193 gene locus_tag LOCUS_32920 1813 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091614.1 protein_id gnl|my_center|LOCUS_32920 3053 2199 gene locus_tag LOCUS_32930 3053 2199 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114756.1 protein_id gnl|my_center|LOCUS_32930 3151 3381 gene locus_tag LOCUS_32940 3151 3381 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110987.1 protein_id gnl|my_center|LOCUS_32940 4145 3390 gene locus_tag LOCUS_32950 4145 3390 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147982.1 protein_id gnl|my_center|LOCUS_32950 4871 4314 gene locus_tag LOCUS_32960 4871 4314 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 protein_id gnl|my_center|LOCUS_32960 6957 4975 gene locus_tag LOCUS_32970 gene mnmC 6957 4975 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114497.1 protein_id gnl|my_center|LOCUS_32970 >Feature sequence230 353 1009 gene locus_tag LOCUS_32980 353 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 1200 1697 gene locus_tag LOCUS_32990 1200 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 2674 1784 gene locus_tag LOCUS_33000 2674 1784 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574643.1 protein_id gnl|my_center|LOCUS_33000 3513 3196 gene locus_tag LOCUS_33010 3513 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 5127 3754 gene locus_tag LOCUS_33020 5127 3754 CDS product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103124.1 protein_id gnl|my_center|LOCUS_33020 5798 5124 gene locus_tag LOCUS_33030 5798 5124 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382360.1 protein_id gnl|my_center|LOCUS_33030 <6960 6115 gene locus_tag LOCUS_33040 <6960 6115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269238.1:OprD family porin >Feature sequence231 1095 157 gene locus_tag LOCUS_33050 1095 157 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 protein_id gnl|my_center|LOCUS_33050 1488 1213 gene locus_tag LOCUS_33060 1488 1213 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119275.1 protein_id gnl|my_center|LOCUS_33060 1635 3095 gene locus_tag LOCUS_33070 gene mltF 1635 3095 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104806.1 protein_id gnl|my_center|LOCUS_33070 5834 3117 gene locus_tag LOCUS_33080 5834 3117 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 protein_id gnl|my_center|LOCUS_33080 6035 6715 gene locus_tag LOCUS_33090 6035 6715 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463381.1 protein_id gnl|my_center|LOCUS_33090 >Feature sequence232 530 1099 gene locus_tag LOCUS_33100 530 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038180.1 protein_id gnl|my_center|LOCUS_33100 1096 1707 gene locus_tag LOCUS_33110 gene cobO 1096 1707 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086769.1 protein_id gnl|my_center|LOCUS_33110 1840 3132 gene locus_tag LOCUS_33120 1840 3132 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082590.1 protein_id gnl|my_center|LOCUS_33120 3129 3776 gene locus_tag LOCUS_33130 gene bluB 3129 3776 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082592.1 protein_id gnl|my_center|LOCUS_33130 3773 4573 gene locus_tag LOCUS_33140 3773 4573 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 protein_id gnl|my_center|LOCUS_33140 4570 5481 gene locus_tag LOCUS_33150 gene cbiB 4570 5481 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268581.1 protein_id gnl|my_center|LOCUS_33150 5474 6463 gene locus_tag LOCUS_33160 gene cobD 5474 6463 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 protein_id gnl|my_center|LOCUS_33160 >Feature sequence233 <1 999 gene locus_tag LOCUS_33170 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192541.1:arginine-ornithine antiporter 1091 2347 gene locus_tag LOCUS_33180 gene arcA 1091 2347 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111744.1 protein_id gnl|my_center|LOCUS_33180 2399 3409 gene locus_tag LOCUS_33190 2399 3409 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100031.1 protein_id gnl|my_center|LOCUS_33190 3450 4379 gene locus_tag LOCUS_33200 gene arcC 3450 4379 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100033.1 protein_id gnl|my_center|LOCUS_33200 5763 4426 gene locus_tag LOCUS_33210 5763 4426 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114884.1 protein_id gnl|my_center|LOCUS_33210 6696 5980 gene locus_tag LOCUS_33220 gene trmB 6696 5980 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118800.1 protein_id gnl|my_center|LOCUS_33220 >Feature sequence234 223 1860 gene locus_tag LOCUS_33230 gene ctaD 223 1860 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083723.1 protein_id gnl|my_center|LOCUS_33230 1925 2500 gene locus_tag LOCUS_33240 1925 2500 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083725.1 protein_id gnl|my_center|LOCUS_33240 2497 3393 gene locus_tag LOCUS_33250 2497 3393 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115030.1 protein_id gnl|my_center|LOCUS_33250 3604 3401 gene locus_tag LOCUS_33260 3604 3401 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101213.1 protein_id gnl|my_center|LOCUS_33260 3676 4413 gene locus_tag LOCUS_33270 3676 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119510.1 protein_id gnl|my_center|LOCUS_33270 4388 4966 gene locus_tag LOCUS_33280 4388 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083738.1 protein_id gnl|my_center|LOCUS_33280 5020 6075 gene locus_tag LOCUS_33290 5020 6075 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_33290 >Feature sequence235 2254 332 gene locus_tag LOCUS_33300 2254 332 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115040.1 protein_id gnl|my_center|LOCUS_33300 3098 2334 gene locus_tag LOCUS_33310 gene madM 3098 2334 CDS product malonate transporter subunit MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084016.1 protein_id gnl|my_center|LOCUS_33310 3535 3104 gene locus_tag LOCUS_33320 gene madL 3535 3104 CDS product malonate transporter subunit MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112671.1 protein_id gnl|my_center|LOCUS_33320 4586 3660 gene locus_tag LOCUS_33330 gene mdcH 4586 3660 CDS product malonate decarboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105302.1 protein_id gnl|my_center|LOCUS_33330 5200 4583 gene locus_tag LOCUS_33340 5200 4583 CDS product malonate decarboxylase holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031628460.1 protein_id gnl|my_center|LOCUS_33340 6035 5271 gene locus_tag LOCUS_33350 gene mdcE 6035 5271 CDS product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266409.1 protein_id gnl|my_center|LOCUS_33350 <6908 6053 gene locus_tag LOCUS_33360 <6908 6053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003084003.1:biotin-independent malonate decarboxylase subunit beta >Feature sequence236 <1 711 gene locus_tag LOCUS_33370 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007246818.1:ABC transporter ATP-binding protein 713 1441 gene locus_tag LOCUS_33380 713 1441 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268764.1 protein_id gnl|my_center|LOCUS_33380 1455 2090 gene locus_tag LOCUS_33390 1455 2090 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_33390 2249 5848 gene locus_tag LOCUS_33400 gene uca 2249 5848 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104917.1 protein_id gnl|my_center|LOCUS_33400 >Feature sequence237 2 211 gene locus_tag LOCUS_33410 2 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 371 1618 gene locus_tag LOCUS_33420 371 1618 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091472.1 protein_id gnl|my_center|LOCUS_33420 1728 2645 gene locus_tag LOCUS_33430 1728 2645 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091471.1 protein_id gnl|my_center|LOCUS_33430 2638 3480 gene locus_tag LOCUS_33440 2638 3480 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406653.1 protein_id gnl|my_center|LOCUS_33440 3492 4664 gene locus_tag LOCUS_33450 gene ugpC 3492 4664 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114840.1 protein_id gnl|my_center|LOCUS_33450 4769 5992 gene locus_tag LOCUS_33460 4769 5992 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207582.1 protein_id gnl|my_center|LOCUS_33460 6776 5997 gene locus_tag LOCUS_33470 6776 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087649.1 protein_id gnl|my_center|LOCUS_33470 >Feature sequence238 <1 689 gene locus_tag LOCUS_33480 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_151613280.1:putative urea ABC transporter substrate-binding protein 683 3073 gene locus_tag LOCUS_33490 683 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 3160 3657 gene locus_tag LOCUS_33500 3160 3657 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082669.1 protein_id gnl|my_center|LOCUS_33500 3854 5380 gene locus_tag LOCUS_33510 3854 5380 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211877.1 protein_id gnl|my_center|LOCUS_33510 5377 6690 gene locus_tag LOCUS_33520 5377 6690 CDS product lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211878.1 protein_id gnl|my_center|LOCUS_33520 >Feature sequence239 31 477 gene locus_tag LOCUS_33530 gene dksA 31 477 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 protein_id gnl|my_center|LOCUS_33530 567 1472 gene locus_tag LOCUS_33540 gene gluQRS 567 1472 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115557.1 protein_id gnl|my_center|LOCUS_33540 1578 1754 gene locus_tag LOCUS_33550 1578 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095129.1 protein_id gnl|my_center|LOCUS_33550 1738 4752 gene locus_tag LOCUS_33560 1738 4752 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266662.1 protein_id gnl|my_center|LOCUS_33560 4752 6167 gene locus_tag LOCUS_33570 gene cbrB 4752 6167 CDS product two-component system response regulator CbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 protein_id gnl|my_center|LOCUS_33570 >Feature sequence240 423 2354 gene locus_tag LOCUS_33580 423 2354 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115040.1 protein_id gnl|my_center|LOCUS_33580 2668 2393 gene locus_tag LOCUS_33590 2668 2393 CDS product polyhydroxyalkanoic acid system family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095874.1 protein_id gnl|my_center|LOCUS_33590 2855 3625 gene locus_tag LOCUS_33600 gene ubiE 2855 3625 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103462.1 protein_id gnl|my_center|LOCUS_33600 3625 4248 gene locus_tag LOCUS_33610 3625 4248 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105338.1 protein_id gnl|my_center|LOCUS_33610 4245 5852 gene locus_tag LOCUS_33620 gene ubiB 4245 5852 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266367.1 protein_id gnl|my_center|LOCUS_33620 5902 6297 gene locus_tag LOCUS_33630 gene hisI 5902 6297 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 protein_id gnl|my_center|LOCUS_33630 6290 6622 gene locus_tag LOCUS_33640 6290 6622 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103458.1 protein_id gnl|my_center|LOCUS_33640 >Feature sequence241 1 573 gene locus_tag LOCUS_33650 1 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 905 2566 gene locus_tag LOCUS_33660 905 2566 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245115.1 protein_id gnl|my_center|LOCUS_33660 2819 3103 gene locus_tag LOCUS_33670 gene ihfB 2819 3103 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554561.1 protein_id gnl|my_center|LOCUS_33670 3256 4536 gene locus_tag LOCUS_33680 3256 4536 CDS product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112588.1 protein_id gnl|my_center|LOCUS_33680 4797 6077 gene locus_tag LOCUS_33690 4797 6077 CDS product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112588.1 protein_id gnl|my_center|LOCUS_33690 6209 6667 gene locus_tag LOCUS_33700 6209 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 >Feature sequence242 572 2410 gene locus_tag LOCUS_33710 gene ilvD 572 2410 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084436.1 protein_id gnl|my_center|LOCUS_33710 4202 2469 gene locus_tag LOCUS_33720 4202 2469 CDS product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037879.1 protein_id gnl|my_center|LOCUS_33720 5418 4300 gene locus_tag LOCUS_33730 5418 4300 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037180.1 protein_id gnl|my_center|LOCUS_33730 5516 5971 gene locus_tag LOCUS_33740 5516 5971 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102894.1 protein_id gnl|my_center|LOCUS_33740 6611 5964 gene locus_tag LOCUS_33750 6611 5964 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397340.1 protein_id gnl|my_center|LOCUS_33750 >Feature sequence243 <1 742 gene locus_tag LOCUS_33760 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268571.1:class II fumarate hydratase 3060 940 gene locus_tag LOCUS_33770 3060 940 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_33770 3522 5813 gene locus_tag LOCUS_33780 3522 5813 CDS product MHYT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090708.1 protein_id gnl|my_center|LOCUS_33780 >Feature sequence244 394 1323 gene locus_tag LOCUS_33790 394 1323 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091099.1 protein_id gnl|my_center|LOCUS_33790 3962 1458 gene locus_tag LOCUS_33800 3962 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703527.1 protein_id gnl|my_center|LOCUS_33800 4917 4147 gene locus_tag LOCUS_33810 4917 4147 CDS product NERD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820009.1 protein_id gnl|my_center|LOCUS_33810 6160 5021 gene locus_tag LOCUS_33820 6160 5021 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113218.1 protein_id gnl|my_center|LOCUS_33820 6640 6564 gene locus_tag LOCUS_t00440 6640 6564 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence245 1245 247 gene locus_tag LOCUS_33830 gene dctP 1245 247 CDS product C4-dicarboxylate TRAP substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105525.1 protein_id gnl|my_center|LOCUS_33830 2290 1391 gene locus_tag LOCUS_33840 2290 1391 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811152.1 protein_id gnl|my_center|LOCUS_33840 2468 3670 gene locus_tag LOCUS_33850 2468 3670 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245808.1 protein_id gnl|my_center|LOCUS_33850 3812 4747 gene locus_tag LOCUS_33860 3812 4747 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807822.1 protein_id gnl|my_center|LOCUS_33860 5138 4971 gene locus_tag LOCUS_33870 5138 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 6364 5870 gene locus_tag LOCUS_33880 6364 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 >Feature sequence246 1190 339 gene locus_tag LOCUS_33890 1190 339 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119656.1 protein_id gnl|my_center|LOCUS_33890 1421 1615 gene locus_tag LOCUS_33900 1421 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 2493 1681 gene locus_tag LOCUS_33910 2493 1681 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 protein_id gnl|my_center|LOCUS_33910 2755 3642 gene locus_tag LOCUS_33920 2755 3642 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113156.1 protein_id gnl|my_center|LOCUS_33920 3639 4421 gene locus_tag LOCUS_33930 3639 4421 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208387.1 protein_id gnl|my_center|LOCUS_33930 4542 5888 gene locus_tag LOCUS_33940 4542 5888 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764944.1 protein_id gnl|my_center|LOCUS_33940 >Feature sequence247 1905 1369 gene locus_tag LOCUS_33950 1905 1369 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093155.1 protein_id gnl|my_center|LOCUS_33950 2634 2023 gene locus_tag LOCUS_33960 2634 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 3926 2643 gene locus_tag LOCUS_33970 gene hemL 3926 2643 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093150.1 protein_id gnl|my_center|LOCUS_33970 4620 3979 gene locus_tag LOCUS_33980 gene thiE 4620 3979 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 protein_id gnl|my_center|LOCUS_33980 5429 4635 gene locus_tag LOCUS_33990 5429 4635 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_33990 >Feature sequence248 357 617 gene locus_tag LOCUS_34000 357 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119823.1 protein_id gnl|my_center|LOCUS_34000 922 1335 gene locus_tag LOCUS_34010 922 1335 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365451.1 protein_id gnl|my_center|LOCUS_34010 1839 1378 gene locus_tag LOCUS_34020 1839 1378 CDS product DUF3597 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973558.1 protein_id gnl|my_center|LOCUS_34020 2288 1920 gene locus_tag LOCUS_34030 2288 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 2586 4181 gene locus_tag LOCUS_34040 gene mcpN 2586 4181 CDS product nitrate chemoreceptor McpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114783.1 protein_id gnl|my_center|LOCUS_34040 5621 4650 gene locus_tag LOCUS_34050 5621 4650 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530078.1 protein_id gnl|my_center|LOCUS_34050 5870 5643 gene locus_tag LOCUS_34060 5870 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 6458 5892 gene locus_tag LOCUS_34070 6458 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 >Feature sequence249 828 631 gene locus_tag LOCUS_34080 828 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 1110 1439 gene locus_tag LOCUS_34090 1110 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 2008 1673 gene locus_tag LOCUS_34100 2008 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 2823 2020 gene locus_tag LOCUS_34110 2823 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444655.1 protein_id gnl|my_center|LOCUS_34110 3509 2820 gene locus_tag LOCUS_34120 3509 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946778.1 protein_id gnl|my_center|LOCUS_34120 5702 3510 gene locus_tag LOCUS_34130 5702 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 6223 5717 gene locus_tag LOCUS_34140 6223 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 >Feature sequence250 1082 312 gene locus_tag LOCUS_34150 gene bdhA 1082 312 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113501.1 protein_id gnl|my_center|LOCUS_34150 2628 1237 gene locus_tag LOCUS_34160 2628 1237 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113502.1 protein_id gnl|my_center|LOCUS_34160 4239 2899 gene locus_tag LOCUS_34170 4239 2899 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490027.1 protein_id gnl|my_center|LOCUS_34170 4347 4763 gene locus_tag LOCUS_34180 4347 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 5470 5000 gene locus_tag LOCUS_34190 5470 5000 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553253.1 protein_id gnl|my_center|LOCUS_34190 >Feature sequence251 983 513 gene locus_tag LOCUS_34200 gene rpsG 983 513 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397077.1 protein_id gnl|my_center|LOCUS_34200 1453 1082 gene locus_tag LOCUS_34210 gene rpsL 1453 1082 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093744.1 protein_id gnl|my_center|LOCUS_34210 5794 1595 gene locus_tag LOCUS_34220 gene rpoC 5794 1595 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431814.1 protein_id gnl|my_center|LOCUS_34220 <6523 5860 gene locus_tag LOCUS_34230 <6523 5860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114335.1:DNA-directed RNA polymerase subunit beta >Feature sequence252 2877 880 gene locus_tag LOCUS_34240 gene tkt 2877 880 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110216.1 protein_id gnl|my_center|LOCUS_34240 3902 2964 gene locus_tag LOCUS_34250 3902 2964 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767830.1 protein_id gnl|my_center|LOCUS_34250 4045 4941 gene locus_tag LOCUS_34260 4045 4941 CDS product clavaminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975576.1 protein_id gnl|my_center|LOCUS_34260 4938 5540 gene locus_tag LOCUS_34270 4938 5540 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971922.1 protein_id gnl|my_center|LOCUS_34270 >Feature sequence253 <1 831 gene locus_tag LOCUS_34280 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003088593.1:bifunctional 3-hydroxy-3-isohexenylglutaryl-CoA lyase/hydroxymethylglutaryl-CoA lyase 917 1612 gene locus_tag LOCUS_34290 917 1612 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192091.1 protein_id gnl|my_center|LOCUS_34290 1617 2246 gene locus_tag LOCUS_34300 1617 2246 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_34300 2504 3685 gene locus_tag LOCUS_34310 2504 3685 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266654.1 protein_id gnl|my_center|LOCUS_34310 3759 4157 gene locus_tag LOCUS_34320 gene liuR 3759 4157 CDS product liu genes transcriptional regulator LiuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100383.1 protein_id gnl|my_center|LOCUS_34320 4563 5648 gene locus_tag LOCUS_34330 gene dctP 4563 5648 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810897.1 protein_id gnl|my_center|LOCUS_34330 5721 6323 gene locus_tag LOCUS_34340 5721 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 >Feature sequence254 <1 1060 gene locus_tag LOCUS_34350 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096872.1:DNA helicase II 1134 2237 gene locus_tag LOCUS_34360 gene dctP 1134 2237 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_34360 2423 3265 gene locus_tag LOCUS_34370 2423 3265 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099685.1 protein_id gnl|my_center|LOCUS_34370 4377 3427 gene locus_tag LOCUS_34380 4377 3427 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969967.1 protein_id gnl|my_center|LOCUS_34380 4843 4415 gene locus_tag LOCUS_34390 4843 4415 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817404.1 protein_id gnl|my_center|LOCUS_34390 4960 5796 gene locus_tag LOCUS_34400 4960 5796 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063703.1 protein_id gnl|my_center|LOCUS_34400 >Feature sequence255 2 568 gene locus_tag LOCUS_34410 gene efp 2 568 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090942.1 protein_id gnl|my_center|LOCUS_34410 2084 636 gene locus_tag LOCUS_34420 2084 636 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_34420 3574 2225 gene locus_tag LOCUS_34430 3574 2225 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104160.1 protein_id gnl|my_center|LOCUS_34430 3713 4462 gene locus_tag LOCUS_34440 3713 4462 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404195.1 protein_id gnl|my_center|LOCUS_34440 >Feature sequence256 367 1044 gene locus_tag LOCUS_34450 367 1044 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967933.1 protein_id gnl|my_center|LOCUS_34450 1126 1716 gene locus_tag LOCUS_34460 1126 1716 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528041.1 protein_id gnl|my_center|LOCUS_34460 1807 2508 gene locus_tag LOCUS_34470 1807 2508 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797789.1 protein_id gnl|my_center|LOCUS_34470 2831 2607 gene locus_tag LOCUS_34480 2831 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 3068 4120 gene locus_tag LOCUS_34490 3068 4120 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372667.1 protein_id gnl|my_center|LOCUS_34490 4446 5375 gene locus_tag LOCUS_34500 4446 5375 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965674.1 protein_id gnl|my_center|LOCUS_34500 5376 6170 gene locus_tag LOCUS_34510 5376 6170 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089562.1 protein_id gnl|my_center|LOCUS_34510 >Feature sequence257 565 350 gene locus_tag LOCUS_34520 565 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 509 2128 gene locus_tag LOCUS_34530 509 2128 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918081.1 protein_id gnl|my_center|LOCUS_34530 2201 3283 gene locus_tag LOCUS_34540 2201 3283 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967455.1 protein_id gnl|my_center|LOCUS_34540 3562 3828 gene locus_tag LOCUS_34550 3562 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 5838 4687 gene locus_tag LOCUS_34560 5838 4687 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770780.1 protein_id gnl|my_center|LOCUS_34560 <6420 5877 gene locus_tag LOCUS_34570 <6420 5877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267228.1:enoyl-CoA hydratase/isomerase family protein >Feature sequence258 <1 613 gene locus_tag LOCUS_34580 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091182.1:NADH:ubiquinone reductase (Na(+)-transporting) subunit E 629 1852 gene locus_tag LOCUS_34590 gene nqrF 629 1852 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113984.1 protein_id gnl|my_center|LOCUS_34590 1980 2903 gene locus_tag LOCUS_34600 1980 2903 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113985.1 protein_id gnl|my_center|LOCUS_34600 2900 3127 gene locus_tag LOCUS_34610 gene nqrM 2900 3127 CDS product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091178.1 protein_id gnl|my_center|LOCUS_34610 3272 4666 gene locus_tag LOCUS_34620 gene sthA 3272 4666 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091177.1 protein_id gnl|my_center|LOCUS_34620 5533 4811 gene locus_tag LOCUS_34630 5533 4811 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405702.1 protein_id gnl|my_center|LOCUS_34630 5838 5530 gene locus_tag LOCUS_34640 5838 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 6414 5842 gene locus_tag LOCUS_34650 6414 5842 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105196.1 protein_id gnl|my_center|LOCUS_34650 >Feature sequence259 1660 26 gene locus_tag LOCUS_34660 1660 26 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267230.1 protein_id gnl|my_center|LOCUS_34660 1920 2750 gene locus_tag LOCUS_34670 1920 2750 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400617.1 protein_id gnl|my_center|LOCUS_34670 4400 2811 gene locus_tag LOCUS_34680 4400 2811 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088336.1 protein_id gnl|my_center|LOCUS_34680 >Feature sequence260 <1 1165 gene locus_tag LOCUS_34690 <1 1165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895599.1:bifunctional diguanylate cyclase/phosphodiesterase 1694 1185 gene locus_tag LOCUS_34700 1694 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 3161 1731 gene locus_tag LOCUS_34710 3161 1731 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382014.1 protein_id gnl|my_center|LOCUS_34710 4065 3268 gene locus_tag LOCUS_34720 4065 3268 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267374.1 protein_id gnl|my_center|LOCUS_34720 4418 4062 gene locus_tag LOCUS_34730 4418 4062 CDS product DUF4398 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409835.1 protein_id gnl|my_center|LOCUS_34730 5251 4427 gene locus_tag LOCUS_34740 5251 4427 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114733.1 protein_id gnl|my_center|LOCUS_34740 6319 5375 gene locus_tag LOCUS_34750 6319 5375 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091099.1 protein_id gnl|my_center|LOCUS_34750 >Feature sequence261 264 1022 gene locus_tag LOCUS_34760 gene pilW 264 1022 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771019.1 protein_id gnl|my_center|LOCUS_34760 1019 2023 gene locus_tag LOCUS_34770 1019 2023 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115257.1 protein_id gnl|my_center|LOCUS_34770 2031 3143 gene locus_tag LOCUS_34780 gene ispG 2031 3143 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092800.1 protein_id gnl|my_center|LOCUS_34780 3160 4449 gene locus_tag LOCUS_34790 gene hisS 3160 4449 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092797.1 protein_id gnl|my_center|LOCUS_34790 4477 5118 gene locus_tag LOCUS_34800 4477 5118 CDS product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106650.1 protein_id gnl|my_center|LOCUS_34800 5122 6270 gene locus_tag LOCUS_34810 gene bamB 5122 6270 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428301.1 protein_id gnl|my_center|LOCUS_34810 >Feature sequence262 1267 11 gene locus_tag LOCUS_34820 1267 11 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082131.1 protein_id gnl|my_center|LOCUS_34820 2187 1264 gene locus_tag LOCUS_34830 gene livH 2187 1264 CDS product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086391.1 protein_id gnl|my_center|LOCUS_34830 3561 2443 gene locus_tag LOCUS_34840 3561 2443 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082136.1 protein_id gnl|my_center|LOCUS_34840 3761 4078 gene locus_tag LOCUS_34850 3761 4078 CDS product DUF2288 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086400.1 protein_id gnl|my_center|LOCUS_34850 4876 4109 gene locus_tag LOCUS_34860 gene phnE 4876 4109 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113152.1 protein_id gnl|my_center|LOCUS_34860 5706 4873 gene locus_tag LOCUS_34870 5706 4873 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113153.1 protein_id gnl|my_center|LOCUS_34870 <6334 5700 gene locus_tag LOCUS_34880 <6334 5700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113154.1:phosphonate ABC transporter ATP-binding protein >Feature sequence263 1432 542 gene locus_tag LOCUS_34890 1432 542 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407877.1 protein_id gnl|my_center|LOCUS_34890 1671 1429 gene locus_tag LOCUS_34900 1671 1429 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551852.1 protein_id gnl|my_center|LOCUS_34900 2587 1826 gene locus_tag LOCUS_34910 gene alcD 2587 1826 CDS product alcaligin biosynthesis protein AlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814016.1 protein_id gnl|my_center|LOCUS_34910 4466 2571 gene locus_tag LOCUS_34920 gene alcC 4466 2571 CDS product alcaligin biosynthesis protein AlcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930939.1 protein_id gnl|my_center|LOCUS_34920 4963 4376 gene locus_tag LOCUS_34930 4963 4376 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214999.1 protein_id gnl|my_center|LOCUS_34930 6114 4960 gene locus_tag LOCUS_34940 6114 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 >Feature sequence264 385 744 gene locus_tag LOCUS_34950 385 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 1525 746 gene locus_tag LOCUS_34960 1525 746 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038724.1 protein_id gnl|my_center|LOCUS_34960 1738 2001 gene locus_tag LOCUS_34970 1738 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 2152 3036 gene locus_tag LOCUS_34980 2152 3036 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114880.1 protein_id gnl|my_center|LOCUS_34980 3101 3883 gene locus_tag LOCUS_34990 3101 3883 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038619.1 protein_id gnl|my_center|LOCUS_34990 4830 3934 gene locus_tag LOCUS_35000 4830 3934 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965715.1 protein_id gnl|my_center|LOCUS_35000 <6309 4830 gene locus_tag LOCUS_35010 <6309 4830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085901.1:thymidine phosphorylase family protein >Feature sequence265 <1 1417 gene locus_tag LOCUS_35020 <1 1417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003098065.1:phosphoenolpyruvate synthase 1562 2050 gene locus_tag LOCUS_35030 gene rraA 1562 2050 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087823.1 protein_id gnl|my_center|LOCUS_35030 2132 3127 gene locus_tag LOCUS_35040 2132 3127 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382467.1 protein_id gnl|my_center|LOCUS_35040 3184 3426 gene locus_tag LOCUS_35050 3184 3426 CDS product crfX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406745.1 protein_id gnl|my_center|LOCUS_35050 3429 4253 gene locus_tag LOCUS_35060 3429 4253 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315687.1 protein_id gnl|my_center|LOCUS_35060 4338 4928 gene locus_tag LOCUS_35070 gene sigX 4338 4928 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015096065.1 protein_id gnl|my_center|LOCUS_35070 5028 6014 gene locus_tag LOCUS_35080 gene oprF 5028 6014 CDS product outer membrane porin OprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087843.1 protein_id gnl|my_center|LOCUS_35080 >Feature sequence266 312 2246 gene locus_tag LOCUS_35090 312 2246 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269181.1 protein_id gnl|my_center|LOCUS_35090 2243 2950 gene locus_tag LOCUS_35100 2243 2950 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103148.1 protein_id gnl|my_center|LOCUS_35100 3613 3095 gene locus_tag LOCUS_35110 3613 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 5481 3712 gene locus_tag LOCUS_35120 5481 3712 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_35120 5750 5487 gene locus_tag LOCUS_35130 5750 5487 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720744.1 protein_id gnl|my_center|LOCUS_35130 >Feature sequence267 298 35 gene locus_tag LOCUS_35140 298 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 191 1168 gene locus_tag LOCUS_35150 191 1168 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111202.1 protein_id gnl|my_center|LOCUS_35150 1780 1223 gene locus_tag LOCUS_35160 1780 1223 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097300.1 protein_id gnl|my_center|LOCUS_35160 2326 1919 gene locus_tag LOCUS_35170 2326 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 3250 3789 gene locus_tag LOCUS_35180 3250 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 4418 3831 gene locus_tag LOCUS_35190 4418 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 4586 5848 gene locus_tag LOCUS_35200 4586 5848 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108247.1 protein_id gnl|my_center|LOCUS_35200 >Feature sequence268 <1 1086 gene locus_tag LOCUS_35210 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113980.1:transcription-repair coupling factor 1087 1605 gene locus_tag LOCUS_35220 1087 1605 CDS product CsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091190.1 protein_id gnl|my_center|LOCUS_35220 1719 3986 gene locus_tag LOCUS_35230 1719 3986 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103848.1 protein_id gnl|my_center|LOCUS_35230 4120 4689 gene locus_tag LOCUS_35240 4120 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081987.1 protein_id gnl|my_center|LOCUS_35240 4831 5847 gene locus_tag LOCUS_35250 4831 5847 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268709.1 protein_id gnl|my_center|LOCUS_35250 >Feature sequence269 1568 759 gene locus_tag LOCUS_35260 1568 759 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105258.1 protein_id gnl|my_center|LOCUS_35260 2740 1565 gene locus_tag LOCUS_35270 2740 1565 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266476.1 protein_id gnl|my_center|LOCUS_35270 3128 2796 gene locus_tag LOCUS_35280 3128 2796 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346798.1 protein_id gnl|my_center|LOCUS_35280 3223 4509 gene locus_tag LOCUS_35290 gene waaA 3223 4509 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_35290 6083 4629 gene locus_tag LOCUS_35300 6083 4629 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762981.1 protein_id gnl|my_center|LOCUS_35300 >Feature sequence270 2 253 gene locus_tag LOCUS_35310 2 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 758 1099 gene locus_tag LOCUS_35320 758 1099 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104394.1 protein_id gnl|my_center|LOCUS_35320 1173 1454 gene locus_tag LOCUS_35330 1173 1454 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087375.1 protein_id gnl|my_center|LOCUS_35330 1895 1602 gene locus_tag LOCUS_35340 1895 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 2344 1958 gene locus_tag LOCUS_35350 gene fliS 2344 1958 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082192.1 protein_id gnl|my_center|LOCUS_35350 4072 2642 gene locus_tag LOCUS_35360 gene fliD 4072 2642 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082190.1 protein_id gnl|my_center|LOCUS_35360 4488 4138 gene locus_tag LOCUS_35370 4488 4138 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112502.1 protein_id gnl|my_center|LOCUS_35370 6027 4546 gene locus_tag LOCUS_35380 gene fliC 6027 4546 CDS product B-type flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112503.1 protein_id gnl|my_center|LOCUS_35380 >Feature sequence271 180 824 gene locus_tag LOCUS_35390 180 824 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764046.1 protein_id gnl|my_center|LOCUS_35390 929 2056 gene locus_tag LOCUS_35400 gene rluB 929 2056 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767718.1 protein_id gnl|my_center|LOCUS_35400 2841 2101 gene locus_tag LOCUS_35410 2841 2101 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113436.1 protein_id gnl|my_center|LOCUS_35410 3597 2926 gene locus_tag LOCUS_35420 gene mupP 3597 2926 CDS product N-acetylmuramic acid 6-phosphate phosphatase MupP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268565.1 protein_id gnl|my_center|LOCUS_35420 4295 3597 gene locus_tag LOCUS_35430 4295 3597 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_35430 5665 4424 gene locus_tag LOCUS_35440 5665 4424 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_35440 >Feature sequence272 1410 289 gene locus_tag LOCUS_35450 1410 289 CDS product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113308.1 protein_id gnl|my_center|LOCUS_35450 2785 1439 gene locus_tag LOCUS_35460 2785 1439 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330452.1 protein_id gnl|my_center|LOCUS_35460 3669 2893 gene locus_tag LOCUS_35470 3669 2893 CDS product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113313.1 protein_id gnl|my_center|LOCUS_35470 4752 3742 gene locus_tag LOCUS_35480 gene benC 4752 3742 CDS product benzoate 1,2-dioxygenase electron transfer component BenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109537.1 protein_id gnl|my_center|LOCUS_35480 5251 4763 gene locus_tag LOCUS_35490 gene benB 5251 4763 CDS product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113314.1 protein_id gnl|my_center|LOCUS_35490 <5979 5254 gene locus_tag LOCUS_35500 <5979 5254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113315.1:benzoate 1,2-dioxygenase large subunit >Feature sequence273 1597 680 gene locus_tag LOCUS_35510 gene thpD 1597 680 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040098.1 protein_id gnl|my_center|LOCUS_35510 2058 1657 gene locus_tag LOCUS_35520 2058 1657 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637098.1 protein_id gnl|my_center|LOCUS_35520 3346 2069 gene locus_tag LOCUS_35530 gene ectB 3346 2069 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263924.1 protein_id gnl|my_center|LOCUS_35530 3858 3343 gene locus_tag LOCUS_35540 gene ectA 3858 3343 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976956.1 protein_id gnl|my_center|LOCUS_35540 5937 4495 gene locus_tag LOCUS_35550 gene zwf 5937 4495 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096859.1 protein_id gnl|my_center|LOCUS_35550 >Feature sequence274 482 138 gene locus_tag LOCUS_35560 482 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 1660 683 gene locus_tag LOCUS_35570 gene lipA 1660 683 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119196.1 protein_id gnl|my_center|LOCUS_35570 2309 1653 gene locus_tag LOCUS_35580 gene lipB 2309 1653 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093177.1 protein_id gnl|my_center|LOCUS_35580 2593 2309 gene locus_tag LOCUS_35590 2593 2309 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100311.1 protein_id gnl|my_center|LOCUS_35590 3817 2660 gene locus_tag LOCUS_35600 3817 2660 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555330.1 protein_id gnl|my_center|LOCUS_35600 4857 3865 gene locus_tag LOCUS_35610 gene rlpA 4857 3865 CDS product septal ring lytic transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100310.1 protein_id gnl|my_center|LOCUS_35610 5831 4854 gene locus_tag LOCUS_35620 gene mltB 5831 4854 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736753.1 protein_id gnl|my_center|LOCUS_35620 >Feature sequence275 42 1709 gene locus_tag LOCUS_35630 gene ettA 42 1709 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399986.1 protein_id gnl|my_center|LOCUS_35630 1869 3860 gene locus_tag LOCUS_35640 gene siaA 1869 3860 CDS product biofilm regulation protein phosphatase SiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112649.1 protein_id gnl|my_center|LOCUS_35640 3876 4418 gene locus_tag LOCUS_35650 gene siaB 3876 4418 CDS product biofilm formation regulator kinase SiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083916.1 protein_id gnl|my_center|LOCUS_35650 4436 4813 gene locus_tag LOCUS_35660 gene siaC 4436 4813 CDS product biofilm formation regulator SiaD modulator protein SiaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083913.1 protein_id gnl|my_center|LOCUS_35660 4826 5611 gene locus_tag LOCUS_35670 gene siaD 4826 5611 CDS product biofilm regulation diguanylate cyclase SiaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118588.1 protein_id gnl|my_center|LOCUS_35670 >Feature sequence276 21 911 gene locus_tag LOCUS_35680 21 911 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095255.1 protein_id gnl|my_center|LOCUS_35680 2533 1061 gene locus_tag LOCUS_35690 2533 1061 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035672.1 protein_id gnl|my_center|LOCUS_35690 5574 2530 gene locus_tag LOCUS_35700 5574 2530 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402871.1 protein_id gnl|my_center|LOCUS_35700 >Feature sequence277 <1 744 gene locus_tag LOCUS_35710 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011817370.1:LysR family transcriptional regulator 821 1267 gene locus_tag LOCUS_35720 821 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 1845 1288 gene locus_tag LOCUS_35730 1845 1288 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701718.1 protein_id gnl|my_center|LOCUS_35730 1977 2201 gene locus_tag LOCUS_35740 1977 2201 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975469.1 protein_id gnl|my_center|LOCUS_35740 2435 2220 gene locus_tag LOCUS_35750 2435 2220 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555770.1 protein_id gnl|my_center|LOCUS_35750 3285 2470 gene locus_tag LOCUS_35760 gene ssuB 3285 2470 CDS product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102311.1 protein_id gnl|my_center|LOCUS_35760 4067 3282 gene locus_tag LOCUS_35770 gene ssuC 4067 3282 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102309.1 protein_id gnl|my_center|LOCUS_35770 5351 4203 gene locus_tag LOCUS_35780 gene ssuD 5351 4203 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091910.1 protein_id gnl|my_center|LOCUS_35780 >Feature sequence278 1944 139 gene locus_tag LOCUS_35790 1944 139 CDS product phenylacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084842.1 protein_id gnl|my_center|LOCUS_35790 2560 2312 gene locus_tag LOCUS_35800 2560 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382340.1 protein_id gnl|my_center|LOCUS_35800 3332 2625 gene locus_tag LOCUS_35810 gene bioD 3332 2625 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269170.1 protein_id gnl|my_center|LOCUS_35810 4131 3334 gene locus_tag LOCUS_35820 gene bioC 4131 3334 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269171.1 protein_id gnl|my_center|LOCUS_35820 4849 4124 gene locus_tag LOCUS_35830 4849 4124 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103332.1 protein_id gnl|my_center|LOCUS_35830 <5870 4842 gene locus_tag LOCUS_35840 <5870 4842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103160.1:8-amino-7-oxononanoate synthase >Feature sequence279 123 3299 gene locus_tag LOCUS_35850 gene mexQ 123 3299 CDS product multidrug efflux RND transporter permease subunit MexQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112892.1 protein_id gnl|my_center|LOCUS_35850 3320 4825 gene locus_tag LOCUS_35860 gene adeC 3320 4825 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039834.1 protein_id gnl|my_center|LOCUS_35860 4875 5261 gene locus_tag LOCUS_35870 gene cadR 4875 5261 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812014.1 protein_id gnl|my_center|LOCUS_35870 >Feature sequence280 41 1012 gene locus_tag LOCUS_35880 gene miaA 41 1012 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113929.1 protein_id gnl|my_center|LOCUS_35880 1105 1359 gene locus_tag LOCUS_35890 gene hfq 1105 1359 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095657.1 protein_id gnl|my_center|LOCUS_35890 1371 2672 gene locus_tag LOCUS_35900 gene hflX 1371 2672 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551820.1 protein_id gnl|my_center|LOCUS_35900 2771 3949 gene locus_tag LOCUS_35910 gene hflK 2771 3949 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105238.1 protein_id gnl|my_center|LOCUS_35910 3949 4815 gene locus_tag LOCUS_35920 gene hflC 3949 4815 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366315.1 protein_id gnl|my_center|LOCUS_35920 >Feature sequence281 142 1533 gene locus_tag LOCUS_35930 142 1533 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095142.1 protein_id gnl|my_center|LOCUS_35930 1481 2062 gene locus_tag LOCUS_35940 gene folK 1481 2062 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103370.1 protein_id gnl|my_center|LOCUS_35940 2189 2989 gene locus_tag LOCUS_35950 gene panB 2189 2989 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266658.1 protein_id gnl|my_center|LOCUS_35950 2986 3846 gene locus_tag LOCUS_35960 gene panC 2986 3846 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109313.1 protein_id gnl|my_center|LOCUS_35960 3930 4310 gene locus_tag LOCUS_35970 3930 4310 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113912.1 protein_id gnl|my_center|LOCUS_35970 >Feature sequence282 4 2025 gene locus_tag LOCUS_35980 gene treS 4 2025 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401001.1 protein_id gnl|my_center|LOCUS_35980 2109 2726 gene locus_tag LOCUS_35990 2109 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 3564 2791 gene locus_tag LOCUS_36000 3564 2791 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099728.1 protein_id gnl|my_center|LOCUS_36000 4300 3623 gene locus_tag LOCUS_36010 4300 3623 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097004.1 protein_id gnl|my_center|LOCUS_36010 5307 4300 gene locus_tag LOCUS_36020 5307 4300 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097002.1 protein_id gnl|my_center|LOCUS_36020 >Feature sequence283 283 561 gene locus_tag LOCUS_36030 gene ftsB 283 561 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098569.1 protein_id gnl|my_center|LOCUS_36030 558 1262 gene locus_tag LOCUS_36040 gene ispD 558 1262 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766007.1 protein_id gnl|my_center|LOCUS_36040 2457 1291 gene locus_tag LOCUS_36050 2457 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933801.1 protein_id gnl|my_center|LOCUS_36050 2848 2534 gene locus_tag LOCUS_36060 2848 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 3865 2966 gene locus_tag LOCUS_36070 3865 2966 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377838.1 protein_id gnl|my_center|LOCUS_36070 4018 5133 gene locus_tag LOCUS_36080 4018 5133 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092351.1 protein_id gnl|my_center|LOCUS_36080 >Feature sequence284 1414 2808 gene locus_tag LOCUS_36090 1414 2808 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112948.1 protein_id gnl|my_center|LOCUS_36090 2836 3501 gene locus_tag LOCUS_36100 2836 3501 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110705.1 protein_id gnl|my_center|LOCUS_36100 3597 4499 gene locus_tag LOCUS_36110 3597 4499 CDS product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121726.1 protein_id gnl|my_center|LOCUS_36110 4577 5473 gene locus_tag LOCUS_36120 4577 5473 CDS product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118774.1 protein_id gnl|my_center|LOCUS_36120 >Feature sequence285 236 724 gene locus_tag LOCUS_36130 236 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 2851 845 gene locus_tag LOCUS_36140 gene aceF 2851 845 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115359.1 protein_id gnl|my_center|LOCUS_36140 <5498 2876 gene locus_tag LOCUS_36150 <5498 2876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114556.1:pyruvate dehydrogenase (acetyl-transferring), homodimeric type >Feature sequence286 59 1477 gene locus_tag LOCUS_36160 59 1477 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403026.1 protein_id gnl|my_center|LOCUS_36160 1617 2681 gene locus_tag LOCUS_36170 gene hemE 1617 2681 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114569.1 protein_id gnl|my_center|LOCUS_36170 4005 2740 gene locus_tag LOCUS_36180 4005 2740 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095819.1 protein_id gnl|my_center|LOCUS_36180 4196 5095 gene locus_tag LOCUS_36190 4196 5095 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095817.1 protein_id gnl|my_center|LOCUS_36190 5394 5104 gene locus_tag LOCUS_36200 5394 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113664.1 protein_id gnl|my_center|LOCUS_36200 >Feature sequence287 34 249 gene locus_tag LOCUS_36210 34 249 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553055.1 protein_id gnl|my_center|LOCUS_36210 1372 341 gene locus_tag LOCUS_36220 1372 341 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103236.1 protein_id gnl|my_center|LOCUS_36220 1705 1484 gene locus_tag LOCUS_36230 1705 1484 CDS product DUF2835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119779.1 protein_id gnl|my_center|LOCUS_36230 1864 2778 gene locus_tag LOCUS_36240 1864 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122457.1 protein_id gnl|my_center|LOCUS_36240 <5457 2896 gene locus_tag LOCUS_36250 <5457 2896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103491.1:NAD-glutamate dehydrogenase GdhB >Feature sequence288 412 951 gene locus_tag LOCUS_36260 412 951 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140452.1 protein_id gnl|my_center|LOCUS_36260 1079 1981 gene locus_tag LOCUS_36270 1079 1981 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811189.1 protein_id gnl|my_center|LOCUS_36270 3581 2103 gene locus_tag LOCUS_36280 3581 2103 CDS product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808423.1 protein_id gnl|my_center|LOCUS_36280 3963 3766 gene locus_tag LOCUS_36290 3963 3766 CDS product DUF2934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531551.1 protein_id gnl|my_center|LOCUS_36290 >Feature sequence289 1211 288 gene locus_tag LOCUS_36300 1211 288 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529224.1 protein_id gnl|my_center|LOCUS_36300 1337 2377 gene locus_tag LOCUS_36310 gene fni 1337 2377 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533385.1 protein_id gnl|my_center|LOCUS_36310 2397 3683 gene locus_tag LOCUS_36320 2397 3683 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966003.1 protein_id gnl|my_center|LOCUS_36320 3673 4839 gene locus_tag LOCUS_36330 3673 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 >Feature sequence290 <1 1865 gene locus_tag LOCUS_36340 <1 1865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114037.1:ATP-binding cassette domain-containing protein 1862 2443 gene locus_tag LOCUS_36350 1862 2443 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551363.1 protein_id gnl|my_center|LOCUS_36350 2453 3211 gene locus_tag LOCUS_36360 2453 3211 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099222.1 protein_id gnl|my_center|LOCUS_36360 3242 3874 gene locus_tag LOCUS_36370 3242 3874 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266152.1 protein_id gnl|my_center|LOCUS_36370 3871 4344 gene locus_tag LOCUS_36380 3871 4344 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099218.1 protein_id gnl|my_center|LOCUS_36380 <5444 4319 gene locus_tag LOCUS_36390 <5444 4319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895656.1:bifunctional diguanylate cyclase/phosphodiesterase >Feature sequence291 26 2080 gene locus_tag LOCUS_36400 gene glyS 26 2080 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401442.1 protein_id gnl|my_center|LOCUS_36400 2049 2627 gene locus_tag LOCUS_36410 gene gmhB 2049 2627 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401440.1 protein_id gnl|my_center|LOCUS_36410 2624 3373 gene locus_tag LOCUS_36420 2624 3373 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_36420 3421 4791 gene locus_tag LOCUS_36430 3421 4791 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931513.1 protein_id gnl|my_center|LOCUS_36430 5443 4865 gene locus_tag LOCUS_36440 5443 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 >Feature sequence292 216 428 gene locus_tag LOCUS_36450 216 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 658 1227 gene locus_tag LOCUS_36460 658 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 1867 1520 gene locus_tag LOCUS_36470 1867 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 1919 4108 gene locus_tag LOCUS_36480 1919 4108 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530144.1 protein_id gnl|my_center|LOCUS_36480 >Feature sequence293 1854 844 gene locus_tag LOCUS_36490 gene gyaR 1854 844 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 protein_id gnl|my_center|LOCUS_36490 2690 1863 gene locus_tag LOCUS_36500 2690 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 3562 2699 gene locus_tag LOCUS_36510 3562 2699 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892069.1 protein_id gnl|my_center|LOCUS_36510 4386 3559 gene locus_tag LOCUS_36520 gene phnC 4386 3559 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569258.1 protein_id gnl|my_center|LOCUS_36520 5305 4772 gene locus_tag LOCUS_36530 5305 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 >Feature sequence294 1520 285 gene locus_tag LOCUS_36540 gene codA 1520 285 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195011.1 protein_id gnl|my_center|LOCUS_36540 2811 1534 gene locus_tag LOCUS_36550 gene codB 2811 1534 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205458.1 protein_id gnl|my_center|LOCUS_36550 3103 4641 gene locus_tag LOCUS_36560 gene katB 3103 4641 CDS product catalase KatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094881.1 protein_id gnl|my_center|LOCUS_36560 4753 5307 gene locus_tag LOCUS_36570 4753 5307 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895679.1 protein_id gnl|my_center|LOCUS_36570 >Feature sequence295 277 1482 gene locus_tag LOCUS_36580 277 1482 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085918.1 protein_id gnl|my_center|LOCUS_36580 1503 2330 gene locus_tag LOCUS_36590 1503 2330 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085920.1 protein_id gnl|my_center|LOCUS_36590 2385 3377 gene locus_tag LOCUS_36600 gene dctP 2385 3377 CDS product C4-dicarboxylate TRAP substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105525.1 protein_id gnl|my_center|LOCUS_36600 3497 4387 gene locus_tag LOCUS_36610 3497 4387 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526295.1 protein_id gnl|my_center|LOCUS_36610 4748 5086 gene locus_tag LOCUS_36620 4748 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 >Feature sequence296 1085 1552 gene locus_tag LOCUS_36630 gene bfr 1085 1552 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093668.1 protein_id gnl|my_center|LOCUS_36630 3529 1607 gene locus_tag LOCUS_36640 3529 1607 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463739.1 protein_id gnl|my_center|LOCUS_36640 4137 3697 gene locus_tag LOCUS_36650 gene cueR 4137 3697 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095248.1 protein_id gnl|my_center|LOCUS_36650 <5374 4151 gene locus_tag LOCUS_36660 <5374 4151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093042.1:copper-translocating P-type ATPase CopA1 >Feature sequence297 461 1501 gene locus_tag LOCUS_36670 461 1501 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_36670 1558 2238 gene locus_tag LOCUS_36680 1558 2238 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103868.1 protein_id gnl|my_center|LOCUS_36680 2448 2251 gene locus_tag LOCUS_36690 gene yacG 2448 2251 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094656.1 protein_id gnl|my_center|LOCUS_36690 2846 2445 gene locus_tag LOCUS_36700 2846 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 2784 3092 gene locus_tag LOCUS_36710 2784 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 4054 3185 gene locus_tag LOCUS_36720 4054 3185 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770019.1 protein_id gnl|my_center|LOCUS_36720 5274 4057 gene locus_tag LOCUS_36730 5274 4057 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_36730 >Feature sequence298 2575 1463 gene locus_tag LOCUS_36740 gene recF 2575 1463 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097265.1 protein_id gnl|my_center|LOCUS_36740 3688 2585 gene locus_tag LOCUS_36750 gene dnaN 3688 2585 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421522.1 protein_id gnl|my_center|LOCUS_36750 5182 3722 gene locus_tag LOCUS_36760 gene dnaA 5182 3722 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401422.1 protein_id gnl|my_center|LOCUS_36760 >Feature sequence299 1053 340 gene locus_tag LOCUS_36770 1053 340 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112914.1 protein_id gnl|my_center|LOCUS_36770 1796 1050 gene locus_tag LOCUS_36780 gene rsxG 1796 1050 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_36780 2853 1825 gene locus_tag LOCUS_36790 2853 1825 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092045.1 protein_id gnl|my_center|LOCUS_36790 <5181 2961 gene locus_tag LOCUS_36800 <5181 2961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112915.1:electron transport complex subunit RsxC >Feature sequence300 3337 2087 gene locus_tag LOCUS_36810 3337 2087 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_36810 3962 3522 gene locus_tag LOCUS_36820 3962 3522 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928030.1 protein_id gnl|my_center|LOCUS_36820 4386 4033 gene locus_tag LOCUS_36830 4386 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 4657 5022 gene locus_tag LOCUS_36840 4657 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 >Feature sequence301 114 755 gene locus_tag LOCUS_36850 gene mexL 114 755 CDS product efflux system transcriptional repressor MexL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092468.1 protein_id gnl|my_center|LOCUS_36850 1562 786 gene locus_tag LOCUS_36860 1562 786 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266962.1 protein_id gnl|my_center|LOCUS_36860 2326 1634 gene locus_tag LOCUS_36870 2326 1634 CDS product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113852.1 protein_id gnl|my_center|LOCUS_36870 3060 2395 gene locus_tag LOCUS_36880 3060 2395 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098658.1 protein_id gnl|my_center|LOCUS_36880 3608 3264 gene locus_tag LOCUS_36890 3608 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098661.1 protein_id gnl|my_center|LOCUS_36890 4401 3673 gene locus_tag LOCUS_36900 gene tsaB 4401 3673 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765933.1 protein_id gnl|my_center|LOCUS_36900 5129 4482 gene locus_tag LOCUS_36910 gene adk 5129 4482 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092485.1 protein_id gnl|my_center|LOCUS_36910 >Feature sequence302 550 1320 gene locus_tag LOCUS_36920 550 1320 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093112.1 protein_id gnl|my_center|LOCUS_36920 3849 1324 gene locus_tag LOCUS_36930 gene hrpB 3849 1324 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114322.1 protein_id gnl|my_center|LOCUS_36930 4409 3909 gene locus_tag LOCUS_36940 4409 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 4599 5015 gene locus_tag LOCUS_36950 4599 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093116.1 protein_id gnl|my_center|LOCUS_36950 >Feature sequence303 192 2345 gene locus_tag LOCUS_36960 192 2345 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114620.1 protein_id gnl|my_center|LOCUS_36960 2940 2416 gene locus_tag LOCUS_36970 2940 2416 CDS product diheme cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337163.1 protein_id gnl|my_center|LOCUS_36970 3355 2951 gene locus_tag LOCUS_36980 3355 2951 CDS product DUF1924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337164.1 protein_id gnl|my_center|LOCUS_36980 3498 5054 gene locus_tag LOCUS_36990 3498 5054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 >Feature sequence304 <1 2022 gene locus_tag LOCUS_37000 <1 2022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266295.1:catalase HPII 2225 3709 gene locus_tag LOCUS_37010 2225 3709 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815196.1 protein_id gnl|my_center|LOCUS_37010 4264 3752 gene locus_tag LOCUS_37020 4264 3752 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404609.1 protein_id gnl|my_center|LOCUS_37020 <5010 4264 gene locus_tag LOCUS_37030 <5010 4264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007247039.1:zinc ABC transporter permease subunit ZnuB