>Feature sequence01 1621 176 gene locus_tag LOCUS_00010 1621 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921029.1 protein_id gnl|my_center|LOCUS_00010 2164 1781 gene locus_tag LOCUS_00020 2164 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2872 2168 gene locus_tag LOCUS_00030 2872 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3622 3804 gene locus_tag LOCUS_00040 3622 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5199 3958 gene locus_tag LOCUS_00050 gene argJ 5199 3958 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057748.1 protein_id gnl|my_center|LOCUS_00050 5739 5296 gene locus_tag LOCUS_00060 5739 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8283 7183 gene locus_tag LOCUS_00070 gene prfA 8283 7183 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056003.1 protein_id gnl|my_center|LOCUS_00070 8911 11064 gene locus_tag LOCUS_00080 8911 11064 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058027.1 protein_id gnl|my_center|LOCUS_00080 11595 11293 gene locus_tag LOCUS_00090 gene rpsN 11595 11293 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057663.1 protein_id gnl|my_center|LOCUS_00090 11757 12311 gene locus_tag LOCUS_00100 11757 12311 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056278.1 protein_id gnl|my_center|LOCUS_00100 13491 14021 gene locus_tag LOCUS_00110 13491 14021 CDS product DUF4242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171919.1 protein_id gnl|my_center|LOCUS_00110 14034 15149 gene locus_tag LOCUS_00120 14034 15149 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117847.1 protein_id gnl|my_center|LOCUS_00120 15146 15928 gene locus_tag LOCUS_00130 15146 15928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115101.1 protein_id gnl|my_center|LOCUS_00130 15933 17141 gene locus_tag LOCUS_00140 15933 17141 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107732.1 protein_id gnl|my_center|LOCUS_00140 17154 17924 gene locus_tag LOCUS_00150 17154 17924 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107734.1 protein_id gnl|my_center|LOCUS_00150 20568 19450 gene locus_tag LOCUS_00160 gene kdpDN 20568 19450 CDS product KdpD-like non-kinase potassium sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181481.1 protein_id gnl|my_center|LOCUS_00160 21663 20713 gene locus_tag LOCUS_00170 21663 20713 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 protein_id gnl|my_center|LOCUS_00170 22040 22927 gene locus_tag LOCUS_00180 22040 22927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 23388 23122 gene locus_tag LOCUS_00190 23388 23122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141287.1 protein_id gnl|my_center|LOCUS_00190 24669 23704 gene locus_tag LOCUS_00200 24669 23704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 27082 24947 gene locus_tag LOCUS_00210 27082 24947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 27321 27076 gene locus_tag LOCUS_00220 27321 27076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 29002 27377 gene locus_tag LOCUS_00230 29002 27377 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056296.1 protein_id gnl|my_center|LOCUS_00230 29729 29373 gene locus_tag LOCUS_00240 29729 29373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 29951 32248 gene locus_tag LOCUS_00250 29951 32248 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920718.1 protein_id gnl|my_center|LOCUS_00250 33416 32685 gene locus_tag LOCUS_00260 33416 32685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 33517 33720 gene locus_tag LOCUS_00270 33517 33720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 34481 33900 gene locus_tag LOCUS_00280 34481 33900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00280 35112 34438 gene locus_tag LOCUS_00290 35112 34438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00290 35871 35185 gene locus_tag LOCUS_00300 35871 35185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 36577 35894 gene locus_tag LOCUS_00310 36577 35894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 36996 36580 gene locus_tag LOCUS_00320 36996 36580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 37351 38349 gene locus_tag LOCUS_00330 37351 38349 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124832.1 protein_id gnl|my_center|LOCUS_00330 38628 40028 gene locus_tag LOCUS_00340 gene leuC 38628 40028 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143406.1 protein_id gnl|my_center|LOCUS_00340 43312 40874 gene locus_tag LOCUS_00350 43312 40874 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892072.1 protein_id gnl|my_center|LOCUS_00350 43450 44910 gene locus_tag LOCUS_00360 gene zds 43450 44910 CDS product 9,9'-di-cis-zeta-carotene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056192.1 protein_id gnl|my_center|LOCUS_00360 45140 45835 gene locus_tag LOCUS_00370 45140 45835 CDS product aldehyde oxygenase (deformylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057153.1 protein_id gnl|my_center|LOCUS_00370 45983 47002 gene locus_tag LOCUS_00380 45983 47002 CDS product long-chain acyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057152.1 protein_id gnl|my_center|LOCUS_00380 48056 49192 gene locus_tag LOCUS_00390 48056 49192 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057921.1 protein_id gnl|my_center|LOCUS_00390 49400 50656 gene locus_tag LOCUS_00400 49400 50656 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058074.1 protein_id gnl|my_center|LOCUS_00400 51343 50693 gene locus_tag LOCUS_00410 51343 50693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_00410 52086 51457 gene locus_tag LOCUS_00420 52086 51457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_00420 53054 52200 gene locus_tag LOCUS_00430 gene purU 53054 52200 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524116.1 protein_id gnl|my_center|LOCUS_00430 53751 53176 gene locus_tag LOCUS_00440 53751 53176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 54038 53820 gene locus_tag LOCUS_00450 54038 53820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 54258 55109 gene locus_tag LOCUS_00460 54258 55109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 56381 55215 gene locus_tag LOCUS_00470 56381 55215 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920638.1 protein_id gnl|my_center|LOCUS_00470 56515 56443 gene locus_tag LOCUS_t00010 56515 56443 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 56835 56635 gene locus_tag LOCUS_00480 56835 56635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 57845 57081 gene locus_tag LOCUS_00490 gene hisF 57845 57081 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799407.1 protein_id gnl|my_center|LOCUS_00490 57869 58945 gene locus_tag LOCUS_00500 gene ruvB 57869 58945 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058086.1 protein_id gnl|my_center|LOCUS_00500 59294 60070 gene locus_tag LOCUS_00510 59294 60070 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 protein_id gnl|my_center|LOCUS_00510 61244 60039 gene locus_tag LOCUS_00520 61244 60039 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036408.1 protein_id gnl|my_center|LOCUS_00520 62854 61721 gene locus_tag LOCUS_00530 62854 61721 CDS product RNA polymerase sigma factor, RpoD/SigA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345474.1 protein_id gnl|my_center|LOCUS_00530 63313 65907 gene locus_tag LOCUS_00540 gene priA 63313 65907 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920687.1 protein_id gnl|my_center|LOCUS_00540 66818 65937 gene locus_tag LOCUS_00550 66818 65937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 67696 66815 gene locus_tag LOCUS_00560 67696 66815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 67992 67693 gene locus_tag LOCUS_00570 67992 67693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 68304 69098 gene locus_tag LOCUS_00580 gene pgeF 68304 69098 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799068.1 protein_id gnl|my_center|LOCUS_00580 69159 70136 gene locus_tag LOCUS_00590 gene fmt 69159 70136 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406043.1 protein_id gnl|my_center|LOCUS_00590 70546 70166 gene locus_tag LOCUS_00600 70546 70166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 71710 70904 gene locus_tag LOCUS_00610 71710 70904 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057297.1 protein_id gnl|my_center|LOCUS_00610 71850 72071 gene locus_tag LOCUS_00620 71850 72071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 73019 72189 gene locus_tag LOCUS_00630 73019 72189 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_00630 74478 73120 gene locus_tag LOCUS_00640 gene trxB 74478 73120 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057761.1 protein_id gnl|my_center|LOCUS_00640 74991 74614 gene locus_tag LOCUS_00650 74991 74614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 75550 74963 gene locus_tag LOCUS_00660 75550 74963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 76551 75685 gene locus_tag LOCUS_00670 76551 75685 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142041.1 protein_id gnl|my_center|LOCUS_00670 78674 76683 gene locus_tag LOCUS_00680 78674 76683 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113630057.1 protein_id gnl|my_center|LOCUS_00680 79114 78815 gene locus_tag LOCUS_00690 79114 78815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 79538 79170 gene locus_tag LOCUS_00700 79538 79170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 79836 79525 gene locus_tag LOCUS_00710 79836 79525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 80095 80283 gene locus_tag LOCUS_00720 80095 80283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 80268 80519 gene locus_tag LOCUS_00730 80268 80519 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080272.1 protein_id gnl|my_center|LOCUS_00730 80815 81495 gene locus_tag LOCUS_00740 80815 81495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 82900 81818 gene locus_tag LOCUS_00750 82900 81818 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388802.1 protein_id gnl|my_center|LOCUS_00750 83777 85657 gene locus_tag LOCUS_00760 83777 85657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 85654 89901 gene locus_tag LOCUS_00770 85654 89901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 89943 91811 gene locus_tag LOCUS_00780 gene asnB 89943 91811 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976178.1 protein_id gnl|my_center|LOCUS_00780 91950 92987 gene locus_tag LOCUS_00790 91950 92987 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267343.1 protein_id gnl|my_center|LOCUS_00790 93146 93982 gene locus_tag LOCUS_00800 93146 93982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 94029 94850 gene locus_tag LOCUS_00810 94029 94850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 94931 100990 gene locus_tag LOCUS_00820 94931 100990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 108211 101057 gene locus_tag LOCUS_00830 108211 101057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 109674 108208 gene locus_tag LOCUS_00840 109674 108208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 111539 109668 gene locus_tag LOCUS_00850 111539 109668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 112412 111555 gene locus_tag LOCUS_00860 112412 111555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 112934 112614 gene locus_tag LOCUS_00870 112934 112614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 114441 113740 gene locus_tag LOCUS_00880 114441 113740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 115090 114566 gene locus_tag LOCUS_00890 115090 114566 CDS product transposase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141835.1 protein_id gnl|my_center|LOCUS_00890 115766 116557 gene locus_tag LOCUS_00900 115766 116557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 116596 117060 gene locus_tag LOCUS_00910 116596 117060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 117267 120542 gene locus_tag LOCUS_00920 117267 120542 CDS product type 2 lanthipeptide synthetase LanM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370929.1 protein_id gnl|my_center|LOCUS_00920 121047 121451 gene locus_tag LOCUS_00930 121047 121451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 121357 121692 gene locus_tag LOCUS_00940 121357 121692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 122241 121678 gene locus_tag LOCUS_00950 122241 121678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168695229.1 protein_id gnl|my_center|LOCUS_00950 122826 122350 gene locus_tag LOCUS_00960 122826 122350 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142127.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00960 124044 123283 gene locus_tag LOCUS_00970 124044 123283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00970 124521 124096 gene locus_tag LOCUS_00980 124521 124096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00980 125086 124493 gene locus_tag LOCUS_00990 125086 124493 CDS product IS607-like element IS1602 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414146.1 protein_id gnl|my_center|LOCUS_00990 127115 125673 gene locus_tag LOCUS_01000 gene gltX 127115 125673 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056357.1 protein_id gnl|my_center|LOCUS_01000 127795 127319 gene locus_tag LOCUS_01010 gene ndhN 127795 127319 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056972.1 protein_id gnl|my_center|LOCUS_01010 128188 128979 gene locus_tag LOCUS_01020 128188 128979 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920815.1 protein_id gnl|my_center|LOCUS_01020 129697 129029 gene locus_tag LOCUS_01030 gene phoU 129697 129029 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583268.1 protein_id gnl|my_center|LOCUS_01030 131118 129817 gene locus_tag LOCUS_01040 131118 129817 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056769.1 protein_id gnl|my_center|LOCUS_01040 131918 131166 gene locus_tag LOCUS_01050 131918 131166 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056437.1 protein_id gnl|my_center|LOCUS_01050 131993 132760 gene locus_tag LOCUS_01060 131993 132760 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057232.1 protein_id gnl|my_center|LOCUS_01060 132962 133726 gene locus_tag LOCUS_01070 132962 133726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 135222 133756 gene locus_tag LOCUS_01080 135222 133756 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 protein_id gnl|my_center|LOCUS_01080 135920 135369 gene locus_tag LOCUS_01090 135920 135369 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920958.1 protein_id gnl|my_center|LOCUS_01090 136080 136346 gene locus_tag LOCUS_01100 136080 136346 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920742.1 protein_id gnl|my_center|LOCUS_01100 136693 136923 gene locus_tag LOCUS_01110 gene infA 136693 136923 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055956.1 protein_id gnl|my_center|LOCUS_01110 137258 137641 gene locus_tag LOCUS_01120 gene rpsM 137258 137641 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055958.1 protein_id gnl|my_center|LOCUS_01120 137681 138073 gene locus_tag LOCUS_01130 gene rpsK 137681 138073 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055959.1 protein_id gnl|my_center|LOCUS_01130 138267 139208 gene locus_tag LOCUS_01140 138267 139208 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143560.1 protein_id gnl|my_center|LOCUS_01140 139230 139580 gene locus_tag LOCUS_01150 gene rplQ 139230 139580 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055961.1 protein_id gnl|my_center|LOCUS_01150 139583 140413 gene locus_tag LOCUS_01160 gene truA 139583 140413 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055962.1 protein_id gnl|my_center|LOCUS_01160 140537 140992 gene locus_tag LOCUS_01170 gene rplM 140537 140992 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055963.1 protein_id gnl|my_center|LOCUS_01170 140997 141410 gene locus_tag LOCUS_01180 gene rpsI 140997 141410 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055964.1 protein_id gnl|my_center|LOCUS_01180 141430 141663 gene locus_tag LOCUS_01190 gene rpmE 141430 141663 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125833.1 protein_id gnl|my_center|LOCUS_01190 144109 142007 gene locus_tag LOCUS_01200 144109 142007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 144633 144133 gene locus_tag LOCUS_01210 144633 144133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 144833 145120 gene locus_tag LOCUS_01220 gene clpS 144833 145120 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024123996.1 protein_id gnl|my_center|LOCUS_01220 145113 145943 gene locus_tag LOCUS_01230 145113 145943 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056065.1 protein_id gnl|my_center|LOCUS_01230 145996 146469 gene locus_tag LOCUS_01240 145996 146469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 147521 146400 gene locus_tag LOCUS_01250 147521 146400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 148954 147698 gene locus_tag LOCUS_01260 148954 147698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 149164 149460 gene locus_tag LOCUS_01270 149164 149460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 149447 150328 gene locus_tag LOCUS_01280 149447 150328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 150654 150433 gene locus_tag LOCUS_01290 150654 150433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 151688 151419 gene locus_tag LOCUS_01300 151688 151419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01300 153077 151737 gene locus_tag LOCUS_01310 153077 151737 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01310 153441 153992 gene locus_tag LOCUS_01320 153441 153992 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057873.1 protein_id gnl|my_center|LOCUS_01320 153989 155341 gene locus_tag LOCUS_01330 153989 155341 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056064.1 protein_id gnl|my_center|LOCUS_01330 155331 155741 gene locus_tag LOCUS_01340 155331 155741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 157444 155810 gene locus_tag LOCUS_01350 157444 155810 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_01350 160761 157792 gene locus_tag LOCUS_01360 gene pruA 160761 157792 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056271.1 protein_id gnl|my_center|LOCUS_01360 161601 162755 gene locus_tag LOCUS_01370 161601 162755 CDS product NAD(P)H-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057128.1 protein_id gnl|my_center|LOCUS_01370 166006 163865 gene locus_tag LOCUS_01380 166006 163865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 166209 166481 gene locus_tag LOCUS_01390 166209 166481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 166877 167311 gene locus_tag LOCUS_01400 166877 167311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 167347 167475 gene locus_tag LOCUS_01410 167347 167475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 167509 168021 gene locus_tag LOCUS_01420 167509 168021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01420 168429 170777 gene locus_tag LOCUS_01430 168429 170777 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096663323.1 protein_id gnl|my_center|LOCUS_01430 170774 171241 gene locus_tag LOCUS_01440 170774 171241 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_01440 171280 171927 gene locus_tag LOCUS_01450 171280 171927 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140508.1 protein_id gnl|my_center|LOCUS_01450 172133 172780 gene locus_tag LOCUS_01460 172133 172780 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140508.1 protein_id gnl|my_center|LOCUS_01460 173082 174710 gene locus_tag LOCUS_01470 173082 174710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 175383 174667 gene locus_tag LOCUS_01480 175383 174667 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_01480 176596 176357 gene locus_tag LOCUS_01490 176596 176357 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809228.1 protein_id gnl|my_center|LOCUS_01490 177072 176917 gene locus_tag LOCUS_01500 177072 176917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 177595 177188 gene locus_tag LOCUS_01510 177595 177188 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142874.1 protein_id gnl|my_center|LOCUS_01510 177981 177595 gene locus_tag LOCUS_01520 177981 177595 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057973.1 protein_id gnl|my_center|LOCUS_01520 178241 178026 gene locus_tag LOCUS_01530 178241 178026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 178552 179553 gene locus_tag LOCUS_01540 178552 179553 CDS product saccharopine dehydrogenase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928537.1 protein_id gnl|my_center|LOCUS_01540 180476 179550 gene locus_tag LOCUS_01550 180476 179550 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057378.1 protein_id gnl|my_center|LOCUS_01550 182299 181211 gene locus_tag LOCUS_01560 182299 181211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 183300 182554 gene locus_tag LOCUS_01570 183300 182554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140907.1 protein_id gnl|my_center|LOCUS_01570 184394 184041 gene locus_tag LOCUS_01580 184394 184041 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_01580 184678 185067 gene locus_tag LOCUS_01590 184678 185067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 185369 185725 gene locus_tag LOCUS_01600 185369 185725 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986038.1 protein_id gnl|my_center|LOCUS_01600 186192 185926 gene locus_tag LOCUS_01610 186192 185926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 186412 190287 gene locus_tag LOCUS_01620 186412 190287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 190541 190882 gene locus_tag LOCUS_01630 190541 190882 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_01630 191238 191020 gene locus_tag LOCUS_01640 191238 191020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 192975 191503 gene locus_tag LOCUS_01650 192975 191503 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548475.1 protein_id gnl|my_center|LOCUS_01650 194559 193639 gene locus_tag LOCUS_01660 194559 193639 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143980.1 protein_id gnl|my_center|LOCUS_01660 194706 195389 gene locus_tag LOCUS_01670 194706 195389 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633409.1 protein_id gnl|my_center|LOCUS_01670 195726 196166 gene locus_tag LOCUS_01680 195726 196166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 197321 196524 gene locus_tag LOCUS_01690 197321 196524 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223173767.1 protein_id gnl|my_center|LOCUS_01690 197602 198606 gene locus_tag LOCUS_01700 197602 198606 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057527.1 protein_id gnl|my_center|LOCUS_01700 199065 198622 gene locus_tag LOCUS_01710 199065 198622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 199391 199062 gene locus_tag LOCUS_01720 199391 199062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 199986 199447 gene locus_tag LOCUS_01730 199986 199447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 200361 201056 gene locus_tag LOCUS_01740 200361 201056 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056123.1 protein_id gnl|my_center|LOCUS_01740 201910 201512 gene locus_tag LOCUS_01750 201910 201512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 202788 201982 gene locus_tag LOCUS_01760 202788 201982 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_01760 203398 204696 gene locus_tag LOCUS_01770 203398 204696 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_01770 204712 205764 gene locus_tag LOCUS_01780 gene metX 204712 205764 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932292.1 protein_id gnl|my_center|LOCUS_01780 205855 207273 gene locus_tag LOCUS_01790 205855 207273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 207270 207857 gene locus_tag LOCUS_01800 207270 207857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 208083 207871 gene locus_tag LOCUS_01810 208083 207871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 210477 208327 gene locus_tag LOCUS_01820 210477 208327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 211418 210780 gene locus_tag LOCUS_01830 211418 210780 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948539.1 protein_id gnl|my_center|LOCUS_01830 212024 211449 gene locus_tag LOCUS_01840 212024 211449 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142793.1 protein_id gnl|my_center|LOCUS_01840 212857 212183 gene locus_tag LOCUS_01850 212857 212183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 213611 213075 gene locus_tag LOCUS_01860 213611 213075 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929789.1 protein_id gnl|my_center|LOCUS_01860 214785 213838 gene locus_tag LOCUS_01870 gene cysK 214785 213838 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056355.1 protein_id gnl|my_center|LOCUS_01870 215453 215974 gene locus_tag LOCUS_01880 215453 215974 CDS product phycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057792.1 protein_id gnl|my_center|LOCUS_01880 216030 216521 gene locus_tag LOCUS_01890 gene cpcA 216030 216521 CDS product phycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057793.1 protein_id gnl|my_center|LOCUS_01890 217944 216946 gene locus_tag LOCUS_01900 217944 216946 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876261.1 protein_id gnl|my_center|LOCUS_01900 218724 218056 gene locus_tag LOCUS_01910 218724 218056 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 protein_id gnl|my_center|LOCUS_01910 219101 218721 gene locus_tag LOCUS_01920 219101 218721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 220673 219591 gene locus_tag LOCUS_01930 220673 219591 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_01930 221327 221121 gene locus_tag LOCUS_01940 221327 221121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 222090 221719 gene locus_tag LOCUS_01950 222090 221719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 222362 222087 gene locus_tag LOCUS_01960 222362 222087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327108.1 protein_id gnl|my_center|LOCUS_01960 222756 224414 gene locus_tag LOCUS_01970 222756 224414 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_01970 224756 224932 gene locus_tag LOCUS_01980 224756 224932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 225660 225133 gene locus_tag LOCUS_01990 225660 225133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 227017 225689 gene locus_tag LOCUS_02000 227017 225689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 227567 227217 gene locus_tag LOCUS_02010 227567 227217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 227916 227551 gene locus_tag LOCUS_02020 227916 227551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 228658 228248 gene locus_tag LOCUS_02030 228658 228248 CDS product aegerolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101225.1 protein_id gnl|my_center|LOCUS_02030 229385 229170 gene locus_tag LOCUS_02040 229385 229170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 229330 231660 gene locus_tag LOCUS_02050 229330 231660 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057757.1 protein_id gnl|my_center|LOCUS_02050 232201 231860 gene locus_tag LOCUS_02060 232201 231860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 232214 233179 gene locus_tag LOCUS_02070 232214 233179 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056369.1 protein_id gnl|my_center|LOCUS_02070 233217 233432 gene locus_tag LOCUS_02080 233217 233432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 235750 233864 gene locus_tag LOCUS_02090 gene ftsH2 235750 233864 CDS product ATP-dependent zinc metalloprotease FtsH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056581.1 protein_id gnl|my_center|LOCUS_02090 236028 237224 gene locus_tag LOCUS_02100 236028 237224 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_02100 237518 238450 gene locus_tag LOCUS_02110 237518 238450 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259191.1 protein_id gnl|my_center|LOCUS_02110 239007 238708 gene locus_tag LOCUS_02120 239007 238708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 240035 239388 gene locus_tag LOCUS_02130 240035 239388 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057176.1 protein_id gnl|my_center|LOCUS_02130 240303 240004 gene locus_tag LOCUS_02140 240303 240004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 240553 240918 gene locus_tag LOCUS_02150 240553 240918 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055968.1 protein_id gnl|my_center|LOCUS_02150 240928 241353 gene locus_tag LOCUS_02160 240928 241353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 241403 241903 gene locus_tag LOCUS_02170 241403 241903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 242079 242807 gene locus_tag LOCUS_02180 gene lptB 242079 242807 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045053120.1 protein_id gnl|my_center|LOCUS_02180 242839 244008 gene locus_tag LOCUS_02190 242839 244008 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140933.1 protein_id gnl|my_center|LOCUS_02190 244884 244045 gene locus_tag LOCUS_02200 gene rsmI 244884 244045 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057354.1 protein_id gnl|my_center|LOCUS_02200 245325 247718 gene locus_tag LOCUS_02210 245325 247718 CDS product DUF3769 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015184012.1 protein_id gnl|my_center|LOCUS_02210 251579 247839 gene locus_tag LOCUS_02220 251579 247839 CDS product NB-ARC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530011.1 protein_id gnl|my_center|LOCUS_02220 252229 251684 gene locus_tag LOCUS_02230 252229 251684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 252726 252328 gene locus_tag LOCUS_02240 252726 252328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 253748 252747 gene locus_tag LOCUS_02250 253748 252747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 253999 253754 gene locus_tag LOCUS_02260 253999 253754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 254258 253992 gene locus_tag LOCUS_02270 254258 253992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 257143 254273 gene locus_tag LOCUS_02280 257143 254273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 257598 257149 gene locus_tag LOCUS_02290 257598 257149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 257986 257624 gene locus_tag LOCUS_02300 257986 257624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 258525 258043 gene locus_tag LOCUS_02310 258525 258043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 258805 258563 gene locus_tag LOCUS_02320 258805 258563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 259393 258851 gene locus_tag LOCUS_02330 259393 258851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 260530 259715 gene locus_tag LOCUS_02340 260530 259715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 261101 262618 gene locus_tag LOCUS_02350 261101 262618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 262611 263927 gene locus_tag LOCUS_02360 262611 263927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 264043 266742 gene locus_tag LOCUS_02370 264043 266742 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888895.1 protein_id gnl|my_center|LOCUS_02370 266917 266762 gene locus_tag LOCUS_02380 266917 266762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 267164 266907 gene locus_tag LOCUS_02390 267164 266907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 267523 267275 gene locus_tag LOCUS_02400 267523 267275 CDS product Ycf34 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058288.1 protein_id gnl|my_center|LOCUS_02400 267618 268862 gene locus_tag LOCUS_02410 267618 268862 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056562.1 protein_id gnl|my_center|LOCUS_02410 269753 269304 gene locus_tag LOCUS_02420 269753 269304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 270918 270100 gene locus_tag LOCUS_02430 270918 270100 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 protein_id gnl|my_center|LOCUS_02430 271005 271637 gene locus_tag LOCUS_02440 gene mtnX 271005 271637 CDS product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245748.1 protein_id gnl|my_center|LOCUS_02440 272267 272638 gene locus_tag LOCUS_02450 272267 272638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 273720 272605 gene locus_tag LOCUS_02460 273720 272605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 274808 274434 gene locus_tag LOCUS_02470 274808 274434 CDS product clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327109.1 protein_id gnl|my_center|LOCUS_02470 275083 274808 gene locus_tag LOCUS_02480 275083 274808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327108.1 protein_id gnl|my_center|LOCUS_02480 275445 275729 gene locus_tag LOCUS_02490 275445 275729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 275726 276178 gene locus_tag LOCUS_02500 275726 276178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 276278 276520 gene locus_tag LOCUS_02510 276278 276520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 276745 276954 gene locus_tag LOCUS_02520 276745 276954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 277062 277580 gene locus_tag LOCUS_02530 277062 277580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02530 279181 280905 gene locus_tag LOCUS_02540 279181 280905 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056931.1 protein_id gnl|my_center|LOCUS_02540 281039 281539 gene locus_tag LOCUS_02550 281039 281539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 281813 283558 gene locus_tag LOCUS_02560 281813 283558 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057213.1 protein_id gnl|my_center|LOCUS_02560 283728 284405 gene locus_tag LOCUS_02570 283728 284405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 284411 284683 gene locus_tag LOCUS_02580 284411 284683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920941.1 protein_id gnl|my_center|LOCUS_02580 285014 285757 gene locus_tag LOCUS_02590 285014 285757 CDS product DUF1995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058055.1 protein_id gnl|my_center|LOCUS_02590 290437 285800 gene locus_tag LOCUS_02600 290437 285800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 291418 290654 gene locus_tag LOCUS_02610 291418 290654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 292078 295869 gene locus_tag LOCUS_02620 292078 295869 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766276.1 protein_id gnl|my_center|LOCUS_02620 296882 296208 gene locus_tag LOCUS_02630 gene bioD 296882 296208 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406219.1 protein_id gnl|my_center|LOCUS_02630 297205 298983 gene locus_tag LOCUS_02640 gene ilvB 297205 298983 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057136.1 protein_id gnl|my_center|LOCUS_02640 299196 300656 gene locus_tag LOCUS_02650 299196 300656 CDS product IS4-like element ISGvi2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140150.1 protein_id gnl|my_center|LOCUS_02650 301068 302645 gene locus_tag LOCUS_02660 gene serA 301068 302645 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056180.1 protein_id gnl|my_center|LOCUS_02660 303026 303922 gene locus_tag LOCUS_02670 gene prmA 303026 303922 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056181.1 protein_id gnl|my_center|LOCUS_02670 304190 305398 gene locus_tag LOCUS_02680 304190 305398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 305510 305436 gene locus_tag LOCUS_t00020 305510 305436 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 305566 306378 gene locus_tag LOCUS_02690 gene surE 305566 306378 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057623.1 protein_id gnl|my_center|LOCUS_02690 306426 307007 gene locus_tag LOCUS_02700 306426 307007 CDS product DUF3727 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141131.1 protein_id gnl|my_center|LOCUS_02700 307143 307364 gene locus_tag LOCUS_02710 307143 307364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 307555 307887 gene locus_tag LOCUS_02720 307555 307887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 308232 307921 gene locus_tag LOCUS_02730 308232 307921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 308589 309590 gene locus_tag LOCUS_02740 308589 309590 CDS product LdpA C-terminal domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056586.1 protein_id gnl|my_center|LOCUS_02740 309708 311453 gene locus_tag LOCUS_02750 309708 311453 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056587.1 protein_id gnl|my_center|LOCUS_02750 311465 312892 gene locus_tag LOCUS_02760 311465 312892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 313522 313094 gene locus_tag LOCUS_02770 313522 313094 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 protein_id gnl|my_center|LOCUS_02770 313832 313527 gene locus_tag LOCUS_02780 313832 313527 CDS product DUF3007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056554.1 protein_id gnl|my_center|LOCUS_02780 314091 313852 gene locus_tag LOCUS_02790 gene ndhL 314091 313852 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056553.1 protein_id gnl|my_center|LOCUS_02790 314264 314349 gene locus_tag LOCUS_t00030 314264 314349 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 315075 314437 gene locus_tag LOCUS_02800 315075 314437 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025687389.1 protein_id gnl|my_center|LOCUS_02800 316012 315065 gene locus_tag LOCUS_02810 gene queG 316012 315065 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920720.1 protein_id gnl|my_center|LOCUS_02810 316462 317520 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 317855 318520 gene locus_tag LOCUS_02820 317855 318520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 318916 320373 gene locus_tag LOCUS_02830 gene lpdA 318916 320373 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920772.1 protein_id gnl|my_center|LOCUS_02830 320472 320648 gene locus_tag LOCUS_02840 320472 320648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 322174 320774 gene locus_tag LOCUS_02850 322174 320774 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929201.1 protein_id gnl|my_center|LOCUS_02850 325557 322312 gene locus_tag LOCUS_02860 gene carB 325557 322312 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058165.1 protein_id gnl|my_center|LOCUS_02860 325846 326886 gene locus_tag LOCUS_02870 325846 326886 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920837.1 protein_id gnl|my_center|LOCUS_02870 327365 326958 gene locus_tag LOCUS_02880 327365 326958 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056937.1 protein_id gnl|my_center|LOCUS_02880 327880 327374 gene locus_tag LOCUS_02890 327880 327374 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920769.1 protein_id gnl|my_center|LOCUS_02890 328089 329330 gene locus_tag LOCUS_02900 328089 329330 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056850.1 protein_id gnl|my_center|LOCUS_02900 329330 329767 gene locus_tag LOCUS_02910 gene ruvX 329330 329767 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058162.1 protein_id gnl|my_center|LOCUS_02910 331087 329825 gene locus_tag LOCUS_02920 331087 329825 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058010.1 protein_id gnl|my_center|LOCUS_02920 332220 331405 gene locus_tag LOCUS_02930 332220 331405 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_02930 333599 332376 gene locus_tag LOCUS_02940 333599 332376 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920968.1 protein_id gnl|my_center|LOCUS_02940 333719 334552 gene locus_tag LOCUS_02950 333719 334552 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921038.1 protein_id gnl|my_center|LOCUS_02950 335220 336392 gene locus_tag LOCUS_02960 gene dxr 335220 336392 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921140.1 protein_id gnl|my_center|LOCUS_02960 337146 338441 gene locus_tag LOCUS_02970 337146 338441 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442178.1 protein_id gnl|my_center|LOCUS_02970 338457 339128 gene locus_tag LOCUS_02980 338457 339128 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057523.1 protein_id gnl|my_center|LOCUS_02980 339391 339191 gene locus_tag LOCUS_02990 339391 339191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 339781 339497 gene locus_tag LOCUS_03000 339781 339497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 340956 339781 gene locus_tag LOCUS_03010 340956 339781 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065470411.1 protein_id gnl|my_center|LOCUS_03010 341200 342477 gene locus_tag LOCUS_03020 gene ahcY 341200 342477 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058222.1 protein_id gnl|my_center|LOCUS_03020 342643 343248 gene locus_tag LOCUS_03030 342643 343248 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 protein_id gnl|my_center|LOCUS_03030 344276 344058 gene locus_tag LOCUS_03040 344276 344058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 344401 344598 gene locus_tag LOCUS_03050 344401 344598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 345652 344705 gene locus_tag LOCUS_03060 345652 344705 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056240.1 protein_id gnl|my_center|LOCUS_03060 347360 345852 gene locus_tag LOCUS_03070 gene atpA 347360 345852 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056290.1 protein_id gnl|my_center|LOCUS_03070 347977 347429 gene locus_tag LOCUS_03080 gene atpH 347977 347429 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056289.1 protein_id gnl|my_center|LOCUS_03080 348520 347978 gene locus_tag LOCUS_03090 348520 347978 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524128.1 protein_id gnl|my_center|LOCUS_03090 349085 348654 gene locus_tag LOCUS_03100 349085 348654 CDS product F0F1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056287.1 protein_id gnl|my_center|LOCUS_03100 349561 349316 gene locus_tag LOCUS_03110 gene atpE 349561 349316 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125083.1 protein_id gnl|my_center|LOCUS_03110 350541 349792 gene locus_tag LOCUS_03120 gene atpB 350541 349792 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056285.1 protein_id gnl|my_center|LOCUS_03120 350962 350600 gene locus_tag LOCUS_03130 350962 350600 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920689.1 protein_id gnl|my_center|LOCUS_03130 352027 351587 gene locus_tag LOCUS_03140 352027 351587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 353308 352175 gene locus_tag LOCUS_03150 353308 352175 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339450.1 protein_id gnl|my_center|LOCUS_03150 353528 354718 gene locus_tag LOCUS_03160 353528 354718 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228024.1 protein_id gnl|my_center|LOCUS_03160 354731 355447 gene locus_tag LOCUS_03170 gene fabG 354731 355447 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106013.1 protein_id gnl|my_center|LOCUS_03170 355551 356546 gene locus_tag LOCUS_03180 gene phaE 355551 356546 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037306.1 protein_id gnl|my_center|LOCUS_03180 356732 357826 gene locus_tag LOCUS_03190 356732 357826 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_03190 358075 359292 gene locus_tag LOCUS_03200 gene chlP 358075 359292 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056005.1 protein_id gnl|my_center|LOCUS_03200 359454 360641 gene locus_tag LOCUS_03210 359454 360641 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_03210 360910 362040 gene locus_tag LOCUS_03220 360910 362040 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142948.1 protein_id gnl|my_center|LOCUS_03220 362806 362030 gene locus_tag LOCUS_03230 362806 362030 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142947.1 protein_id gnl|my_center|LOCUS_03230 364177 363293 gene locus_tag LOCUS_03240 364177 363293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 364325 365146 gene locus_tag LOCUS_03250 364325 365146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 365458 365243 gene locus_tag LOCUS_03260 365458 365243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057807.1 protein_id gnl|my_center|LOCUS_03260 366514 365861 gene locus_tag LOCUS_03270 366514 365861 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889576.1 protein_id gnl|my_center|LOCUS_03270 367455 366529 gene locus_tag LOCUS_03280 367455 366529 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143466.1 protein_id gnl|my_center|LOCUS_03280 367658 368854 gene locus_tag LOCUS_03290 367658 368854 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058195.1 protein_id gnl|my_center|LOCUS_03290 369097 368843 gene locus_tag LOCUS_03300 369097 368843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 370403 369141 gene locus_tag LOCUS_03310 370403 369141 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166117.1 protein_id gnl|my_center|LOCUS_03310 371073 370405 gene locus_tag LOCUS_03320 gene lipB 371073 370405 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056676.1 protein_id gnl|my_center|LOCUS_03320 371149 371649 gene locus_tag LOCUS_03330 371149 371649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 373034 371700 gene locus_tag LOCUS_03340 373034 371700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 373404 373063 gene locus_tag LOCUS_03350 373404 373063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 373944 373453 gene locus_tag LOCUS_03360 373944 373453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057012.1 protein_id gnl|my_center|LOCUS_03360 376178 374967 gene locus_tag LOCUS_03370 376178 374967 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162850918.1 protein_id gnl|my_center|LOCUS_03370 377962 376715 gene locus_tag LOCUS_03380 gene trpB 377962 376715 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058306.1 protein_id gnl|my_center|LOCUS_03380 380669 378099 gene locus_tag LOCUS_03390 380669 378099 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058103.1 protein_id gnl|my_center|LOCUS_03390 381108 381389 gene locus_tag LOCUS_03400 381108 381389 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_03400 381400 381714 gene locus_tag LOCUS_03410 381400 381714 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939018.1 protein_id gnl|my_center|LOCUS_03410 382395 382141 gene locus_tag LOCUS_03420 382395 382141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 382780 382559 gene locus_tag LOCUS_03430 382780 382559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 383010 382783 gene locus_tag LOCUS_03440 383010 382783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 383592 383278 gene locus_tag LOCUS_03450 383592 383278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03450 384306 383701 gene locus_tag LOCUS_03460 384306 383701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03460 384853 384443 gene locus_tag LOCUS_03470 384853 384443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 385555 384881 gene locus_tag LOCUS_03480 385555 384881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 387383 386157 gene locus_tag LOCUS_03490 387383 386157 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143728.1 protein_id gnl|my_center|LOCUS_03490 387395 388288 gene locus_tag LOCUS_03500 387395 388288 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056446.1 protein_id gnl|my_center|LOCUS_03500 391513 388397 gene locus_tag LOCUS_03510 391513 388397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 391974 392204 gene locus_tag LOCUS_03520 391974 392204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 396168 392380 gene locus_tag LOCUS_03530 396168 392380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 396702 396298 gene locus_tag LOCUS_03540 396702 396298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 >Feature sequence02 784 194 gene locus_tag LOCUS_03550 784 194 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048752389.1 protein_id gnl|my_center|LOCUS_03550 1224 784 gene locus_tag LOCUS_03560 1224 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 2479 1397 gene locus_tag LOCUS_03570 2479 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 3077 3310 gene locus_tag LOCUS_03580 3077 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 3597 4037 gene locus_tag LOCUS_03590 3597 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 4045 6249 gene locus_tag LOCUS_03600 4045 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 6534 6328 gene locus_tag LOCUS_03610 6534 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 6765 7376 gene locus_tag LOCUS_03620 6765 7376 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_03620 7723 7469 gene locus_tag LOCUS_03630 7723 7469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 9002 7794 gene locus_tag LOCUS_03640 9002 7794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 9528 9082 gene locus_tag LOCUS_03650 9528 9082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 9679 10617 gene locus_tag LOCUS_03660 9679 10617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_03660 10703 11572 gene locus_tag LOCUS_03670 10703 11572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_03670 11851 13929 gene locus_tag LOCUS_03680 gene glgX 11851 13929 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706229.1 protein_id gnl|my_center|LOCUS_03680 14045 14806 gene locus_tag LOCUS_03690 14045 14806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 14853 16151 gene locus_tag LOCUS_03700 gene eno 14853 16151 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056505.1 protein_id gnl|my_center|LOCUS_03700 16719 16357 gene locus_tag LOCUS_03710 16719 16357 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_03710 17025 18221 gene locus_tag LOCUS_03720 17025 18221 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_03720 18373 18540 gene locus_tag LOCUS_03730 18373 18540 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390272.1 protein_id gnl|my_center|LOCUS_03730 19198 18809 gene locus_tag LOCUS_03740 19198 18809 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058006.1 protein_id gnl|my_center|LOCUS_03740 19499 19942 gene locus_tag LOCUS_03750 19499 19942 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056024.1 protein_id gnl|my_center|LOCUS_03750 19956 20363 gene locus_tag LOCUS_03760 19956 20363 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530041.1 protein_id gnl|my_center|LOCUS_03760 20366 21346 gene locus_tag LOCUS_03770 gene cbiB 20366 21346 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058209.1 protein_id gnl|my_center|LOCUS_03770 21661 21287 gene locus_tag LOCUS_03780 21661 21287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 22739 22095 gene locus_tag LOCUS_03790 22739 22095 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055897.1 protein_id gnl|my_center|LOCUS_03790 23151 23351 gene locus_tag LOCUS_03800 23151 23351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 24184 23687 gene locus_tag LOCUS_03810 24184 23687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03810 24653 24204 gene locus_tag LOCUS_03820 24653 24204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 25000 26163 gene locus_tag LOCUS_03830 25000 26163 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_03830 26522 26917 gene locus_tag LOCUS_03840 26522 26917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 27295 27966 gene locus_tag LOCUS_03850 27295 27966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 28012 28656 gene locus_tag LOCUS_03860 28012 28656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 29847 29125 gene locus_tag LOCUS_03870 29847 29125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 30115 29894 gene locus_tag LOCUS_03880 30115 29894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 30652 31647 gene locus_tag LOCUS_03890 30652 31647 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143724.1 protein_id gnl|my_center|LOCUS_03890 32040 32303 gene locus_tag LOCUS_03900 32040 32303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 32304 32771 gene locus_tag LOCUS_03910 32304 32771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 33221 33481 gene locus_tag LOCUS_03920 33221 33481 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587616.1 protein_id gnl|my_center|LOCUS_03920 33474 33740 gene locus_tag LOCUS_03930 33474 33740 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_03930 34473 34138 gene locus_tag LOCUS_03940 34473 34138 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_03940 34728 34474 gene locus_tag LOCUS_03950 34728 34474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 35521 35153 gene locus_tag LOCUS_03960 35521 35153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 35797 36042 gene locus_tag LOCUS_03970 35797 36042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 36035 36244 gene locus_tag LOCUS_03980 36035 36244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 36551 36838 gene locus_tag LOCUS_03990 36551 36838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 36871 37188 gene locus_tag LOCUS_04000 36871 37188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 37438 37779 gene locus_tag LOCUS_04010 37438 37779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 37767 37964 gene locus_tag LOCUS_04020 37767 37964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 38308 38234 gene locus_tag LOCUS_t00040 38308 38234 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 39503 38364 gene locus_tag LOCUS_04030 39503 38364 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928444.1 protein_id gnl|my_center|LOCUS_04030 39702 40460 gene locus_tag LOCUS_04040 39702 40460 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140639.1 protein_id gnl|my_center|LOCUS_04040 40707 40477 gene locus_tag LOCUS_04050 gene yidD 40707 40477 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229076.1 protein_id gnl|my_center|LOCUS_04050 40763 41449 gene locus_tag LOCUS_04060 40763 41449 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143139.1 protein_id gnl|my_center|LOCUS_04060 41687 42559 gene locus_tag LOCUS_04070 41687 42559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142558.1 protein_id gnl|my_center|LOCUS_04070 42623 42694 gene locus_tag LOCUS_t00050 42623 42694 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 42724 43326 gene locus_tag LOCUS_04080 gene tsaB 42724 43326 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055917.1 protein_id gnl|my_center|LOCUS_04080 43386 44159 gene locus_tag LOCUS_04090 gene cysE 43386 44159 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056695.1 protein_id gnl|my_center|LOCUS_04090 44361 47273 gene locus_tag LOCUS_04100 gene uvrA 44361 47273 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524117.1 protein_id gnl|my_center|LOCUS_04100 48006 47230 gene locus_tag LOCUS_04110 48006 47230 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205364.1 protein_id gnl|my_center|LOCUS_04110 48283 47999 gene locus_tag LOCUS_04120 48283 47999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 48533 48829 gene locus_tag LOCUS_04130 48533 48829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 48836 49240 gene locus_tag LOCUS_04140 48836 49240 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047368852.1 protein_id gnl|my_center|LOCUS_04140 49472 49957 gene locus_tag LOCUS_04150 49472 49957 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_04150 50063 50962 gene locus_tag LOCUS_04160 50063 50962 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 protein_id gnl|my_center|LOCUS_04160 51116 51880 gene locus_tag LOCUS_04170 gene fabG 51116 51880 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057342.1 protein_id gnl|my_center|LOCUS_04170 52261 53028 gene locus_tag LOCUS_04180 52261 53028 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920648.1 protein_id gnl|my_center|LOCUS_04180 53060 53797 gene locus_tag LOCUS_04190 53060 53797 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975024.1 protein_id gnl|my_center|LOCUS_04190 53917 54336 gene locus_tag LOCUS_04200 53917 54336 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920771.1 protein_id gnl|my_center|LOCUS_04200 54329 55216 gene locus_tag LOCUS_04210 54329 55216 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056486.1 protein_id gnl|my_center|LOCUS_04210 55195 55279 gene locus_tag LOCUS_t00060 55195 55279 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 56346 55405 gene locus_tag LOCUS_04220 56346 55405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 56834 57055 gene locus_tag LOCUS_04230 56834 57055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 57590 58834 gene locus_tag LOCUS_04240 gene dcm 57590 58834 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963014.1 protein_id gnl|my_center|LOCUS_04240 59469 59005 gene locus_tag LOCUS_04250 59469 59005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920763.1 protein_id gnl|my_center|LOCUS_04250 59655 61124 gene locus_tag LOCUS_04260 59655 61124 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056379.1 protein_id gnl|my_center|LOCUS_04260 61127 61717 gene locus_tag LOCUS_04270 61127 61717 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036612.1 protein_id gnl|my_center|LOCUS_04270 61947 63290 gene locus_tag LOCUS_04280 61947 63290 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920812.1 protein_id gnl|my_center|LOCUS_04280 64092 63655 gene locus_tag LOCUS_04290 64092 63655 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_04290 64820 66934 gene locus_tag LOCUS_04300 64820 66934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 67924 67058 gene locus_tag LOCUS_04310 67924 67058 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057619.1 protein_id gnl|my_center|LOCUS_04310 68925 67924 gene locus_tag LOCUS_04320 68925 67924 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_04320 70518 69040 gene locus_tag LOCUS_04330 70518 69040 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 protein_id gnl|my_center|LOCUS_04330 71582 70518 gene locus_tag LOCUS_04340 71582 70518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 72162 71683 gene locus_tag LOCUS_04350 72162 71683 CDS product IS607-like element ISTko1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04350 72445 73113 gene locus_tag LOCUS_04360 72445 73113 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056639.1 protein_id gnl|my_center|LOCUS_04360 73165 73647 gene locus_tag LOCUS_04370 gene petD 73165 73647 CDS product cytochrome b6-f complex subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056640.1 protein_id gnl|my_center|LOCUS_04370 74763 73954 gene locus_tag LOCUS_04380 74763 73954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 75257 75033 gene locus_tag LOCUS_04390 75257 75033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 77617 75977 gene locus_tag LOCUS_04400 gene hmpF 77617 75977 CDS product pilus motility taxis protein HmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058194.1 protein_id gnl|my_center|LOCUS_04400 78927 77596 gene locus_tag LOCUS_04410 78927 77596 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_04410 80441 80806 gene locus_tag LOCUS_04420 80441 80806 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_04420 80898 81428 gene locus_tag LOCUS_04430 80898 81428 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056202.1 protein_id gnl|my_center|LOCUS_04430 81518 84196 gene locus_tag LOCUS_04440 81518 84196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 84270 85481 gene locus_tag LOCUS_04450 84270 85481 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056224.1 protein_id gnl|my_center|LOCUS_04450 85928 87265 gene locus_tag LOCUS_04460 85928 87265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 93070 87287 gene locus_tag LOCUS_04470 93070 87287 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_04470 94522 93143 gene locus_tag LOCUS_04480 94522 93143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 95263 94607 gene locus_tag LOCUS_04490 95263 94607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 96372 95287 gene locus_tag LOCUS_04500 96372 95287 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225697.1 protein_id gnl|my_center|LOCUS_04500 96742 96939 gene locus_tag LOCUS_04510 96742 96939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 96923 97201 gene locus_tag LOCUS_04520 96923 97201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 97479 97264 gene locus_tag LOCUS_04530 97479 97264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 97802 97476 gene locus_tag LOCUS_04540 97802 97476 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393300.1 protein_id gnl|my_center|LOCUS_04540 98228 100183 gene locus_tag LOCUS_04550 98228 100183 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816805.1 protein_id gnl|my_center|LOCUS_04550 100202 100516 gene locus_tag LOCUS_04560 100202 100516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 100726 100896 gene locus_tag LOCUS_04570 100726 100896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 101070 101249 gene locus_tag LOCUS_04580 101070 101249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 101445 101624 gene locus_tag LOCUS_04590 101445 101624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 101782 102228 gene locus_tag LOCUS_04600 101782 102228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 102269 103363 gene locus_tag LOCUS_04610 102269 103363 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530370.1 protein_id gnl|my_center|LOCUS_04610 104025 103693 gene locus_tag LOCUS_04620 104025 103693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 104171 103983 gene locus_tag LOCUS_04630 104171 103983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 104542 104168 gene locus_tag LOCUS_04640 104542 104168 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081150.1 protein_id gnl|my_center|LOCUS_04640 104822 105109 gene locus_tag LOCUS_04650 104822 105109 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010699606.1 protein_id gnl|my_center|LOCUS_04650 105087 105359 gene locus_tag LOCUS_04660 105087 105359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 105624 105914 gene locus_tag LOCUS_04670 105624 105914 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038219.1 protein_id gnl|my_center|LOCUS_04670 105911 106405 gene locus_tag LOCUS_04680 105911 106405 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530563.1 protein_id gnl|my_center|LOCUS_04680 107039 106557 gene locus_tag LOCUS_04690 107039 106557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 107410 107036 gene locus_tag LOCUS_04700 107410 107036 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081150.1 protein_id gnl|my_center|LOCUS_04700 107780 108001 gene locus_tag LOCUS_04710 107780 108001 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142023.1 protein_id gnl|my_center|LOCUS_04710 108018 108236 gene locus_tag LOCUS_04720 108018 108236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 108233 108616 gene locus_tag LOCUS_04730 108233 108616 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_04730 108938 109282 gene locus_tag LOCUS_04740 108938 109282 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296467.1 protein_id gnl|my_center|LOCUS_04740 109285 109584 gene locus_tag LOCUS_04750 109285 109584 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838298.1 protein_id gnl|my_center|LOCUS_04750 111916 109619 gene locus_tag LOCUS_04760 111916 109619 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227744.1 protein_id gnl|my_center|LOCUS_04760 112487 112861 gene locus_tag LOCUS_04770 112487 112861 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057533.1 protein_id gnl|my_center|LOCUS_04770 113034 113960 gene locus_tag LOCUS_04780 113034 113960 CDS product photosynthesis system II assembly factor Ycf48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057532.1 protein_id gnl|my_center|LOCUS_04780 114039 114284 gene locus_tag LOCUS_04790 gene psbE 114039 114284 CDS product cytochrome b559 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057381.1 protein_id gnl|my_center|LOCUS_04790 114310 114444 gene locus_tag LOCUS_04800 gene psbF 114310 114444 CDS product cytochrome b559 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057382.1 protein_id gnl|my_center|LOCUS_04800 114617 114736 gene locus_tag LOCUS_04810 114617 114736 CDS product photosystem II reaction center protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071823295.1 protein_id gnl|my_center|LOCUS_04810 114941 114729 gene locus_tag LOCUS_04820 114941 114729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 116561 115035 gene locus_tag LOCUS_04830 gene psbB 116561 115035 CDS product photosystem II chlorophyll-binding protein CP47 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057370.1 protein_id gnl|my_center|LOCUS_04830 117249 116926 gene locus_tag LOCUS_04840 117249 116926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055877.1 protein_id gnl|my_center|LOCUS_04840 118077 117316 gene locus_tag LOCUS_04850 gene tatC 118077 117316 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141910.1 protein_id gnl|my_center|LOCUS_04850 118272 119258 gene locus_tag LOCUS_04860 gene nadA 118272 119258 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_04860 121074 119617 gene locus_tag LOCUS_04870 121074 119617 CDS product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140837.1 protein_id gnl|my_center|LOCUS_04870 123546 121234 gene locus_tag LOCUS_04880 123546 121234 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 protein_id gnl|my_center|LOCUS_04880 124342 125184 gene locus_tag LOCUS_04890 124342 125184 CDS product putative capsular polysaccharide synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478193.1 protein_id gnl|my_center|LOCUS_04890 125210 126511 gene locus_tag LOCUS_04900 125210 126511 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965385.1 protein_id gnl|my_center|LOCUS_04900 127147 127944 gene locus_tag LOCUS_04910 127147 127944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 128253 129086 gene locus_tag LOCUS_04920 128253 129086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 129120 130031 gene locus_tag LOCUS_04930 129120 130031 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140468.1 protein_id gnl|my_center|LOCUS_04930 130534 131472 gene locus_tag LOCUS_04940 130534 131472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 131552 132274 gene locus_tag LOCUS_04950 131552 132274 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407647.1 protein_id gnl|my_center|LOCUS_04950 132271 133551 gene locus_tag LOCUS_04960 132271 133551 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058221.1 protein_id gnl|my_center|LOCUS_04960 133622 133942 gene locus_tag LOCUS_04970 133622 133942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 134365 135027 gene locus_tag LOCUS_04980 134365 135027 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929453.1 protein_id gnl|my_center|LOCUS_04980 135942 136952 gene locus_tag LOCUS_04990 135942 136952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 137026 137907 gene locus_tag LOCUS_05000 137026 137907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 137925 138875 gene locus_tag LOCUS_05010 137925 138875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 138936 140012 gene locus_tag LOCUS_05020 138936 140012 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387716.1 protein_id gnl|my_center|LOCUS_05020 140064 141176 gene locus_tag LOCUS_05030 140064 141176 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_05030 141169 142068 gene locus_tag LOCUS_05040 141169 142068 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921254.1 protein_id gnl|my_center|LOCUS_05040 143107 144039 gene locus_tag LOCUS_05050 143107 144039 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793191.1 protein_id gnl|my_center|LOCUS_05050 144036 145010 gene locus_tag LOCUS_05060 144036 145010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 145055 146101 gene locus_tag LOCUS_05070 145055 146101 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478388.1 protein_id gnl|my_center|LOCUS_05070 146151 146822 gene locus_tag LOCUS_05080 146151 146822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 146929 147570 gene locus_tag LOCUS_05090 146929 147570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 147593 148372 gene locus_tag LOCUS_05100 147593 148372 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107719.1 protein_id gnl|my_center|LOCUS_05100 148393 149373 gene locus_tag LOCUS_05110 148393 149373 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433078.1 protein_id gnl|my_center|LOCUS_05110 152122 149396 gene locus_tag LOCUS_05120 152122 149396 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057097.1 protein_id gnl|my_center|LOCUS_05120 152571 152966 gene locus_tag LOCUS_05130 gene gcvH 152571 152966 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057515.1 protein_id gnl|my_center|LOCUS_05130 153126 154298 gene locus_tag LOCUS_05140 gene moeB 153126 154298 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058235.1 protein_id gnl|my_center|LOCUS_05140 154549 155136 gene locus_tag LOCUS_05150 154549 155136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 155739 155272 gene locus_tag LOCUS_05160 155739 155272 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_05160 156040 158790 gene locus_tag LOCUS_05170 156040 158790 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 protein_id gnl|my_center|LOCUS_05170 158943 159203 gene locus_tag LOCUS_05180 158943 159203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 159285 159665 gene locus_tag LOCUS_05190 159285 159665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 159662 160054 gene locus_tag LOCUS_05200 159662 160054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 160169 160405 gene locus_tag LOCUS_05210 160169 160405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 160402 160830 gene locus_tag LOCUS_05220 160402 160830 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_05220 161009 161437 gene locus_tag LOCUS_05230 161009 161437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 162715 161519 gene locus_tag LOCUS_05240 162715 161519 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_05240 164252 162948 gene locus_tag LOCUS_05250 164252 162948 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 protein_id gnl|my_center|LOCUS_05250 165965 164727 gene locus_tag LOCUS_05260 165965 164727 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057446.1 protein_id gnl|my_center|LOCUS_05260 167236 166157 gene locus_tag LOCUS_05270 gene fba 167236 166157 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056231.1 protein_id gnl|my_center|LOCUS_05270 168496 167369 gene locus_tag LOCUS_05280 168496 167369 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143741.1 protein_id gnl|my_center|LOCUS_05280 169251 168751 gene locus_tag LOCUS_05290 169251 168751 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920972.1 protein_id gnl|my_center|LOCUS_05290 170002 170610 gene locus_tag LOCUS_05300 gene rpsD 170002 170610 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056002.1 protein_id gnl|my_center|LOCUS_05300 170938 171219 gene locus_tag LOCUS_05310 170938 171219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 171718 171497 gene locus_tag LOCUS_05320 171718 171497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 173154 171946 gene locus_tag LOCUS_05330 173154 171946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 175774 173225 gene locus_tag LOCUS_05340 175774 173225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 176455 176018 gene locus_tag LOCUS_05350 176455 176018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 177138 176659 gene locus_tag LOCUS_05360 177138 176659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 178508 177531 gene locus_tag LOCUS_05370 178508 177531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 178702 180213 gene locus_tag LOCUS_05380 gene gpmI 178702 180213 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056006.1 protein_id gnl|my_center|LOCUS_05380 180733 180966 gene locus_tag LOCUS_05390 gene secG 180733 180966 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056943.1 protein_id gnl|my_center|LOCUS_05390 180967 181683 gene locus_tag LOCUS_05400 180967 181683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058125.1 protein_id gnl|my_center|LOCUS_05400 182154 181945 gene locus_tag LOCUS_05410 182154 181945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 184917 182455 gene locus_tag LOCUS_05420 184917 182455 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974867.1 protein_id gnl|my_center|LOCUS_05420 185948 184962 gene locus_tag LOCUS_05430 185948 184962 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045231753.1 protein_id gnl|my_center|LOCUS_05430 186319 188370 gene locus_tag LOCUS_05440 186319 188370 CDS product NAD(P)H-quinone oxidoreductase subunit 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056567.1 protein_id gnl|my_center|LOCUS_05440 188968 189774 gene locus_tag LOCUS_05450 188968 189774 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920880.1 protein_id gnl|my_center|LOCUS_05450 191449 190202 gene locus_tag LOCUS_05460 191449 190202 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143911.1 protein_id gnl|my_center|LOCUS_05460 191867 191460 gene locus_tag LOCUS_05470 191867 191460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057546.1 protein_id gnl|my_center|LOCUS_05470 192110 192039 gene locus_tag LOCUS_t00070 192110 192039 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 192461 192129 gene locus_tag LOCUS_05480 192461 192129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 192553 193740 gene locus_tag LOCUS_05490 192553 193740 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_05490 194383 193838 gene locus_tag LOCUS_05500 gene ribH 194383 193838 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055922.1 protein_id gnl|my_center|LOCUS_05500 194720 194532 gene locus_tag LOCUS_05510 194720 194532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 195538 195083 gene locus_tag LOCUS_05520 195538 195083 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112796.1 protein_id gnl|my_center|LOCUS_05520 195652 198348 gene locus_tag LOCUS_05530 195652 198348 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056370.1 protein_id gnl|my_center|LOCUS_05530 198731 198567 gene locus_tag LOCUS_05540 198731 198567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 199463 199167 gene locus_tag LOCUS_05550 199463 199167 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_05550 199922 202261 gene locus_tag LOCUS_05560 199922 202261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 202486 203490 gene locus_tag LOCUS_05570 gene pheS 202486 203490 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056537.1 protein_id gnl|my_center|LOCUS_05570 203504 203848 gene locus_tag LOCUS_05580 203504 203848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 203924 205042 gene locus_tag LOCUS_05590 203924 205042 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920975.1 protein_id gnl|my_center|LOCUS_05590 206018 205098 gene locus_tag LOCUS_05600 206018 205098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 206987 206313 gene locus_tag LOCUS_05610 206987 206313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05610 207407 207808 gene locus_tag LOCUS_05620 207407 207808 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_05620 208128 207913 gene locus_tag LOCUS_05630 208128 207913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 209750 208485 gene locus_tag LOCUS_05640 209750 208485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 209809 210984 gene locus_tag LOCUS_05650 209809 210984 CDS product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125209.1 protein_id gnl|my_center|LOCUS_05650 211043 211351 gene locus_tag LOCUS_05660 211043 211351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 212565 211429 gene locus_tag LOCUS_05670 212565 211429 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815068.1 protein_id gnl|my_center|LOCUS_05670 213141 212875 gene locus_tag LOCUS_05680 gene psaK 213141 212875 CDS product photosystem I reaction center subunit PsaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921012.1 protein_id gnl|my_center|LOCUS_05680 213522 213286 gene locus_tag LOCUS_05690 gene rpmB 213522 213286 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058293.1 protein_id gnl|my_center|LOCUS_05690 214199 213867 gene locus_tag LOCUS_05700 214199 213867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 214936 214196 gene locus_tag LOCUS_05710 214936 214196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 215415 218612 gene locus_tag LOCUS_05720 215415 218612 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_05720 219364 222180 gene locus_tag LOCUS_05730 gene secA 219364 222180 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057688.1 protein_id gnl|my_center|LOCUS_05730 222790 223977 gene locus_tag LOCUS_05740 222790 223977 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_05740 224002 224613 gene locus_tag LOCUS_05750 224002 224613 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224619.1 protein_id gnl|my_center|LOCUS_05750 225080 225559 gene locus_tag LOCUS_05760 gene ispF 225080 225559 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168569903.1 protein_id gnl|my_center|LOCUS_05760 225800 225582 gene locus_tag LOCUS_05770 225800 225582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 226058 225804 gene locus_tag LOCUS_05780 226058 225804 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022120.1 protein_id gnl|my_center|LOCUS_05780 226364 228121 gene locus_tag LOCUS_05790 gene argS 226364 228121 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056669.1 protein_id gnl|my_center|LOCUS_05790 228691 229083 gene locus_tag LOCUS_05800 228691 229083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 229093 229872 gene locus_tag LOCUS_05810 229093 229872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105219828.1 protein_id gnl|my_center|LOCUS_05810 229878 230129 gene locus_tag LOCUS_05820 229878 230129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056812.1 protein_id gnl|my_center|LOCUS_05820 230579 230172 gene locus_tag LOCUS_05830 230579 230172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 232519 230579 gene locus_tag LOCUS_05840 232519 230579 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016398.1 protein_id gnl|my_center|LOCUS_05840 232998 232828 gene locus_tag LOCUS_05850 232998 232828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 235137 233086 gene locus_tag LOCUS_05860 235137 233086 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779460.1 protein_id gnl|my_center|LOCUS_05860 235465 235139 gene locus_tag LOCUS_05870 235465 235139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 235594 236295 gene locus_tag LOCUS_05880 235594 236295 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920927.1 protein_id gnl|my_center|LOCUS_05880 236738 237367 gene locus_tag LOCUS_05890 236738 237367 CDS product DUF6391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140118.1 protein_id gnl|my_center|LOCUS_05890 237445 237678 gene locus_tag LOCUS_05900 237445 237678 CDS product photosystem I reaction center subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124526.1 protein_id gnl|my_center|LOCUS_05900 238052 239440 gene locus_tag LOCUS_05910 gene hpnO 238052 239440 CDS product aminobacteriohopanetriol synthase HpnO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085794.1 protein_id gnl|my_center|LOCUS_05910 239446 240543 gene locus_tag LOCUS_05920 239446 240543 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202512.1 protein_id gnl|my_center|LOCUS_05920 240715 241710 gene locus_tag LOCUS_05930 240715 241710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 243681 242119 gene locus_tag LOCUS_05940 gene kaiC 243681 242119 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056334.1 protein_id gnl|my_center|LOCUS_05940 244189 243875 gene locus_tag LOCUS_05950 gene kaiB 244189 243875 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056333.1 protein_id gnl|my_center|LOCUS_05950 245088 244246 gene locus_tag LOCUS_05960 245088 244246 CDS product circadian clock protein KaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056332.1 protein_id gnl|my_center|LOCUS_05960 245452 247827 gene locus_tag LOCUS_05970 245452 247827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 249393 248197 gene locus_tag LOCUS_05980 249393 248197 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_05980 249937 250572 gene locus_tag LOCUS_05990 249937 250572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 250615 252939 gene locus_tag LOCUS_06000 gene feoB 250615 252939 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057577.1 protein_id gnl|my_center|LOCUS_06000 253473 254483 gene locus_tag LOCUS_06010 253473 254483 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057563.1 protein_id gnl|my_center|LOCUS_06010 255428 254712 gene locus_tag LOCUS_06020 255428 254712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892606.1 protein_id gnl|my_center|LOCUS_06020 256241 255432 gene locus_tag LOCUS_06030 256241 255432 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125718.1 protein_id gnl|my_center|LOCUS_06030 257020 256241 gene locus_tag LOCUS_06040 257020 256241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 258436 257462 gene locus_tag LOCUS_06050 258436 257462 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 protein_id gnl|my_center|LOCUS_06050 260463 258607 gene locus_tag LOCUS_06060 gene thrS 260463 258607 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216087114.1 protein_id gnl|my_center|LOCUS_06060 262401 260812 gene locus_tag LOCUS_06070 262401 260812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 263661 262918 gene locus_tag LOCUS_06080 263661 262918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 264306 263794 gene locus_tag LOCUS_06090 gene fldA 264306 263794 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140318.1 protein_id gnl|my_center|LOCUS_06090 265601 264573 gene locus_tag LOCUS_06100 265601 264573 CDS product chlorophyll a/b binding light-harvesting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921141.1 protein_id gnl|my_center|LOCUS_06100 266507 266061 gene locus_tag LOCUS_06110 266507 266061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 266578 267366 gene locus_tag LOCUS_06120 gene rncS 266578 267366 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_06120 268366 267587 gene locus_tag LOCUS_06130 268366 267587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 268537 269580 gene locus_tag LOCUS_06140 268537 269580 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_06140 269592 269933 gene locus_tag LOCUS_06150 269592 269933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 269953 270795 gene locus_tag LOCUS_06160 gene cysT 269953 270795 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056130.1 protein_id gnl|my_center|LOCUS_06160 270837 271679 gene locus_tag LOCUS_06170 gene cysW 270837 271679 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056131.1 protein_id gnl|my_center|LOCUS_06170 271760 272800 gene locus_tag LOCUS_06180 271760 272800 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057527.1 protein_id gnl|my_center|LOCUS_06180 274073 272847 gene locus_tag LOCUS_06190 274073 272847 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_06190 274510 274106 gene locus_tag LOCUS_06200 274510 274106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 274762 274529 gene locus_tag LOCUS_06210 274762 274529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 275057 274872 gene locus_tag LOCUS_06220 275057 274872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 276268 275315 gene locus_tag LOCUS_06230 276268 275315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 277448 276324 gene locus_tag LOCUS_06240 277448 276324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 >Feature sequence03 296 889 gene locus_tag LOCUS_06250 296 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 993 4862 gene locus_tag LOCUS_06260 993 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 6684 5116 gene locus_tag LOCUS_06270 6684 5116 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_06270 7082 7282 gene locus_tag LOCUS_06280 7082 7282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 8487 7369 gene locus_tag LOCUS_06290 gene ssuD 8487 7369 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268305.1 protein_id gnl|my_center|LOCUS_06290 10651 8633 gene locus_tag LOCUS_06300 10651 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 11704 10655 gene locus_tag LOCUS_06310 11704 10655 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144241.1 protein_id gnl|my_center|LOCUS_06310 12219 13316 gene locus_tag LOCUS_06320 gene sfnG 12219 13316 CDS product dimethyl sulfone monooxygenase SfnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551446.1 protein_id gnl|my_center|LOCUS_06320 13356 14864 gene locus_tag LOCUS_06330 13356 14864 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 protein_id gnl|my_center|LOCUS_06330 14963 15400 gene locus_tag LOCUS_06340 14963 15400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 15441 16655 gene locus_tag LOCUS_06350 15441 16655 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107493.1 protein_id gnl|my_center|LOCUS_06350 16734 17780 gene locus_tag LOCUS_06360 16734 17780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 17828 18409 gene locus_tag LOCUS_06370 gene ssuE 17828 18409 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142759.1 protein_id gnl|my_center|LOCUS_06370 18531 19733 gene locus_tag LOCUS_06380 18531 19733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 20856 20095 gene locus_tag LOCUS_06390 20856 20095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 22342 20849 gene locus_tag LOCUS_06400 22342 20849 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_06400 25019 22395 gene locus_tag LOCUS_06410 gene alaS 25019 22395 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057938.1 protein_id gnl|my_center|LOCUS_06410 25337 25092 gene locus_tag LOCUS_06420 25337 25092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 25363 27923 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29506 28622 gene locus_tag LOCUS_06430 29506 28622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_06430 30387 29503 gene locus_tag LOCUS_06440 30387 29503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_06440 30758 30564 gene locus_tag LOCUS_06450 30758 30564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 31632 31132 gene locus_tag LOCUS_06460 31632 31132 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056117.1 protein_id gnl|my_center|LOCUS_06460 32175 32534 gene locus_tag LOCUS_06470 gene psb28 32175 32534 CDS product photosystem II reaction center protein Psb28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928665.1 protein_id gnl|my_center|LOCUS_06470 32677 33624 gene locus_tag LOCUS_06480 32677 33624 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 protein_id gnl|my_center|LOCUS_06480 34386 33661 gene locus_tag LOCUS_06490 34386 33661 CDS product GUN4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057433.1 protein_id gnl|my_center|LOCUS_06490 34615 36018 gene locus_tag LOCUS_06500 gene lysA 34615 36018 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057598.1 protein_id gnl|my_center|LOCUS_06500 36202 36960 gene locus_tag LOCUS_06510 36202 36960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 36957 37706 gene locus_tag LOCUS_06520 gene uppS 36957 37706 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920928.1 protein_id gnl|my_center|LOCUS_06520 37959 38273 gene locus_tag LOCUS_06530 37959 38273 CDS product DUF1825 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057879.1 protein_id gnl|my_center|LOCUS_06530 38404 39516 gene locus_tag LOCUS_06540 38404 39516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 39855 40046 gene locus_tag LOCUS_06550 39855 40046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 41698 40334 gene locus_tag LOCUS_06560 41698 40334 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142799.1 protein_id gnl|my_center|LOCUS_06560 42751 41723 gene locus_tag LOCUS_06570 gene pdxA 42751 41723 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057880.1 protein_id gnl|my_center|LOCUS_06570 42943 44100 gene locus_tag LOCUS_06580 gene corA 42943 44100 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_06580 45964 44309 gene locus_tag LOCUS_06590 45964 44309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 47129 46146 gene locus_tag LOCUS_06600 gene holA 47129 46146 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920898.1 protein_id gnl|my_center|LOCUS_06600 47457 47302 gene locus_tag LOCUS_06610 47457 47302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 47656 48498 gene locus_tag LOCUS_06620 47656 48498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 49318 50388 gene locus_tag LOCUS_06630 49318 50388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 50499 50675 gene locus_tag LOCUS_06640 50499 50675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 50672 52621 gene locus_tag LOCUS_06650 50672 52621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 52752 52955 gene locus_tag LOCUS_06660 52752 52955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 53323 53919 gene locus_tag LOCUS_06670 53323 53919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 57555 54229 gene locus_tag LOCUS_06680 57555 54229 CDS product AAA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057338.1 protein_id gnl|my_center|LOCUS_06680 57670 58026 gene locus_tag LOCUS_06690 57670 58026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 58180 58380 gene locus_tag LOCUS_06700 58180 58380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 59369 58446 gene locus_tag LOCUS_06710 59369 58446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 59408 59911 gene locus_tag LOCUS_06720 59408 59911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 60797 59949 gene locus_tag LOCUS_06730 60797 59949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920996.1 protein_id gnl|my_center|LOCUS_06730 61072 61902 gene locus_tag LOCUS_06740 61072 61902 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057037.1 protein_id gnl|my_center|LOCUS_06740 62760 61903 gene locus_tag LOCUS_06750 62760 61903 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057406.1 protein_id gnl|my_center|LOCUS_06750 64219 62876 gene locus_tag LOCUS_06760 64219 62876 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056530.1 protein_id gnl|my_center|LOCUS_06760 64998 64270 gene locus_tag LOCUS_06770 64998 64270 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055907.1 protein_id gnl|my_center|LOCUS_06770 65379 65017 gene locus_tag LOCUS_06780 65379 65017 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143896.1 protein_id gnl|my_center|LOCUS_06780 66338 65382 gene locus_tag LOCUS_06790 66338 65382 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256681.1 protein_id gnl|my_center|LOCUS_06790 68051 66339 gene locus_tag LOCUS_06800 68051 66339 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041470421.1 protein_id gnl|my_center|LOCUS_06800 68277 68516 gene locus_tag LOCUS_06810 68277 68516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 68673 68891 gene locus_tag LOCUS_06820 68673 68891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 69039 69497 gene locus_tag LOCUS_06830 69039 69497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 70588 69881 gene locus_tag LOCUS_06840 70588 69881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 70964 71251 gene locus_tag LOCUS_06850 70964 71251 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_06850 71553 71816 gene locus_tag LOCUS_06860 71553 71816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 71823 72269 gene locus_tag LOCUS_06870 71823 72269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 72299 72844 gene locus_tag LOCUS_06880 72299 72844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314297.1 protein_id gnl|my_center|LOCUS_06880 74672 73794 gene locus_tag LOCUS_06890 gene murB 74672 73794 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056225.1 protein_id gnl|my_center|LOCUS_06890 76530 75103 gene locus_tag LOCUS_06900 gene murC 76530 75103 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056226.1 protein_id gnl|my_center|LOCUS_06900 76941 77957 gene locus_tag LOCUS_06910 76941 77957 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140533.1 protein_id gnl|my_center|LOCUS_06910 78851 78075 gene locus_tag LOCUS_06920 gene fetB 78851 78075 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 protein_id gnl|my_center|LOCUS_06920 78978 80090 gene locus_tag LOCUS_06930 78978 80090 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_06930 80119 81021 gene locus_tag LOCUS_06940 80119 81021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 82965 81322 gene locus_tag LOCUS_06950 gene hflX 82965 81322 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144128.1 protein_id gnl|my_center|LOCUS_06950 84466 83960 gene locus_tag LOCUS_06960 84466 83960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 84671 84483 gene locus_tag LOCUS_06970 84671 84483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 85004 84792 gene locus_tag LOCUS_06980 85004 84792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 86004 87857 gene locus_tag LOCUS_06990 86004 87857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 87949 88022 gene locus_tag LOCUS_t00080 87949 88022 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 89708 88866 gene locus_tag LOCUS_07000 89708 88866 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143083.1 protein_id gnl|my_center|LOCUS_07000 90317 92599 gene locus_tag LOCUS_07010 90317 92599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 92758 97125 gene locus_tag LOCUS_07020 92758 97125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 97647 97207 gene locus_tag LOCUS_07030 97647 97207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 97916 97644 gene locus_tag LOCUS_07040 97916 97644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 98419 98796 gene locus_tag LOCUS_07050 98419 98796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 98856 99071 gene locus_tag LOCUS_07060 98856 99071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 100657 99197 gene locus_tag LOCUS_07070 100657 99197 CDS product IS4-like element ISGvi2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140150.1 protein_id gnl|my_center|LOCUS_07070 100880 101311 gene locus_tag LOCUS_07080 100880 101311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 101844 102632 gene locus_tag LOCUS_07090 101844 102632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 102613 104052 gene locus_tag LOCUS_07100 102613 104052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 104171 104380 gene locus_tag LOCUS_07110 104171 104380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 104361 104720 gene locus_tag LOCUS_07120 104361 104720 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393652.1 protein_id gnl|my_center|LOCUS_07120 104751 105989 gene locus_tag LOCUS_07130 104751 105989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 105959 107092 gene locus_tag LOCUS_07140 105959 107092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 107648 108859 gene locus_tag LOCUS_07150 107648 108859 CDS product FAD-dependent hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921015.1 protein_id gnl|my_center|LOCUS_07150 109234 109309 gene locus_tag LOCUS_t00090 109234 109309 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 109440 111362 gene locus_tag LOCUS_07160 109440 111362 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_07160 111938 112123 gene locus_tag LOCUS_07170 111938 112123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 112934 112299 gene locus_tag LOCUS_07180 112934 112299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 113136 114140 gene locus_tag LOCUS_07190 113136 114140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 114793 115395 gene locus_tag LOCUS_07200 114793 115395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 115398 116399 gene locus_tag LOCUS_07210 115398 116399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 116632 117690 gene locus_tag LOCUS_07220 116632 117690 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056373.1 protein_id gnl|my_center|LOCUS_07220 118512 117748 gene locus_tag LOCUS_07230 118512 117748 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929431.1 protein_id gnl|my_center|LOCUS_07230 120296 118620 gene locus_tag LOCUS_07240 gene ribBA 120296 118620 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920923.1 protein_id gnl|my_center|LOCUS_07240 121312 120434 gene locus_tag LOCUS_07250 121312 120434 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057794.1 protein_id gnl|my_center|LOCUS_07250 122173 121358 gene locus_tag LOCUS_07260 122173 121358 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057794.1 protein_id gnl|my_center|LOCUS_07260 122781 122293 gene locus_tag LOCUS_07270 gene cpcA 122781 122293 CDS product phycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057793.1 protein_id gnl|my_center|LOCUS_07270 123366 122848 gene locus_tag LOCUS_07280 123366 122848 CDS product phycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057792.1 protein_id gnl|my_center|LOCUS_07280 124070 125293 gene locus_tag LOCUS_07290 124070 125293 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921052.1 protein_id gnl|my_center|LOCUS_07290 125373 126260 gene locus_tag LOCUS_07300 gene argB 125373 126260 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_07300 126429 126650 gene locus_tag LOCUS_07310 126429 126650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 126694 127914 gene locus_tag LOCUS_07320 126694 127914 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920707.1 protein_id gnl|my_center|LOCUS_07320 128218 128412 gene locus_tag LOCUS_07330 128218 128412 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_07330 128409 128666 gene locus_tag LOCUS_07340 128409 128666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 129286 130620 gene locus_tag LOCUS_07350 129286 130620 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_07350 130674 131183 gene locus_tag LOCUS_07360 130674 131183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798166.1 protein_id gnl|my_center|LOCUS_07360 131255 132034 gene locus_tag LOCUS_07370 131255 132034 CDS product photosystem II S4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140394.1 protein_id gnl|my_center|LOCUS_07370 132078 134126 gene locus_tag LOCUS_07380 132078 134126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 134161 134787 gene locus_tag LOCUS_07390 134161 134787 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530066.1 protein_id gnl|my_center|LOCUS_07390 134804 136117 gene locus_tag LOCUS_07400 134804 136117 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058269.1 protein_id gnl|my_center|LOCUS_07400 136179 137189 gene locus_tag LOCUS_07410 gene trpS 136179 137189 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057831.1 protein_id gnl|my_center|LOCUS_07410 137426 138475 gene locus_tag LOCUS_07420 137426 138475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 138831 139010 gene locus_tag LOCUS_07430 138831 139010 CDS product ssl1498 family light-harvesting-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055918.1 protein_id gnl|my_center|LOCUS_07430 139867 139085 gene locus_tag LOCUS_07440 139867 139085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 139930 140478 gene locus_tag LOCUS_07450 gene psbP 139930 140478 CDS product photosystem II reaction center PsbP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057910.1 protein_id gnl|my_center|LOCUS_07450 140649 141059 gene locus_tag LOCUS_07460 140649 141059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 141183 141770 gene locus_tag LOCUS_07470 141183 141770 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057142.1 protein_id gnl|my_center|LOCUS_07470 141946 142539 gene locus_tag LOCUS_07480 gene ureG 141946 142539 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055912.1 protein_id gnl|my_center|LOCUS_07480 143283 142549 gene locus_tag LOCUS_07490 143283 142549 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920693.1 protein_id gnl|my_center|LOCUS_07490 144732 143302 gene locus_tag LOCUS_07500 144732 143302 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057120.1 protein_id gnl|my_center|LOCUS_07500 146504 144903 gene locus_tag LOCUS_07510 146504 144903 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057717.1 protein_id gnl|my_center|LOCUS_07510 147082 147258 gene locus_tag LOCUS_07520 147082 147258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 147255 148586 gene locus_tag LOCUS_07530 147255 148586 CDS product AtzE family amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965237.1 protein_id gnl|my_center|LOCUS_07530 150081 148912 gene locus_tag LOCUS_07540 150081 148912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 150247 151524 gene locus_tag LOCUS_07550 150247 151524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 151511 152302 gene locus_tag LOCUS_07560 151511 152302 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_07560 152588 153649 gene locus_tag LOCUS_07570 152588 153649 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921045.1 protein_id gnl|my_center|LOCUS_07570 153862 155142 gene locus_tag LOCUS_07580 gene rodA 153862 155142 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920901.1 protein_id gnl|my_center|LOCUS_07580 155697 155849 gene locus_tag LOCUS_07590 155697 155849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 156127 157107 gene locus_tag LOCUS_07600 156127 157107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267860.1 protein_id gnl|my_center|LOCUS_07600 157161 158135 gene locus_tag LOCUS_07610 157161 158135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267860.1 protein_id gnl|my_center|LOCUS_07610 158885 158352 gene locus_tag LOCUS_07620 158885 158352 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764601.1 protein_id gnl|my_center|LOCUS_07620 161102 159039 gene locus_tag LOCUS_07630 161102 159039 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_07630 161590 161336 gene locus_tag LOCUS_07640 161590 161336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920999.1 protein_id gnl|my_center|LOCUS_07640 162633 161689 gene locus_tag LOCUS_07650 162633 161689 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142872.1 protein_id gnl|my_center|LOCUS_07650 162731 163558 gene locus_tag LOCUS_07660 162731 163558 CDS product YaaW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920905.1 protein_id gnl|my_center|LOCUS_07660 163976 165187 gene locus_tag LOCUS_07670 163976 165187 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028529.1 protein_id gnl|my_center|LOCUS_07670 166361 165465 gene locus_tag LOCUS_07680 166361 165465 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228102.1 protein_id gnl|my_center|LOCUS_07680 167010 166411 gene locus_tag LOCUS_07690 167010 166411 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_07690 167480 167172 gene locus_tag LOCUS_07700 167480 167172 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_07700 168387 167527 gene locus_tag LOCUS_07710 168387 167527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 171020 168594 gene locus_tag LOCUS_07720 171020 168594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 171412 173001 gene locus_tag LOCUS_07730 171412 173001 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058172.1 protein_id gnl|my_center|LOCUS_07730 173535 173221 gene locus_tag LOCUS_07740 173535 173221 CDS product DUF2488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057339.1 protein_id gnl|my_center|LOCUS_07740 174358 173600 gene locus_tag LOCUS_07750 174358 173600 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056682.1 protein_id gnl|my_center|LOCUS_07750 174804 174382 gene locus_tag LOCUS_07760 174804 174382 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056570.1 protein_id gnl|my_center|LOCUS_07760 174990 176186 gene locus_tag LOCUS_07770 174990 176186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 177405 176629 gene locus_tag LOCUS_07780 177405 176629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 177827 180079 gene locus_tag LOCUS_07790 177827 180079 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057710.1 protein_id gnl|my_center|LOCUS_07790 180082 180864 gene locus_tag LOCUS_07800 180082 180864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 181172 182218 gene locus_tag LOCUS_07810 gene fbp 181172 182218 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056391.1 protein_id gnl|my_center|LOCUS_07810 182334 183704 gene locus_tag LOCUS_07820 182334 183704 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_07820 183722 184366 gene locus_tag LOCUS_07830 183722 184366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188163.1 protein_id gnl|my_center|LOCUS_07830 185069 184683 gene locus_tag LOCUS_07840 185069 184683 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_07840 185299 185075 gene locus_tag LOCUS_07850 185299 185075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 185586 185951 gene locus_tag LOCUS_07860 185586 185951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 186525 186968 gene locus_tag LOCUS_07870 186525 186968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 187960 187532 gene locus_tag LOCUS_07880 187960 187532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 188344 188126 gene locus_tag LOCUS_07890 188344 188126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 189146 189502 gene locus_tag LOCUS_07900 gene folB 189146 189502 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798382.1 protein_id gnl|my_center|LOCUS_07900 190031 189489 gene locus_tag LOCUS_07910 190031 189489 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056276.1 protein_id gnl|my_center|LOCUS_07910 190192 190518 gene locus_tag LOCUS_07920 190192 190518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 191123 190515 gene locus_tag LOCUS_07930 191123 190515 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_07930 192055 191399 gene locus_tag LOCUS_07940 gene nth 192055 191399 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_07940 193146 192055 gene locus_tag LOCUS_07950 gene rseP 193146 192055 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057479.1 protein_id gnl|my_center|LOCUS_07950 193296 193859 gene locus_tag LOCUS_07960 193296 193859 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141254.1 protein_id gnl|my_center|LOCUS_07960 194039 194629 gene locus_tag LOCUS_07970 194039 194629 CDS product PAP/fibrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056274.1 protein_id gnl|my_center|LOCUS_07970 194860 195516 gene locus_tag LOCUS_07980 194860 195516 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141737.1 protein_id gnl|my_center|LOCUS_07980 195630 196181 gene locus_tag LOCUS_07990 195630 196181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 197390 196185 gene locus_tag LOCUS_08000 197390 196185 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141002.1 protein_id gnl|my_center|LOCUS_08000 197763 198086 gene locus_tag LOCUS_08010 gene trxA 197763 198086 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140882.1 protein_id gnl|my_center|LOCUS_08010 199244 198096 gene locus_tag LOCUS_08020 gene dprA 199244 198096 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920872.1 protein_id gnl|my_center|LOCUS_08020 199681 199998 gene locus_tag LOCUS_08030 199681 199998 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144191.1 protein_id gnl|my_center|LOCUS_08030 199988 200320 gene locus_tag LOCUS_08040 199988 200320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 201181 200942 gene locus_tag LOCUS_08050 201181 200942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 204085 201503 gene locus_tag LOCUS_08060 204085 201503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 204976 204272 gene locus_tag LOCUS_08070 204976 204272 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091011.1 protein_id gnl|my_center|LOCUS_08070 205599 204973 gene locus_tag LOCUS_08080 205599 204973 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763134.1 protein_id gnl|my_center|LOCUS_08080 207025 205601 gene locus_tag LOCUS_08090 207025 205601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 207780 207211 gene locus_tag LOCUS_08100 207780 207211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_08100 208485 207838 gene locus_tag LOCUS_08110 208485 207838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_08110 209190 208543 gene locus_tag LOCUS_08120 209190 208543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_08120 209787 209248 gene locus_tag LOCUS_08130 209787 209248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_08130 209851 211119 gene locus_tag LOCUS_08140 gene cbiE 209851 211119 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114023.1 protein_id gnl|my_center|LOCUS_08140 211686 211297 gene locus_tag LOCUS_08150 211686 211297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 212413 211706 gene locus_tag LOCUS_08160 212413 211706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 213105 212410 gene locus_tag LOCUS_08170 213105 212410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975094.1 protein_id gnl|my_center|LOCUS_08170 213349 213981 gene locus_tag LOCUS_08180 213349 213981 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141012.1 protein_id gnl|my_center|LOCUS_08180 216567 214126 gene locus_tag LOCUS_08190 gene ppsA 216567 214126 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_08190 217292 217038 gene locus_tag LOCUS_08200 217292 217038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 218814 217366 gene locus_tag LOCUS_08210 218814 217366 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056475.1 protein_id gnl|my_center|LOCUS_08210 220578 219022 gene locus_tag LOCUS_08220 220578 219022 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920854.1 protein_id gnl|my_center|LOCUS_08220 221155 221493 gene locus_tag LOCUS_08230 221155 221493 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015154861.1 protein_id gnl|my_center|LOCUS_08230 221619 222764 gene locus_tag LOCUS_08240 gene arsB 221619 222764 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_08240 222774 223421 gene locus_tag LOCUS_08250 gene arsH 222774 223421 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928410.1 protein_id gnl|my_center|LOCUS_08250 223445 223843 gene locus_tag LOCUS_08260 gene arsC 223445 223843 CDS product arsenate reductase, glutathione/glutaredoxin type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140008.1 protein_id gnl|my_center|LOCUS_08260 224121 224900 gene locus_tag LOCUS_08270 224121 224900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 224926 225141 gene locus_tag LOCUS_08280 224926 225141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 225497 226645 gene locus_tag LOCUS_08290 225497 226645 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_08290 226791 227087 gene locus_tag LOCUS_08300 226791 227087 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_08300 227084 228493 gene locus_tag LOCUS_08310 227084 228493 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence04 1219 578 gene locus_tag LOCUS_08320 1219 578 CDS product cofactor assembly of complex C subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056532.1 protein_id gnl|my_center|LOCUS_08320 1957 1229 gene locus_tag LOCUS_08330 1957 1229 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929702.1 protein_id gnl|my_center|LOCUS_08330 2191 3717 gene locus_tag LOCUS_08340 gene radA 2191 3717 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142401.1 protein_id gnl|my_center|LOCUS_08340 3937 4392 gene locus_tag LOCUS_08350 3937 4392 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_08350 4405 4860 gene locus_tag LOCUS_08360 4405 4860 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_08360 4872 5327 gene locus_tag LOCUS_08370 4872 5327 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_08370 5340 5795 gene locus_tag LOCUS_08380 5340 5795 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_08380 5808 6266 gene locus_tag LOCUS_08390 5808 6266 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_08390 6259 7188 gene locus_tag LOCUS_08400 6259 7188 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389971.1 protein_id gnl|my_center|LOCUS_08400 7454 8242 gene locus_tag LOCUS_08410 7454 8242 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_08410 8813 9097 gene locus_tag LOCUS_08420 8813 9097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 10797 9241 gene locus_tag LOCUS_08430 10797 9241 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_08430 11152 10868 gene locus_tag LOCUS_08440 11152 10868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 11328 11918 gene locus_tag LOCUS_08450 11328 11918 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530066.1 protein_id gnl|my_center|LOCUS_08450 12293 12051 gene locus_tag LOCUS_08460 12293 12051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 12591 15218 gene locus_tag LOCUS_08470 12591 15218 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144168.1 protein_id gnl|my_center|LOCUS_08470 15607 15227 gene locus_tag LOCUS_08480 15607 15227 CDS product DUF1830 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057308.1 protein_id gnl|my_center|LOCUS_08480 17653 16352 gene locus_tag LOCUS_08490 gene hemL 17653 16352 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797681.1 protein_id gnl|my_center|LOCUS_08490 18057 19205 gene locus_tag LOCUS_08500 gene dnaN 18057 19205 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058182.1 protein_id gnl|my_center|LOCUS_08500 20931 19471 gene locus_tag LOCUS_08510 20931 19471 CDS product IS4-like element ISGvi2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140150.1 protein_id gnl|my_center|LOCUS_08510 22258 21323 gene locus_tag LOCUS_08520 22258 21323 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095959.1 protein_id gnl|my_center|LOCUS_08520 23348 22335 gene locus_tag LOCUS_08530 23348 22335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 25003 23387 gene locus_tag LOCUS_08540 25003 23387 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_08540 33089 25227 gene locus_tag LOCUS_08550 33089 25227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 34009 33254 gene locus_tag LOCUS_08560 34009 33254 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_08560 44444 34041 gene locus_tag LOCUS_08570 44444 34041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 56374 44669 gene locus_tag LOCUS_08580 56374 44669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 57099 65462 gene locus_tag LOCUS_08590 57099 65462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08590 65478 71858 gene locus_tag LOCUS_08600 65478 71858 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503026.1 protein_id gnl|my_center|LOCUS_08600 71855 75730 gene locus_tag LOCUS_08610 71855 75730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08610 77874 75823 gene locus_tag LOCUS_08620 77874 75823 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142700.1 protein_id gnl|my_center|LOCUS_08620 78681 78118 gene locus_tag LOCUS_08630 78681 78118 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_08630 79408 78845 gene locus_tag LOCUS_08640 79408 78845 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_08640 80981 79455 gene locus_tag LOCUS_08650 80981 79455 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056133.1 protein_id gnl|my_center|LOCUS_08650 81992 83812 gene locus_tag LOCUS_08660 81992 83812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 84124 85125 gene locus_tag LOCUS_08670 84124 85125 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057751.1 protein_id gnl|my_center|LOCUS_08670 85890 85177 gene locus_tag LOCUS_08680 85890 85177 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_08680 87726 86641 gene locus_tag LOCUS_08690 gene mtnA 87726 86641 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056904.1 protein_id gnl|my_center|LOCUS_08690 87941 88375 gene locus_tag LOCUS_08700 87941 88375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 88765 89565 gene locus_tag LOCUS_08710 88765 89565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057863.1 protein_id gnl|my_center|LOCUS_08710 89571 90455 gene locus_tag LOCUS_08720 gene prmC 89571 90455 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172187304.1 protein_id gnl|my_center|LOCUS_08720 90988 90452 gene locus_tag LOCUS_08730 90988 90452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 91653 90952 gene locus_tag LOCUS_08740 gene pyrF 91653 90952 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141657.1 protein_id gnl|my_center|LOCUS_08740 92214 91750 gene locus_tag LOCUS_08750 92214 91750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 92731 92237 gene locus_tag LOCUS_08760 92731 92237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 92886 93929 gene locus_tag LOCUS_08770 92886 93929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 94558 93926 gene locus_tag LOCUS_08780 94558 93926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 94786 95181 gene locus_tag LOCUS_08790 gene queF 94786 95181 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056073.1 protein_id gnl|my_center|LOCUS_08790 95600 95974 gene locus_tag LOCUS_08800 95600 95974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 96007 96600 gene locus_tag LOCUS_08810 96007 96600 CDS product IS607-like element IS1602 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414146.1 protein_id gnl|my_center|LOCUS_08810 96572 96997 gene locus_tag LOCUS_08820 96572 96997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08820 97049 97810 gene locus_tag LOCUS_08830 97049 97810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08830 97786 98430 gene locus_tag LOCUS_08840 97786 98430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 98468 98890 gene locus_tag LOCUS_08850 98468 98890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 98917 99312 gene locus_tag LOCUS_08860 98917 99312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 99378 101897 gene locus_tag LOCUS_08870 99378 101897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08870 101979 102293 gene locus_tag LOCUS_08880 101979 102293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08880 102887 103198 gene locus_tag LOCUS_08890 102887 103198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 103201 103416 gene locus_tag LOCUS_08900 103201 103416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 103423 103593 gene locus_tag LOCUS_08910 103423 103593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 104844 103636 gene locus_tag LOCUS_08920 104844 103636 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057156.1 protein_id gnl|my_center|LOCUS_08920 106056 105031 gene locus_tag LOCUS_08930 106056 105031 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_08930 109613 106059 gene locus_tag LOCUS_08940 gene nifJ 109613 106059 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933292.1 protein_id gnl|my_center|LOCUS_08940 110303 110917 gene locus_tag LOCUS_08950 gene lexA 110303 110917 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125487.1 protein_id gnl|my_center|LOCUS_08950 111048 111314 gene locus_tag LOCUS_08960 111048 111314 CDS product TIGR02450 family Trp-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142102.1 protein_id gnl|my_center|LOCUS_08960 111792 111526 gene locus_tag LOCUS_08970 111792 111526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 113191 112184 gene locus_tag LOCUS_08980 113191 112184 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056261.1 protein_id gnl|my_center|LOCUS_08980 113289 115310 gene locus_tag LOCUS_08990 113289 115310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 116302 115700 gene locus_tag LOCUS_09000 116302 115700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09000 116917 116324 gene locus_tag LOCUS_09010 116917 116324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09010 118595 117258 gene locus_tag LOCUS_09020 118595 117258 CDS product DUF4335 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057325.1 protein_id gnl|my_center|LOCUS_09020 119392 118841 gene locus_tag LOCUS_09030 119392 118841 CDS product DUF3038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057324.1 protein_id gnl|my_center|LOCUS_09030 119517 121088 gene locus_tag LOCUS_09040 119517 121088 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_09040 121696 121118 gene locus_tag LOCUS_09050 121696 121118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 123380 122184 gene locus_tag LOCUS_09060 123380 122184 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_09060 123595 123810 gene locus_tag LOCUS_09070 123595 123810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 123797 124009 gene locus_tag LOCUS_09080 123797 124009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 124670 124173 gene locus_tag LOCUS_09090 124670 124173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 124774 125769 gene locus_tag LOCUS_09100 124774 125769 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190761.1 protein_id gnl|my_center|LOCUS_09100 126140 126979 gene locus_tag LOCUS_09110 126140 126979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09110 128816 127629 gene locus_tag LOCUS_09120 128816 127629 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_09120 129296 129655 gene locus_tag LOCUS_09130 129296 129655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 129656 130021 gene locus_tag LOCUS_09140 129656 130021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057414.1 protein_id gnl|my_center|LOCUS_09140 133023 130465 gene locus_tag LOCUS_09150 133023 130465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 133598 134404 gene locus_tag LOCUS_09160 133598 134404 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524138.1 protein_id gnl|my_center|LOCUS_09160 134562 135266 gene locus_tag LOCUS_09170 134562 135266 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921011.1 protein_id gnl|my_center|LOCUS_09170 136820 135669 gene locus_tag LOCUS_09180 136820 135669 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231833781.1 protein_id gnl|my_center|LOCUS_09180 137641 136943 gene locus_tag LOCUS_09190 gene ubiE 137641 136943 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140131.1 protein_id gnl|my_center|LOCUS_09190 138698 137829 gene locus_tag LOCUS_09200 138698 137829 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_09200 138830 140113 gene locus_tag LOCUS_09210 138830 140113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 141202 140222 gene locus_tag LOCUS_09220 141202 140222 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056617.1 protein_id gnl|my_center|LOCUS_09220 142313 141270 gene locus_tag LOCUS_09230 142313 141270 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141878.1 protein_id gnl|my_center|LOCUS_09230 143203 142343 gene locus_tag LOCUS_09240 143203 142343 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056438.1 protein_id gnl|my_center|LOCUS_09240 143866 143489 gene locus_tag LOCUS_09250 143866 143489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 145194 144178 gene locus_tag LOCUS_09260 145194 144178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 145535 145215 gene locus_tag LOCUS_09270 145535 145215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 146105 147712 gene locus_tag LOCUS_09280 146105 147712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 149842 147998 gene locus_tag LOCUS_09290 149842 147998 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530091.1 protein_id gnl|my_center|LOCUS_09290 151826 149925 gene locus_tag LOCUS_09300 gene arsA 151826 149925 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461627.1 protein_id gnl|my_center|LOCUS_09300 152522 151839 gene locus_tag LOCUS_09310 152522 151839 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928988.1 protein_id gnl|my_center|LOCUS_09310 152663 152947 gene locus_tag LOCUS_09320 152663 152947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 153334 153071 gene locus_tag LOCUS_09330 153334 153071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 154083 153349 gene locus_tag LOCUS_09340 154083 153349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 154572 154099 gene locus_tag LOCUS_09350 154572 154099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 155351 155079 gene locus_tag LOCUS_09360 155351 155079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 155766 155344 gene locus_tag LOCUS_09370 155766 155344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 156824 155784 gene locus_tag LOCUS_09380 gene gvpN 156824 155784 CDS product gas vesicle protein GvpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904110.1 protein_id gnl|my_center|LOCUS_09380 158074 157436 gene locus_tag LOCUS_09390 158074 157436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 158286 158567 gene locus_tag LOCUS_09400 158286 158567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 158757 158515 gene locus_tag LOCUS_09410 158757 158515 CDS product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724507.1 protein_id gnl|my_center|LOCUS_09410 161313 161044 gene locus_tag LOCUS_09420 161313 161044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 161855 163192 gene locus_tag LOCUS_09430 161855 163192 CDS product trans-splicing intein-formed DNA polymerase III subunit alpha C-terminal partner DnaE-C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057904.1 protein_id gnl|my_center|LOCUS_09430 163354 163196 gene locus_tag LOCUS_09440 163354 163196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 163307 164341 gene locus_tag LOCUS_09450 163307 164341 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728943.1 protein_id gnl|my_center|LOCUS_09450 164829 164338 gene locus_tag LOCUS_09460 164829 164338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 165409 165251 gene locus_tag LOCUS_09470 165409 165251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 165360 166814 gene locus_tag LOCUS_09480 165360 166814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 167070 167447 gene locus_tag LOCUS_09490 167070 167447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 167580 168686 gene locus_tag LOCUS_09500 167580 168686 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_09500 168910 171696 gene locus_tag LOCUS_09510 168910 171696 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057066.1 protein_id gnl|my_center|LOCUS_09510 174495 171883 gene locus_tag LOCUS_09520 174495 171883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 175030 176337 gene locus_tag LOCUS_09530 175030 176337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 176413 177261 gene locus_tag LOCUS_09540 176413 177261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 177726 178208 gene locus_tag LOCUS_09550 177726 178208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 178286 179944 gene locus_tag LOCUS_09560 178286 179944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 179986 180414 gene locus_tag LOCUS_09570 179986 180414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 180800 180973 gene locus_tag LOCUS_09580 180800 180973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 181015 181302 gene locus_tag LOCUS_09590 181015 181302 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 protein_id gnl|my_center|LOCUS_09590 181280 181504 gene locus_tag LOCUS_09600 181280 181504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 182131 182811 gene locus_tag LOCUS_09610 182131 182811 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056503.1 protein_id gnl|my_center|LOCUS_09610 182838 183599 gene locus_tag LOCUS_09620 182838 183599 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057337.1 protein_id gnl|my_center|LOCUS_09620 183608 184456 gene locus_tag LOCUS_09630 183608 184456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 185762 184770 gene locus_tag LOCUS_09640 185762 184770 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125344.1 protein_id gnl|my_center|LOCUS_09640 188879 185814 gene locus_tag LOCUS_09650 188879 185814 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142489.1 protein_id gnl|my_center|LOCUS_09650 189550 189233 gene locus_tag LOCUS_09660 189550 189233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 191086 189626 gene locus_tag LOCUS_09670 191086 189626 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142490.1 protein_id gnl|my_center|LOCUS_09670 191385 192743 gene locus_tag LOCUS_09680 191385 192743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 193406 194827 gene locus_tag LOCUS_09690 193406 194827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 196681 194894 gene locus_tag LOCUS_09700 gene aspS 196681 194894 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056986.1 protein_id gnl|my_center|LOCUS_09700 196992 198203 gene locus_tag LOCUS_09710 gene tnpB 196992 198203 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_09710 198241 199023 gene locus_tag LOCUS_09720 198241 199023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 200807 199980 gene locus_tag LOCUS_09730 200807 199980 CDS product DUF3598 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141575.1 protein_id gnl|my_center|LOCUS_09730 200845 201264 gene locus_tag LOCUS_09740 gene panD 200845 201264 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225586.1 protein_id gnl|my_center|LOCUS_09740 201339 202526 gene locus_tag LOCUS_09750 201339 202526 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057679.1 protein_id gnl|my_center|LOCUS_09750 203735 202980 gene locus_tag LOCUS_09760 203735 202980 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531081.1 protein_id gnl|my_center|LOCUS_09760 204305 205753 gene locus_tag LOCUS_09770 204305 205753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073592997.1 protein_id gnl|my_center|LOCUS_09770 207982 205760 gene locus_tag LOCUS_09780 207982 205760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 209326 208100 gene locus_tag LOCUS_09790 209326 208100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 210193 209447 gene locus_tag LOCUS_09800 210193 209447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 211091 210186 gene locus_tag LOCUS_09810 gene crtB 211091 210186 CDS product cyanoexosortase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214431335.1 protein_id gnl|my_center|LOCUS_09810 212268 211129 gene locus_tag LOCUS_09820 212268 211129 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_09820 212494 213147 gene locus_tag LOCUS_09830 212494 213147 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530085.1 protein_id gnl|my_center|LOCUS_09830 214365 213100 gene locus_tag LOCUS_09840 214365 213100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 214471 215022 gene locus_tag LOCUS_09850 214471 215022 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920633.1 protein_id gnl|my_center|LOCUS_09850 215449 215027 gene locus_tag LOCUS_09860 215449 215027 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015159351.1 protein_id gnl|my_center|LOCUS_09860 215522 215902 gene locus_tag LOCUS_09870 215522 215902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 216073 216369 gene locus_tag LOCUS_09880 216073 216369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 217062 216718 gene locus_tag LOCUS_09890 217062 216718 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817423.1 protein_id gnl|my_center|LOCUS_09890 217323 217066 gene locus_tag LOCUS_09900 217323 217066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 217563 218186 gene locus_tag LOCUS_09910 217563 218186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_09910 218180 218455 gene locus_tag LOCUS_09920 218180 218455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 218679 218452 gene locus_tag LOCUS_09930 218679 218452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence05 454 140 gene locus_tag LOCUS_09940 454 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058283.1 protein_id gnl|my_center|LOCUS_09940 844 1347 gene locus_tag LOCUS_09950 844 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1698 2810 gene locus_tag LOCUS_09960 1698 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 2859 3458 gene locus_tag LOCUS_09970 2859 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 4759 3569 gene locus_tag LOCUS_09980 4759 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 5733 4804 gene locus_tag LOCUS_09990 5733 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 6463 5840 gene locus_tag LOCUS_10000 6463 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 7712 6624 gene locus_tag LOCUS_10010 gene aksF 7712 6624 CDS product homoisocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875823.1 protein_id gnl|my_center|LOCUS_10010 8483 8247 gene locus_tag LOCUS_10020 8483 8247 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798862.1 protein_id gnl|my_center|LOCUS_10020 9204 8557 gene locus_tag LOCUS_10030 9204 8557 CDS product DUF3386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056760.1 protein_id gnl|my_center|LOCUS_10030 9392 9628 gene locus_tag LOCUS_10040 9392 9628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 9888 11642 gene locus_tag LOCUS_10050 9888 11642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 12065 11853 gene locus_tag LOCUS_10060 12065 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 12913 12107 gene locus_tag LOCUS_10070 12913 12107 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_10070 13164 13009 gene locus_tag LOCUS_10080 13164 13009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 13674 13183 gene locus_tag LOCUS_10090 13674 13183 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_10090 13822 16092 gene locus_tag LOCUS_10100 gene purL 13822 16092 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057520.1 protein_id gnl|my_center|LOCUS_10100 16360 17823 gene locus_tag LOCUS_10110 gene purF 16360 17823 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057521.1 protein_id gnl|my_center|LOCUS_10110 19547 17832 gene locus_tag LOCUS_10120 19547 17832 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392228.1 protein_id gnl|my_center|LOCUS_10120 21083 19743 gene locus_tag LOCUS_10130 gene aroA 21083 19743 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056198.1 protein_id gnl|my_center|LOCUS_10130 21200 21418 gene locus_tag LOCUS_10140 21200 21418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 21837 22649 gene locus_tag LOCUS_10150 21837 22649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 22902 23444 gene locus_tag LOCUS_10160 22902 23444 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057036.1 protein_id gnl|my_center|LOCUS_10160 23886 25226 gene locus_tag LOCUS_10170 23886 25226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 26567 25629 gene locus_tag LOCUS_10180 26567 25629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 27019 28149 gene locus_tag LOCUS_10190 27019 28149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 28296 29366 gene locus_tag LOCUS_10200 28296 29366 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_10200 30439 29486 gene locus_tag LOCUS_10210 30439 29486 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_10210 31459 30677 gene locus_tag LOCUS_10220 31459 30677 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058265.1 protein_id gnl|my_center|LOCUS_10220 31866 33293 gene locus_tag LOCUS_10230 gene gndA 31866 33293 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056424.1 protein_id gnl|my_center|LOCUS_10230 33982 33356 gene locus_tag LOCUS_10240 33982 33356 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080647.1 protein_id gnl|my_center|LOCUS_10240 36138 33979 gene locus_tag LOCUS_10250 36138 33979 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056445.1 protein_id gnl|my_center|LOCUS_10250 38364 36847 gene locus_tag LOCUS_10260 38364 36847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 39112 38357 gene locus_tag LOCUS_10270 39112 38357 CDS product DUF2232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057242.1 protein_id gnl|my_center|LOCUS_10270 41230 39647 gene locus_tag LOCUS_10280 41230 39647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 42951 41656 gene locus_tag LOCUS_10290 42951 41656 CDS product CO2 hydration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141007.1 protein_id gnl|my_center|LOCUS_10290 44559 43009 gene locus_tag LOCUS_10300 44559 43009 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141006.1 protein_id gnl|my_center|LOCUS_10300 45363 44638 gene locus_tag LOCUS_10310 45363 44638 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142086.1 protein_id gnl|my_center|LOCUS_10310 47298 45445 gene locus_tag LOCUS_10320 47298 45445 CDS product NAD(P)H-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056748.1 protein_id gnl|my_center|LOCUS_10320 48289 47345 gene locus_tag LOCUS_10330 48289 47345 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_10330 48649 49338 gene locus_tag LOCUS_10340 48649 49338 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143961.1 protein_id gnl|my_center|LOCUS_10340 50674 49511 gene locus_tag LOCUS_10350 gene grrM 50674 49511 CDS product GRRM system radical SAM/SPASM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970460.1 protein_id gnl|my_center|LOCUS_10350 51885 50764 gene locus_tag LOCUS_10360 51885 50764 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056813.1 protein_id gnl|my_center|LOCUS_10360 53296 51962 gene locus_tag LOCUS_10370 53296 51962 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140787.1 protein_id gnl|my_center|LOCUS_10370 53574 53329 gene locus_tag LOCUS_10380 53574 53329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 53687 53759 gene locus_tag LOCUS_t00100 53687 53759 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 56767 54032 gene locus_tag LOCUS_10390 56767 54032 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143241.1 protein_id gnl|my_center|LOCUS_10390 57851 56808 gene locus_tag LOCUS_10400 57851 56808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 58350 57892 gene locus_tag LOCUS_10410 58350 57892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 60443 58437 gene locus_tag LOCUS_10420 gene tkt 60443 58437 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057707.1 protein_id gnl|my_center|LOCUS_10420 61776 60526 gene locus_tag LOCUS_10430 gene fabF 61776 60526 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057708.1 protein_id gnl|my_center|LOCUS_10430 62095 61847 gene locus_tag LOCUS_10440 gene acpP 62095 61847 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_10440 63236 62517 gene locus_tag LOCUS_10450 63236 62517 CDS product heme oxygenase (biliverdin-producing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920678.1 protein_id gnl|my_center|LOCUS_10450 63747 64487 gene locus_tag LOCUS_10460 63747 64487 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058255.1 protein_id gnl|my_center|LOCUS_10460 66379 64895 gene locus_tag LOCUS_10470 66379 64895 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_10470 67591 66752 gene locus_tag LOCUS_10480 gene ylqF 67591 66752 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057347.1 protein_id gnl|my_center|LOCUS_10480 67699 68241 gene locus_tag LOCUS_10490 67699 68241 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_10490 68402 69343 gene locus_tag LOCUS_10500 68402 69343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_10500 70310 69369 gene locus_tag LOCUS_10510 70310 69369 CDS product TIGR04168 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235619519.1 protein_id gnl|my_center|LOCUS_10510 70632 70829 gene locus_tag LOCUS_10520 70632 70829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 71997 70831 gene locus_tag LOCUS_10530 71997 70831 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056757.1 protein_id gnl|my_center|LOCUS_10530 73135 74457 gene locus_tag LOCUS_10540 73135 74457 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057190.1 protein_id gnl|my_center|LOCUS_10540 74603 75430 gene locus_tag LOCUS_10550 gene ntrB 74603 75430 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142085.1 protein_id gnl|my_center|LOCUS_10550 75578 77584 gene locus_tag LOCUS_10560 75578 77584 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057192.1 protein_id gnl|my_center|LOCUS_10560 77631 78629 gene locus_tag LOCUS_10570 77631 78629 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142088.1 protein_id gnl|my_center|LOCUS_10570 80689 79241 gene locus_tag LOCUS_10580 80689 79241 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220208744.1 protein_id gnl|my_center|LOCUS_10580 81616 80933 gene locus_tag LOCUS_10590 81616 80933 CDS product DevA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_10590 82814 81642 gene locus_tag LOCUS_10600 gene devC 82814 81642 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_10600 84132 82819 gene locus_tag LOCUS_10610 84132 82819 CDS product ABC exporter membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056492.1 protein_id gnl|my_center|LOCUS_10610 85103 84129 gene locus_tag LOCUS_10620 85103 84129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 86142 85177 gene locus_tag LOCUS_10630 86142 85177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 87395 86370 gene locus_tag LOCUS_10640 87395 86370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 88590 87442 gene locus_tag LOCUS_10650 88590 87442 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964369.1 protein_id gnl|my_center|LOCUS_10650 89812 88964 gene locus_tag LOCUS_10660 89812 88964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964370.1 protein_id gnl|my_center|LOCUS_10660 90029 89829 gene locus_tag LOCUS_10670 90029 89829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 91181 90555 gene locus_tag LOCUS_10680 91181 90555 CDS product DUF2301 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142018.1 protein_id gnl|my_center|LOCUS_10680 91402 93306 gene locus_tag LOCUS_10690 91402 93306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 94922 93387 gene locus_tag LOCUS_10700 94922 93387 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920904.1 protein_id gnl|my_center|LOCUS_10700 95124 95387 gene locus_tag LOCUS_10710 95124 95387 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994045.1 protein_id gnl|my_center|LOCUS_10710 96928 95384 gene locus_tag LOCUS_10720 96928 95384 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_10720 98110 97079 gene locus_tag LOCUS_10730 gene lpxD 98110 97079 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142707.1 protein_id gnl|my_center|LOCUS_10730 98856 99881 gene locus_tag LOCUS_10740 98856 99881 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920628.1 protein_id gnl|my_center|LOCUS_10740 99964 100659 gene locus_tag LOCUS_10750 gene fabG 99964 100659 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144338.1 protein_id gnl|my_center|LOCUS_10750 100729 101385 gene locus_tag LOCUS_10760 gene plsY 100729 101385 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056950.1 protein_id gnl|my_center|LOCUS_10760 102072 101572 gene locus_tag LOCUS_10770 102072 101572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081148.1 protein_id gnl|my_center|LOCUS_10770 102640 102461 gene locus_tag LOCUS_10780 102640 102461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 103137 102667 gene locus_tag LOCUS_10790 103137 102667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081148.1 protein_id gnl|my_center|LOCUS_10790 103472 103119 gene locus_tag LOCUS_10800 103472 103119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 104492 103662 gene locus_tag LOCUS_10810 gene dapB 104492 103662 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920961.1 protein_id gnl|my_center|LOCUS_10810 105806 105354 gene locus_tag LOCUS_10820 105806 105354 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921062.1 protein_id gnl|my_center|LOCUS_10820 106804 105824 gene locus_tag LOCUS_10830 106804 105824 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055875.1 protein_id gnl|my_center|LOCUS_10830 107164 108561 gene locus_tag LOCUS_10840 107164 108561 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056941.1 protein_id gnl|my_center|LOCUS_10840 108905 109480 gene locus_tag LOCUS_10850 gene def 108905 109480 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057513.1 protein_id gnl|my_center|LOCUS_10850 109512 109709 gene locus_tag LOCUS_10860 109512 109709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057514.1 protein_id gnl|my_center|LOCUS_10860 110101 110418 gene locus_tag LOCUS_10870 110101 110418 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056338.1 protein_id gnl|my_center|LOCUS_10870 112140 110500 gene locus_tag LOCUS_10880 112140 110500 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056613.1 protein_id gnl|my_center|LOCUS_10880 112372 112725 gene locus_tag LOCUS_10890 112372 112725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 112956 114359 gene locus_tag LOCUS_10900 112956 114359 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058264.1 protein_id gnl|my_center|LOCUS_10900 115790 114351 gene locus_tag LOCUS_10910 115790 114351 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393748.1 protein_id gnl|my_center|LOCUS_10910 117798 115984 gene locus_tag LOCUS_10920 117798 115984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056407.1 protein_id gnl|my_center|LOCUS_10920 118915 117839 gene locus_tag LOCUS_10930 118915 117839 CDS product phosphotransacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057861.1 protein_id gnl|my_center|LOCUS_10930 119327 118950 gene locus_tag LOCUS_10940 119327 118950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057860.1 protein_id gnl|my_center|LOCUS_10940 120703 119447 gene locus_tag LOCUS_10950 120703 119447 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056050.1 protein_id gnl|my_center|LOCUS_10950 121092 121412 gene locus_tag LOCUS_10960 121092 121412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 121649 122437 gene locus_tag LOCUS_10970 121649 122437 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057170.1 protein_id gnl|my_center|LOCUS_10970 124418 122523 gene locus_tag LOCUS_10980 gene ftsH2 124418 122523 CDS product ATP-dependent zinc metalloprotease FtsH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056581.1 protein_id gnl|my_center|LOCUS_10980 124633 125103 gene locus_tag LOCUS_10990 gene rimP 124633 125103 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929303.1 protein_id gnl|my_center|LOCUS_10990 125505 126698 gene locus_tag LOCUS_11000 gene nusA 125505 126698 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057772.1 protein_id gnl|my_center|LOCUS_11000 126698 126979 gene locus_tag LOCUS_11010 126698 126979 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172451.1 protein_id gnl|my_center|LOCUS_11010 127091 130123 gene locus_tag LOCUS_11020 gene infB 127091 130123 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056909.1 protein_id gnl|my_center|LOCUS_11020 130283 130852 gene locus_tag LOCUS_11030 130283 130852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 131607 130879 gene locus_tag LOCUS_11040 131607 130879 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039062.1 protein_id gnl|my_center|LOCUS_11040 131784 131632 gene locus_tag LOCUS_11050 131784 131632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 132121 133074 gene locus_tag LOCUS_11060 132121 133074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_11060 133816 133097 gene locus_tag LOCUS_11070 133816 133097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 133894 134559 gene locus_tag LOCUS_11080 133894 134559 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921118.1 protein_id gnl|my_center|LOCUS_11080 134633 135724 gene locus_tag LOCUS_11090 134633 135724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 136309 135836 gene locus_tag LOCUS_11100 136309 135836 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_11100 137396 136410 gene locus_tag LOCUS_11110 137396 136410 CDS product RNA polymerase sigma factor, RpoD/SigA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193329020.1 protein_id gnl|my_center|LOCUS_11110 138099 139523 gene locus_tag LOCUS_11120 138099 139523 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_11120 140184 139612 gene locus_tag LOCUS_11130 140184 139612 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_11130 141371 140205 gene locus_tag LOCUS_11140 141371 140205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 142727 141456 gene locus_tag LOCUS_11150 142727 141456 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088243667.1 protein_id gnl|my_center|LOCUS_11150 142917 144185 gene locus_tag LOCUS_11160 142917 144185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 144232 144396 gene locus_tag LOCUS_11170 144232 144396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 144562 145344 gene locus_tag LOCUS_11180 144562 145344 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_11180 145569 145408 gene locus_tag LOCUS_11190 145569 145408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 145561 146358 gene locus_tag LOCUS_11200 145561 146358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 146817 147089 gene locus_tag LOCUS_11210 146817 147089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 147083 147430 gene locus_tag LOCUS_11220 147083 147430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11220 147615 148484 gene locus_tag LOCUS_11230 147615 148484 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_11230 149365 148556 gene locus_tag LOCUS_11240 149365 148556 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989683.1 protein_id gnl|my_center|LOCUS_11240 149668 149489 gene locus_tag LOCUS_11250 149668 149489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 150027 149671 gene locus_tag LOCUS_11260 150027 149671 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_11260 150272 150024 gene locus_tag LOCUS_11270 150272 150024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 151146 150658 gene locus_tag LOCUS_11280 151146 150658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 151671 152651 gene locus_tag LOCUS_11290 gene cysK 151671 152651 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172232.1 protein_id gnl|my_center|LOCUS_11290 152648 153607 gene locus_tag LOCUS_11300 152648 153607 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194474.1 protein_id gnl|my_center|LOCUS_11300 153684 154616 gene locus_tag LOCUS_11310 153684 154616 CDS product family 2A encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107594.1 protein_id gnl|my_center|LOCUS_11310 154609 156297 gene locus_tag LOCUS_11320 154609 156297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence06 1887 508 gene locus_tag LOCUS_11330 1887 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 2491 2129 gene locus_tag LOCUS_11340 2491 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 2949 4031 gene locus_tag LOCUS_11350 gene psbA 2949 4031 CDS product photosystem II q(b) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057317.1 protein_id gnl|my_center|LOCUS_11350 4124 4354 gene locus_tag LOCUS_11360 4124 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 4357 4713 gene locus_tag LOCUS_11370 4357 4713 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617906.1 protein_id gnl|my_center|LOCUS_11370 5713 4898 gene locus_tag LOCUS_11380 5713 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 6014 5784 gene locus_tag LOCUS_11390 6014 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 6410 6036 gene locus_tag LOCUS_11400 6410 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 7925 6873 gene locus_tag LOCUS_11410 gene purM 7925 6873 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057648.1 protein_id gnl|my_center|LOCUS_11410 8734 8003 gene locus_tag LOCUS_11420 gene radC 8734 8003 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920920.1 protein_id gnl|my_center|LOCUS_11420 10019 8832 gene locus_tag LOCUS_11430 10019 8832 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057885.1 protein_id gnl|my_center|LOCUS_11430 10276 11562 gene locus_tag LOCUS_11440 10276 11562 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_11440 11572 12927 gene locus_tag LOCUS_11450 11572 12927 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_11450 14413 12980 gene locus_tag LOCUS_11460 14413 12980 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920889.1 protein_id gnl|my_center|LOCUS_11460 14977 14633 gene locus_tag LOCUS_11470 14977 14633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 15493 16326 gene locus_tag LOCUS_11480 15493 16326 CDS product photosystem II manganese-stabilizing polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056297.1 protein_id gnl|my_center|LOCUS_11480 16456 17853 gene locus_tag LOCUS_11490 16456 17853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 18075 17839 gene locus_tag LOCUS_11500 18075 17839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 18676 18404 gene locus_tag LOCUS_11510 18676 18404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11510 19197 18808 gene locus_tag LOCUS_11520 19197 18808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11520 19682 21493 gene locus_tag LOCUS_11530 19682 21493 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056620.1 protein_id gnl|my_center|LOCUS_11530 22126 21854 gene locus_tag LOCUS_11540 22126 21854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 22624 22388 gene locus_tag LOCUS_11550 22624 22388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 22881 22672 gene locus_tag LOCUS_11560 22881 22672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 23538 23287 gene locus_tag LOCUS_11570 23538 23287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 24094 23885 gene locus_tag LOCUS_11580 24094 23885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 24309 24091 gene locus_tag LOCUS_11590 24309 24091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 25893 24370 gene locus_tag LOCUS_11600 25893 24370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 26041 25874 gene locus_tag LOCUS_11610 26041 25874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 26515 26168 gene locus_tag LOCUS_11620 26515 26168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 27008 26739 gene locus_tag LOCUS_11630 27008 26739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 27196 27005 gene locus_tag LOCUS_11640 27196 27005 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532021.1 protein_id gnl|my_center|LOCUS_11640 27396 27193 gene locus_tag LOCUS_11650 27396 27193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 27762 27406 gene locus_tag LOCUS_11660 27762 27406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 28293 29498 gene locus_tag LOCUS_11670 28293 29498 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256400.1 protein_id gnl|my_center|LOCUS_11670 29501 30811 gene locus_tag LOCUS_11680 29501 30811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 31223 32905 gene locus_tag LOCUS_11690 31223 32905 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057114.1 protein_id gnl|my_center|LOCUS_11690 33033 33584 gene locus_tag LOCUS_11700 33033 33584 CDS product DUF2854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056635.1 protein_id gnl|my_center|LOCUS_11700 33585 34346 gene locus_tag LOCUS_11710 33585 34346 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057760.1 protein_id gnl|my_center|LOCUS_11710 35165 34497 gene locus_tag LOCUS_11720 35165 34497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 35329 36030 gene locus_tag LOCUS_11730 35329 36030 CDS product DUF3120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190832035.1 protein_id gnl|my_center|LOCUS_11730 36455 37537 gene locus_tag LOCUS_11740 36455 37537 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058242.1 protein_id gnl|my_center|LOCUS_11740 38888 37896 gene locus_tag LOCUS_11750 38888 37896 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057881.1 protein_id gnl|my_center|LOCUS_11750 39856 39341 gene locus_tag LOCUS_11760 gene nrdR 39856 39341 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057698.1 protein_id gnl|my_center|LOCUS_11760 40576 40184 gene locus_tag LOCUS_11770 gene rplL 40576 40184 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141601.1 protein_id gnl|my_center|LOCUS_11770 41168 40620 gene locus_tag LOCUS_11780 gene rplJ 41168 40620 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056152.1 protein_id gnl|my_center|LOCUS_11780 42635 41964 gene locus_tag LOCUS_11790 42635 41964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 43923 42640 gene locus_tag LOCUS_11800 43923 42640 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035889.1 protein_id gnl|my_center|LOCUS_11800 47822 44181 gene locus_tag LOCUS_11810 gene cobN 47822 44181 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056744.1 protein_id gnl|my_center|LOCUS_11810 48250 50445 gene locus_tag LOCUS_11820 48250 50445 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056743.1 protein_id gnl|my_center|LOCUS_11820 51283 50801 gene locus_tag LOCUS_11830 51283 50801 CDS product photosystem I reaction center protein subunit XI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058236.1 protein_id gnl|my_center|LOCUS_11830 51948 51538 gene locus_tag LOCUS_11840 51948 51538 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058102.1 protein_id gnl|my_center|LOCUS_11840 52112 53320 gene locus_tag LOCUS_11850 52112 53320 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058101.1 protein_id gnl|my_center|LOCUS_11850 54042 53458 gene locus_tag LOCUS_11860 54042 53458 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_11860 55657 54302 gene locus_tag LOCUS_11870 gene opcA 55657 54302 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056389.1 protein_id gnl|my_center|LOCUS_11870 57313 55784 gene locus_tag LOCUS_11880 gene zwf 57313 55784 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056390.1 protein_id gnl|my_center|LOCUS_11880 58601 57420 gene locus_tag LOCUS_11890 58601 57420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 59037 59189 gene locus_tag LOCUS_11900 59037 59189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 60744 59554 gene locus_tag LOCUS_11910 60744 59554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 61203 67340 gene locus_tag LOCUS_11920 61203 67340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 67492 67983 gene locus_tag LOCUS_11930 67492 67983 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642421.1 protein_id gnl|my_center|LOCUS_11930 71000 67980 gene locus_tag LOCUS_11940 71000 67980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 71486 73798 gene locus_tag LOCUS_11950 71486 73798 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016141.1 protein_id gnl|my_center|LOCUS_11950 73861 74352 gene locus_tag LOCUS_11960 73861 74352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 74391 74867 gene locus_tag LOCUS_11970 74391 74867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 74871 75323 gene locus_tag LOCUS_11980 74871 75323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 75336 75788 gene locus_tag LOCUS_11990 75336 75788 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141996.1 protein_id gnl|my_center|LOCUS_11990 75788 76252 gene locus_tag LOCUS_12000 75788 76252 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141996.1 protein_id gnl|my_center|LOCUS_12000 76306 77373 gene locus_tag LOCUS_12010 76306 77373 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897713.1 protein_id gnl|my_center|LOCUS_12010 78533 77613 gene locus_tag LOCUS_12020 78533 77613 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056335.1 protein_id gnl|my_center|LOCUS_12020 80478 78694 gene locus_tag LOCUS_12030 gene ltrA 80478 78694 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140181.1 protein_id gnl|my_center|LOCUS_12030 81744 82283 gene locus_tag LOCUS_12040 81744 82283 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141530.1 protein_id gnl|my_center|LOCUS_12040 83753 82371 gene locus_tag LOCUS_12050 gene thiC 83753 82371 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921089.1 protein_id gnl|my_center|LOCUS_12050 84122 84523 gene locus_tag LOCUS_12060 84122 84523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 86121 84946 gene locus_tag LOCUS_12070 86121 84946 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141596.1 protein_id gnl|my_center|LOCUS_12070 86331 86534 gene locus_tag LOCUS_12080 gene rpmI 86331 86534 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125970.1 protein_id gnl|my_center|LOCUS_12080 86566 86913 gene locus_tag LOCUS_12090 gene rplT 86566 86913 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057992.1 protein_id gnl|my_center|LOCUS_12090 86927 87883 gene locus_tag LOCUS_12100 86927 87883 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055892.1 protein_id gnl|my_center|LOCUS_12100 89398 88283 gene locus_tag LOCUS_12110 89398 88283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 89803 91314 gene locus_tag LOCUS_12120 89803 91314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 91321 91977 gene locus_tag LOCUS_12130 91321 91977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 92047 93240 gene locus_tag LOCUS_12140 92047 93240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 93287 93607 gene locus_tag LOCUS_12150 93287 93607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 93604 96489 gene locus_tag LOCUS_12160 93604 96489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 96774 96622 gene locus_tag LOCUS_12170 96774 96622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 96793 97044 gene locus_tag LOCUS_12180 96793 97044 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140617.1 protein_id gnl|my_center|LOCUS_12180 97241 97378 gene locus_tag LOCUS_12190 97241 97378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 97582 98382 gene locus_tag LOCUS_12200 97582 98382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 98922 99122 gene locus_tag LOCUS_12210 98922 99122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 99147 100115 gene locus_tag LOCUS_12220 99147 100115 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921231.1 protein_id gnl|my_center|LOCUS_12220 100048 100221 gene locus_tag LOCUS_12230 100048 100221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 100273 100551 gene locus_tag LOCUS_12240 100273 100551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 101027 101383 gene locus_tag LOCUS_12250 101027 101383 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142926.1 protein_id gnl|my_center|LOCUS_12250 101870 101652 gene locus_tag LOCUS_12260 101870 101652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 102370 101873 gene locus_tag LOCUS_12270 102370 101873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 104808 102778 gene locus_tag LOCUS_12280 104808 102778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 106664 105906 gene locus_tag LOCUS_12290 106664 105906 CDS product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119074.1 protein_id gnl|my_center|LOCUS_12290 107334 106678 gene locus_tag LOCUS_12300 107334 106678 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003198.1 protein_id gnl|my_center|LOCUS_12300 107373 107555 gene locus_tag LOCUS_12310 107373 107555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 107986 107600 gene locus_tag LOCUS_12320 107986 107600 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057922.1 protein_id gnl|my_center|LOCUS_12320 108731 108030 gene locus_tag LOCUS_12330 108731 108030 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056001.1 protein_id gnl|my_center|LOCUS_12330 108918 109217 gene locus_tag LOCUS_12340 108918 109217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 109639 110505 gene locus_tag LOCUS_12350 109639 110505 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391041.1 protein_id gnl|my_center|LOCUS_12350 110502 110792 gene locus_tag LOCUS_12360 gene kaiB 110502 110792 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056333.1 protein_id gnl|my_center|LOCUS_12360 110979 111161 gene locus_tag LOCUS_12370 110979 111161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 111357 112550 gene locus_tag LOCUS_12380 111357 112550 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920820.1 protein_id gnl|my_center|LOCUS_12380 112949 112530 gene locus_tag LOCUS_12390 112949 112530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 113249 114346 gene locus_tag LOCUS_12400 113249 114346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 114406 115740 gene locus_tag LOCUS_12410 114406 115740 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920917.1 protein_id gnl|my_center|LOCUS_12410 115737 116429 gene locus_tag LOCUS_12420 115737 116429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 116644 116847 gene locus_tag LOCUS_12430 116644 116847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 116844 117068 gene locus_tag LOCUS_12440 116844 117068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 118039 117323 gene locus_tag LOCUS_12450 118039 117323 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142237.1 protein_id gnl|my_center|LOCUS_12450 118196 119809 gene locus_tag LOCUS_12460 gene metG 118196 119809 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056597.1 protein_id gnl|my_center|LOCUS_12460 119910 120515 gene locus_tag LOCUS_12470 119910 120515 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056598.1 protein_id gnl|my_center|LOCUS_12470 121941 120745 gene locus_tag LOCUS_12480 121941 120745 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057505.1 protein_id gnl|my_center|LOCUS_12480 123213 122050 gene locus_tag LOCUS_12490 123213 122050 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_12490 123391 123206 gene locus_tag LOCUS_12500 123391 123206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 123814 124197 gene locus_tag LOCUS_12510 gene rpsL 123814 124197 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143913.1 protein_id gnl|my_center|LOCUS_12510 124353 124823 gene locus_tag LOCUS_12520 gene rpsG 124353 124823 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057585.1 protein_id gnl|my_center|LOCUS_12520 124955 127030 gene locus_tag LOCUS_12530 gene fusA 124955 127030 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057586.1 protein_id gnl|my_center|LOCUS_12530 127183 128412 gene locus_tag LOCUS_12540 gene tuf 127183 128412 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143916.1 protein_id gnl|my_center|LOCUS_12540 128503 128820 gene locus_tag LOCUS_12550 gene rpsJ 128503 128820 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006042265.1 protein_id gnl|my_center|LOCUS_12550 130829 129174 gene locus_tag LOCUS_12560 130829 129174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 132020 131145 gene locus_tag LOCUS_12570 gene glyQ 132020 131145 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920808.1 protein_id gnl|my_center|LOCUS_12570 133115 132192 gene locus_tag LOCUS_12580 133115 132192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 135216 133591 gene locus_tag LOCUS_12590 135216 133591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 135512 135333 gene locus_tag LOCUS_12600 135512 135333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 135728 136687 gene locus_tag LOCUS_12610 gene hemC 135728 136687 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057483.1 protein_id gnl|my_center|LOCUS_12610 137209 136898 gene locus_tag LOCUS_12620 137209 136898 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143612.1 protein_id gnl|my_center|LOCUS_12620 138292 137522 gene locus_tag LOCUS_12630 138292 137522 CDS product AhpC/TSA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125038.1 protein_id gnl|my_center|LOCUS_12630 139425 138289 gene locus_tag LOCUS_12640 139425 138289 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058228.1 protein_id gnl|my_center|LOCUS_12640 139663 140859 gene locus_tag LOCUS_12650 139663 140859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 141116 140907 gene locus_tag LOCUS_12660 gene thiS 141116 140907 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056654.1 protein_id gnl|my_center|LOCUS_12660 143208 142192 gene locus_tag LOCUS_12670 143208 142192 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920956.1 protein_id gnl|my_center|LOCUS_12670 144102 143491 gene locus_tag LOCUS_12680 144102 143491 CDS product IS607-like element ISTko1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 protein_id gnl|my_center|LOCUS_12680 145197 145829 gene locus_tag LOCUS_12690 145197 145829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 146364 145990 gene locus_tag LOCUS_12700 146364 145990 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_12700 146519 147154 gene locus_tag LOCUS_12710 gene hisIE 146519 147154 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056088.1 protein_id gnl|my_center|LOCUS_12710 147456 148841 gene locus_tag LOCUS_12720 gene lpdA 147456 148841 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830471.1 protein_id gnl|my_center|LOCUS_12720 148867 149490 gene locus_tag LOCUS_12730 gene tmk 148867 149490 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250354.1 protein_id gnl|my_center|LOCUS_12730 149495 150988 gene locus_tag LOCUS_12740 149495 150988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 151564 151133 gene locus_tag LOCUS_12750 151564 151133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 >Feature sequence07 373 975 gene locus_tag LOCUS_12760 gene clpP 373 975 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125072.1 protein_id gnl|my_center|LOCUS_12760 1187 1648 gene locus_tag LOCUS_12770 1187 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140803.1 protein_id gnl|my_center|LOCUS_12770 1729 2853 gene locus_tag LOCUS_12780 gene tgt 1729 2853 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055935.1 protein_id gnl|my_center|LOCUS_12780 2850 3041 gene locus_tag LOCUS_12790 2850 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 3815 3153 gene locus_tag LOCUS_12800 3815 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 4231 3869 gene locus_tag LOCUS_12810 4231 3869 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056614.1 protein_id gnl|my_center|LOCUS_12810 5438 4428 gene locus_tag LOCUS_12820 5438 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 5574 7025 gene locus_tag LOCUS_12830 gene gatA 5574 7025 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920797.1 protein_id gnl|my_center|LOCUS_12830 7713 7327 gene locus_tag LOCUS_12840 7713 7327 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 protein_id gnl|my_center|LOCUS_12840 7907 7710 gene locus_tag LOCUS_12850 7907 7710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 8028 8513 gene locus_tag LOCUS_12860 8028 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 8555 8767 gene locus_tag LOCUS_12870 8555 8767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 8903 9121 gene locus_tag LOCUS_12880 8903 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 9974 10306 gene locus_tag LOCUS_12890 9974 10306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 10410 11762 gene locus_tag LOCUS_12900 10410 11762 CDS product TIGR03279 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057484.1 protein_id gnl|my_center|LOCUS_12900 12799 12005 gene locus_tag LOCUS_12910 12799 12005 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141808.1 protein_id gnl|my_center|LOCUS_12910 12986 14170 gene locus_tag LOCUS_12920 12986 14170 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_12920 14547 14137 gene locus_tag LOCUS_12930 14547 14137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 14982 15791 gene locus_tag LOCUS_12940 14982 15791 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818985.1 protein_id gnl|my_center|LOCUS_12940 16776 15853 gene locus_tag LOCUS_12950 16776 15853 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056938.1 protein_id gnl|my_center|LOCUS_12950 16972 17133 gene locus_tag LOCUS_12960 16972 17133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 17400 17155 gene locus_tag LOCUS_12970 17400 17155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 17662 17387 gene locus_tag LOCUS_12980 17662 17387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 21669 17683 gene locus_tag LOCUS_12990 21669 17683 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056126.1 protein_id gnl|my_center|LOCUS_12990 22384 22815 gene locus_tag LOCUS_13000 22384 22815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 22823 24199 gene locus_tag LOCUS_13010 22823 24199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 24205 25701 gene locus_tag LOCUS_13020 24205 25701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390741.1 protein_id gnl|my_center|LOCUS_13020 25857 26732 gene locus_tag LOCUS_13030 25857 26732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 28178 27003 gene locus_tag LOCUS_13040 28178 27003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 28846 28400 gene locus_tag LOCUS_13050 28846 28400 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021290.1 protein_id gnl|my_center|LOCUS_13050 31091 28785 gene locus_tag LOCUS_13060 31091 28785 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_13060 31761 31480 gene locus_tag LOCUS_13070 31761 31480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 31982 31758 gene locus_tag LOCUS_13080 31982 31758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 34303 32252 gene locus_tag LOCUS_13090 34303 32252 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 protein_id gnl|my_center|LOCUS_13090 35985 34951 gene locus_tag LOCUS_13100 gene cobW 35985 34951 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057463.1 protein_id gnl|my_center|LOCUS_13100 36189 36377 gene locus_tag LOCUS_13110 36189 36377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 38483 36711 gene locus_tag LOCUS_13120 38483 36711 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706692.1 protein_id gnl|my_center|LOCUS_13120 38998 40509 gene locus_tag LOCUS_13130 gene crtH 38998 40509 CDS product carotene isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891794.1 protein_id gnl|my_center|LOCUS_13130 40731 42410 gene locus_tag LOCUS_13140 40731 42410 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058118.1 protein_id gnl|my_center|LOCUS_13140 42941 47305 gene locus_tag LOCUS_13150 42941 47305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 47603 47809 gene locus_tag LOCUS_13160 47603 47809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 48060 52700 gene locus_tag LOCUS_13170 48060 52700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 52844 53110 gene locus_tag LOCUS_13180 52844 53110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 53690 53609 gene locus_tag LOCUS_t00110 53690 53609 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 54425 53745 gene locus_tag LOCUS_13190 54425 53745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056940.1 protein_id gnl|my_center|LOCUS_13190 54549 55604 gene locus_tag LOCUS_13200 54549 55604 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799101.1 protein_id gnl|my_center|LOCUS_13200 56698 55793 gene locus_tag LOCUS_13210 gene rimK 56698 55793 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096254.1 protein_id gnl|my_center|LOCUS_13210 57447 57055 gene locus_tag LOCUS_13220 57447 57055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 57789 57454 gene locus_tag LOCUS_13230 57789 57454 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142949.1 protein_id gnl|my_center|LOCUS_13230 58092 57790 gene locus_tag LOCUS_13240 58092 57790 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144191.1 protein_id gnl|my_center|LOCUS_13240 58879 58544 gene locus_tag LOCUS_13250 58879 58544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 59282 59037 gene locus_tag LOCUS_13260 59282 59037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 59622 59290 gene locus_tag LOCUS_13270 59622 59290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 60084 59815 gene locus_tag LOCUS_13280 60084 59815 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_13280 60284 60081 gene locus_tag LOCUS_13290 60284 60081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 60432 60298 gene locus_tag LOCUS_13300 60432 60298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 60656 60429 gene locus_tag LOCUS_13310 60656 60429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 63685 60701 gene locus_tag LOCUS_13320 63685 60701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 63803 63949 gene locus_tag LOCUS_13330 63803 63949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 64059 63986 gene locus_tag LOCUS_t00120 64059 63986 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 65870 64143 gene locus_tag LOCUS_13340 65870 64143 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057217.1 protein_id gnl|my_center|LOCUS_13340 66704 66327 gene locus_tag LOCUS_13350 gene petE 66704 66327 CDS product plastocyanin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125233.1 protein_id gnl|my_center|LOCUS_13350 66897 67217 gene locus_tag LOCUS_13360 66897 67217 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103126030.1 protein_id gnl|my_center|LOCUS_13360 67334 69013 gene locus_tag LOCUS_13370 67334 69013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 69292 69666 gene locus_tag LOCUS_13380 69292 69666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 70059 70259 gene locus_tag LOCUS_13390 70059 70259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 70373 70777 gene locus_tag LOCUS_13400 70373 70777 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_13400 71565 71062 gene locus_tag LOCUS_13410 71565 71062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 71856 72125 gene locus_tag LOCUS_13420 71856 72125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 72617 73522 gene locus_tag LOCUS_13430 72617 73522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 74365 73907 gene locus_tag LOCUS_13440 74365 73907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 75033 75326 gene locus_tag LOCUS_13450 75033 75326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 75316 75579 gene locus_tag LOCUS_13460 75316 75579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 76002 76193 gene locus_tag LOCUS_13470 76002 76193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 76190 76372 gene locus_tag LOCUS_13480 76190 76372 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061317.1 protein_id gnl|my_center|LOCUS_13480 76704 77609 gene locus_tag LOCUS_13490 76704 77609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 78854 77835 gene locus_tag LOCUS_13500 78854 77835 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_13500 80481 79561 gene locus_tag LOCUS_13510 80481 79561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 81361 80558 gene locus_tag LOCUS_13520 81361 80558 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817427.1 protein_id gnl|my_center|LOCUS_13520 82880 81543 gene locus_tag LOCUS_13530 82880 81543 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258102.1 protein_id gnl|my_center|LOCUS_13530 83044 84234 gene locus_tag LOCUS_13540 83044 84234 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_13540 84311 85459 gene locus_tag LOCUS_13550 84311 85459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 85992 85681 gene locus_tag LOCUS_13560 gene nuoK 85992 85681 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140654.1 protein_id gnl|my_center|LOCUS_13560 86608 86012 gene locus_tag LOCUS_13570 86608 86012 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056516.1 protein_id gnl|my_center|LOCUS_13570 87326 86754 gene locus_tag LOCUS_13580 gene ndhI 87326 86754 CDS product NAD(P)H-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056515.1 protein_id gnl|my_center|LOCUS_13580 88487 87369 gene locus_tag LOCUS_13590 gene nuoH 88487 87369 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126985484.1 protein_id gnl|my_center|LOCUS_13590 89774 89085 gene locus_tag LOCUS_13600 gene pyrE 89774 89085 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057665.1 protein_id gnl|my_center|LOCUS_13600 89828 90280 gene locus_tag LOCUS_13610 89828 90280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 92389 90395 gene locus_tag LOCUS_13620 92389 90395 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_13620 93181 92573 gene locus_tag LOCUS_13630 93181 92573 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161817388.1 protein_id gnl|my_center|LOCUS_13630 97742 93279 gene locus_tag LOCUS_13640 97742 93279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 98612 97836 gene locus_tag LOCUS_13650 98612 97836 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929513.1 protein_id gnl|my_center|LOCUS_13650 101947 98669 gene locus_tag LOCUS_13660 101947 98669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 102983 102039 gene locus_tag LOCUS_13670 102983 102039 CDS product putative capsular polysaccharide synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478215.1 protein_id gnl|my_center|LOCUS_13670 103815 103015 gene locus_tag LOCUS_13680 gene bacG 103815 103015 CDS product NADPH-dependent reductase BacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244095.1 protein_id gnl|my_center|LOCUS_13680 104490 103864 gene locus_tag LOCUS_13690 104490 103864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 105219 104587 gene locus_tag LOCUS_13700 gene bacA 105219 104587 CDS product prephenate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968341.1 protein_id gnl|my_center|LOCUS_13700 106256 105213 gene locus_tag LOCUS_13710 gene fni 106256 105213 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057243.1 protein_id gnl|my_center|LOCUS_13710 111068 106296 gene locus_tag LOCUS_13720 111068 106296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 113069 111192 gene locus_tag LOCUS_13730 113069 111192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 117572 113313 gene locus_tag LOCUS_13740 117572 113313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 118158 118943 gene locus_tag LOCUS_13750 118158 118943 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142264.1 protein_id gnl|my_center|LOCUS_13750 121701 119065 gene locus_tag LOCUS_13760 gene topA 121701 119065 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057718.1 protein_id gnl|my_center|LOCUS_13760 122833 123447 gene locus_tag LOCUS_13770 122833 123447 CDS product DUF938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143861.1 protein_id gnl|my_center|LOCUS_13770 124532 123477 gene locus_tag LOCUS_13780 124532 123477 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_13780 124780 127401 gene locus_tag LOCUS_13790 124780 127401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 127899 128708 gene locus_tag LOCUS_13800 127899 128708 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124685.1 protein_id gnl|my_center|LOCUS_13800 129341 129790 gene locus_tag LOCUS_13810 gene ndk 129341 129790 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056122.1 protein_id gnl|my_center|LOCUS_13810 129914 131287 gene locus_tag LOCUS_13820 129914 131287 CDS product DICT sensory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929211.1 protein_id gnl|my_center|LOCUS_13820 132512 131496 gene locus_tag LOCUS_13830 gene hpnH 132512 131496 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_13830 133604 134164 gene locus_tag LOCUS_13840 133604 134164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 134187 134615 gene locus_tag LOCUS_13850 134187 134615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 134617 135660 gene locus_tag LOCUS_13860 134617 135660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 135759 136358 gene locus_tag LOCUS_13870 135759 136358 CDS product DUF1517 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141514.1 protein_id gnl|my_center|LOCUS_13870 136375 137247 gene locus_tag LOCUS_13880 136375 137247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141513.1 protein_id gnl|my_center|LOCUS_13880 138051 137539 gene locus_tag LOCUS_13890 138051 137539 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920918.1 protein_id gnl|my_center|LOCUS_13890 138766 138113 gene locus_tag LOCUS_13900 138766 138113 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056679.1 protein_id gnl|my_center|LOCUS_13900 139128 139490 gene locus_tag LOCUS_13910 139128 139490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 139483 140298 gene locus_tag LOCUS_13920 139483 140298 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_13920 140321 140557 gene locus_tag LOCUS_13930 140321 140557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 140550 141380 gene locus_tag LOCUS_13940 140550 141380 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_13940 141634 141446 gene locus_tag LOCUS_13950 141634 141446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 142793 141615 gene locus_tag LOCUS_13960 142793 141615 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124972844.1 protein_id gnl|my_center|LOCUS_13960 143169 142810 gene locus_tag LOCUS_13970 gene trxA 143169 142810 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403255.1 protein_id gnl|my_center|LOCUS_13970 144096 143218 gene locus_tag LOCUS_13980 144096 143218 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084173.1 protein_id gnl|my_center|LOCUS_13980 144295 144528 gene locus_tag LOCUS_13990 144295 144528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 144516 144926 gene locus_tag LOCUS_14000 144516 144926 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_14000 144954 146033 gene locus_tag LOCUS_14010 144954 146033 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799067.1 protein_id gnl|my_center|LOCUS_14010 147267 146281 gene locus_tag LOCUS_14020 147267 146281 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055856.1 protein_id gnl|my_center|LOCUS_14020 147767 147273 gene locus_tag LOCUS_14030 gene accB 147767 147273 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892082.1 protein_id gnl|my_center|LOCUS_14030 148491 147934 gene locus_tag LOCUS_14040 gene efp 148491 147934 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057134.1 protein_id gnl|my_center|LOCUS_14040 148715 150202 gene locus_tag LOCUS_14050 148715 150202 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_14050 150206 150529 gene locus_tag LOCUS_14060 150206 150529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence08 114 1334 gene locus_tag LOCUS_14070 114 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1555 4986 gene locus_tag LOCUS_14080 1555 4986 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_14080 5386 6180 gene locus_tag LOCUS_14090 5386 6180 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_14090 6211 7077 gene locus_tag LOCUS_14100 6211 7077 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_14100 7108 7950 gene locus_tag LOCUS_14110 7108 7950 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_14110 8974 8216 gene locus_tag LOCUS_14120 8974 8216 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355989.1 protein_id gnl|my_center|LOCUS_14120 9230 10117 gene locus_tag LOCUS_14130 9230 10117 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525079.1 protein_id gnl|my_center|LOCUS_14130 11151 10120 gene locus_tag LOCUS_14140 11151 10120 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 protein_id gnl|my_center|LOCUS_14140 11952 11212 gene locus_tag LOCUS_14150 11952 11212 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550381.1 protein_id gnl|my_center|LOCUS_14150 11997 12701 gene locus_tag LOCUS_14160 11997 12701 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144068.1 protein_id gnl|my_center|LOCUS_14160 12955 12716 gene locus_tag LOCUS_14170 12955 12716 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141646.1 protein_id gnl|my_center|LOCUS_14170 14440 12965 gene locus_tag LOCUS_14180 14440 12965 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057553.1 protein_id gnl|my_center|LOCUS_14180 14963 14529 gene locus_tag LOCUS_14190 14963 14529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057265.1 protein_id gnl|my_center|LOCUS_14190 15046 15348 gene locus_tag LOCUS_14200 15046 15348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 15404 15859 gene locus_tag LOCUS_14210 15404 15859 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056015.1 protein_id gnl|my_center|LOCUS_14210 15959 16639 gene locus_tag LOCUS_14220 15959 16639 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056891.1 protein_id gnl|my_center|LOCUS_14220 17136 16732 gene locus_tag LOCUS_14230 17136 16732 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706948.1 protein_id gnl|my_center|LOCUS_14230 17840 17241 gene locus_tag LOCUS_14240 17840 17241 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125539.1 protein_id gnl|my_center|LOCUS_14240 18562 17876 gene locus_tag LOCUS_14250 18562 17876 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125538.1 protein_id gnl|my_center|LOCUS_14250 19375 21609 gene locus_tag LOCUS_14260 19375 21609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 22813 22247 gene locus_tag LOCUS_14270 22813 22247 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038393.1 protein_id gnl|my_center|LOCUS_14270 24203 22884 gene locus_tag LOCUS_14280 gene secY 24203 22884 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055954.1 protein_id gnl|my_center|LOCUS_14280 25005 24562 gene locus_tag LOCUS_14290 gene rplO 25005 24562 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055953.1 protein_id gnl|my_center|LOCUS_14290 25537 25016 gene locus_tag LOCUS_14300 gene rpsE 25537 25016 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055952.1 protein_id gnl|my_center|LOCUS_14300 25926 25564 gene locus_tag LOCUS_14310 gene rplR 25926 25564 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143899.1 protein_id gnl|my_center|LOCUS_14310 26499 25930 gene locus_tag LOCUS_14320 gene rplF 26499 25930 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055950.1 protein_id gnl|my_center|LOCUS_14320 27036 26635 gene locus_tag LOCUS_14330 gene rpsH 27036 26635 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055949.1 protein_id gnl|my_center|LOCUS_14330 27806 27267 gene locus_tag LOCUS_14340 gene rplE 27806 27267 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055948.1 protein_id gnl|my_center|LOCUS_14340 28214 27861 gene locus_tag LOCUS_14350 gene rplX 28214 27861 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055947.1 protein_id gnl|my_center|LOCUS_14350 28623 28255 gene locus_tag LOCUS_14360 gene rplN 28623 28255 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055946.1 protein_id gnl|my_center|LOCUS_14360 28886 28644 gene locus_tag LOCUS_14370 gene rpsQ 28886 28644 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055945.1 protein_id gnl|my_center|LOCUS_14370 29111 28893 gene locus_tag LOCUS_14380 gene rpmC 29111 28893 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143907.1 protein_id gnl|my_center|LOCUS_14380 29530 29111 gene locus_tag LOCUS_14390 gene rplP 29530 29111 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055943.1 protein_id gnl|my_center|LOCUS_14390 30289 29561 gene locus_tag LOCUS_14400 gene rpsC 30289 29561 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055942.1 protein_id gnl|my_center|LOCUS_14400 30672 30313 gene locus_tag LOCUS_14410 gene rplV 30672 30313 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055941.1 protein_id gnl|my_center|LOCUS_14410 31079 30798 gene locus_tag LOCUS_14420 gene rpsS 31079 30798 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055940.1 protein_id gnl|my_center|LOCUS_14420 31943 31110 gene locus_tag LOCUS_14430 gene rplB 31943 31110 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055939.1 protein_id gnl|my_center|LOCUS_14430 32282 31977 gene locus_tag LOCUS_14440 32282 31977 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055938.1 protein_id gnl|my_center|LOCUS_14440 32904 32272 gene locus_tag LOCUS_14450 gene rplD 32904 32272 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055937.1 protein_id gnl|my_center|LOCUS_14450 33563 32925 gene locus_tag LOCUS_14460 gene rplC 33563 32925 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055936.1 protein_id gnl|my_center|LOCUS_14460 34897 34559 gene locus_tag LOCUS_14470 34897 34559 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056439.1 protein_id gnl|my_center|LOCUS_14470 35562 35077 gene locus_tag LOCUS_14480 35562 35077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 35761 36420 gene locus_tag LOCUS_14490 35761 36420 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957597.1 protein_id gnl|my_center|LOCUS_14490 36844 36542 gene locus_tag LOCUS_14500 36844 36542 CDS product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056708.1 protein_id gnl|my_center|LOCUS_14500 37218 38027 gene locus_tag LOCUS_14510 37218 38027 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799517.1 protein_id gnl|my_center|LOCUS_14510 38129 38278 gene locus_tag LOCUS_14520 38129 38278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 38298 39248 gene locus_tag LOCUS_14530 gene accD 38298 39248 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057480.1 protein_id gnl|my_center|LOCUS_14530 39717 39334 gene locus_tag LOCUS_14540 39717 39334 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056047.1 protein_id gnl|my_center|LOCUS_14540 39749 40024 gene locus_tag LOCUS_14550 gene purS 39749 40024 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140445.1 protein_id gnl|my_center|LOCUS_14550 40122 40838 gene locus_tag LOCUS_14560 gene purQ 40122 40838 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141325.1 protein_id gnl|my_center|LOCUS_14560 41103 42029 gene locus_tag LOCUS_14570 41103 42029 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920864.1 protein_id gnl|my_center|LOCUS_14570 42061 43152 gene locus_tag LOCUS_14580 gene rfbB 42061 43152 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143225.1 protein_id gnl|my_center|LOCUS_14580 43347 43595 gene locus_tag LOCUS_14590 43347 43595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 43588 43953 gene locus_tag LOCUS_14600 43588 43953 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055894.1 protein_id gnl|my_center|LOCUS_14600 44991 43963 gene locus_tag LOCUS_14610 gene obgE 44991 43963 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058186.1 protein_id gnl|my_center|LOCUS_14610 45248 45036 gene locus_tag LOCUS_14620 45248 45036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 45959 45711 gene locus_tag LOCUS_14630 45959 45711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 47205 46993 gene locus_tag LOCUS_14640 47205 46993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 47402 47208 gene locus_tag LOCUS_14650 47402 47208 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_14650 48202 47510 gene locus_tag LOCUS_14660 48202 47510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_14660 48966 48316 gene locus_tag LOCUS_14670 48966 48316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_14670 49278 49090 gene locus_tag LOCUS_14680 49278 49090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 49325 49525 gene locus_tag LOCUS_14690 49325 49525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 50459 49830 gene locus_tag LOCUS_14700 50459 49830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_14700 51092 50898 gene locus_tag LOCUS_14710 51092 50898 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_14710 51543 51166 gene locus_tag LOCUS_14720 51543 51166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 51866 51540 gene locus_tag LOCUS_14730 51866 51540 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402966.1 protein_id gnl|my_center|LOCUS_14730 52273 52052 gene locus_tag LOCUS_14740 52273 52052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 52795 52301 gene locus_tag LOCUS_14750 52795 52301 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_14750 53069 52779 gene locus_tag LOCUS_14760 53069 52779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 53421 53152 gene locus_tag LOCUS_14770 53421 53152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 53662 53414 gene locus_tag LOCUS_14780 53662 53414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 54619 54368 gene locus_tag LOCUS_14790 54619 54368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 55233 54655 gene locus_tag LOCUS_14800 55233 54655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 56569 55784 gene locus_tag LOCUS_14810 56569 55784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 56990 56688 gene locus_tag LOCUS_14820 56990 56688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 57866 57222 gene locus_tag LOCUS_14830 gene pdxH 57866 57222 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056186.1 protein_id gnl|my_center|LOCUS_14830 57918 58688 gene locus_tag LOCUS_14840 57918 58688 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920913.1 protein_id gnl|my_center|LOCUS_14840 60428 58944 gene locus_tag LOCUS_14850 60428 58944 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142619.1 protein_id gnl|my_center|LOCUS_14850 60696 62003 gene locus_tag LOCUS_14860 60696 62003 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056829.1 protein_id gnl|my_center|LOCUS_14860 62040 62846 gene locus_tag LOCUS_14870 62040 62846 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_14870 64219 62882 gene locus_tag LOCUS_14880 64219 62882 CDS product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226578028.1 protein_id gnl|my_center|LOCUS_14880 64297 66417 gene locus_tag LOCUS_14890 64297 66417 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920752.1 protein_id gnl|my_center|LOCUS_14890 66685 66515 gene locus_tag LOCUS_14900 66685 66515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 67101 66703 gene locus_tag LOCUS_14910 67101 66703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 67960 67148 gene locus_tag LOCUS_14920 gene hypB 67960 67148 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933458.1 protein_id gnl|my_center|LOCUS_14920 68295 67951 gene locus_tag LOCUS_14930 gene hypA 68295 67951 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 protein_id gnl|my_center|LOCUS_14930 69638 68568 gene locus_tag LOCUS_14940 gene hypE 69638 68568 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720673.1 protein_id gnl|my_center|LOCUS_14940 70589 69744 gene locus_tag LOCUS_14950 70589 69744 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_14950 70836 71729 gene locus_tag LOCUS_14960 70836 71729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 71797 74265 gene locus_tag LOCUS_14970 gene recG 71797 74265 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056582.1 protein_id gnl|my_center|LOCUS_14970 75305 74757 gene locus_tag LOCUS_14980 75305 74757 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257073.1 protein_id gnl|my_center|LOCUS_14980 75843 75382 gene locus_tag LOCUS_14990 75843 75382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 76241 75846 gene locus_tag LOCUS_15000 76241 75846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 76966 76250 gene locus_tag LOCUS_15010 gene hoxU 76966 76250 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_15010 78680 77052 gene locus_tag LOCUS_15020 gene hcp 78680 77052 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545464.1 protein_id gnl|my_center|LOCUS_15020 79821 79567 gene locus_tag LOCUS_15030 79821 79567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15030 80276 79950 gene locus_tag LOCUS_15040 80276 79950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258616.1 protein_id gnl|my_center|LOCUS_15040 80731 80519 gene locus_tag LOCUS_15050 80731 80519 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119262.1 protein_id gnl|my_center|LOCUS_15050 82288 80768 gene locus_tag LOCUS_15060 82288 80768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 83700 82384 gene locus_tag LOCUS_15070 83700 82384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 84881 83886 gene locus_tag LOCUS_15080 84881 83886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 85041 85331 gene locus_tag LOCUS_15090 85041 85331 CDS product YiaA/YiaB family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349694.1 protein_id gnl|my_center|LOCUS_15090 85404 86054 gene locus_tag LOCUS_15100 85404 86054 CDS product Coq4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141416.1 protein_id gnl|my_center|LOCUS_15100 86453 87592 gene locus_tag LOCUS_15110 86453 87592 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056246.1 protein_id gnl|my_center|LOCUS_15110 87862 88341 gene locus_tag LOCUS_15120 gene fabZ 87862 88341 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057628.1 protein_id gnl|my_center|LOCUS_15120 88345 89112 gene locus_tag LOCUS_15130 88345 89112 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888398.1 protein_id gnl|my_center|LOCUS_15130 89573 89109 gene locus_tag LOCUS_15140 89573 89109 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143783.1 protein_id gnl|my_center|LOCUS_15140 90542 89724 gene locus_tag LOCUS_15150 90542 89724 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_15150 91415 90615 gene locus_tag LOCUS_15160 91415 90615 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058253.1 protein_id gnl|my_center|LOCUS_15160 92002 93060 gene locus_tag LOCUS_15170 gene nagA 92002 93060 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057928.1 protein_id gnl|my_center|LOCUS_15170 93459 93016 gene locus_tag LOCUS_15180 93459 93016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 94597 93584 gene locus_tag LOCUS_15190 94597 93584 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 protein_id gnl|my_center|LOCUS_15190 95315 94998 gene locus_tag LOCUS_15200 95315 94998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056366.1 protein_id gnl|my_center|LOCUS_15200 96105 95545 gene locus_tag LOCUS_15210 96105 95545 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524131.1 protein_id gnl|my_center|LOCUS_15210 96138 96455 gene locus_tag LOCUS_15220 gene grxC 96138 96455 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056751.1 protein_id gnl|my_center|LOCUS_15220 96440 96934 gene locus_tag LOCUS_15230 96440 96934 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141055.1 protein_id gnl|my_center|LOCUS_15230 98224 97166 gene locus_tag LOCUS_15240 98224 97166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 98498 98268 gene locus_tag LOCUS_15250 98498 98268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 99593 99030 gene locus_tag LOCUS_15260 99593 99030 CDS product DUF4334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090605.1 protein_id gnl|my_center|LOCUS_15260 100115 99672 gene locus_tag LOCUS_15270 100115 99672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 101074 100256 gene locus_tag LOCUS_15280 101074 100256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 101509 102603 gene locus_tag LOCUS_15290 101509 102603 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172598138.1 protein_id gnl|my_center|LOCUS_15290 104138 102666 gene locus_tag LOCUS_15300 104138 102666 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921221.1 protein_id gnl|my_center|LOCUS_15300 104925 106427 gene locus_tag LOCUS_15310 104925 106427 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201884.1 protein_id gnl|my_center|LOCUS_15310 106523 106702 gene locus_tag LOCUS_15320 106523 106702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 106878 108947 gene locus_tag LOCUS_15330 106878 108947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 108975 110186 gene locus_tag LOCUS_15340 108975 110186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 110183 111391 gene locus_tag LOCUS_15350 110183 111391 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_15350 111401 112831 gene locus_tag LOCUS_15360 111401 112831 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057580.1 protein_id gnl|my_center|LOCUS_15360 114198 112846 gene locus_tag LOCUS_15370 114198 112846 CDS product 2-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920832.1 protein_id gnl|my_center|LOCUS_15370 115139 114174 gene locus_tag LOCUS_15380 115139 114174 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057016.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence09 860 1717 gene locus_tag LOCUS_15390 860 1717 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142304.1 protein_id gnl|my_center|LOCUS_15390 1881 2945 gene locus_tag LOCUS_15400 1881 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 3017 4018 gene locus_tag LOCUS_15410 3017 4018 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056735.1 protein_id gnl|my_center|LOCUS_15410 4847 4116 gene locus_tag LOCUS_15420 4847 4116 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_15420 5039 5716 gene locus_tag LOCUS_15430 5039 5716 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090466.1 protein_id gnl|my_center|LOCUS_15430 6368 5736 gene locus_tag LOCUS_15440 6368 5736 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056571.1 protein_id gnl|my_center|LOCUS_15440 6491 8728 gene locus_tag LOCUS_15450 6491 8728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 8752 10263 gene locus_tag LOCUS_15460 8752 10263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 10813 11814 gene locus_tag LOCUS_15470 10813 11814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 13404 13072 gene locus_tag LOCUS_15480 13404 13072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15480 13678 14685 gene locus_tag LOCUS_15490 13678 14685 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056135.1 protein_id gnl|my_center|LOCUS_15490 15207 14863 gene locus_tag LOCUS_15500 15207 14863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 15565 15804 gene locus_tag LOCUS_15510 15565 15804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 16180 17616 gene locus_tag LOCUS_15520 16180 17616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 17597 19837 gene locus_tag LOCUS_15530 17597 19837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 21208 20165 gene locus_tag LOCUS_15540 21208 20165 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903345.1 protein_id gnl|my_center|LOCUS_15540 22254 21211 gene locus_tag LOCUS_15550 22254 21211 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202993.1 protein_id gnl|my_center|LOCUS_15550 22462 23625 gene locus_tag LOCUS_15560 22462 23625 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055867.1 protein_id gnl|my_center|LOCUS_15560 23686 23853 gene locus_tag LOCUS_15570 23686 23853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 23981 25324 gene locus_tag LOCUS_15580 23981 25324 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056381.1 protein_id gnl|my_center|LOCUS_15580 25352 25909 gene locus_tag LOCUS_15590 25352 25909 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140402.1 protein_id gnl|my_center|LOCUS_15590 26773 26018 gene locus_tag LOCUS_15600 26773 26018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_15600 27178 28098 gene locus_tag LOCUS_15610 27178 28098 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057303.1 protein_id gnl|my_center|LOCUS_15610 28185 28448 gene locus_tag LOCUS_15620 28185 28448 CDS product DUF3146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058048.1 protein_id gnl|my_center|LOCUS_15620 28703 29764 gene locus_tag LOCUS_15630 gene argC 28703 29764 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058053.1 protein_id gnl|my_center|LOCUS_15630 30627 30364 gene locus_tag LOCUS_15640 30627 30364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 30898 30614 gene locus_tag LOCUS_15650 30898 30614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 32240 30948 gene locus_tag LOCUS_15660 32240 30948 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057931.1 protein_id gnl|my_center|LOCUS_15660 32390 33445 gene locus_tag LOCUS_15670 gene plsX 32390 33445 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056688.1 protein_id gnl|my_center|LOCUS_15670 33643 34644 gene locus_tag LOCUS_15680 33643 34644 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056689.1 protein_id gnl|my_center|LOCUS_15680 34804 35730 gene locus_tag LOCUS_15690 gene fabD 34804 35730 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920631.1 protein_id gnl|my_center|LOCUS_15690 37060 36728 gene locus_tag LOCUS_15700 37060 36728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15700 37819 37169 gene locus_tag LOCUS_15710 37819 37169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 40469 38100 gene locus_tag LOCUS_15720 gene glgX 40469 38100 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389296.1 protein_id gnl|my_center|LOCUS_15720 40823 40593 gene locus_tag LOCUS_15730 40823 40593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 43078 40835 gene locus_tag LOCUS_15740 43078 40835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 43873 43082 gene locus_tag LOCUS_15750 43873 43082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 44069 44425 gene locus_tag LOCUS_15760 44069 44425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 44431 45096 gene locus_tag LOCUS_15770 44431 45096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 46132 45137 gene locus_tag LOCUS_15780 46132 45137 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057048.1 protein_id gnl|my_center|LOCUS_15780 46654 46938 gene locus_tag LOCUS_15790 46654 46938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 47281 48567 gene locus_tag LOCUS_15800 47281 48567 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_15800 48578 48940 gene locus_tag LOCUS_15810 48578 48940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 49714 48941 gene locus_tag LOCUS_15820 49714 48941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 49842 50735 gene locus_tag LOCUS_15830 49842 50735 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057729.1 protein_id gnl|my_center|LOCUS_15830 51153 50752 gene locus_tag LOCUS_15840 gene aroH 51153 50752 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057640.1 protein_id gnl|my_center|LOCUS_15840 52043 51222 gene locus_tag LOCUS_15850 gene sppA 52043 51222 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057641.1 protein_id gnl|my_center|LOCUS_15850 52480 52650 gene locus_tag LOCUS_15860 52480 52650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 52704 54125 gene locus_tag LOCUS_15870 gene glnA 52704 54125 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057427.1 protein_id gnl|my_center|LOCUS_15870 54490 54897 gene locus_tag LOCUS_15880 54490 54897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140148.1 protein_id gnl|my_center|LOCUS_15880 56559 54910 gene locus_tag LOCUS_15890 56559 54910 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141468.1 protein_id gnl|my_center|LOCUS_15890 58186 57125 gene locus_tag LOCUS_15900 58186 57125 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479721.1 protein_id gnl|my_center|LOCUS_15900 59305 58319 gene locus_tag LOCUS_15910 gene petA 59305 58319 CDS product apocytochrome f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056804.1 protein_id gnl|my_center|LOCUS_15910 59888 59349 gene locus_tag LOCUS_15920 59888 59349 CDS product cytochrome b6-f complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056803.1 protein_id gnl|my_center|LOCUS_15920 60250 63552 gene locus_tag LOCUS_15930 60250 63552 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962208.1 protein_id gnl|my_center|LOCUS_15930 63557 64267 gene locus_tag LOCUS_15940 63557 64267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 64545 64697 gene locus_tag LOCUS_15950 64545 64697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 64697 66310 gene locus_tag LOCUS_15960 64697 66310 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076961.1 protein_id gnl|my_center|LOCUS_15960 66571 66840 gene locus_tag LOCUS_15970 66571 66840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124299.1 protein_id gnl|my_center|LOCUS_15970 67131 67703 gene locus_tag LOCUS_15980 67131 67703 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920717.1 protein_id gnl|my_center|LOCUS_15980 67726 68337 gene locus_tag LOCUS_15990 67726 68337 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142986.1 protein_id gnl|my_center|LOCUS_15990 69185 68466 gene locus_tag LOCUS_16000 gene sfsA 69185 68466 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141732.1 protein_id gnl|my_center|LOCUS_16000 69442 70542 gene locus_tag LOCUS_16010 gene aroC 69442 70542 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_16010 70556 71758 gene locus_tag LOCUS_16020 70556 71758 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075901854.1 protein_id gnl|my_center|LOCUS_16020 72608 72018 gene locus_tag LOCUS_16030 72608 72018 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530066.1 protein_id gnl|my_center|LOCUS_16030 72685 72969 gene locus_tag LOCUS_16040 72685 72969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 72966 73385 gene locus_tag LOCUS_16050 72966 73385 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404325.1 protein_id gnl|my_center|LOCUS_16050 73421 74923 gene locus_tag LOCUS_16060 73421 74923 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_16060 75496 75002 gene locus_tag LOCUS_16070 75496 75002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 75861 76691 gene locus_tag LOCUS_16080 75861 76691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 77504 76821 gene locus_tag LOCUS_16090 77504 76821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 77870 78118 gene locus_tag LOCUS_16100 77870 78118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 79204 78290 gene locus_tag LOCUS_16110 79204 78290 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_16110 79793 79278 gene locus_tag LOCUS_16120 79793 79278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 80332 79961 gene locus_tag LOCUS_16130 80332 79961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 81480 80518 gene locus_tag LOCUS_16140 81480 80518 CDS product orange carotenoid protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140054.1 protein_id gnl|my_center|LOCUS_16140 82760 82002 gene locus_tag LOCUS_16150 82760 82002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140178.1 protein_id gnl|my_center|LOCUS_16150 83646 82831 gene locus_tag LOCUS_16160 83646 82831 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140177.1 protein_id gnl|my_center|LOCUS_16160 84773 83733 gene locus_tag LOCUS_16170 84773 83733 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191315613.1 protein_id gnl|my_center|LOCUS_16170 85526 84837 gene locus_tag LOCUS_16180 gene hypB 85526 84837 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_16180 85941 85585 gene locus_tag LOCUS_16190 85941 85585 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939601.1 protein_id gnl|my_center|LOCUS_16190 87129 85948 gene locus_tag LOCUS_16200 87129 85948 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243172.1 protein_id gnl|my_center|LOCUS_16200 88162 87998 gene locus_tag LOCUS_16210 88162 87998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 88788 88997 gene locus_tag LOCUS_16220 88788 88997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 88994 89248 gene locus_tag LOCUS_16230 88994 89248 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249742.1 protein_id gnl|my_center|LOCUS_16230 90884 89919 gene locus_tag LOCUS_16240 90884 89919 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056460.1 protein_id gnl|my_center|LOCUS_16240 92440 91103 gene locus_tag LOCUS_16250 92440 91103 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920668.1 protein_id gnl|my_center|LOCUS_16250 92947 92570 gene locus_tag LOCUS_16260 92947 92570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057498.1 protein_id gnl|my_center|LOCUS_16260 94702 92984 gene locus_tag LOCUS_16270 94702 92984 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057497.1 protein_id gnl|my_center|LOCUS_16270 95578 94874 gene locus_tag LOCUS_16280 95578 94874 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_16280 95977 95738 gene locus_tag LOCUS_16290 95977 95738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 96104 96370 gene locus_tag LOCUS_16300 96104 96370 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056266.1 protein_id gnl|my_center|LOCUS_16300 96557 96755 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 98508 96862 gene locus_tag LOCUS_16310 98508 96862 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920494.1 protein_id gnl|my_center|LOCUS_16310 99372 98593 gene locus_tag LOCUS_16320 99372 98593 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921431.1 protein_id gnl|my_center|LOCUS_16320 99612 102383 gene locus_tag LOCUS_16330 gene secA 99612 102383 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920904.1 protein_id gnl|my_center|LOCUS_16330 103527 102454 gene locus_tag LOCUS_16340 103527 102454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 104145 103597 gene locus_tag LOCUS_16350 104145 103597 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 protein_id gnl|my_center|LOCUS_16350 104429 105223 gene locus_tag LOCUS_16360 104429 105223 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640545.1 protein_id gnl|my_center|LOCUS_16360 105503 105291 gene locus_tag LOCUS_16370 105503 105291 CDS product DUF3126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153775551.1 protein_id gnl|my_center|LOCUS_16370 105644 105544 gene locus_tag LOCUS_t00130 105644 105544 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 106382 105564 gene locus_tag LOCUS_16380 106382 105564 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921054.1 protein_id gnl|my_center|LOCUS_16380 106959 106384 gene locus_tag LOCUS_16390 106959 106384 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921055.1 protein_id gnl|my_center|LOCUS_16390 107762 106956 gene locus_tag LOCUS_16400 gene thiD 107762 106956 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921056.1 protein_id gnl|my_center|LOCUS_16400 108598 107816 gene locus_tag LOCUS_16410 gene folP 108598 107816 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921057.1 protein_id gnl|my_center|LOCUS_16410 108692 109546 gene locus_tag LOCUS_16420 108692 109546 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920105.1 protein_id gnl|my_center|LOCUS_16420 109657 110850 gene locus_tag LOCUS_16430 109657 110850 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920104.1 protein_id gnl|my_center|LOCUS_16430 110875 111807 gene locus_tag LOCUS_16440 gene argF 110875 111807 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920103.1 protein_id gnl|my_center|LOCUS_16440 111804 112754 gene locus_tag LOCUS_16450 111804 112754 CDS product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920102.1 protein_id gnl|my_center|LOCUS_16450 114055 112826 gene locus_tag LOCUS_16460 114055 112826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 115222 114191 gene locus_tag LOCUS_16470 115222 114191 CDS product cupin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039037.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence10 <1 517 gene locus_tag LOCUS_16480 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021891.1:pentapeptide repeat-containing protein 560 916 gene locus_tag LOCUS_16490 560 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 891 1253 gene locus_tag LOCUS_16500 891 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 2159 1290 gene locus_tag LOCUS_16510 2159 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2626 2399 gene locus_tag LOCUS_16520 2626 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 2864 2613 gene locus_tag LOCUS_16530 2864 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 3619 3134 gene locus_tag LOCUS_16540 gene ruvC 3619 3134 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_16540 4741 3623 gene locus_tag LOCUS_16550 gene wecB 4741 3623 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057875.1 protein_id gnl|my_center|LOCUS_16550 6299 4968 gene locus_tag LOCUS_16560 6299 4968 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144101.1 protein_id gnl|my_center|LOCUS_16560 7131 6346 gene locus_tag LOCUS_16570 7131 6346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920674.1 protein_id gnl|my_center|LOCUS_16570 7679 7203 gene locus_tag LOCUS_16580 7679 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 8131 9279 gene locus_tag LOCUS_16590 8131 9279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 9842 9612 gene locus_tag LOCUS_16600 9842 9612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 10280 10600 gene locus_tag LOCUS_16610 10280 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 10804 11451 gene locus_tag LOCUS_16620 10804 11451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 11676 13184 gene locus_tag LOCUS_16630 gene crtD 11676 13184 CDS product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056087.1 protein_id gnl|my_center|LOCUS_16630 13529 14221 gene locus_tag LOCUS_16640 13529 14221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 15704 14367 gene locus_tag LOCUS_16650 15704 14367 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057372.1 protein_id gnl|my_center|LOCUS_16650 16107 17354 gene locus_tag LOCUS_16660 16107 17354 CDS product DUF4912 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057902.1 protein_id gnl|my_center|LOCUS_16660 19131 17479 gene locus_tag LOCUS_16670 19131 17479 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920935.1 protein_id gnl|my_center|LOCUS_16670 19914 19351 gene locus_tag LOCUS_16680 19914 19351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 21558 20911 gene locus_tag LOCUS_16690 21558 20911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 22578 21904 gene locus_tag LOCUS_16700 22578 21904 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_16700 22810 23226 gene locus_tag LOCUS_16710 22810 23226 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933012.1 protein_id gnl|my_center|LOCUS_16710 25133 23274 gene locus_tag LOCUS_16720 25133 23274 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920919.1 protein_id gnl|my_center|LOCUS_16720 25523 25909 gene locus_tag LOCUS_16730 25523 25909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 27608 26232 gene locus_tag LOCUS_16740 27608 26232 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920940.1 protein_id gnl|my_center|LOCUS_16740 27847 27707 gene locus_tag LOCUS_16750 27847 27707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 28473 30152 gene locus_tag LOCUS_16760 gene pckA 28473 30152 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_16760 31706 30483 gene locus_tag LOCUS_16770 31706 30483 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_16770 32426 31728 gene locus_tag LOCUS_16780 gene urtE 32426 31728 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_16780 33211 32465 gene locus_tag LOCUS_16790 gene urtD 33211 32465 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 protein_id gnl|my_center|LOCUS_16790 34479 33325 gene locus_tag LOCUS_16800 gene urtC 34479 33325 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056964.1 protein_id gnl|my_center|LOCUS_16800 35679 34483 gene locus_tag LOCUS_16810 35679 34483 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056963.1 protein_id gnl|my_center|LOCUS_16810 37090 35774 gene locus_tag LOCUS_16820 gene urtA 37090 35774 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_16820 37460 37481 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37931 37599 gene locus_tag LOCUS_16830 37931 37599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 38145 38750 gene locus_tag LOCUS_16840 38145 38750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 40226 38799 gene locus_tag LOCUS_16850 gene glgA 40226 38799 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056608.1 protein_id gnl|my_center|LOCUS_16850 41196 40867 gene locus_tag LOCUS_16860 41196 40867 CDS product NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141521.1 protein_id gnl|my_center|LOCUS_16860 41488 41757 gene locus_tag LOCUS_16870 gene rpsO 41488 41757 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144014.1 protein_id gnl|my_center|LOCUS_16870 41782 42246 gene locus_tag LOCUS_16880 41782 42246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 42305 43360 gene locus_tag LOCUS_16890 gene aroF 42305 43360 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056213.1 protein_id gnl|my_center|LOCUS_16890 43425 44081 gene locus_tag LOCUS_16900 43425 44081 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017653748.1 protein_id gnl|my_center|LOCUS_16900 44102 44758 gene locus_tag LOCUS_16910 44102 44758 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017653748.1 protein_id gnl|my_center|LOCUS_16910 45288 46103 gene locus_tag LOCUS_16920 45288 46103 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140835.1 protein_id gnl|my_center|LOCUS_16920 46243 46977 gene locus_tag LOCUS_16930 46243 46977 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057263.1 protein_id gnl|my_center|LOCUS_16930 47074 47931 gene locus_tag LOCUS_16940 47074 47931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 48180 49022 gene locus_tag LOCUS_16950 48180 49022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142083.1 protein_id gnl|my_center|LOCUS_16950 49036 49695 gene locus_tag LOCUS_16960 49036 49695 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057788.1 protein_id gnl|my_center|LOCUS_16960 49722 50591 gene locus_tag LOCUS_16970 49722 50591 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287606.1 protein_id gnl|my_center|LOCUS_16970 51379 51029 gene locus_tag LOCUS_16980 51379 51029 CDS product DUF760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057859.1 protein_id gnl|my_center|LOCUS_16980 52033 51515 gene locus_tag LOCUS_16990 gene scpB 52033 51515 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056690.1 protein_id gnl|my_center|LOCUS_16990 52095 52907 gene locus_tag LOCUS_17000 52095 52907 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057953.1 protein_id gnl|my_center|LOCUS_17000 52967 53731 gene locus_tag LOCUS_17010 52967 53731 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057606.1 protein_id gnl|my_center|LOCUS_17010 54069 53791 gene locus_tag LOCUS_17020 54069 53791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 54473 54111 gene locus_tag LOCUS_17030 54473 54111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 56467 54884 gene locus_tag LOCUS_17040 gene ndhD1 56467 54884 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit D1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056566.1 protein_id gnl|my_center|LOCUS_17040 57737 57000 gene locus_tag LOCUS_17050 57737 57000 CDS product phycocyanobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058141.1 protein_id gnl|my_center|LOCUS_17050 57906 60218 gene locus_tag LOCUS_17060 57906 60218 CDS product DUF3488 and DUF4129 domain-containing transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056828.1 protein_id gnl|my_center|LOCUS_17060 60805 60599 gene locus_tag LOCUS_17070 60805 60599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 61133 61381 gene locus_tag LOCUS_17080 61133 61381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 61458 62615 gene locus_tag LOCUS_17090 61458 62615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 62940 63404 gene locus_tag LOCUS_17100 62940 63404 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140032.1 protein_id gnl|my_center|LOCUS_17100 63680 63477 gene locus_tag LOCUS_17110 63680 63477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530057.1 protein_id gnl|my_center|LOCUS_17110 63751 64266 gene locus_tag LOCUS_17120 63751 64266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 64304 64801 gene locus_tag LOCUS_17130 64304 64801 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_17130 65001 65882 gene locus_tag LOCUS_17140 65001 65882 CDS product 4-hydroxybenzoate solanesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143417.1 protein_id gnl|my_center|LOCUS_17140 66488 65922 gene locus_tag LOCUS_17150 66488 65922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 66615 66854 gene locus_tag LOCUS_17160 66615 66854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125028.1 protein_id gnl|my_center|LOCUS_17160 69119 66819 gene locus_tag LOCUS_17170 69119 66819 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056167.1 protein_id gnl|my_center|LOCUS_17170 70436 69462 gene locus_tag LOCUS_17180 gene tilS 70436 69462 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057455.1 protein_id gnl|my_center|LOCUS_17180 71599 70652 gene locus_tag LOCUS_17190 gene hemF 71599 70652 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920736.1 protein_id gnl|my_center|LOCUS_17190 72656 71868 gene locus_tag LOCUS_17200 72656 71868 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408189.1 protein_id gnl|my_center|LOCUS_17200 73653 72736 gene locus_tag LOCUS_17210 73653 72736 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056702.1 protein_id gnl|my_center|LOCUS_17210 74654 73677 gene locus_tag LOCUS_17220 74654 73677 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056703.1 protein_id gnl|my_center|LOCUS_17220 75606 74716 gene locus_tag LOCUS_17230 75606 74716 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055901.1 protein_id gnl|my_center|LOCUS_17230 75692 76501 gene locus_tag LOCUS_17240 75692 76501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 77446 77018 gene locus_tag LOCUS_17250 77446 77018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 78367 77525 gene locus_tag LOCUS_17260 gene folP 78367 77525 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057362.1 protein_id gnl|my_center|LOCUS_17260 79259 78462 gene locus_tag LOCUS_17270 79259 78462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 80086 79427 gene locus_tag LOCUS_17280 80086 79427 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057008.1 protein_id gnl|my_center|LOCUS_17280 80596 80123 gene locus_tag LOCUS_17290 gene coaD 80596 80123 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057007.1 protein_id gnl|my_center|LOCUS_17290 80877 80593 gene locus_tag LOCUS_17300 80877 80593 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057607.1 protein_id gnl|my_center|LOCUS_17300 81228 80911 gene locus_tag LOCUS_17310 gene trxA 81228 80911 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921014.1 protein_id gnl|my_center|LOCUS_17310 81361 82206 gene locus_tag LOCUS_17320 gene map 81361 82206 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056279.1 protein_id gnl|my_center|LOCUS_17320 82297 82698 gene locus_tag LOCUS_17330 82297 82698 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920646.1 protein_id gnl|my_center|LOCUS_17330 83137 83361 gene locus_tag LOCUS_17340 83137 83361 CDS product DUF2811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140944.1 protein_id gnl|my_center|LOCUS_17340 83411 84037 gene locus_tag LOCUS_17350 gene pth 83411 84037 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140541.1 protein_id gnl|my_center|LOCUS_17350 84172 86499 gene locus_tag LOCUS_17360 84172 86499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 88023 86620 gene locus_tag LOCUS_17370 gene fumC 88023 86620 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083118.1 protein_id gnl|my_center|LOCUS_17370 88278 88565 gene locus_tag LOCUS_17380 88278 88565 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920900.1 protein_id gnl|my_center|LOCUS_17380 89724 88570 gene locus_tag LOCUS_17390 gene gshA 89724 88570 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056177.1 protein_id gnl|my_center|LOCUS_17390 90156 89764 gene locus_tag LOCUS_17400 gene ruvX 90156 89764 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920731.1 protein_id gnl|my_center|LOCUS_17400 90864 90457 gene locus_tag LOCUS_17410 90864 90457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 91075 90842 gene locus_tag LOCUS_17420 91075 90842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 91411 91172 gene locus_tag LOCUS_17430 91411 91172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 93349 91487 gene locus_tag LOCUS_17440 93349 91487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 93723 93439 gene locus_tag LOCUS_17450 93723 93439 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920842.1 protein_id gnl|my_center|LOCUS_17450 94019 93726 gene locus_tag LOCUS_17460 gene clpS 94019 93726 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056930.1 protein_id gnl|my_center|LOCUS_17460 95208 94075 gene locus_tag LOCUS_17470 95208 94075 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056273.1 protein_id gnl|my_center|LOCUS_17470 95966 95304 gene locus_tag LOCUS_17480 95966 95304 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142845.1 protein_id gnl|my_center|LOCUS_17480 96077 97018 gene locus_tag LOCUS_17490 96077 97018 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058107.1 protein_id gnl|my_center|LOCUS_17490 97258 98607 gene locus_tag LOCUS_17500 97258 98607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 98608 99300 gene locus_tag LOCUS_17510 98608 99300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 99579 100277 gene locus_tag LOCUS_17520 99579 100277 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141522.1 protein_id gnl|my_center|LOCUS_17520 100495 101187 gene locus_tag LOCUS_17530 100495 101187 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141522.1 protein_id gnl|my_center|LOCUS_17530 101570 102994 gene locus_tag LOCUS_17540 101570 102994 CDS product deoxyribodipyrimidine photo-lyase, 8-HDF type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056280.1 protein_id gnl|my_center|LOCUS_17540 105646 103001 gene locus_tag LOCUS_17550 105646 103001 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141744.1 protein_id gnl|my_center|LOCUS_17550 107411 106377 gene locus_tag LOCUS_17560 gene trpD 107411 106377 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057551.1 protein_id gnl|my_center|LOCUS_17560 108018 107491 gene locus_tag LOCUS_17570 108018 107491 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057421.1 protein_id gnl|my_center|LOCUS_17570 108212 108799 gene locus_tag LOCUS_17580 108212 108799 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920984.1 protein_id gnl|my_center|LOCUS_17580 108802 109611 gene locus_tag LOCUS_17590 108802 109611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 110017 109547 gene locus_tag LOCUS_17600 110017 109547 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171945.1 protein_id gnl|my_center|LOCUS_17600 <110674 110121 gene locus_tag LOCUS_17610 <110674 110121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056077.1:RNA-guided endonuclease TnpB family protein >Feature sequence11 1122 214 gene locus_tag LOCUS_17620 1122 214 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919502.1 protein_id gnl|my_center|LOCUS_17620 1885 1127 gene locus_tag LOCUS_17630 1885 1127 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920524.1 protein_id gnl|my_center|LOCUS_17630 1972 2793 gene locus_tag LOCUS_17640 gene map 1972 2793 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920527.1 protein_id gnl|my_center|LOCUS_17640 2852 4384 gene locus_tag LOCUS_17650 2852 4384 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144406.1 protein_id gnl|my_center|LOCUS_17650 4403 4846 gene locus_tag LOCUS_17660 4403 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 4836 5291 gene locus_tag LOCUS_17670 4836 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 5314 7011 gene locus_tag LOCUS_17680 5314 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 7233 7024 gene locus_tag LOCUS_17690 7233 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 7690 7451 gene locus_tag LOCUS_17700 7690 7451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 8283 7732 gene locus_tag LOCUS_17710 8283 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 9757 8435 gene locus_tag LOCUS_17720 9757 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 11845 10589 gene locus_tag LOCUS_17730 11845 10589 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938989.1 protein_id gnl|my_center|LOCUS_17730 12831 11827 gene locus_tag LOCUS_17740 12831 11827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 13106 12906 gene locus_tag LOCUS_17750 13106 12906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 13228 15945 gene locus_tag LOCUS_17760 13228 15945 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048879517.1 protein_id gnl|my_center|LOCUS_17760 16001 16411 gene locus_tag LOCUS_17770 16001 16411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 16439 18508 gene locus_tag LOCUS_17780 16439 18508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039745.1 protein_id gnl|my_center|LOCUS_17780 18501 19688 gene locus_tag LOCUS_17790 18501 19688 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037257.1 protein_id gnl|my_center|LOCUS_17790 19848 20897 gene locus_tag LOCUS_17800 19848 20897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 21250 20927 gene locus_tag LOCUS_17810 21250 20927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 21749 21285 gene locus_tag LOCUS_17820 21749 21285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 22244 21786 gene locus_tag LOCUS_17830 22244 21786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 22444 22629 gene locus_tag LOCUS_17840 22444 22629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 22742 22924 gene locus_tag LOCUS_17850 22742 22924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 22924 23121 gene locus_tag LOCUS_17860 22924 23121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 23407 23144 gene locus_tag LOCUS_17870 23407 23144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 23528 23974 gene locus_tag LOCUS_17880 23528 23974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 24341 25072 gene locus_tag LOCUS_17890 24341 25072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 25735 25187 gene locus_tag LOCUS_17900 25735 25187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088355.1 protein_id gnl|my_center|LOCUS_17900 25996 26511 gene locus_tag LOCUS_17910 25996 26511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 26544 27107 gene locus_tag LOCUS_17920 26544 27107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 27194 27478 gene locus_tag LOCUS_17930 27194 27478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 27489 27743 gene locus_tag LOCUS_17940 27489 27743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 27789 28391 gene locus_tag LOCUS_17950 27789 28391 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_17950 29034 28555 gene locus_tag LOCUS_17960 29034 28555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 28931 29167 gene locus_tag LOCUS_17970 28931 29167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 29653 29255 gene locus_tag LOCUS_17980 29653 29255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 29794 30069 gene locus_tag LOCUS_17990 29794 30069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 30187 30444 gene locus_tag LOCUS_18000 30187 30444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 30838 30449 gene locus_tag LOCUS_18010 30838 30449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 31387 31025 gene locus_tag LOCUS_18020 31387 31025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 31854 31408 gene locus_tag LOCUS_18030 31854 31408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 32264 31851 gene locus_tag LOCUS_18040 32264 31851 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640096.1 protein_id gnl|my_center|LOCUS_18040 32967 32539 gene locus_tag LOCUS_18050 32967 32539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 33194 33532 gene locus_tag LOCUS_18060 33194 33532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 33721 34665 gene locus_tag LOCUS_18070 33721 34665 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_18070 34662 35177 gene locus_tag LOCUS_18080 34662 35177 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918967.1 protein_id gnl|my_center|LOCUS_18080 35236 35475 gene locus_tag LOCUS_18090 35236 35475 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640511.1 protein_id gnl|my_center|LOCUS_18090 35478 36401 gene locus_tag LOCUS_18100 35478 36401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920361.1 protein_id gnl|my_center|LOCUS_18100 37481 36405 gene locus_tag LOCUS_18110 37481 36405 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027999116.1 protein_id gnl|my_center|LOCUS_18110 37593 37940 gene locus_tag LOCUS_18120 gene grxD 37593 37940 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920362.1 protein_id gnl|my_center|LOCUS_18120 37947 38375 gene locus_tag LOCUS_18130 37947 38375 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920363.1 protein_id gnl|my_center|LOCUS_18130 38769 38380 gene locus_tag LOCUS_18140 38769 38380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 39512 38895 gene locus_tag LOCUS_18150 gene rpsD 39512 38895 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920368.1 protein_id gnl|my_center|LOCUS_18150 40607 39663 gene locus_tag LOCUS_18160 40607 39663 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974583.1 protein_id gnl|my_center|LOCUS_18160 41316 40708 gene locus_tag LOCUS_18170 41316 40708 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919645.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18170 41630 41406 gene locus_tag LOCUS_18180 41630 41406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 42467 41634 gene locus_tag LOCUS_18190 gene fghA 42467 41634 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920372.1 protein_id gnl|my_center|LOCUS_18190 43165 42467 gene locus_tag LOCUS_18200 43165 42467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 43628 43236 gene locus_tag LOCUS_18210 43628 43236 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491259.1 protein_id gnl|my_center|LOCUS_18210 44091 43690 gene locus_tag LOCUS_18220 44091 43690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 45208 44102 gene locus_tag LOCUS_18230 45208 44102 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920373.1 protein_id gnl|my_center|LOCUS_18230 45846 45274 gene locus_tag LOCUS_18240 45846 45274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 46531 46729 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46818 47099 gene locus_tag LOCUS_18250 46818 47099 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_18250 47116 47430 gene locus_tag LOCUS_18260 47116 47430 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_18260 48690 47713 gene locus_tag LOCUS_18270 48690 47713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 50575 49256 gene locus_tag LOCUS_18280 50575 49256 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058262.1 protein_id gnl|my_center|LOCUS_18280 50726 51562 gene locus_tag LOCUS_18290 gene lpxA 50726 51562 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921189.1 protein_id gnl|my_center|LOCUS_18290 51801 53003 gene locus_tag LOCUS_18300 gene lpxB 51801 53003 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056176.1 protein_id gnl|my_center|LOCUS_18300 56475 53431 gene locus_tag LOCUS_18310 gene gcvP 56475 53431 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140250.1 protein_id gnl|my_center|LOCUS_18310 58152 56527 gene locus_tag LOCUS_18320 58152 56527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 58473 59285 gene locus_tag LOCUS_18330 58473 59285 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176088.1 protein_id gnl|my_center|LOCUS_18330 59692 59342 gene locus_tag LOCUS_18340 59692 59342 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057330.1 protein_id gnl|my_center|LOCUS_18340 59916 60953 gene locus_tag LOCUS_18350 59916 60953 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056782.1 protein_id gnl|my_center|LOCUS_18350 61044 61793 gene locus_tag LOCUS_18360 61044 61793 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056783.1 protein_id gnl|my_center|LOCUS_18360 61805 62341 gene locus_tag LOCUS_18370 gene mreD 61805 62341 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144384.1 protein_id gnl|my_center|LOCUS_18370 62614 65064 gene locus_tag LOCUS_18380 62614 65064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 65514 67274 gene locus_tag LOCUS_18390 65514 67274 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 protein_id gnl|my_center|LOCUS_18390 67297 68220 gene locus_tag LOCUS_18400 67297 68220 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057302.1 protein_id gnl|my_center|LOCUS_18400 69187 70401 gene locus_tag LOCUS_18410 69187 70401 CDS product ISL3-like element ISBma1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538232.1 protein_id gnl|my_center|LOCUS_18410 70456 70623 gene locus_tag LOCUS_18420 70456 70623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 71604 71362 gene locus_tag LOCUS_18430 71604 71362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 72630 72058 gene locus_tag LOCUS_18440 72630 72058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18440 72954 73163 gene locus_tag LOCUS_18450 72954 73163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 73441 77631 gene locus_tag LOCUS_18460 73441 77631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 77654 79786 gene locus_tag LOCUS_18470 77654 79786 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021631.1 protein_id gnl|my_center|LOCUS_18470 79904 82078 gene locus_tag LOCUS_18480 79904 82078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 82130 82696 gene locus_tag LOCUS_18490 82130 82696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 83031 83528 gene locus_tag LOCUS_18500 83031 83528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 83513 83914 gene locus_tag LOCUS_18510 83513 83914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18510 83871 84113 gene locus_tag LOCUS_18520 83871 84113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 84315 85835 gene locus_tag LOCUS_18530 gene kaiC 84315 85835 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259117.1 protein_id gnl|my_center|LOCUS_18530 85916 86746 gene locus_tag LOCUS_18540 85916 86746 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929594.1 protein_id gnl|my_center|LOCUS_18540 86832 89456 gene locus_tag LOCUS_18550 86832 89456 CDS product trans-splicing intein-formed DNA polymerase III subunit alpha N-terminal partner DnaE-N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057891.1 protein_id gnl|my_center|LOCUS_18550 92555 89680 gene locus_tag LOCUS_r00010 92555 89680 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 92783 92708 gene locus_tag LOCUS_t00140 92783 92708 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 94401 92917 gene locus_tag LOCUS_r00020 94401 92917 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 95095 95973 gene locus_tag LOCUS_18560 95095 95973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 96313 98388 gene locus_tag LOCUS_18570 96313 98388 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057626.1 protein_id gnl|my_center|LOCUS_18570 98481 99293 gene locus_tag LOCUS_18580 gene lpxC 98481 99293 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057627.1 protein_id gnl|my_center|LOCUS_18580 100726 99620 gene locus_tag LOCUS_18590 100726 99620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 101352 102521 gene locus_tag LOCUS_18600 gene acsF 101352 102521 CDS product magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920870.1 protein_id gnl|my_center|LOCUS_18600 102678 103199 gene locus_tag LOCUS_18610 102678 103199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence12 766 188 gene locus_tag LOCUS_18620 gene rimM 766 188 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056908.1 protein_id gnl|my_center|LOCUS_18620 1741 896 gene locus_tag LOCUS_18630 1741 896 CDS product ISKra4-like element ISGvi7 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929313.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18630 1959 1750 gene locus_tag LOCUS_18640 1959 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 2187 2984 gene locus_tag LOCUS_18650 2187 2984 CDS product Tab2/Atab2 family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057694.1 protein_id gnl|my_center|LOCUS_18650 3761 2967 gene locus_tag LOCUS_18660 3761 2967 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928875.1 protein_id gnl|my_center|LOCUS_18660 4525 4139 gene locus_tag LOCUS_18670 4525 4139 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056992.1 protein_id gnl|my_center|LOCUS_18670 5049 6041 gene locus_tag LOCUS_18680 5049 6041 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057591.1 protein_id gnl|my_center|LOCUS_18680 6115 7116 gene locus_tag LOCUS_18690 6115 7116 CDS product curli production assembly/transport component CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869127.1 protein_id gnl|my_center|LOCUS_18690 7916 8878 gene locus_tag LOCUS_18700 7916 8878 CDS product protochlorophyllide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056423.1 protein_id gnl|my_center|LOCUS_18700 10320 9112 gene locus_tag LOCUS_18710 gene gltS 10320 9112 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094878.1 protein_id gnl|my_center|LOCUS_18710 12472 10568 gene locus_tag LOCUS_18720 gene dnaK 12472 10568 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057570.1 protein_id gnl|my_center|LOCUS_18720 12830 14011 gene locus_tag LOCUS_18730 12830 14011 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207588.1 protein_id gnl|my_center|LOCUS_18730 14093 14704 gene locus_tag LOCUS_18740 14093 14704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 14966 14745 gene locus_tag LOCUS_18750 14966 14745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 16274 14988 gene locus_tag LOCUS_18760 16274 14988 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_18760 16878 16435 gene locus_tag LOCUS_18770 16878 16435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 17854 18339 gene locus_tag LOCUS_18780 17854 18339 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920767.1 protein_id gnl|my_center|LOCUS_18780 18510 20441 gene locus_tag LOCUS_18790 18510 20441 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797673.1 protein_id gnl|my_center|LOCUS_18790 20557 20838 gene locus_tag LOCUS_18800 20557 20838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 20871 21446 gene locus_tag LOCUS_18810 20871 21446 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_18810 21519 22328 gene locus_tag LOCUS_18820 21519 22328 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989683.1 protein_id gnl|my_center|LOCUS_18820 23863 23492 gene locus_tag LOCUS_18830 23863 23492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18830 24345 23893 gene locus_tag LOCUS_18840 24345 23893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 26054 24399 gene locus_tag LOCUS_18850 26054 24399 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929004.1 protein_id gnl|my_center|LOCUS_18850 27873 26131 gene locus_tag LOCUS_18860 27873 26131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056502.1 protein_id gnl|my_center|LOCUS_18860 28493 30622 gene locus_tag LOCUS_18870 28493 30622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 32294 31050 gene locus_tag LOCUS_18880 32294 31050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 33053 32340 gene locus_tag LOCUS_18890 33053 32340 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141338.1 protein_id gnl|my_center|LOCUS_18890 33974 33339 gene locus_tag LOCUS_18900 33974 33339 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141001.1 protein_id gnl|my_center|LOCUS_18900 34671 34033 gene locus_tag LOCUS_18910 34671 34033 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798139.1 protein_id gnl|my_center|LOCUS_18910 36562 36143 gene locus_tag LOCUS_18920 36562 36143 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057574.1 protein_id gnl|my_center|LOCUS_18920 37107 36730 gene locus_tag LOCUS_18930 37107 36730 CDS product DUF3110 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056170.1 protein_id gnl|my_center|LOCUS_18930 37648 37187 gene locus_tag LOCUS_18940 37648 37187 CDS product DUF2996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799827.1 protein_id gnl|my_center|LOCUS_18940 38419 38033 gene locus_tag LOCUS_18950 38419 38033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 39947 38460 gene locus_tag LOCUS_18960 39947 38460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 42240 40222 gene locus_tag LOCUS_18970 gene ligA 42240 40222 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056701.1 protein_id gnl|my_center|LOCUS_18970 42821 42255 gene locus_tag LOCUS_18980 42821 42255 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 protein_id gnl|my_center|LOCUS_18980 44284 42962 gene locus_tag LOCUS_18990 44284 42962 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058098.1 protein_id gnl|my_center|LOCUS_18990 44346 44819 gene locus_tag LOCUS_19000 44346 44819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143336.1 protein_id gnl|my_center|LOCUS_19000 45083 46066 gene locus_tag LOCUS_19010 45083 46066 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986681.1 protein_id gnl|my_center|LOCUS_19010 46063 46332 gene locus_tag LOCUS_19020 46063 46332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 46338 49400 gene locus_tag LOCUS_19030 46338 49400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 49425 50843 gene locus_tag LOCUS_19040 49425 50843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 51911 52396 gene locus_tag LOCUS_19050 51911 52396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 52418 53164 gene locus_tag LOCUS_19060 52418 53164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 53550 55655 gene locus_tag LOCUS_19070 53550 55655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 56764 55841 gene locus_tag LOCUS_19080 56764 55841 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_19080 57121 56786 gene locus_tag LOCUS_19090 57121 56786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 57406 58923 gene locus_tag LOCUS_19100 57406 58923 CDS product methyltransferase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387742.1 protein_id gnl|my_center|LOCUS_19100 60589 59471 gene locus_tag LOCUS_19110 60589 59471 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056664.1 protein_id gnl|my_center|LOCUS_19110 60979 62139 gene locus_tag LOCUS_19120 gene mtnW 60979 62139 CDS product 2,3-diketo-5-methylthiopentyl-1-phosphate enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245108.1 protein_id gnl|my_center|LOCUS_19120 63698 62415 gene locus_tag LOCUS_19130 gene serS 63698 62415 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057392.1 protein_id gnl|my_center|LOCUS_19130 64022 64624 gene locus_tag LOCUS_19140 64022 64624 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057675.1 protein_id gnl|my_center|LOCUS_19140 64735 65697 gene locus_tag LOCUS_19150 64735 65697 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057967.1 protein_id gnl|my_center|LOCUS_19150 66268 65759 gene locus_tag LOCUS_19160 66268 65759 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142230.1 protein_id gnl|my_center|LOCUS_19160 66573 67526 gene locus_tag LOCUS_19170 66573 67526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 70468 67541 gene locus_tag LOCUS_19180 70468 67541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 70799 71734 gene locus_tag LOCUS_19190 70799 71734 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_19190 71731 72513 gene locus_tag LOCUS_19200 71731 72513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 72696 73232 gene locus_tag LOCUS_19210 72696 73232 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921042.1 protein_id gnl|my_center|LOCUS_19210 75086 73287 gene locus_tag LOCUS_19220 75086 73287 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421615.1 protein_id gnl|my_center|LOCUS_19220 77871 75091 gene locus_tag LOCUS_19230 77871 75091 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057066.1 protein_id gnl|my_center|LOCUS_19230 78317 79747 gene locus_tag LOCUS_19240 gene pds 78317 79747 CDS product 15-cis-phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124322.1 protein_id gnl|my_center|LOCUS_19240 79853 80785 gene locus_tag LOCUS_19250 79853 80785 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057400.1 protein_id gnl|my_center|LOCUS_19250 81436 81098 gene locus_tag LOCUS_19260 81436 81098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 82037 82279 gene locus_tag LOCUS_19270 82037 82279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 83032 82340 gene locus_tag LOCUS_19280 83032 82340 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_19280 83484 83750 gene locus_tag LOCUS_19290 83484 83750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 84303 83785 gene locus_tag LOCUS_19300 84303 83785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 84820 84449 gene locus_tag LOCUS_19310 84820 84449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19310 85038 84829 gene locus_tag LOCUS_19320 85038 84829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 85287 85096 gene locus_tag LOCUS_19330 85287 85096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 85229 85756 gene locus_tag LOCUS_19340 85229 85756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 86970 86428 gene locus_tag LOCUS_19350 86970 86428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 86969 87928 gene locus_tag LOCUS_19360 86969 87928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228636.1 protein_id gnl|my_center|LOCUS_19360 88047 93947 gene locus_tag LOCUS_19370 88047 93947 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831510.1 protein_id gnl|my_center|LOCUS_19370 93997 94563 gene locus_tag LOCUS_19380 93997 94563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228656.1 protein_id gnl|my_center|LOCUS_19380 95635 94694 gene locus_tag LOCUS_19390 95635 94694 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957516.1 protein_id gnl|my_center|LOCUS_19390 95690 95902 gene locus_tag LOCUS_19400 95690 95902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 95899 96312 gene locus_tag LOCUS_19410 95899 96312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 96708 96325 gene locus_tag LOCUS_19420 96708 96325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 97036 97464 gene locus_tag LOCUS_19430 97036 97464 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228629.1 protein_id gnl|my_center|LOCUS_19430 98822 97659 gene locus_tag LOCUS_19440 gene devC 98822 97659 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_19440 100206 98839 gene locus_tag LOCUS_19450 100206 98839 CDS product ABC exporter membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056492.1 protein_id gnl|my_center|LOCUS_19450 100455 101309 gene locus_tag LOCUS_19460 100455 101309 CDS product DUF1702 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086861803.1 protein_id gnl|my_center|LOCUS_19460 101361 103259 gene locus_tag LOCUS_19470 101361 103259 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228637.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence13 838 3006 gene locus_tag LOCUS_19480 gene ppk1 838 3006 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921077.1 protein_id gnl|my_center|LOCUS_19480 3229 3402 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttgcttccaattcgtgaagcgt 3830 4075 gene locus_tag LOCUS_19490 3830 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 6428 4770 gene locus_tag LOCUS_19500 6428 4770 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_19500 6592 8028 gene locus_tag LOCUS_19510 6592 8028 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_19510 10258 8534 gene locus_tag LOCUS_19520 10258 8534 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141773.1 protein_id gnl|my_center|LOCUS_19520 10922 10596 gene locus_tag LOCUS_19530 10922 10596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 11984 11748 gene locus_tag LOCUS_19540 11984 11748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 12558 12124 gene locus_tag LOCUS_19550 12558 12124 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_19550 12929 12558 gene locus_tag LOCUS_19560 12929 12558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 13574 13140 gene locus_tag LOCUS_19570 13574 13140 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_19570 13804 13577 gene locus_tag LOCUS_19580 13804 13577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 14148 13927 gene locus_tag LOCUS_19590 14148 13927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 14403 14630 gene locus_tag LOCUS_19600 14403 14630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 14570 16411 gene locus_tag LOCUS_19610 14570 16411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 16500 17651 gene locus_tag LOCUS_19620 16500 17651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 18009 18212 gene locus_tag LOCUS_19630 18009 18212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 18187 18510 gene locus_tag LOCUS_19640 18187 18510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 18713 18507 gene locus_tag LOCUS_19650 18713 18507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 19302 19069 gene locus_tag LOCUS_19660 19302 19069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 19613 19287 gene locus_tag LOCUS_19670 19613 19287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 21412 23139 gene locus_tag LOCUS_19680 gene murJ 21412 23139 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058183.1 protein_id gnl|my_center|LOCUS_19680 24035 23385 gene locus_tag LOCUS_19690 24035 23385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 25470 24190 gene locus_tag LOCUS_19700 gene hisS 25470 24190 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057735.1 protein_id gnl|my_center|LOCUS_19700 27604 25877 gene locus_tag LOCUS_19710 27604 25877 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083755.1 protein_id gnl|my_center|LOCUS_19710 27761 28069 gene locus_tag LOCUS_19720 27761 28069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 28235 29179 gene locus_tag LOCUS_19730 28235 29179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 29272 30168 gene locus_tag LOCUS_19740 29272 30168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 30286 33426 gene locus_tag LOCUS_19750 30286 33426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 33430 33969 gene locus_tag LOCUS_19760 33430 33969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 33977 34285 gene locus_tag LOCUS_19770 33977 34285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 34428 34706 gene locus_tag LOCUS_19780 34428 34706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 35647 34871 gene locus_tag LOCUS_19790 gene fabI 35647 34871 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057530.1 protein_id gnl|my_center|LOCUS_19790 35862 36539 gene locus_tag LOCUS_19800 gene ntcA 35862 36539 CDS product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920910.1 protein_id gnl|my_center|LOCUS_19800 36547 38034 gene locus_tag LOCUS_19810 36547 38034 CDS product DUF3084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057621.1 protein_id gnl|my_center|LOCUS_19810 38644 38048 gene locus_tag LOCUS_19820 38644 38048 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_19820 39288 38713 gene locus_tag LOCUS_19830 39288 38713 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_19830 40606 39335 gene locus_tag LOCUS_19840 40606 39335 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393799.1 protein_id gnl|my_center|LOCUS_19840 42188 40866 gene locus_tag LOCUS_19850 42188 40866 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140425.1 protein_id gnl|my_center|LOCUS_19850 43288 42395 gene locus_tag LOCUS_19860 43288 42395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 44544 43558 gene locus_tag LOCUS_19870 gene ccsB 44544 43558 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057454.1 protein_id gnl|my_center|LOCUS_19870 44677 46641 gene locus_tag LOCUS_19880 gene ftsH 44677 46641 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 protein_id gnl|my_center|LOCUS_19880 48801 46900 gene locus_tag LOCUS_19890 48801 46900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 49138 48785 gene locus_tag LOCUS_19900 49138 48785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 49804 49253 gene locus_tag LOCUS_19910 49804 49253 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056210.1 protein_id gnl|my_center|LOCUS_19910 49846 50250 gene locus_tag LOCUS_19920 49846 50250 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057637.1 protein_id gnl|my_center|LOCUS_19920 50486 51895 gene locus_tag LOCUS_19930 50486 51895 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057055.1 protein_id gnl|my_center|LOCUS_19930 53283 51907 gene locus_tag LOCUS_19940 53283 51907 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948760.1 protein_id gnl|my_center|LOCUS_19940 54792 53314 gene locus_tag LOCUS_19950 54792 53314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057099.1 protein_id gnl|my_center|LOCUS_19950 55630 54839 gene locus_tag LOCUS_19960 55630 54839 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172597933.1 protein_id gnl|my_center|LOCUS_19960 56665 55655 gene locus_tag LOCUS_19970 56665 55655 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056460.1 protein_id gnl|my_center|LOCUS_19970 57781 56972 gene locus_tag LOCUS_19980 gene larE 57781 56972 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920840.1 protein_id gnl|my_center|LOCUS_19980 58015 58329 gene locus_tag LOCUS_19990 58015 58329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 58574 58389 gene locus_tag LOCUS_20000 58574 58389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 58790 58575 gene locus_tag LOCUS_20010 58790 58575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 59275 58913 gene locus_tag LOCUS_20020 59275 58913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142930.1 protein_id gnl|my_center|LOCUS_20020 59766 59425 gene locus_tag LOCUS_20030 59766 59425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 60035 59754 gene locus_tag LOCUS_20040 60035 59754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 60169 60050 gene locus_tag LOCUS_20050 60169 60050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 61662 60457 gene locus_tag LOCUS_20060 61662 60457 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056559.1 protein_id gnl|my_center|LOCUS_20060 63753 61825 gene locus_tag LOCUS_20070 63753 61825 CDS product DICT sensory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057496.1 protein_id gnl|my_center|LOCUS_20070 64334 64200 gene locus_tag LOCUS_20080 64334 64200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 64417 65355 gene locus_tag LOCUS_20090 64417 65355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 66528 65401 gene locus_tag LOCUS_20100 66528 65401 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057098.1 protein_id gnl|my_center|LOCUS_20100 67034 66525 gene locus_tag LOCUS_20110 67034 66525 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125313.1 protein_id gnl|my_center|LOCUS_20110 67219 67608 gene locus_tag LOCUS_20120 67219 67608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 67670 69388 gene locus_tag LOCUS_20130 67670 69388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 69596 70459 gene locus_tag LOCUS_20140 69596 70459 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_20140 71078 70695 gene locus_tag LOCUS_20150 71078 70695 CDS product DUF4346 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056206.1 protein_id gnl|my_center|LOCUS_20150 72903 71509 gene locus_tag LOCUS_20160 72903 71509 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039725284.1 protein_id gnl|my_center|LOCUS_20160 74996 73290 gene locus_tag LOCUS_20170 74996 73290 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898994.1 protein_id gnl|my_center|LOCUS_20170 75885 75424 gene locus_tag LOCUS_20180 75885 75424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 77216 76239 gene locus_tag LOCUS_20190 77216 76239 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463394.1 protein_id gnl|my_center|LOCUS_20190 77647 78309 gene locus_tag LOCUS_20200 77647 78309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 78342 79118 gene locus_tag LOCUS_20210 78342 79118 CDS product DUF2092 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967308.1 protein_id gnl|my_center|LOCUS_20210 79210 79452 gene locus_tag LOCUS_20220 79210 79452 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140099.1 protein_id gnl|my_center|LOCUS_20220 79656 80549 gene locus_tag LOCUS_20230 79656 80549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 83608 80546 gene locus_tag LOCUS_20240 83608 80546 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142263.1 protein_id gnl|my_center|LOCUS_20240 83810 84598 gene locus_tag LOCUS_20250 83810 84598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 84966 84595 gene locus_tag LOCUS_20260 84966 84595 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799703.1 protein_id gnl|my_center|LOCUS_20260 85229 85059 gene locus_tag LOCUS_20270 85229 85059 CDS product metallothionein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143419.1 protein_id gnl|my_center|LOCUS_20270 85543 86187 gene locus_tag LOCUS_20280 85543 86187 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_20280 86432 86665 gene locus_tag LOCUS_20290 86432 86665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 86735 86917 gene locus_tag LOCUS_20300 86735 86917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 87520 87173 gene locus_tag LOCUS_20310 87520 87173 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_20310 87692 87507 gene locus_tag LOCUS_20320 87692 87507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 88541 87969 gene locus_tag LOCUS_20330 88541 87969 CDS product DUF2808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142565.1 protein_id gnl|my_center|LOCUS_20330 88707 89834 gene locus_tag LOCUS_20340 gene recF 88707 89834 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142400.1 protein_id gnl|my_center|LOCUS_20340 90708 89998 gene locus_tag LOCUS_20350 gene rpiA 90708 89998 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057113.1 protein_id gnl|my_center|LOCUS_20350 91308 90781 gene locus_tag LOCUS_20360 91308 90781 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920888.1 protein_id gnl|my_center|LOCUS_20360 92639 91353 gene locus_tag LOCUS_20370 92639 91353 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_20370 93348 93548 gene locus_tag LOCUS_20380 93348 93548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 93682 94563 gene locus_tag LOCUS_20390 93682 94563 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057174.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence14 606 178 gene locus_tag LOCUS_20400 606 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 1358 1188 gene locus_tag LOCUS_20410 1358 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 1820 1620 gene locus_tag LOCUS_20420 1820 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 2079 1804 gene locus_tag LOCUS_20430 2079 1804 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_20430 2817 2290 gene locus_tag LOCUS_20440 2817 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 3025 3459 gene locus_tag LOCUS_20450 3025 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 4100 3480 gene locus_tag LOCUS_20460 4100 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 4784 4260 gene locus_tag LOCUS_20470 4784 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 5488 4871 gene locus_tag LOCUS_20480 5488 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 6170 5631 gene locus_tag LOCUS_20490 6170 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 6618 6238 gene locus_tag LOCUS_20500 6618 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 9744 6754 gene locus_tag LOCUS_20510 9744 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 10432 10755 gene locus_tag LOCUS_20520 10432 10755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 11684 10752 gene locus_tag LOCUS_20530 gene secF 11684 10752 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056057.1 protein_id gnl|my_center|LOCUS_20530 13488 12082 gene locus_tag LOCUS_20540 gene secD 13488 12082 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056058.1 protein_id gnl|my_center|LOCUS_20540 14498 13515 gene locus_tag LOCUS_20550 14498 13515 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056059.1 protein_id gnl|my_center|LOCUS_20550 16021 14888 gene locus_tag LOCUS_20560 16021 14888 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_20560 16166 17734 gene locus_tag LOCUS_20570 16166 17734 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 protein_id gnl|my_center|LOCUS_20570 17815 18411 gene locus_tag LOCUS_20580 gene yqeK 17815 18411 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057165.1 protein_id gnl|my_center|LOCUS_20580 18467 18871 gene locus_tag LOCUS_20590 gene rsfS 18467 18871 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057064.1 protein_id gnl|my_center|LOCUS_20590 18877 19380 gene locus_tag LOCUS_20600 18877 19380 CDS product CGLD27 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140851.1 protein_id gnl|my_center|LOCUS_20600 19396 20349 gene locus_tag LOCUS_20610 19396 20349 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550332.1 protein_id gnl|my_center|LOCUS_20610 20463 20729 gene locus_tag LOCUS_20620 20463 20729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 20969 22120 gene locus_tag LOCUS_20630 20969 22120 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_20630 22123 22545 gene locus_tag LOCUS_20640 22123 22545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 24507 22795 gene locus_tag LOCUS_20650 24507 22795 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057909.1 protein_id gnl|my_center|LOCUS_20650 25740 25183 gene locus_tag LOCUS_20660 25740 25183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 27405 26041 gene locus_tag LOCUS_20670 27405 26041 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_20670 28027 27563 gene locus_tag LOCUS_20680 28027 27563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 28734 28024 gene locus_tag LOCUS_20690 28734 28024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 29040 29339 gene locus_tag LOCUS_20700 29040 29339 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_20700 29323 29721 gene locus_tag LOCUS_20710 29323 29721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 29860 30126 gene locus_tag LOCUS_20720 29860 30126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 31787 30123 gene locus_tag LOCUS_20730 31787 30123 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056162.1 protein_id gnl|my_center|LOCUS_20730 31900 32787 gene locus_tag LOCUS_20740 gene cofG 31900 32787 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057355.1 protein_id gnl|my_center|LOCUS_20740 33333 34646 gene locus_tag LOCUS_20750 33333 34646 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 protein_id gnl|my_center|LOCUS_20750 35148 34807 gene locus_tag LOCUS_20760 35148 34807 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142756.1 protein_id gnl|my_center|LOCUS_20760 35384 36379 gene locus_tag LOCUS_20770 35384 36379 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143314.1 protein_id gnl|my_center|LOCUS_20770 36888 37190 gene locus_tag LOCUS_20780 36888 37190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024171.1 protein_id gnl|my_center|LOCUS_20780 37662 37408 gene locus_tag LOCUS_20790 37662 37408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 38164 37820 gene locus_tag LOCUS_20800 38164 37820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 39401 38214 gene locus_tag LOCUS_20810 39401 38214 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_20810 39907 39629 gene locus_tag LOCUS_20820 39907 39629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 40228 40521 gene locus_tag LOCUS_20830 40228 40521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 40518 40862 gene locus_tag LOCUS_20840 40518 40862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 42393 41125 gene locus_tag LOCUS_20850 42393 41125 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966003.1 protein_id gnl|my_center|LOCUS_20850 44135 42393 gene locus_tag LOCUS_20860 44135 42393 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056653.1 protein_id gnl|my_center|LOCUS_20860 45473 44334 gene locus_tag LOCUS_20870 45473 44334 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058225.1 protein_id gnl|my_center|LOCUS_20870 46457 45762 gene locus_tag LOCUS_20880 46457 45762 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928653.1 protein_id gnl|my_center|LOCUS_20880 47453 46800 gene locus_tag LOCUS_20890 47453 46800 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141012.1 protein_id gnl|my_center|LOCUS_20890 48213 47626 gene locus_tag LOCUS_20900 48213 47626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 48477 49700 gene locus_tag LOCUS_20910 48477 49700 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057105.1 protein_id gnl|my_center|LOCUS_20910 49753 50247 gene locus_tag LOCUS_20920 gene sixA 49753 50247 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057106.1 protein_id gnl|my_center|LOCUS_20920 50316 50672 gene locus_tag LOCUS_20930 50316 50672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 50961 51290 gene locus_tag LOCUS_20940 50961 51290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 51962 51342 gene locus_tag LOCUS_20950 51962 51342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 52006 52173 gene locus_tag LOCUS_20960 52006 52173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 52160 52378 gene locus_tag LOCUS_20970 52160 52378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 53857 52472 gene locus_tag LOCUS_20980 53857 52472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 54422 53832 gene locus_tag LOCUS_20990 54422 53832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 55017 54565 gene locus_tag LOCUS_21000 55017 54565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 55298 55014 gene locus_tag LOCUS_21010 55298 55014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 56148 55483 gene locus_tag LOCUS_21020 56148 55483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 57029 56541 gene locus_tag LOCUS_21030 57029 56541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 57290 57547 gene locus_tag LOCUS_21040 57290 57547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 57532 57951 gene locus_tag LOCUS_21050 57532 57951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 59981 58698 gene locus_tag LOCUS_21060 59981 58698 CDS product DUF3086 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056951.1 protein_id gnl|my_center|LOCUS_21060 60643 60227 gene locus_tag LOCUS_21070 60643 60227 CDS product DUF3119 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056952.1 protein_id gnl|my_center|LOCUS_21070 61483 60683 gene locus_tag LOCUS_21080 61483 60683 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 protein_id gnl|my_center|LOCUS_21080 62912 61578 gene locus_tag LOCUS_21090 gene ftsY 62912 61578 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056772.1 protein_id gnl|my_center|LOCUS_21090 63138 63725 gene locus_tag LOCUS_21100 63138 63725 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_21100 64021 64608 gene locus_tag LOCUS_21110 64021 64608 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_21110 64748 64933 gene locus_tag LOCUS_21120 64748 64933 CDS product PCP reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143955.1 protein_id gnl|my_center|LOCUS_21120 65927 64938 gene locus_tag LOCUS_21130 gene moaA 65927 64938 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143017.1 protein_id gnl|my_center|LOCUS_21130 66346 67689 gene locus_tag LOCUS_21140 66346 67689 CDS product DUF3370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921041.1 protein_id gnl|my_center|LOCUS_21140 68209 67697 gene locus_tag LOCUS_21150 68209 67697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 68448 68233 gene locus_tag LOCUS_21160 68448 68233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 68669 68744 gene locus_tag LOCUS_t00150 68669 68744 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 71363 68829 gene locus_tag LOCUS_21170 71363 68829 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141000.1 protein_id gnl|my_center|LOCUS_21170 72203 71799 gene locus_tag LOCUS_21180 gene crcB 72203 71799 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639315.1 protein_id gnl|my_center|LOCUS_21180 72751 72362 gene locus_tag LOCUS_21190 gene crcB 72751 72362 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258331.1 protein_id gnl|my_center|LOCUS_21190 72876 73682 gene locus_tag LOCUS_21200 gene rsmA 72876 73682 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056506.1 protein_id gnl|my_center|LOCUS_21200 73700 74641 gene locus_tag LOCUS_21210 gene ispE 73700 74641 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056351.1 protein_id gnl|my_center|LOCUS_21210 75475 74663 gene locus_tag LOCUS_21220 75475 74663 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056386.1 protein_id gnl|my_center|LOCUS_21220 75999 75475 gene locus_tag LOCUS_21230 75999 75475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 76313 76561 gene locus_tag LOCUS_21240 76313 76561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 76558 77283 gene locus_tag LOCUS_21250 76558 77283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 78448 77285 gene locus_tag LOCUS_21260 78448 77285 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_21260 78704 81256 gene locus_tag LOCUS_21270 gene gyrA 78704 81256 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057209.1 protein_id gnl|my_center|LOCUS_21270 81930 81400 gene locus_tag LOCUS_21280 81930 81400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 82325 81930 gene locus_tag LOCUS_21290 82325 81930 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143142.1 protein_id gnl|my_center|LOCUS_21290 82407 83771 gene locus_tag LOCUS_21300 gene asnS 82407 83771 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058304.1 protein_id gnl|my_center|LOCUS_21300 83980 84132 gene locus_tag LOCUS_21310 83980 84132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 84193 84495 gene locus_tag LOCUS_21320 84193 84495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083794109.1 protein_id gnl|my_center|LOCUS_21320 84483 84710 gene locus_tag LOCUS_21330 84483 84710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 85297 84974 gene locus_tag LOCUS_21340 85297 84974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 85571 85287 gene locus_tag LOCUS_21350 85571 85287 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929718.1 protein_id gnl|my_center|LOCUS_21350 85807 86241 gene locus_tag LOCUS_21360 85807 86241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 86488 86904 gene locus_tag LOCUS_21370 86488 86904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 86901 87263 gene locus_tag LOCUS_21380 86901 87263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 87480 87716 gene locus_tag LOCUS_21390 87480 87716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 87719 87958 gene locus_tag LOCUS_21400 87719 87958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 88546 88037 gene locus_tag LOCUS_21410 88546 88037 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_21410 88788 88543 gene locus_tag LOCUS_21420 88788 88543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 89766 89356 gene locus_tag LOCUS_21430 89766 89356 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484774.1 protein_id gnl|my_center|LOCUS_21430 89962 89756 gene locus_tag LOCUS_21440 89962 89756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 90514 90759 gene locus_tag LOCUS_21450 90514 90759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 90756 91256 gene locus_tag LOCUS_21460 90756 91256 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_21460 91672 91349 gene locus_tag LOCUS_21470 91672 91349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 91946 91662 gene locus_tag LOCUS_21480 91946 91662 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929718.1 protein_id gnl|my_center|LOCUS_21480 92405 92124 gene locus_tag LOCUS_21490 92405 92124 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_21490 92703 92398 gene locus_tag LOCUS_21500 92703 92398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 93299 92976 gene locus_tag LOCUS_21510 93299 92976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 93597 93289 gene locus_tag LOCUS_21520 93597 93289 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929718.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence15 2637 2179 gene locus_tag LOCUS_21530 2637 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 4485 2680 gene locus_tag LOCUS_21540 4485 2680 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057670.1 protein_id gnl|my_center|LOCUS_21540 6471 4915 gene locus_tag LOCUS_21550 6471 4915 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058227.1 protein_id gnl|my_center|LOCUS_21550 6989 7576 gene locus_tag LOCUS_21560 6989 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 8043 8243 gene locus_tag LOCUS_21570 8043 8243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 9145 8369 gene locus_tag LOCUS_21580 9145 8369 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_21580 10178 9174 gene locus_tag LOCUS_21590 10178 9174 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207999.1 protein_id gnl|my_center|LOCUS_21590 10791 12839 gene locus_tag LOCUS_21600 gene dnaK 10791 12839 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056634.1 protein_id gnl|my_center|LOCUS_21600 13100 14224 gene locus_tag LOCUS_21610 gene dnaJ 13100 14224 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920758.1 protein_id gnl|my_center|LOCUS_21610 14438 14659 gene locus_tag LOCUS_21620 14438 14659 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056832.1 protein_id gnl|my_center|LOCUS_21620 14660 15736 gene locus_tag LOCUS_21630 gene rsgA 14660 15736 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056831.1 protein_id gnl|my_center|LOCUS_21630 16046 15879 gene locus_tag LOCUS_21640 16046 15879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 18023 16803 gene locus_tag LOCUS_21650 18023 16803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 18058 18765 gene locus_tag LOCUS_21660 18058 18765 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126987297.1 protein_id gnl|my_center|LOCUS_21660 18946 19284 gene locus_tag LOCUS_21670 18946 19284 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920728.1 protein_id gnl|my_center|LOCUS_21670 19459 22164 gene locus_tag LOCUS_21680 19459 22164 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058198.1 protein_id gnl|my_center|LOCUS_21680 22380 23618 gene locus_tag LOCUS_21690 22380 23618 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203374.1 protein_id gnl|my_center|LOCUS_21690 23615 24127 gene locus_tag LOCUS_21700 23615 24127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 24565 27258 gene locus_tag LOCUS_21710 gene adhE 24565 27258 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056082.1 protein_id gnl|my_center|LOCUS_21710 28172 27399 gene locus_tag LOCUS_21720 gene gloB 28172 27399 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057476.1 protein_id gnl|my_center|LOCUS_21720 28336 28902 gene locus_tag LOCUS_21730 28336 28902 CDS product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703843.1 protein_id gnl|my_center|LOCUS_21730 29047 29322 gene locus_tag LOCUS_21740 29047 29322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 29685 29542 gene locus_tag LOCUS_21750 29685 29542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 31651 29801 gene locus_tag LOCUS_21760 31651 29801 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928942.1 protein_id gnl|my_center|LOCUS_21760 32113 33264 gene locus_tag LOCUS_21770 32113 33264 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_21770 33860 33366 gene locus_tag LOCUS_21780 33860 33366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 34255 33881 gene locus_tag LOCUS_21790 34255 33881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 34839 34255 gene locus_tag LOCUS_21800 34839 34255 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056172.1 protein_id gnl|my_center|LOCUS_21800 36188 35019 gene locus_tag LOCUS_21810 36188 35019 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_21810 37180 36185 gene locus_tag LOCUS_21820 37180 36185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 39024 37297 gene locus_tag LOCUS_21830 39024 37297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 40521 39082 gene locus_tag LOCUS_21840 gene glmM 40521 39082 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013191710.1 protein_id gnl|my_center|LOCUS_21840 40834 41775 gene locus_tag LOCUS_21850 40834 41775 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142791.1 protein_id gnl|my_center|LOCUS_21850 42065 43474 gene locus_tag LOCUS_21860 42065 43474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 43713 44405 gene locus_tag LOCUS_21870 43713 44405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 45053 45265 gene locus_tag LOCUS_21880 45053 45265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 46330 46184 gene locus_tag LOCUS_21890 46330 46184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 46962 47483 gene locus_tag LOCUS_21900 46962 47483 CDS product photosystem I assembly protein Ycf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057365.1 protein_id gnl|my_center|LOCUS_21900 47612 47908 gene locus_tag LOCUS_21910 gene gatC 47612 47908 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143272.1 protein_id gnl|my_center|LOCUS_21910 48042 48443 gene locus_tag LOCUS_21920 48042 48443 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172237.1 protein_id gnl|my_center|LOCUS_21920 49865 49362 gene locus_tag LOCUS_21930 49865 49362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 50419 49877 gene locus_tag LOCUS_21940 50419 49877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 50855 53071 gene locus_tag LOCUS_21950 gene dnaK 50855 53071 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_21950 53592 56051 gene locus_tag LOCUS_21960 53592 56051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 56066 56437 gene locus_tag LOCUS_21970 56066 56437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 56440 56907 gene locus_tag LOCUS_21980 56440 56907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 57074 57283 gene locus_tag LOCUS_21990 57074 57283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 57292 58137 gene locus_tag LOCUS_22000 57292 58137 CDS product ISKra4-like element ISGvi7 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929313.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22000 58210 60828 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccattaattaaacttgctaagaagttaaaag 61312 62316 gene locus_tag LOCUS_22010 gene cas1 61312 62316 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_22010 62379 62951 gene locus_tag LOCUS_22020 62379 62951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 62960 63583 gene locus_tag LOCUS_22030 62960 63583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 63644 63841 gene locus_tag LOCUS_22040 63644 63841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 63850 64332 gene locus_tag LOCUS_22050 63850 64332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 64453 65886 gene locus_tag LOCUS_22060 64453 65886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 65930 67348 gene locus_tag LOCUS_22070 65930 67348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 67652 70654 gene locus_tag LOCUS_22080 67652 70654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 70661 71539 gene locus_tag LOCUS_22090 70661 71539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 71613 72806 gene locus_tag LOCUS_22100 71613 72806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 72822 73223 gene locus_tag LOCUS_22110 72822 73223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 73220 74137 gene locus_tag LOCUS_22120 gene cmr4 73220 74137 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082339.1 protein_id gnl|my_center|LOCUS_22120 74134 74529 gene locus_tag LOCUS_22130 74134 74529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 74526 76412 gene locus_tag LOCUS_22140 74526 76412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 76641 76396 gene locus_tag LOCUS_22150 76641 76396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 77475 78110 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccattaattaaacttgctaagaagttaaaag 78731 79333 gene locus_tag LOCUS_22160 78731 79333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 79330 79626 gene locus_tag LOCUS_22170 79330 79626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 79636 80217 gene locus_tag LOCUS_22180 79636 80217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 80219 80866 gene locus_tag LOCUS_22190 80219 80866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 80853 81320 gene locus_tag LOCUS_22200 80853 81320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 81351 81803 gene locus_tag LOCUS_22210 81351 81803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 84805 82256 gene locus_tag LOCUS_22220 84805 82256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 85735 87600 gene locus_tag LOCUS_22230 85735 87600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 88634 87675 gene locus_tag LOCUS_22240 88634 87675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 88821 89222 gene locus_tag LOCUS_22250 88821 89222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 89439 90425 gene locus_tag LOCUS_22260 89439 90425 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258346.1 protein_id gnl|my_center|LOCUS_22260 90512 90772 gene locus_tag LOCUS_22270 90512 90772 CDS product YlcI/YnfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140893.1 protein_id gnl|my_center|LOCUS_22270 90765 91124 gene locus_tag LOCUS_22280 90765 91124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 91196 92092 gene locus_tag LOCUS_22290 91196 92092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 92482 92790 gene locus_tag LOCUS_22300 92482 92790 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_22300 92777 93124 gene locus_tag LOCUS_22310 92777 93124 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626344.1 protein_id gnl|my_center|LOCUS_22310 >Feature sequence16 882 241 gene locus_tag LOCUS_22320 882 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 1029 1283 gene locus_tag LOCUS_22330 1029 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 1508 1684 gene locus_tag LOCUS_22340 1508 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 2849 2208 gene locus_tag LOCUS_22350 2849 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056166.1 protein_id gnl|my_center|LOCUS_22350 3138 4184 gene locus_tag LOCUS_22360 3138 4184 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920885.1 protein_id gnl|my_center|LOCUS_22360 4505 4576 gene locus_tag LOCUS_t00160 4505 4576 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4698 6194 gene locus_tag LOCUS_22370 4698 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 6410 7033 gene locus_tag LOCUS_22380 6410 7033 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038867.1 protein_id gnl|my_center|LOCUS_22380 7047 10553 gene locus_tag LOCUS_22390 gene brxC 7047 10553 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228200.1 protein_id gnl|my_center|LOCUS_22390 10627 11691 gene locus_tag LOCUS_22400 10627 11691 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939306.1 protein_id gnl|my_center|LOCUS_22400 11688 12173 gene locus_tag LOCUS_22410 11688 12173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 12205 15777 gene locus_tag LOCUS_22420 gene pglX 12205 15777 CDS product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939304.1 protein_id gnl|my_center|LOCUS_22420 16188 17237 gene locus_tag LOCUS_22430 16188 17237 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 protein_id gnl|my_center|LOCUS_22430 17277 19775 gene locus_tag LOCUS_22440 gene pglZ 17277 19775 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939302.1 protein_id gnl|my_center|LOCUS_22440 20517 19822 gene locus_tag LOCUS_22450 gene trmD 20517 19822 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057450.1 protein_id gnl|my_center|LOCUS_22450 20891 21745 gene locus_tag LOCUS_22460 20891 21745 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058003.1 protein_id gnl|my_center|LOCUS_22460 21853 24486 gene locus_tag LOCUS_22470 gene cphA 21853 24486 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058004.1 protein_id gnl|my_center|LOCUS_22470 25824 24709 gene locus_tag LOCUS_22480 25824 24709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 26741 26055 gene locus_tag LOCUS_22490 26741 26055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 27101 26748 gene locus_tag LOCUS_22500 27101 26748 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143142.1 protein_id gnl|my_center|LOCUS_22500 27310 27098 gene locus_tag LOCUS_22510 27310 27098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 27646 27365 gene locus_tag LOCUS_22520 27646 27365 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928995.1 protein_id gnl|my_center|LOCUS_22520 28531 28052 gene locus_tag LOCUS_22530 28531 28052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143509.1 protein_id gnl|my_center|LOCUS_22530 29561 28668 gene locus_tag LOCUS_22540 29561 28668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 30473 29700 gene locus_tag LOCUS_22550 30473 29700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 31159 30536 gene locus_tag LOCUS_22560 31159 30536 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057797.1 protein_id gnl|my_center|LOCUS_22560 31739 31308 gene locus_tag LOCUS_22570 31739 31308 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_22570 32607 31795 gene locus_tag LOCUS_22580 32607 31795 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009454959.1 protein_id gnl|my_center|LOCUS_22580 34554 32779 gene locus_tag LOCUS_22590 gene pyk 34554 32779 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058108.1 protein_id gnl|my_center|LOCUS_22590 36408 34711 gene locus_tag LOCUS_22600 36408 34711 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920919.1 protein_id gnl|my_center|LOCUS_22600 37105 37920 gene locus_tag LOCUS_22610 37105 37920 CDS product Ycf66 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057849.1 protein_id gnl|my_center|LOCUS_22610 37933 38469 gene locus_tag LOCUS_22620 37933 38469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 38639 39160 gene locus_tag LOCUS_22630 38639 39160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 40452 39355 gene locus_tag LOCUS_22640 40452 39355 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090620535.1 protein_id gnl|my_center|LOCUS_22640 42140 40851 gene locus_tag LOCUS_22650 42140 40851 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920845.1 protein_id gnl|my_center|LOCUS_22650 42347 43711 gene locus_tag LOCUS_22660 42347 43711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 44013 45032 gene locus_tag LOCUS_22670 gene dusA 44013 45032 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888333.1 protein_id gnl|my_center|LOCUS_22670 45048 45860 gene locus_tag LOCUS_22680 45048 45860 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143024.1 protein_id gnl|my_center|LOCUS_22680 46587 46237 gene locus_tag LOCUS_22690 46587 46237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 47177 46596 gene locus_tag LOCUS_22700 47177 46596 CDS product DUF1997 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057548.1 protein_id gnl|my_center|LOCUS_22700 48041 48457 gene locus_tag LOCUS_22710 48041 48457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 48640 48458 gene locus_tag LOCUS_22720 48640 48458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 48881 50452 gene locus_tag LOCUS_22730 48881 50452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 50586 51620 gene locus_tag LOCUS_22740 gene tsaD 50586 51620 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056353.1 protein_id gnl|my_center|LOCUS_22740 51887 52768 gene locus_tag LOCUS_22750 gene truB 51887 52768 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057445.1 protein_id gnl|my_center|LOCUS_22750 53169 52897 gene locus_tag LOCUS_22760 53169 52897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 54316 53270 gene locus_tag LOCUS_22770 gene hisC 54316 53270 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943720.1 protein_id gnl|my_center|LOCUS_22770 55659 54418 gene locus_tag LOCUS_22780 gene ispG 55659 54418 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056840.1 protein_id gnl|my_center|LOCUS_22780 56587 55673 gene locus_tag LOCUS_22790 56587 55673 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056888.1 protein_id gnl|my_center|LOCUS_22790 56793 57362 gene locus_tag LOCUS_22800 56793 57362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 57645 59282 gene locus_tag LOCUS_22810 gene lysS 57645 59282 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015229441.1 protein_id gnl|my_center|LOCUS_22810 59195 59911 gene locus_tag LOCUS_22820 59195 59911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22820 60025 60390 gene locus_tag LOCUS_22830 60025 60390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22830 60347 60685 gene locus_tag LOCUS_22840 60347 60685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 62434 60788 gene locus_tag LOCUS_22850 62434 60788 CDS product DUF3685 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058156.1 protein_id gnl|my_center|LOCUS_22850 62933 62493 gene locus_tag LOCUS_22860 62933 62493 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055880.1 protein_id gnl|my_center|LOCUS_22860 64177 63707 gene locus_tag LOCUS_22870 64177 63707 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_22870 64356 65414 gene locus_tag LOCUS_22880 64356 65414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444437.1 protein_id gnl|my_center|LOCUS_22880 65432 66190 gene locus_tag LOCUS_22890 65432 66190 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 protein_id gnl|my_center|LOCUS_22890 66392 68119 gene locus_tag LOCUS_22900 gene recN 66392 68119 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140275.1 protein_id gnl|my_center|LOCUS_22900 68764 68123 gene locus_tag LOCUS_22910 68764 68123 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140140.1 protein_id gnl|my_center|LOCUS_22910 69430 68789 gene locus_tag LOCUS_22920 69430 68789 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140140.1 protein_id gnl|my_center|LOCUS_22920 69552 70709 gene locus_tag LOCUS_22930 69552 70709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 71257 70982 gene locus_tag LOCUS_22940 71257 70982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 71804 73246 gene locus_tag LOCUS_22950 gene cysS 71804 73246 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920936.1 protein_id gnl|my_center|LOCUS_22950 74758 73229 gene locus_tag LOCUS_22960 74758 73229 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986277.1 protein_id gnl|my_center|LOCUS_22960 74877 75881 gene locus_tag LOCUS_22970 74877 75881 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057358.1 protein_id gnl|my_center|LOCUS_22970 75893 77326 gene locus_tag LOCUS_22980 75893 77326 CDS product bifunctional orotidine-5'-phosphate decarboxylase/orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141081.1 protein_id gnl|my_center|LOCUS_22980 77943 77659 gene locus_tag LOCUS_22990 77943 77659 CDS product DUF1816 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057540.1 protein_id gnl|my_center|LOCUS_22990 78934 78068 gene locus_tag LOCUS_23000 gene rlmB 78934 78068 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056885.1 protein_id gnl|my_center|LOCUS_23000 79394 78978 gene locus_tag LOCUS_23010 79394 78978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 79748 79398 gene locus_tag LOCUS_23020 79748 79398 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524127.1 protein_id gnl|my_center|LOCUS_23020 80971 79823 gene locus_tag LOCUS_23030 gene carA 80971 79823 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056605.1 protein_id gnl|my_center|LOCUS_23030 81169 82056 gene locus_tag LOCUS_23040 81169 82056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 82549 83328 gene locus_tag LOCUS_23050 82549 83328 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015184994.1 protein_id gnl|my_center|LOCUS_23050 83897 83370 gene locus_tag LOCUS_23060 83897 83370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 84304 84825 gene locus_tag LOCUS_23070 84304 84825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 84867 85292 gene locus_tag LOCUS_23080 84867 85292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 85350 86897 gene locus_tag LOCUS_23090 85350 86897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 87758 86946 gene locus_tag LOCUS_23100 87758 86946 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085861.1 protein_id gnl|my_center|LOCUS_23100 87836 87908 gene locus_tag LOCUS_t00170 87836 87908 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 88222 89004 gene locus_tag LOCUS_23110 gene recO 88222 89004 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058068.1 protein_id gnl|my_center|LOCUS_23110 89132 90517 gene locus_tag LOCUS_23120 89132 90517 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058069.1 protein_id gnl|my_center|LOCUS_23120 90699 91094 gene locus_tag LOCUS_23130 90699 91094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 >Feature sequence17 225 569 gene locus_tag LOCUS_23140 225 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056501.1 protein_id gnl|my_center|LOCUS_23140 648 1862 gene locus_tag LOCUS_23150 648 1862 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 protein_id gnl|my_center|LOCUS_23150 2426 1965 gene locus_tag LOCUS_23160 2426 1965 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_23160 4159 2786 gene locus_tag LOCUS_23170 4159 2786 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141145.1 protein_id gnl|my_center|LOCUS_23170 5319 4468 gene locus_tag LOCUS_23180 5319 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 5528 6811 gene locus_tag LOCUS_23190 5528 6811 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141361.1 protein_id gnl|my_center|LOCUS_23190 8848 7169 gene locus_tag LOCUS_23200 8848 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 10180 8924 gene locus_tag LOCUS_23210 10180 8924 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254458.1 protein_id gnl|my_center|LOCUS_23210 10590 12587 gene locus_tag LOCUS_23220 gene bchD 10590 12587 CDS product magnesium chelatase ATPase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057253.1 protein_id gnl|my_center|LOCUS_23220 12851 13354 gene locus_tag LOCUS_23230 12851 13354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797617.1 protein_id gnl|my_center|LOCUS_23230 13365 14255 gene locus_tag LOCUS_23240 13365 14255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920654.1 protein_id gnl|my_center|LOCUS_23240 14442 15119 gene locus_tag LOCUS_23250 14442 15119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 15378 15776 gene locus_tag LOCUS_23260 15378 15776 CDS product DUF1824 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929141.1 protein_id gnl|my_center|LOCUS_23260 16079 16759 gene locus_tag LOCUS_23270 gene ispD 16079 16759 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056453.1 protein_id gnl|my_center|LOCUS_23270 17371 16754 gene locus_tag LOCUS_23280 17371 16754 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971715.1 protein_id gnl|my_center|LOCUS_23280 17476 18426 gene locus_tag LOCUS_23290 17476 18426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 18673 18500 gene locus_tag LOCUS_23300 18673 18500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 18862 19695 gene locus_tag LOCUS_23310 gene menB 18862 19695 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058289.1 protein_id gnl|my_center|LOCUS_23310 20051 20353 gene locus_tag LOCUS_23320 20051 20353 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_23320 21028 20411 gene locus_tag LOCUS_23330 21028 20411 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141508.1 protein_id gnl|my_center|LOCUS_23330 21098 21637 gene locus_tag LOCUS_23340 21098 21637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 22162 23778 gene locus_tag LOCUS_23350 22162 23778 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036534662.1 protein_id gnl|my_center|LOCUS_23350 24204 24986 gene locus_tag LOCUS_23360 24204 24986 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_23360 25705 25172 gene locus_tag LOCUS_23370 gene pyrR 25705 25172 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921232.1 protein_id gnl|my_center|LOCUS_23370 25835 27232 gene locus_tag LOCUS_23380 25835 27232 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528760.1 protein_id gnl|my_center|LOCUS_23380 29195 27225 gene locus_tag LOCUS_23390 29195 27225 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920781.1 protein_id gnl|my_center|LOCUS_23390 31035 29785 gene locus_tag LOCUS_23400 gene metK 31035 29785 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056822.1 protein_id gnl|my_center|LOCUS_23400 31361 33682 gene locus_tag LOCUS_23410 gene pcrA 31361 33682 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058290.1 protein_id gnl|my_center|LOCUS_23410 34148 34576 gene locus_tag LOCUS_23420 34148 34576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 36152 34989 gene locus_tag LOCUS_23430 36152 34989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 36840 36400 gene locus_tag LOCUS_23440 36840 36400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 37180 37503 gene locus_tag LOCUS_23450 gene trxA 37180 37503 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056655.1 protein_id gnl|my_center|LOCUS_23450 38304 38921 gene locus_tag LOCUS_23460 38304 38921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 39959 40270 gene locus_tag LOCUS_23470 gene groES 39959 40270 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125740.1 protein_id gnl|my_center|LOCUS_23470 40317 41942 gene locus_tag LOCUS_23480 gene groL 40317 41942 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056040.1 protein_id gnl|my_center|LOCUS_23480 43110 42820 gene locus_tag LOCUS_23490 43110 42820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 43466 43128 gene locus_tag LOCUS_23500 43466 43128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 43874 43587 gene locus_tag LOCUS_23510 43874 43587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 44188 43982 gene locus_tag LOCUS_23520 44188 43982 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020810.1 protein_id gnl|my_center|LOCUS_23520 44388 44185 gene locus_tag LOCUS_23530 44388 44185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 44739 44506 gene locus_tag LOCUS_23540 44739 44506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 44972 45265 gene locus_tag LOCUS_23550 44972 45265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 45738 47015 gene locus_tag LOCUS_23560 45738 47015 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056607.1 protein_id gnl|my_center|LOCUS_23560 47206 48267 gene locus_tag LOCUS_23570 gene corA 47206 48267 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_23570 48503 48327 gene locus_tag LOCUS_23580 48503 48327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 49558 49049 gene locus_tag LOCUS_23590 49558 49049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 50095 49583 gene locus_tag LOCUS_23600 50095 49583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 51018 50533 gene locus_tag LOCUS_23610 51018 50533 CDS product allophycocyanin subunit alpha-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920894.1 protein_id gnl|my_center|LOCUS_23610 51251 52036 gene locus_tag LOCUS_23620 51251 52036 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258918.1 protein_id gnl|my_center|LOCUS_23620 53533 52181 gene locus_tag LOCUS_23630 gene gor 53533 52181 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057447.1 protein_id gnl|my_center|LOCUS_23630 53828 53750 gene locus_tag LOCUS_t00180 53828 53750 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 53880 55304 gene locus_tag LOCUS_23640 gene dacB 53880 55304 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057215.1 protein_id gnl|my_center|LOCUS_23640 55530 57008 gene locus_tag LOCUS_23650 gene glgA 55530 57008 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_23650 57952 57152 gene locus_tag LOCUS_23660 57952 57152 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256114.1 protein_id gnl|my_center|LOCUS_23660 58580 57972 gene locus_tag LOCUS_23670 58580 57972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 59250 58615 gene locus_tag LOCUS_23680 gene trmB 59250 58615 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057818.1 protein_id gnl|my_center|LOCUS_23680 59316 60050 gene locus_tag LOCUS_23690 59316 60050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 60524 60692 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 61513 62835 gene locus_tag LOCUS_23700 61513 62835 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_23700 63044 64417 gene locus_tag LOCUS_23710 gene mnmE 63044 64417 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056805.1 protein_id gnl|my_center|LOCUS_23710 64798 64502 gene locus_tag LOCUS_23720 64798 64502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 65219 64911 gene locus_tag LOCUS_23730 65219 64911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 65608 65333 gene locus_tag LOCUS_23740 65608 65333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 67291 66308 gene locus_tag LOCUS_23750 gene tnpB 67291 66308 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_23750 67511 68707 gene locus_tag LOCUS_23760 gene alr 67511 68707 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056313.1 protein_id gnl|my_center|LOCUS_23760 68921 70225 gene locus_tag LOCUS_23770 68921 70225 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965184.1 protein_id gnl|my_center|LOCUS_23770 72345 70354 gene locus_tag LOCUS_23780 72345 70354 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056794.1 protein_id gnl|my_center|LOCUS_23780 73558 72467 gene locus_tag LOCUS_23790 73558 72467 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214433169.1 protein_id gnl|my_center|LOCUS_23790 74856 73783 gene locus_tag LOCUS_23800 gene bchI 74856 73783 CDS product magnesium chelatase ATPase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920887.1 protein_id gnl|my_center|LOCUS_23800 75341 74940 gene locus_tag LOCUS_23810 75341 74940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045052736.1 protein_id gnl|my_center|LOCUS_23810 77894 75762 gene locus_tag LOCUS_23820 gene glyS 77894 75762 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198128218.1 protein_id gnl|my_center|LOCUS_23820 78012 78611 gene locus_tag LOCUS_23830 78012 78611 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 protein_id gnl|my_center|LOCUS_23830 79830 78640 gene locus_tag LOCUS_23840 79830 78640 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057699.1 protein_id gnl|my_center|LOCUS_23840 80547 79867 gene locus_tag LOCUS_23850 80547 79867 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106289931.1 protein_id gnl|my_center|LOCUS_23850 80639 82564 gene locus_tag LOCUS_23860 80639 82564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 83460 82606 gene locus_tag LOCUS_23870 gene pheA 83460 82606 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073594784.1 protein_id gnl|my_center|LOCUS_23870 83923 83516 gene locus_tag LOCUS_23880 83923 83516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 83942 84430 gene locus_tag LOCUS_23890 83942 84430 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140692.1 protein_id gnl|my_center|LOCUS_23890 85016 84441 gene locus_tag LOCUS_23900 gene lepB 85016 84441 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056260.1 protein_id gnl|my_center|LOCUS_23900 85849 85016 gene locus_tag LOCUS_23910 85849 85016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 86620 86249 gene locus_tag LOCUS_23920 86620 86249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence18 3176 2766 gene locus_tag LOCUS_23930 3176 2766 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_23930 3423 3163 gene locus_tag LOCUS_23940 3423 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 4603 3548 gene locus_tag LOCUS_23950 4603 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 4845 5456 gene locus_tag LOCUS_23960 4845 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 5609 6208 gene locus_tag LOCUS_23970 5609 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 6227 6493 gene locus_tag LOCUS_23980 6227 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23980 6872 7885 gene locus_tag LOCUS_23990 gene rlmN 6872 7885 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058257.1 protein_id gnl|my_center|LOCUS_23990 8194 8418 gene locus_tag LOCUS_24000 8194 8418 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057795.1 protein_id gnl|my_center|LOCUS_24000 8707 9906 gene locus_tag LOCUS_24010 8707 9906 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057053.1 protein_id gnl|my_center|LOCUS_24010 10114 10956 gene locus_tag LOCUS_24020 10114 10956 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012164238.1 protein_id gnl|my_center|LOCUS_24020 11049 11924 gene locus_tag LOCUS_24030 11049 11924 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929069.1 protein_id gnl|my_center|LOCUS_24030 12038 12268 gene locus_tag LOCUS_24040 12038 12268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 12472 14343 gene locus_tag LOCUS_24050 12472 14343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 15003 14482 gene locus_tag LOCUS_24060 15003 14482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 15293 15006 gene locus_tag LOCUS_24070 15293 15006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 15810 15950 gene locus_tag LOCUS_24080 15810 15950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 16335 16156 gene locus_tag LOCUS_24090 16335 16156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 16618 16322 gene locus_tag LOCUS_24100 16618 16322 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836217.1 protein_id gnl|my_center|LOCUS_24100 17715 16849 gene locus_tag LOCUS_24110 17715 16849 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142803.1 protein_id gnl|my_center|LOCUS_24110 18594 17773 gene locus_tag LOCUS_24120 18594 17773 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073519.1 protein_id gnl|my_center|LOCUS_24120 19475 19011 gene locus_tag LOCUS_24130 19475 19011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 20452 19673 gene locus_tag LOCUS_24140 20452 19673 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 protein_id gnl|my_center|LOCUS_24140 21596 20859 gene locus_tag LOCUS_24150 21596 20859 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_24150 21991 21740 gene locus_tag LOCUS_24160 21991 21740 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057929.1 protein_id gnl|my_center|LOCUS_24160 23745 22060 gene locus_tag LOCUS_24170 23745 22060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 23943 25160 gene locus_tag LOCUS_24180 gene tyrS 23943 25160 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055905.1 protein_id gnl|my_center|LOCUS_24180 25413 25177 gene locus_tag LOCUS_24190 25413 25177 CDS product ferredoxin-thioredoxin reductase variable chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057357.1 protein_id gnl|my_center|LOCUS_24190 25646 26476 gene locus_tag LOCUS_24200 25646 26476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 27573 26683 gene locus_tag LOCUS_24210 27573 26683 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141217.1 protein_id gnl|my_center|LOCUS_24210 27782 28105 gene locus_tag LOCUS_24220 27782 28105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 28125 28343 gene locus_tag LOCUS_24230 28125 28343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 28611 29081 gene locus_tag LOCUS_24240 28611 29081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 31000 29111 gene locus_tag LOCUS_24250 31000 29111 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140600.1 protein_id gnl|my_center|LOCUS_24250 32874 31192 gene locus_tag LOCUS_24260 gene groL 32874 31192 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142891.1 protein_id gnl|my_center|LOCUS_24260 33123 34895 gene locus_tag LOCUS_24270 33123 34895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 36970 34946 gene locus_tag LOCUS_24280 36970 34946 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144393.1 protein_id gnl|my_center|LOCUS_24280 37691 37266 gene locus_tag LOCUS_24290 37691 37266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 38962 37691 gene locus_tag LOCUS_24300 38962 37691 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979630.1 protein_id gnl|my_center|LOCUS_24300 40027 39188 gene locus_tag LOCUS_24310 40027 39188 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142412.1 protein_id gnl|my_center|LOCUS_24310 43163 40041 gene locus_tag LOCUS_24320 43163 40041 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142413.1 protein_id gnl|my_center|LOCUS_24320 46469 45492 gene locus_tag LOCUS_24330 46469 45492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 47620 46619 gene locus_tag LOCUS_24340 47620 46619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141987.1 protein_id gnl|my_center|LOCUS_24340 49157 47679 gene locus_tag LOCUS_24350 49157 47679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 50049 49201 gene locus_tag LOCUS_24360 50049 49201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 51259 50093 gene locus_tag LOCUS_24370 51259 50093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 52177 51269 gene locus_tag LOCUS_24380 52177 51269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 52750 52253 gene locus_tag LOCUS_24390 52750 52253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 53535 52822 gene locus_tag LOCUS_24400 53535 52822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 54460 53624 gene locus_tag LOCUS_24410 54460 53624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 55156 54494 gene locus_tag LOCUS_24420 55156 54494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 55836 55195 gene locus_tag LOCUS_24430 55836 55195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 56162 55872 gene locus_tag LOCUS_24440 56162 55872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 57730 56384 gene locus_tag LOCUS_24450 57730 56384 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_24450 58429 59871 gene locus_tag LOCUS_24460 58429 59871 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920897.1 protein_id gnl|my_center|LOCUS_24460 59964 61061 gene locus_tag LOCUS_24470 59964 61061 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141720.1 protein_id gnl|my_center|LOCUS_24470 61065 62747 gene locus_tag LOCUS_24480 61065 62747 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942368.1 protein_id gnl|my_center|LOCUS_24480 63971 64891 gene locus_tag LOCUS_24490 gene aglG 63971 64891 CDS product glucosyl-dolichyl phosphate glucuronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289272.1 protein_id gnl|my_center|LOCUS_24490 64906 65865 gene locus_tag LOCUS_24500 gene gmd 64906 65865 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_24500 65868 67055 gene locus_tag LOCUS_24510 65868 67055 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545872.1 protein_id gnl|my_center|LOCUS_24510 67115 68098 gene locus_tag LOCUS_24520 67115 68098 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920729.1 protein_id gnl|my_center|LOCUS_24520 68126 68680 gene locus_tag LOCUS_24530 68126 68680 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928657.1 protein_id gnl|my_center|LOCUS_24530 68767 69159 gene locus_tag LOCUS_24540 68767 69159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 69165 70385 gene locus_tag LOCUS_24550 69165 70385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 70382 71164 gene locus_tag LOCUS_24560 70382 71164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 72138 71488 gene locus_tag LOCUS_24570 72138 71488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 72333 73556 gene locus_tag LOCUS_24580 72333 73556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 73704 75128 gene locus_tag LOCUS_24590 73704 75128 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058070.1 protein_id gnl|my_center|LOCUS_24590 76383 75142 gene locus_tag LOCUS_24600 76383 75142 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056626.1 protein_id gnl|my_center|LOCUS_24600 76690 77310 gene locus_tag LOCUS_24610 76690 77310 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142214.1 protein_id gnl|my_center|LOCUS_24610 77493 77281 gene locus_tag LOCUS_24620 77493 77281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 77731 79065 gene locus_tag LOCUS_24630 77731 79065 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058187.1 protein_id gnl|my_center|LOCUS_24630 79772 79089 gene locus_tag LOCUS_24640 79772 79089 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141522.1 protein_id gnl|my_center|LOCUS_24640 79928 80638 gene locus_tag LOCUS_24650 79928 80638 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140508.1 protein_id gnl|my_center|LOCUS_24650 80694 81149 gene locus_tag LOCUS_24660 80694 81149 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257075.1 protein_id gnl|my_center|LOCUS_24660 >Feature sequence19 1044 427 gene locus_tag LOCUS_24670 1044 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 1380 2174 gene locus_tag LOCUS_24680 1380 2174 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_24680 2205 3071 gene locus_tag LOCUS_24690 2205 3071 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_24690 3708 3334 gene locus_tag LOCUS_24700 3708 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 4622 3723 gene locus_tag LOCUS_24710 4622 3723 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938053.1 protein_id gnl|my_center|LOCUS_24710 5157 4711 gene locus_tag LOCUS_24720 5157 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 5675 5475 gene locus_tag LOCUS_24730 5675 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 6934 5762 gene locus_tag LOCUS_24740 6934 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 7486 7043 gene locus_tag LOCUS_24750 7486 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 8519 7560 gene locus_tag LOCUS_24760 8519 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 9608 8544 gene locus_tag LOCUS_24770 9608 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 10630 9848 gene locus_tag LOCUS_24780 10630 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 11811 10627 gene locus_tag LOCUS_24790 11811 10627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 12106 12555 gene locus_tag LOCUS_24800 12106 12555 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_24800 12568 13317 gene locus_tag LOCUS_24810 12568 13317 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_24810 14901 13336 gene locus_tag LOCUS_24820 14901 13336 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_24820 18350 15048 gene locus_tag LOCUS_24830 18350 15048 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143976.1 protein_id gnl|my_center|LOCUS_24830 19556 18357 gene locus_tag LOCUS_24840 19556 18357 CDS product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226578028.1 protein_id gnl|my_center|LOCUS_24840 20596 19742 gene locus_tag LOCUS_24850 20596 19742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 22002 20854 gene locus_tag LOCUS_24860 22002 20854 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_24860 22292 22471 gene locus_tag LOCUS_24870 22292 22471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 22547 22894 gene locus_tag LOCUS_24880 22547 22894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 23009 25006 gene locus_tag LOCUS_24890 23009 25006 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056292.1 protein_id gnl|my_center|LOCUS_24890 25391 24987 gene locus_tag LOCUS_24900 25391 24987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 25831 25424 gene locus_tag LOCUS_24910 25831 25424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 25880 26785 gene locus_tag LOCUS_24920 25880 26785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 27131 27859 gene locus_tag LOCUS_24930 27131 27859 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057150.1 protein_id gnl|my_center|LOCUS_24930 27909 28607 gene locus_tag LOCUS_24940 gene folE 27909 28607 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015079151.1 protein_id gnl|my_center|LOCUS_24940 29389 28751 gene locus_tag LOCUS_24950 29389 28751 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140756.1 protein_id gnl|my_center|LOCUS_24950 29510 29776 gene locus_tag LOCUS_24960 gene psaK 29510 29776 CDS product photosystem I reaction center subunit PsaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921012.1 protein_id gnl|my_center|LOCUS_24960 30443 30201 gene locus_tag LOCUS_24970 30443 30201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 30624 30424 gene locus_tag LOCUS_24980 30624 30424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 31025 30738 gene locus_tag LOCUS_24990 31025 30738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 31606 31259 gene locus_tag LOCUS_25000 31606 31259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 32335 31625 gene locus_tag LOCUS_25010 32335 31625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 33459 32347 gene locus_tag LOCUS_25020 33459 32347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 34036 33449 gene locus_tag LOCUS_25030 34036 33449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 35409 34264 gene locus_tag LOCUS_25040 35409 34264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 35781 36380 gene locus_tag LOCUS_25050 35781 36380 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057294.1 protein_id gnl|my_center|LOCUS_25050 36549 37808 gene locus_tag LOCUS_25060 36549 37808 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544926.1 protein_id gnl|my_center|LOCUS_25060 38522 38403 gene locus_tag LOCUS_25070 38522 38403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 38662 38928 gene locus_tag LOCUS_25080 38662 38928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 39079 38912 gene locus_tag LOCUS_25090 39079 38912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 40251 39688 gene locus_tag LOCUS_25100 40251 39688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 41435 40305 gene locus_tag LOCUS_25110 41435 40305 CDS product CO2 hydration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057960.1 protein_id gnl|my_center|LOCUS_25110 41823 41467 gene locus_tag LOCUS_25120 41823 41467 CDS product DUF1823 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057769.1 protein_id gnl|my_center|LOCUS_25120 42015 42908 gene locus_tag LOCUS_25130 42015 42908 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926022.1 protein_id gnl|my_center|LOCUS_25130 43357 43857 gene locus_tag LOCUS_25140 43357 43857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 43835 44464 gene locus_tag LOCUS_25150 43835 44464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 44906 44505 gene locus_tag LOCUS_25160 44906 44505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 44979 45260 gene locus_tag LOCUS_25170 44979 45260 CDS product DUF6439 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056108.1 protein_id gnl|my_center|LOCUS_25170 45658 45257 gene locus_tag LOCUS_25180 45658 45257 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083625306.1 protein_id gnl|my_center|LOCUS_25180 47367 46000 gene locus_tag LOCUS_25190 gene rlmD 47367 46000 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056786.1 protein_id gnl|my_center|LOCUS_25190 47822 47370 gene locus_tag LOCUS_25200 47822 47370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 49663 47879 gene locus_tag LOCUS_25210 49663 47879 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057930.1 protein_id gnl|my_center|LOCUS_25210 50849 49938 gene locus_tag LOCUS_25220 gene menA 50849 49938 CDS product 2-carboxy-1,4-naphthoquinone phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073592656.1 protein_id gnl|my_center|LOCUS_25220 51626 51054 gene locus_tag LOCUS_25230 51626 51054 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_25230 52904 51891 gene locus_tag LOCUS_25240 52904 51891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 53183 52941 gene locus_tag LOCUS_25250 53183 52941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 53622 53191 gene locus_tag LOCUS_25260 53622 53191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 53981 54202 gene locus_tag LOCUS_25270 53981 54202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 55655 54279 gene locus_tag LOCUS_25280 55655 54279 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144101.1 protein_id gnl|my_center|LOCUS_25280 56563 55784 gene locus_tag LOCUS_25290 56563 55784 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920674.1 protein_id gnl|my_center|LOCUS_25290 57223 56591 gene locus_tag LOCUS_25300 57223 56591 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929521.1 protein_id gnl|my_center|LOCUS_25300 58382 57444 gene locus_tag LOCUS_25310 58382 57444 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693969.1 protein_id gnl|my_center|LOCUS_25310 58945 58379 gene locus_tag LOCUS_25320 58945 58379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 59171 61606 gene locus_tag LOCUS_25330 gene pheT 59171 61606 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920733.1 protein_id gnl|my_center|LOCUS_25330 61829 62170 gene locus_tag LOCUS_25340 61829 62170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 62175 62516 gene locus_tag LOCUS_25350 62175 62516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 62680 62513 gene locus_tag LOCUS_25360 62680 62513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 64838 63333 gene locus_tag LOCUS_25370 64838 63333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 65446 65655 gene locus_tag LOCUS_25380 65446 65655 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393634.1 protein_id gnl|my_center|LOCUS_25380 65652 65891 gene locus_tag LOCUS_25390 65652 65891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 66647 66471 gene locus_tag LOCUS_25400 66647 66471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 66885 66628 gene locus_tag LOCUS_25410 66885 66628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 67441 67139 gene locus_tag LOCUS_25420 67441 67139 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144191.1 protein_id gnl|my_center|LOCUS_25420 67676 67924 gene locus_tag LOCUS_25430 67676 67924 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_25430 68445 68708 gene locus_tag LOCUS_25440 68445 68708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 68701 68940 gene locus_tag LOCUS_25450 68701 68940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 71867 69447 gene locus_tag LOCUS_25460 71867 69447 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057028.1 protein_id gnl|my_center|LOCUS_25460 72404 73438 gene locus_tag LOCUS_25470 gene gap 72404 73438 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143315.1 protein_id gnl|my_center|LOCUS_25470 73553 73921 gene locus_tag LOCUS_25480 73553 73921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799199.1 protein_id gnl|my_center|LOCUS_25480 73918 74931 gene locus_tag LOCUS_25490 73918 74931 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057784.1 protein_id gnl|my_center|LOCUS_25490 76878 75220 gene locus_tag LOCUS_25500 76878 75220 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057022.1 protein_id gnl|my_center|LOCUS_25500 77619 76891 gene locus_tag LOCUS_25510 77619 76891 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057021.1 protein_id gnl|my_center|LOCUS_25510 78182 77616 gene locus_tag LOCUS_25520 78182 77616 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057020.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence20 799 1272 gene locus_tag LOCUS_25530 799 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 1276 2268 gene locus_tag LOCUS_25540 1276 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 2516 2782 gene locus_tag LOCUS_25550 2516 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327108.1 protein_id gnl|my_center|LOCUS_25550 3017 3457 gene locus_tag LOCUS_25560 3017 3457 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_25560 4554 3607 gene locus_tag LOCUS_25570 4554 3607 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920765.1 protein_id gnl|my_center|LOCUS_25570 6078 4819 gene locus_tag LOCUS_25580 6078 4819 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057139.1 protein_id gnl|my_center|LOCUS_25580 7173 6430 gene locus_tag LOCUS_25590 7173 6430 CDS product DUF561 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057089.1 protein_id gnl|my_center|LOCUS_25590 7433 7266 gene locus_tag LOCUS_25600 7433 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 7619 8977 gene locus_tag LOCUS_25610 gene glmU 7619 8977 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920683.1 protein_id gnl|my_center|LOCUS_25610 10725 9280 gene locus_tag LOCUS_25620 10725 9280 CDS product DUF3370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921041.1 protein_id gnl|my_center|LOCUS_25620 11426 12469 gene locus_tag LOCUS_25630 11426 12469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 12729 13310 gene locus_tag LOCUS_25640 12729 13310 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_25640 14752 13502 gene locus_tag LOCUS_25650 14752 13502 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920846.1 protein_id gnl|my_center|LOCUS_25650 14755 15816 gene locus_tag LOCUS_25660 14755 15816 CDS product tocopherol cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530023.1 protein_id gnl|my_center|LOCUS_25660 16107 17852 gene locus_tag LOCUS_25670 gene kdpA 16107 17852 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140576.1 protein_id gnl|my_center|LOCUS_25670 18132 20246 gene locus_tag LOCUS_25680 gene kdpB 18132 20246 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140577.1 protein_id gnl|my_center|LOCUS_25680 20246 21463 gene locus_tag LOCUS_25690 20246 21463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 21878 22522 gene locus_tag LOCUS_25700 gene kdpC 21878 22522 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140578.1 protein_id gnl|my_center|LOCUS_25700 23338 22655 gene locus_tag LOCUS_25710 23338 22655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 26065 23342 gene locus_tag LOCUS_25720 26065 23342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 26148 26552 gene locus_tag LOCUS_25730 26148 26552 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065974.1 protein_id gnl|my_center|LOCUS_25730 27488 26796 gene locus_tag LOCUS_25740 27488 26796 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058294.1 protein_id gnl|my_center|LOCUS_25740 29372 27771 gene locus_tag LOCUS_25750 gene dndC 29372 27771 CDS product DNA phosphorothioation system sulfurtransferase DndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109921.1 protein_id gnl|my_center|LOCUS_25750 30766 29531 gene locus_tag LOCUS_25760 30766 29531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 31897 31163 gene locus_tag LOCUS_25770 31897 31163 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941468.1 protein_id gnl|my_center|LOCUS_25770 32725 31937 gene locus_tag LOCUS_25780 32725 31937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 33219 33383 gene locus_tag LOCUS_25790 33219 33383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 34035 33556 gene locus_tag LOCUS_25800 34035 33556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 38569 34313 gene locus_tag LOCUS_25810 38569 34313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 52934 38736 gene locus_tag LOCUS_25820 52934 38736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25820 59317 52931 gene locus_tag LOCUS_25830 59317 52931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25830 60058 59405 gene locus_tag LOCUS_25840 60058 59405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 60521 62590 gene locus_tag LOCUS_25850 60521 62590 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_25850 62652 63821 gene locus_tag LOCUS_25860 62652 63821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 64248 66260 gene locus_tag LOCUS_25870 64248 66260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 66312 66797 gene locus_tag LOCUS_25880 66312 66797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 66909 68570 gene locus_tag LOCUS_25890 66909 68570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 69040 68858 gene locus_tag LOCUS_25900 69040 68858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 69614 69150 gene locus_tag LOCUS_25910 69614 69150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 69852 71042 gene locus_tag LOCUS_25920 69852 71042 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_25920 71906 71157 gene locus_tag LOCUS_25930 71906 71157 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124783.1 protein_id gnl|my_center|LOCUS_25930 72405 72025 gene locus_tag LOCUS_25940 72405 72025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 72727 72518 gene locus_tag LOCUS_25950 72727 72518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 73115 73423 gene locus_tag LOCUS_25960 73115 73423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25960 73639 76008 gene locus_tag LOCUS_25970 gene atsD 73639 76008 CDS product arylsulfatase AtsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403397.1 protein_id gnl|my_center|LOCUS_25970 >Feature sequence21 154 1053 gene locus_tag LOCUS_25980 154 1053 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928449.1 protein_id gnl|my_center|LOCUS_25980 1450 3612 gene locus_tag LOCUS_25990 gene dnaK 1450 3612 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920992.1 protein_id gnl|my_center|LOCUS_25990 3953 4828 gene locus_tag LOCUS_26000 3953 4828 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057983.1 protein_id gnl|my_center|LOCUS_26000 5019 6167 gene locus_tag LOCUS_26010 5019 6167 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056427.1 protein_id gnl|my_center|LOCUS_26010 6343 7932 gene locus_tag LOCUS_26020 6343 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 9153 7906 gene locus_tag LOCUS_26030 9153 7906 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798996.1 protein_id gnl|my_center|LOCUS_26030 10190 9465 gene locus_tag LOCUS_26040 10190 9465 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056258.1 protein_id gnl|my_center|LOCUS_26040 10621 11037 gene locus_tag LOCUS_26050 10621 11037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 11025 11360 gene locus_tag LOCUS_26060 11025 11360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 13460 11841 gene locus_tag LOCUS_26070 13460 11841 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021891.1 protein_id gnl|my_center|LOCUS_26070 13618 13797 gene locus_tag LOCUS_26080 13618 13797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 14194 15147 gene locus_tag LOCUS_26090 14194 15147 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141923.1 protein_id gnl|my_center|LOCUS_26090 15275 16342 gene locus_tag LOCUS_26100 gene recA 15275 16342 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125865.1 protein_id gnl|my_center|LOCUS_26100 16962 16366 gene locus_tag LOCUS_26110 16962 16366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 17876 17007 gene locus_tag LOCUS_26120 17876 17007 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445511.1 protein_id gnl|my_center|LOCUS_26120 18349 18170 gene locus_tag LOCUS_26130 18349 18170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 19500 19973 gene locus_tag LOCUS_26140 19500 19973 CDS product CRR6 family NdhI maturation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057132.1 protein_id gnl|my_center|LOCUS_26140 20068 21276 gene locus_tag LOCUS_26150 20068 21276 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056884.1 protein_id gnl|my_center|LOCUS_26150 22039 21854 gene locus_tag LOCUS_26160 22039 21854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 22889 22056 gene locus_tag LOCUS_26170 22889 22056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 23350 24219 gene locus_tag LOCUS_26180 gene bchL 23350 24219 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921031.1 protein_id gnl|my_center|LOCUS_26180 24450 25214 gene locus_tag LOCUS_26190 24450 25214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 25231 26631 gene locus_tag LOCUS_26200 25231 26631 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058178.1 protein_id gnl|my_center|LOCUS_26200 26802 28094 gene locus_tag LOCUS_26210 26802 28094 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_26210 28096 28740 gene locus_tag LOCUS_26220 28096 28740 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994243.1 protein_id gnl|my_center|LOCUS_26220 28852 29655 gene locus_tag LOCUS_26230 gene udp 28852 29655 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016796.1 protein_id gnl|my_center|LOCUS_26230 30656 29652 gene locus_tag LOCUS_26240 30656 29652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 30964 31323 gene locus_tag LOCUS_26250 30964 31323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 34715 31320 gene locus_tag LOCUS_26260 34715 31320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 35198 34884 gene locus_tag LOCUS_26270 35198 34884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 35489 35208 gene locus_tag LOCUS_26280 35489 35208 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_26280 35947 35789 gene locus_tag LOCUS_26290 35947 35789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 36294 36073 gene locus_tag LOCUS_26300 36294 36073 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391794.1 protein_id gnl|my_center|LOCUS_26300 36490 36284 gene locus_tag LOCUS_26310 36490 36284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 36904 36680 gene locus_tag LOCUS_26320 36904 36680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 37086 37346 gene locus_tag LOCUS_26330 37086 37346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 37333 37755 gene locus_tag LOCUS_26340 37333 37755 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_26340 38174 37827 gene locus_tag LOCUS_26350 38174 37827 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941219.1 protein_id gnl|my_center|LOCUS_26350 38451 38155 gene locus_tag LOCUS_26360 38451 38155 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045668639.1 protein_id gnl|my_center|LOCUS_26360 38753 38598 gene locus_tag LOCUS_26370 38753 38598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 39084 38872 gene locus_tag LOCUS_26380 39084 38872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 39547 39077 gene locus_tag LOCUS_26390 39547 39077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 40800 39799 gene locus_tag LOCUS_26400 gene dusB 40800 39799 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056835.1 protein_id gnl|my_center|LOCUS_26400 41010 42584 gene locus_tag LOCUS_26410 41010 42584 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056564.1 protein_id gnl|my_center|LOCUS_26410 42698 43912 gene locus_tag LOCUS_26420 42698 43912 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_26420 46690 45284 gene locus_tag LOCUS_26430 46690 45284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 47116 48159 gene locus_tag LOCUS_26440 47116 48159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 50513 49257 gene locus_tag LOCUS_26450 gene hisD 50513 49257 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058085.1 protein_id gnl|my_center|LOCUS_26450 50812 52158 gene locus_tag LOCUS_26460 gene accC 50812 52158 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057645.1 protein_id gnl|my_center|LOCUS_26460 52202 52771 gene locus_tag LOCUS_26470 52202 52771 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_26470 52802 53377 gene locus_tag LOCUS_26480 52802 53377 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_26480 53404 53979 gene locus_tag LOCUS_26490 53404 53979 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_26490 54523 54056 gene locus_tag LOCUS_26500 54523 54056 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_26500 55245 54646 gene locus_tag LOCUS_26510 55245 54646 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_26510 55437 57032 gene locus_tag LOCUS_26520 55437 57032 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058049.1 protein_id gnl|my_center|LOCUS_26520 57575 57444 gene locus_tag LOCUS_26530 57575 57444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 59025 57772 gene locus_tag LOCUS_26540 59025 57772 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073594983.1 protein_id gnl|my_center|LOCUS_26540 60110 61078 gene locus_tag LOCUS_26550 60110 61078 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_26550 61505 61143 gene locus_tag LOCUS_26560 61505 61143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 61631 61704 gene locus_tag LOCUS_t00190 61631 61704 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 61945 62889 gene locus_tag LOCUS_26570 61945 62889 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056551.1 protein_id gnl|my_center|LOCUS_26570 62960 64147 gene locus_tag LOCUS_26580 62960 64147 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799340.1 protein_id gnl|my_center|LOCUS_26580 64792 65748 gene locus_tag LOCUS_26590 64792 65748 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224412629.1 protein_id gnl|my_center|LOCUS_26590 65751 68987 gene locus_tag LOCUS_26600 65751 68987 CDS product tubulin-like doman-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920803.1 protein_id gnl|my_center|LOCUS_26600 69331 70257 gene locus_tag LOCUS_26610 gene argF 69331 70257 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920816.1 protein_id gnl|my_center|LOCUS_26610 70390 70815 gene locus_tag LOCUS_26620 70390 70815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797542.1 protein_id gnl|my_center|LOCUS_26620 72587 71085 gene locus_tag LOCUS_26630 gene malQ 72587 71085 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056555.1 protein_id gnl|my_center|LOCUS_26630 74074 72950 gene locus_tag LOCUS_26640 74074 72950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227417.1 protein_id gnl|my_center|LOCUS_26640 75150 76124 gene locus_tag LOCUS_26650 75150 76124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 >Feature sequence22 176 493 gene locus_tag LOCUS_26660 176 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 519 776 gene locus_tag LOCUS_26670 519 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 1265 1573 gene locus_tag LOCUS_26680 1265 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 1587 2201 gene locus_tag LOCUS_26690 1587 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 2343 3782 gene locus_tag LOCUS_26700 2343 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 3891 4307 gene locus_tag LOCUS_26710 3891 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 4295 4624 gene locus_tag LOCUS_26720 4295 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 4654 5502 gene locus_tag LOCUS_26730 4654 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 5925 6491 gene locus_tag LOCUS_26740 5925 6491 CDS product photosystem I assembly protein Ycf4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057228.1 protein_id gnl|my_center|LOCUS_26740 6520 7212 gene locus_tag LOCUS_26750 6520 7212 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055992.1 protein_id gnl|my_center|LOCUS_26750 7506 8630 gene locus_tag LOCUS_26760 7506 8630 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056469.1 protein_id gnl|my_center|LOCUS_26760 9366 11246 gene locus_tag LOCUS_26770 gene dnaG 9366 11246 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057157.1 protein_id gnl|my_center|LOCUS_26770 12497 11259 gene locus_tag LOCUS_26780 12497 11259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142706.1 protein_id gnl|my_center|LOCUS_26780 13805 12645 gene locus_tag LOCUS_26790 13805 12645 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056459.1 protein_id gnl|my_center|LOCUS_26790 15698 14511 gene locus_tag LOCUS_26800 15698 14511 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_26800 16140 15850 gene locus_tag LOCUS_26810 16140 15850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 16161 16649 gene locus_tag LOCUS_26820 16161 16649 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140769.1 protein_id gnl|my_center|LOCUS_26820 16649 17497 gene locus_tag LOCUS_26830 16649 17497 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140768.1 protein_id gnl|my_center|LOCUS_26830 17500 17967 gene locus_tag LOCUS_26840 gene bcp 17500 17967 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233532.1 protein_id gnl|my_center|LOCUS_26840 18124 18921 gene locus_tag LOCUS_26850 gene rpsB 18124 18921 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057525.1 protein_id gnl|my_center|LOCUS_26850 19038 19793 gene locus_tag LOCUS_26860 gene tsf 19038 19793 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124978.1 protein_id gnl|my_center|LOCUS_26860 20044 21951 gene locus_tag LOCUS_26870 gene shc 20044 21951 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058142.1 protein_id gnl|my_center|LOCUS_26870 22407 22012 gene locus_tag LOCUS_26880 22407 22012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 22526 23521 gene locus_tag LOCUS_26890 22526 23521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 23757 24662 gene locus_tag LOCUS_26900 23757 24662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 24995 24705 gene locus_tag LOCUS_26910 24995 24705 CDS product DUF3288 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057272.1 protein_id gnl|my_center|LOCUS_26910 25612 24998 gene locus_tag LOCUS_26920 25612 24998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 26032 26244 gene locus_tag LOCUS_26930 26032 26244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 26604 27494 gene locus_tag LOCUS_26940 gene trpC 26604 27494 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056545.1 protein_id gnl|my_center|LOCUS_26940 27937 29091 gene locus_tag LOCUS_26950 27937 29091 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057305.1 protein_id gnl|my_center|LOCUS_26950 30166 29231 gene locus_tag LOCUS_26960 30166 29231 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083253.1 protein_id gnl|my_center|LOCUS_26960 31484 30186 gene locus_tag LOCUS_26970 31484 30186 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921083.1 protein_id gnl|my_center|LOCUS_26970 33050 31869 gene locus_tag LOCUS_26980 33050 31869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 33309 33076 gene locus_tag LOCUS_26990 33309 33076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 34529 33510 gene locus_tag LOCUS_27000 34529 33510 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_27000 35359 34661 gene locus_tag LOCUS_27010 35359 34661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 36461 35748 gene locus_tag LOCUS_27020 36461 35748 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072041.1 protein_id gnl|my_center|LOCUS_27020 36724 37083 gene locus_tag LOCUS_27030 36724 37083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 37101 39080 gene locus_tag LOCUS_27040 37101 39080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 39089 40108 gene locus_tag LOCUS_27050 39089 40108 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030141.1 protein_id gnl|my_center|LOCUS_27050 40101 42719 gene locus_tag LOCUS_27060 40101 42719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 43247 43549 gene locus_tag LOCUS_27070 gene ureA 43247 43549 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056825.1 protein_id gnl|my_center|LOCUS_27070 43569 43895 gene locus_tag LOCUS_27080 43569 43895 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056185.1 protein_id gnl|my_center|LOCUS_27080 43978 44853 gene locus_tag LOCUS_27090 43978 44853 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057121.1 protein_id gnl|my_center|LOCUS_27090 46033 45077 gene locus_tag LOCUS_27100 46033 45077 CDS product RNA polymerase sigma factor, RpoD/SigA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056119.1 protein_id gnl|my_center|LOCUS_27100 47661 46465 gene locus_tag LOCUS_27110 47661 46465 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_27110 48732 48433 gene locus_tag LOCUS_27120 48732 48433 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057369.1 protein_id gnl|my_center|LOCUS_27120 50035 48776 gene locus_tag LOCUS_27130 gene coaBC 50035 48776 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249472.1 protein_id gnl|my_center|LOCUS_27130 50217 51158 gene locus_tag LOCUS_27140 50217 51158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 52237 51287 gene locus_tag LOCUS_27150 52237 51287 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 protein_id gnl|my_center|LOCUS_27150 52672 52352 gene locus_tag LOCUS_27160 52672 52352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27160 53505 53669 gene locus_tag LOCUS_27170 53505 53669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 54166 53720 gene locus_tag LOCUS_27180 54166 53720 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331447.1 protein_id gnl|my_center|LOCUS_27180 54386 54153 gene locus_tag LOCUS_27190 54386 54153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 54640 54933 gene locus_tag LOCUS_27200 54640 54933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 54947 55294 gene locus_tag LOCUS_27210 54947 55294 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190909147.1 protein_id gnl|my_center|LOCUS_27210 55424 56011 gene locus_tag LOCUS_27220 55424 56011 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_27220 56719 61689 gene locus_tag LOCUS_27230 56719 61689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 62107 61715 gene locus_tag LOCUS_27240 62107 61715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 62286 62134 gene locus_tag LOCUS_27250 62286 62134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 65198 62646 gene locus_tag LOCUS_27260 gene leuS 65198 62646 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057933.1 protein_id gnl|my_center|LOCUS_27260 65860 65528 gene locus_tag LOCUS_27270 65860 65528 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174551.1 protein_id gnl|my_center|LOCUS_27270 66812 65883 gene locus_tag LOCUS_27280 66812 65883 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056823.1 protein_id gnl|my_center|LOCUS_27280 67454 67104 gene locus_tag LOCUS_27290 67454 67104 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562568.1 protein_id gnl|my_center|LOCUS_27290 68421 68864 gene locus_tag LOCUS_27300 68421 68864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 >Feature sequence23 833 2293 gene locus_tag LOCUS_27310 833 2293 CDS product IS4-like element ISGvi2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140150.1 protein_id gnl|my_center|LOCUS_27310 4316 2412 gene locus_tag LOCUS_27320 4316 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 8714 4338 gene locus_tag LOCUS_27330 8714 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 9977 8748 gene locus_tag LOCUS_27340 9977 8748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 10934 10287 gene locus_tag LOCUS_27350 10934 10287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142166.1 protein_id gnl|my_center|LOCUS_27350 13878 11026 gene locus_tag LOCUS_27360 13878 11026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 17932 13928 gene locus_tag LOCUS_27370 17932 13928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 18259 18711 gene locus_tag LOCUS_27380 18259 18711 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141996.1 protein_id gnl|my_center|LOCUS_27380 20002 18746 gene locus_tag LOCUS_27390 gene larC 20002 18746 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058129.1 protein_id gnl|my_center|LOCUS_27390 19979 20620 gene locus_tag LOCUS_27400 19979 20620 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055998.1 protein_id gnl|my_center|LOCUS_27400 21024 21434 gene locus_tag LOCUS_27410 21024 21434 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_27410 22092 21493 gene locus_tag LOCUS_27420 gene raiA 22092 21493 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056677.1 protein_id gnl|my_center|LOCUS_27420 22912 23478 gene locus_tag LOCUS_27430 22912 23478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 23733 24320 gene locus_tag LOCUS_27440 23733 24320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_27440 24533 25231 gene locus_tag LOCUS_27450 24533 25231 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143627.1 protein_id gnl|my_center|LOCUS_27450 25438 25238 gene locus_tag LOCUS_27460 25438 25238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 26044 25493 gene locus_tag LOCUS_27470 26044 25493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 26449 27057 gene locus_tag LOCUS_27480 26449 27057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_27480 26987 27265 gene locus_tag LOCUS_27490 26987 27265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 27496 28173 gene locus_tag LOCUS_27500 27496 28173 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143627.1 protein_id gnl|my_center|LOCUS_27500 28569 28180 gene locus_tag LOCUS_27510 28569 28180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 28715 29506 gene locus_tag LOCUS_27520 28715 29506 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057118.1 protein_id gnl|my_center|LOCUS_27520 30185 29493 gene locus_tag LOCUS_27530 gene tpiA 30185 29493 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798681.1 protein_id gnl|my_center|LOCUS_27530 30596 31360 gene locus_tag LOCUS_27540 30596 31360 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337498.1 protein_id gnl|my_center|LOCUS_27540 32526 31279 gene locus_tag LOCUS_27550 32526 31279 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920848.1 protein_id gnl|my_center|LOCUS_27550 33294 32668 gene locus_tag LOCUS_27560 33294 32668 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057328.1 protein_id gnl|my_center|LOCUS_27560 34173 33451 gene locus_tag LOCUS_27570 gene pgl 34173 33451 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_27570 34975 36036 gene locus_tag LOCUS_27580 34975 36036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 36096 36887 gene locus_tag LOCUS_27590 36096 36887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 37920 38651 gene locus_tag LOCUS_27600 37920 38651 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125542.1 protein_id gnl|my_center|LOCUS_27600 39368 38799 gene locus_tag LOCUS_27610 39368 38799 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_27610 39581 42439 gene locus_tag LOCUS_27620 gene ileS 39581 42439 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921027.1 protein_id gnl|my_center|LOCUS_27620 42543 42977 gene locus_tag LOCUS_27630 42543 42977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 42988 45654 gene locus_tag LOCUS_27640 42988 45654 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143241.1 protein_id gnl|my_center|LOCUS_27640 45764 46180 gene locus_tag LOCUS_27650 45764 46180 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056577.1 protein_id gnl|my_center|LOCUS_27650 48101 46221 gene locus_tag LOCUS_27660 48101 46221 CDS product DNA-directed RNA polymerase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056488.1 protein_id gnl|my_center|LOCUS_27660 49759 48248 gene locus_tag LOCUS_27670 49759 48248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 51382 49802 gene locus_tag LOCUS_27680 51382 49802 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057307.1 protein_id gnl|my_center|LOCUS_27680 54986 51624 gene locus_tag LOCUS_27690 gene smc 54986 51624 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057762.1 protein_id gnl|my_center|LOCUS_27690 55563 55294 gene locus_tag LOCUS_27700 55563 55294 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056004.1 protein_id gnl|my_center|LOCUS_27700 56850 55915 gene locus_tag LOCUS_27710 56850 55915 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_27710 57227 56847 gene locus_tag LOCUS_27720 57227 56847 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062081852.1 protein_id gnl|my_center|LOCUS_27720 58143 57232 gene locus_tag LOCUS_27730 58143 57232 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002733687.1 protein_id gnl|my_center|LOCUS_27730 58964 58140 gene locus_tag LOCUS_27740 58964 58140 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546302.1 protein_id gnl|my_center|LOCUS_27740 60116 59166 gene locus_tag LOCUS_27750 60116 59166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 61162 60113 gene locus_tag LOCUS_27760 61162 60113 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972791.1 protein_id gnl|my_center|LOCUS_27760 61425 61174 gene locus_tag LOCUS_27770 61425 61174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 62672 61926 gene locus_tag LOCUS_27780 62672 61926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 64657 62999 gene locus_tag LOCUS_27790 64657 62999 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_27790 65637 64867 gene locus_tag LOCUS_27800 65637 64867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 66502 65672 gene locus_tag LOCUS_27810 66502 65672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 67380 66619 gene locus_tag LOCUS_27820 67380 66619 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_27820 >Feature sequence24 788 330 gene locus_tag LOCUS_27830 788 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 1808 1608 gene locus_tag LOCUS_27840 1808 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 2322 2597 gene locus_tag LOCUS_27850 2322 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 3707 3132 gene locus_tag LOCUS_27860 3707 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 4477 3743 gene locus_tag LOCUS_27870 4477 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 5658 5464 gene locus_tag LOCUS_27880 5658 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 5789 6031 gene locus_tag LOCUS_27890 5789 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 6889 6035 gene locus_tag LOCUS_27900 6889 6035 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920890.1 protein_id gnl|my_center|LOCUS_27900 7237 8214 gene locus_tag LOCUS_27910 7237 8214 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928745.1 protein_id gnl|my_center|LOCUS_27910 9285 8644 gene locus_tag LOCUS_27920 9285 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 9388 10446 gene locus_tag LOCUS_27930 gene mnmA 9388 10446 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058089.1 protein_id gnl|my_center|LOCUS_27930 11295 12284 gene locus_tag LOCUS_27940 11295 12284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 12331 12948 gene locus_tag LOCUS_27950 12331 12948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 13118 12951 gene locus_tag LOCUS_27960 13118 12951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 13465 13121 gene locus_tag LOCUS_27970 13465 13121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 13564 16038 gene locus_tag LOCUS_27980 13564 16038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 16243 17478 gene locus_tag LOCUS_27990 16243 17478 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254458.1 protein_id gnl|my_center|LOCUS_27990 17559 18017 gene locus_tag LOCUS_28000 17559 18017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 18859 18107 gene locus_tag LOCUS_28010 18859 18107 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057799.1 protein_id gnl|my_center|LOCUS_28010 19650 19069 gene locus_tag LOCUS_28020 19650 19069 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141191.1 protein_id gnl|my_center|LOCUS_28020 20814 19891 gene locus_tag LOCUS_28030 20814 19891 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_28030 21410 21078 gene locus_tag LOCUS_28040 21410 21078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 21548 21618 gene locus_tag LOCUS_t00200 21548 21618 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 22350 21667 gene locus_tag LOCUS_28050 gene mtnB 22350 21667 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111958.1 protein_id gnl|my_center|LOCUS_28050 22523 22903 gene locus_tag LOCUS_28060 22523 22903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057511.1 protein_id gnl|my_center|LOCUS_28060 25087 23651 gene locus_tag LOCUS_28070 25087 23651 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124464.1 protein_id gnl|my_center|LOCUS_28070 25391 26605 gene locus_tag LOCUS_28080 25391 26605 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058160.1 protein_id gnl|my_center|LOCUS_28080 27849 27250 gene locus_tag LOCUS_28090 27849 27250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28090 28122 28379 gene locus_tag LOCUS_28100 28122 28379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 28624 28821 gene locus_tag LOCUS_28110 28624 28821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 30822 28900 gene locus_tag LOCUS_28120 gene gyrB 30822 28900 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056494.1 protein_id gnl|my_center|LOCUS_28120 31966 31256 gene locus_tag LOCUS_28130 31966 31256 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459569.1 protein_id gnl|my_center|LOCUS_28130 33469 32120 gene locus_tag LOCUS_28140 33469 32120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 34200 33481 gene locus_tag LOCUS_28150 34200 33481 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143369.1 protein_id gnl|my_center|LOCUS_28150 36920 34308 gene locus_tag LOCUS_28160 36920 34308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 38317 36953 gene locus_tag LOCUS_28170 38317 36953 CDS product DUF1822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057814.1 protein_id gnl|my_center|LOCUS_28170 39491 38334 gene locus_tag LOCUS_28180 39491 38334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 39728 40822 gene locus_tag LOCUS_28190 39728 40822 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_28190 41147 41680 gene locus_tag LOCUS_28200 gene pgsA 41147 41680 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140305.1 protein_id gnl|my_center|LOCUS_28200 41817 42788 gene locus_tag LOCUS_28210 41817 42788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 45250 42998 gene locus_tag LOCUS_28220 45250 42998 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057331.1 protein_id gnl|my_center|LOCUS_28220 46047 45523 gene locus_tag LOCUS_28230 gene ilvN 46047 45523 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056724.1 protein_id gnl|my_center|LOCUS_28230 47308 46097 gene locus_tag LOCUS_28240 47308 46097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 48120 47506 gene locus_tag LOCUS_28250 48120 47506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056873.1 protein_id gnl|my_center|LOCUS_28250 48907 48290 gene locus_tag LOCUS_28260 48907 48290 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140532.1 protein_id gnl|my_center|LOCUS_28260 49634 48891 gene locus_tag LOCUS_28270 49634 48891 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056184.1 protein_id gnl|my_center|LOCUS_28270 49962 49890 gene locus_tag LOCUS_t00210 49962 49890 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 52268 50040 gene locus_tag LOCUS_28280 52268 50040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 53127 52912 gene locus_tag LOCUS_28290 gene rpsR 53127 52912 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057896.1 protein_id gnl|my_center|LOCUS_28290 53362 53168 gene locus_tag LOCUS_28300 gene rpmG 53362 53168 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057895.1 protein_id gnl|my_center|LOCUS_28300 53539 54951 gene locus_tag LOCUS_28310 53539 54951 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 protein_id gnl|my_center|LOCUS_28310 55347 54961 gene locus_tag LOCUS_28320 55347 54961 CDS product DUF2358 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929025.1 protein_id gnl|my_center|LOCUS_28320 56752 55412 gene locus_tag LOCUS_28330 gene miaB 56752 55412 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057155.1 protein_id gnl|my_center|LOCUS_28330 57056 57340 gene locus_tag LOCUS_28340 57056 57340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 57960 58271 gene locus_tag LOCUS_28350 57960 58271 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_28350 58338 58679 gene locus_tag LOCUS_28360 58338 58679 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_28360 58712 59023 gene locus_tag LOCUS_28370 58712 59023 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_28370 59094 61052 gene locus_tag LOCUS_28380 59094 61052 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171949.1 protein_id gnl|my_center|LOCUS_28380 61184 61846 gene locus_tag LOCUS_28390 61184 61846 CDS product carbon dioxide concentrating mechanism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142090.1 protein_id gnl|my_center|LOCUS_28390 62398 63813 gene locus_tag LOCUS_28400 62398 63813 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142153.1 protein_id gnl|my_center|LOCUS_28400 63944 64342 gene locus_tag LOCUS_28410 63944 64342 CDS product chaperonin family protein RbcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142154.1 protein_id gnl|my_center|LOCUS_28410 64358 64693 gene locus_tag LOCUS_28420 64358 64693 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142155.1 protein_id gnl|my_center|LOCUS_28420 65606 64761 gene locus_tag LOCUS_28430 65606 64761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 67330 65795 gene locus_tag LOCUS_28440 67330 65795 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088620334.1 protein_id gnl|my_center|LOCUS_28440 >Feature sequence25 782 114 gene locus_tag LOCUS_28450 782 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 991 3114 gene locus_tag LOCUS_28460 991 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 4519 3137 gene locus_tag LOCUS_28470 4519 3137 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190570100.1 protein_id gnl|my_center|LOCUS_28470 4713 5177 gene locus_tag LOCUS_28480 4713 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 5219 5674 gene locus_tag LOCUS_28490 gene aroQ 5219 5674 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_28490 6477 5896 gene locus_tag LOCUS_28500 6477 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 6832 7509 gene locus_tag LOCUS_28510 gene pyrH 6832 7509 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056115.1 protein_id gnl|my_center|LOCUS_28510 7496 8044 gene locus_tag LOCUS_28520 gene frr 7496 8044 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056114.1 protein_id gnl|my_center|LOCUS_28520 9051 10331 gene locus_tag LOCUS_28530 9051 10331 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_28530 12097 10418 gene locus_tag LOCUS_28540 12097 10418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 12985 13372 gene locus_tag LOCUS_tm00010 12985 13372 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 13385 14551 gene locus_tag LOCUS_28550 13385 14551 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881286.1 protein_id gnl|my_center|LOCUS_28550 14731 15918 gene locus_tag LOCUS_28560 14731 15918 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041233550.1 protein_id gnl|my_center|LOCUS_28560 16930 16052 gene locus_tag LOCUS_28570 gene rsmH 16930 16052 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057907.1 protein_id gnl|my_center|LOCUS_28570 18472 16961 gene locus_tag LOCUS_28580 gene ilvA 18472 16961 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_28580 19384 19725 gene locus_tag LOCUS_28590 19384 19725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 20121 20354 gene locus_tag LOCUS_28600 20121 20354 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_28600 20351 20692 gene locus_tag LOCUS_28610 20351 20692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 20764 21498 gene locus_tag LOCUS_28620 20764 21498 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224783972.1 protein_id gnl|my_center|LOCUS_28620 21617 23353 gene locus_tag LOCUS_28630 21617 23353 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_28630 24049 23672 gene locus_tag LOCUS_28640 24049 23672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 27032 26754 gene locus_tag LOCUS_28650 27032 26754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 27273 26995 gene locus_tag LOCUS_28660 27273 26995 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010699606.1 protein_id gnl|my_center|LOCUS_28660 27919 27677 gene locus_tag LOCUS_28670 27919 27677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 28273 28506 gene locus_tag LOCUS_28680 28273 28506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 28660 28484 gene locus_tag LOCUS_28690 28660 28484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 29148 28663 gene locus_tag LOCUS_28700 29148 28663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 30524 29373 gene locus_tag LOCUS_28710 30524 29373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 30838 31596 gene locus_tag LOCUS_28720 gene cobS 30838 31596 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057177.1 protein_id gnl|my_center|LOCUS_28720 32054 31593 gene locus_tag LOCUS_28730 32054 31593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 32598 32368 gene locus_tag LOCUS_28740 32598 32368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 33717 32638 gene locus_tag LOCUS_28750 33717 32638 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057218.1 protein_id gnl|my_center|LOCUS_28750 34226 36433 gene locus_tag LOCUS_28760 34226 36433 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140564.1 protein_id gnl|my_center|LOCUS_28760 37260 36730 gene locus_tag LOCUS_28770 gene infC 37260 36730 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106456574.1 protein_id gnl|my_center|LOCUS_28770 37659 39083 gene locus_tag LOCUS_28780 37659 39083 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039073.1 protein_id gnl|my_center|LOCUS_28780 39094 39795 gene locus_tag LOCUS_28790 39094 39795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 39893 40072 gene locus_tag LOCUS_28800 39893 40072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 40085 40351 gene locus_tag LOCUS_28810 40085 40351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 40452 41753 gene locus_tag LOCUS_28820 40452 41753 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351354.1 protein_id gnl|my_center|LOCUS_28820 42469 41756 gene locus_tag LOCUS_28830 42469 41756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 44121 42811 gene locus_tag LOCUS_28840 gene purB 44121 42811 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057666.1 protein_id gnl|my_center|LOCUS_28840 45765 44431 gene locus_tag LOCUS_28850 45765 44431 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_28850 46851 46300 gene locus_tag LOCUS_28860 46851 46300 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056687.1 protein_id gnl|my_center|LOCUS_28860 46960 47475 gene locus_tag LOCUS_28870 46960 47475 CDS product TIGR02652 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058200.1 protein_id gnl|my_center|LOCUS_28870 47673 48170 gene locus_tag LOCUS_28880 47673 48170 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057581.1 protein_id gnl|my_center|LOCUS_28880 48301 49338 gene locus_tag LOCUS_28890 gene glpX 48301 49338 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057116.1 protein_id gnl|my_center|LOCUS_28890 49523 50809 gene locus_tag LOCUS_28900 49523 50809 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057575.1 protein_id gnl|my_center|LOCUS_28900 51140 52321 gene locus_tag LOCUS_28910 51140 52321 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182199.1 protein_id gnl|my_center|LOCUS_28910 53605 54102 gene locus_tag LOCUS_28920 53605 54102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 54661 54185 gene locus_tag LOCUS_28930 54661 54185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 54769 55824 gene locus_tag LOCUS_28940 54769 55824 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140060.1 protein_id gnl|my_center|LOCUS_28940 55840 56727 gene locus_tag LOCUS_28950 55840 56727 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267092.1 protein_id gnl|my_center|LOCUS_28950 56740 57081 gene locus_tag LOCUS_28960 56740 57081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 57197 58279 gene locus_tag LOCUS_28970 gene gmd 57197 58279 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_28970 58292 59230 gene locus_tag LOCUS_28980 58292 59230 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056480.1 protein_id gnl|my_center|LOCUS_28980 59961 59284 gene locus_tag LOCUS_28990 59961 59284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 60920 62140 gene locus_tag LOCUS_29000 60920 62140 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057832.1 protein_id gnl|my_center|LOCUS_29000 62201 63385 gene locus_tag LOCUS_29010 62201 63385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 63899 64057 gene locus_tag LOCUS_29020 63899 64057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 65296 64112 gene locus_tag LOCUS_29030 65296 64112 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104714.1 protein_id gnl|my_center|LOCUS_29030 66789 65365 gene locus_tag LOCUS_29040 66789 65365 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920919.1 protein_id gnl|my_center|LOCUS_29040 >Feature sequence26 2811 1618 gene locus_tag LOCUS_29050 2811 1618 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986860.1 protein_id gnl|my_center|LOCUS_29050 3844 2927 gene locus_tag LOCUS_29060 3844 2927 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141275.1 protein_id gnl|my_center|LOCUS_29060 4005 4874 gene locus_tag LOCUS_29070 4005 4874 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_29070 4948 5892 gene locus_tag LOCUS_29080 4948 5892 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140702.1 protein_id gnl|my_center|LOCUS_29080 6229 5957 gene locus_tag LOCUS_29090 6229 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 7526 6168 gene locus_tag LOCUS_29100 7526 6168 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_29100 9203 7767 gene locus_tag LOCUS_29110 9203 7767 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920960.1 protein_id gnl|my_center|LOCUS_29110 9674 10771 gene locus_tag LOCUS_29120 gene ribD 9674 10771 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057986.1 protein_id gnl|my_center|LOCUS_29120 10947 13004 gene locus_tag LOCUS_29130 gene htpG 10947 13004 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057033.1 protein_id gnl|my_center|LOCUS_29130 13334 14836 gene locus_tag LOCUS_29140 13334 14836 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_29140 14897 15247 gene locus_tag LOCUS_29150 14897 15247 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085898.1 protein_id gnl|my_center|LOCUS_29150 16122 15244 gene locus_tag LOCUS_29160 16122 15244 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_29160 18272 16308 gene locus_tag LOCUS_29170 18272 16308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 18745 19377 gene locus_tag LOCUS_29180 18745 19377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_29180 19882 19697 gene locus_tag LOCUS_29190 19882 19697 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061317.1 protein_id gnl|my_center|LOCUS_29190 20103 19879 gene locus_tag LOCUS_29200 20103 19879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 20397 20149 gene locus_tag LOCUS_29210 20397 20149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 20667 20867 gene locus_tag LOCUS_29220 20667 20867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 20864 21112 gene locus_tag LOCUS_29230 20864 21112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 21316 22809 gene locus_tag LOCUS_29240 21316 22809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 22815 23273 gene locus_tag LOCUS_29250 22815 23273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 23504 24232 gene locus_tag LOCUS_29260 23504 24232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 27140 24276 gene locus_tag LOCUS_29270 27140 24276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 27672 27343 gene locus_tag LOCUS_29280 27672 27343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 28623 27901 gene locus_tag LOCUS_29290 28623 27901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 30386 28620 gene locus_tag LOCUS_29300 30386 28620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 30828 30598 gene locus_tag LOCUS_29310 30828 30598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 31377 33188 gene locus_tag LOCUS_29320 gene lepA 31377 33188 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056160.1 protein_id gnl|my_center|LOCUS_29320 33245 34423 gene locus_tag LOCUS_29330 33245 34423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 34810 36624 gene locus_tag LOCUS_29340 34810 36624 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056007.1 protein_id gnl|my_center|LOCUS_29340 36684 37004 gene locus_tag LOCUS_29350 36684 37004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 38059 37073 gene locus_tag LOCUS_29360 gene hemB 38059 37073 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144341.1 protein_id gnl|my_center|LOCUS_29360 38680 39045 gene locus_tag LOCUS_29370 38680 39045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 39105 39485 gene locus_tag LOCUS_29380 39105 39485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 39714 39565 gene locus_tag LOCUS_29390 39714 39565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 40507 39911 gene locus_tag LOCUS_29400 40507 39911 CDS product TIGR02646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105321.1 protein_id gnl|my_center|LOCUS_29400 41793 40504 gene locus_tag LOCUS_29410 41793 40504 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_29410 42080 43270 gene locus_tag LOCUS_29420 42080 43270 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057783.1 protein_id gnl|my_center|LOCUS_29420 43738 43499 gene locus_tag LOCUS_29430 43738 43499 CDS product DUF4327 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058280.1 protein_id gnl|my_center|LOCUS_29430 44826 44338 gene locus_tag LOCUS_29440 44826 44338 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920902.1 protein_id gnl|my_center|LOCUS_29440 45367 44855 gene locus_tag LOCUS_29450 gene ybeY 45367 44855 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928724.1 protein_id gnl|my_center|LOCUS_29450 45564 45379 gene locus_tag LOCUS_29460 45564 45379 CDS product DUF3285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928928.1 protein_id gnl|my_center|LOCUS_29460 45766 47217 gene locus_tag LOCUS_29470 45766 47217 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056643.1 protein_id gnl|my_center|LOCUS_29470 47557 47796 gene locus_tag LOCUS_29480 47557 47796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 47789 48178 gene locus_tag LOCUS_29490 47789 48178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 48278 48682 gene locus_tag LOCUS_29500 48278 48682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 48850 49080 gene locus_tag LOCUS_29510 48850 49080 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_29510 49084 49455 gene locus_tag LOCUS_29520 49084 49455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 49680 49955 gene locus_tag LOCUS_29530 49680 49955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 49952 50200 gene locus_tag LOCUS_29540 49952 50200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 50597 50872 gene locus_tag LOCUS_29550 50597 50872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327108.1 protein_id gnl|my_center|LOCUS_29550 50872 51249 gene locus_tag LOCUS_29560 50872 51249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 51848 52378 gene locus_tag LOCUS_29570 51848 52378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 52475 53182 gene locus_tag LOCUS_29580 52475 53182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 54866 54147 gene locus_tag LOCUS_29590 54866 54147 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125174.1 protein_id gnl|my_center|LOCUS_29590 55092 55985 gene locus_tag LOCUS_29600 55092 55985 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986764.1 protein_id gnl|my_center|LOCUS_29600 56105 56413 gene locus_tag LOCUS_29610 56105 56413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 56436 56921 gene locus_tag LOCUS_29620 56436 56921 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056942.1 protein_id gnl|my_center|LOCUS_29620 57125 59785 gene locus_tag LOCUS_29630 gene clpB 57125 59785 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058284.1 protein_id gnl|my_center|LOCUS_29630 60110 61078 gene locus_tag LOCUS_29640 60110 61078 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920885.1 protein_id gnl|my_center|LOCUS_29640 62223 61126 gene locus_tag LOCUS_29650 gene glk 62223 61126 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_29650 65216 62280 gene locus_tag LOCUS_29660 65216 62280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 66696 65398 gene locus_tag LOCUS_29670 66696 65398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 >Feature sequence27 1321 317 gene locus_tag LOCUS_29680 1321 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 1518 1910 gene locus_tag LOCUS_29690 1518 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 2313 2927 gene locus_tag LOCUS_29700 2313 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 3131 5881 gene locus_tag LOCUS_29710 3131 5881 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142684.1 protein_id gnl|my_center|LOCUS_29710 8690 6534 gene locus_tag LOCUS_29720 gene ppsA 8690 6534 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629687.1 protein_id gnl|my_center|LOCUS_29720 8984 9679 gene locus_tag LOCUS_29730 8984 9679 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057103.1 protein_id gnl|my_center|LOCUS_29730 9769 10005 gene locus_tag LOCUS_29740 9769 10005 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_29740 10430 10059 gene locus_tag LOCUS_29750 10430 10059 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971327.1 protein_id gnl|my_center|LOCUS_29750 10618 10427 gene locus_tag LOCUS_29760 10618 10427 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545607.1 protein_id gnl|my_center|LOCUS_29760 12521 11307 gene locus_tag LOCUS_29770 12521 11307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 12934 13722 gene locus_tag LOCUS_29780 12934 13722 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545759.1 protein_id gnl|my_center|LOCUS_29780 13915 14499 gene locus_tag LOCUS_29790 13915 14499 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056493.1 protein_id gnl|my_center|LOCUS_29790 14724 16112 gene locus_tag LOCUS_29800 14724 16112 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_29800 16112 16678 gene locus_tag LOCUS_29810 16112 16678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 17181 16753 gene locus_tag LOCUS_29820 17181 16753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056982.1 protein_id gnl|my_center|LOCUS_29820 17380 18681 gene locus_tag LOCUS_29830 17380 18681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057293.1 protein_id gnl|my_center|LOCUS_29830 20376 18850 gene locus_tag LOCUS_29840 20376 18850 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_29840 20558 20899 gene locus_tag LOCUS_29850 20558 20899 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_29850 20983 21519 gene locus_tag LOCUS_29860 20983 21519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 22636 21551 gene locus_tag LOCUS_29870 gene hppD 22636 21551 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810922.1 protein_id gnl|my_center|LOCUS_29870 23467 22763 gene locus_tag LOCUS_29880 23467 22763 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056362.1 protein_id gnl|my_center|LOCUS_29880 23599 24768 gene locus_tag LOCUS_29890 gene sat 23599 24768 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056887.1 protein_id gnl|my_center|LOCUS_29890 25172 27193 gene locus_tag LOCUS_29900 25172 27193 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057163.1 protein_id gnl|my_center|LOCUS_29900 27269 28921 gene locus_tag LOCUS_29910 27269 28921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142439.1 protein_id gnl|my_center|LOCUS_29910 31112 29139 gene locus_tag LOCUS_29920 31112 29139 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261759.1 protein_id gnl|my_center|LOCUS_29920 36819 32047 gene locus_tag LOCUS_29930 36819 32047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 37841 38503 gene locus_tag LOCUS_29940 gene msrA 37841 38503 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_29940 41321 38922 gene locus_tag LOCUS_29950 41321 38922 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057093.1 protein_id gnl|my_center|LOCUS_29950 41518 43455 gene locus_tag LOCUS_29960 gene sir 41518 43455 CDS product sulfite reductase, ferredoxin dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920675.1 protein_id gnl|my_center|LOCUS_29960 43561 45441 gene locus_tag LOCUS_29970 43561 45441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 45446 46699 gene locus_tag LOCUS_29980 45446 46699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 47623 47931 gene locus_tag LOCUS_29990 47623 47931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057985.1 protein_id gnl|my_center|LOCUS_29990 48214 48675 gene locus_tag LOCUS_30000 48214 48675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 48672 49757 gene locus_tag LOCUS_30010 gene cax 48672 49757 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_30010 49840 51420 gene locus_tag LOCUS_30020 49840 51420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 52777 51509 gene locus_tag LOCUS_30030 52777 51509 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776584.1 protein_id gnl|my_center|LOCUS_30030 53610 52960 gene locus_tag LOCUS_30040 53610 52960 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141023.1 protein_id gnl|my_center|LOCUS_30040 54866 53625 gene locus_tag LOCUS_30050 54866 53625 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928656.1 protein_id gnl|my_center|LOCUS_30050 56580 54955 gene locus_tag LOCUS_30060 gene guaA 56580 54955 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058250.1 protein_id gnl|my_center|LOCUS_30060 57848 56721 gene locus_tag LOCUS_30070 gene cbiD 57848 56721 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056612.1 protein_id gnl|my_center|LOCUS_30070 59598 58045 gene locus_tag LOCUS_30080 59598 58045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 60639 59893 gene locus_tag LOCUS_30090 60639 59893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929385.1 protein_id gnl|my_center|LOCUS_30090 60696 61652 gene locus_tag LOCUS_30100 gene era 60696 61652 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055911.1 protein_id gnl|my_center|LOCUS_30100 61859 62536 gene locus_tag LOCUS_30110 61859 62536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 62540 63085 gene locus_tag LOCUS_30120 gene rsmD 62540 63085 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056896.1 protein_id gnl|my_center|LOCUS_30120 63631 64935 gene locus_tag LOCUS_30130 gene thrC 63631 64935 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056826.1 protein_id gnl|my_center|LOCUS_30130 65042 65317 gene locus_tag LOCUS_30140 65042 65317 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056827.1 protein_id gnl|my_center|LOCUS_30140 >Feature sequence28 2166 949 gene locus_tag LOCUS_30150 2166 949 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056036.1 protein_id gnl|my_center|LOCUS_30150 3859 2588 gene locus_tag LOCUS_30160 3859 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 4879 4424 gene locus_tag LOCUS_30170 4879 4424 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920697.1 protein_id gnl|my_center|LOCUS_30170 6623 4929 gene locus_tag LOCUS_30180 6623 4929 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 protein_id gnl|my_center|LOCUS_30180 6759 8402 gene locus_tag LOCUS_30190 6759 8402 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025269720.1 protein_id gnl|my_center|LOCUS_30190 8960 8385 gene locus_tag LOCUS_30200 8960 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 10030 9071 gene locus_tag LOCUS_30210 10030 9071 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 protein_id gnl|my_center|LOCUS_30210 11881 10388 gene locus_tag LOCUS_30220 11881 10388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 12012 14210 gene locus_tag LOCUS_30230 12012 14210 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143066.1 protein_id gnl|my_center|LOCUS_30230 15213 14278 gene locus_tag LOCUS_30240 15213 14278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 15298 16425 gene locus_tag LOCUS_30250 15298 16425 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056993.1 protein_id gnl|my_center|LOCUS_30250 16583 17809 gene locus_tag LOCUS_30260 16583 17809 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_30260 18042 20834 gene locus_tag LOCUS_30270 18042 20834 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057035.1 protein_id gnl|my_center|LOCUS_30270 21947 20985 gene locus_tag LOCUS_30280 21947 20985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_30280 23940 21937 gene locus_tag LOCUS_30290 gene uvrB 23940 21937 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057868.1 protein_id gnl|my_center|LOCUS_30290 24132 24623 gene locus_tag LOCUS_30300 24132 24623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 24749 25456 gene locus_tag LOCUS_30310 24749 25456 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_30310 25512 25898 gene locus_tag LOCUS_30320 25512 25898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 26277 26675 gene locus_tag LOCUS_30330 26277 26675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 29696 26688 gene locus_tag LOCUS_30340 29696 26688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 29806 30468 gene locus_tag LOCUS_30350 29806 30468 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_30350 30734 30646 gene locus_tag LOCUS_t00220 30734 30646 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30795 31736 gene locus_tag LOCUS_30360 30795 31736 CDS product homogentisate phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140287.1 protein_id gnl|my_center|LOCUS_30360 31733 33979 gene locus_tag LOCUS_30370 31733 33979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 34148 34516 gene locus_tag LOCUS_30380 34148 34516 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057493.1 protein_id gnl|my_center|LOCUS_30380 34531 35352 gene locus_tag LOCUS_30390 34531 35352 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057494.1 protein_id gnl|my_center|LOCUS_30390 35405 36346 gene locus_tag LOCUS_30400 35405 36346 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056037.1 protein_id gnl|my_center|LOCUS_30400 36487 36963 gene locus_tag LOCUS_30410 36487 36963 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797565.1 protein_id gnl|my_center|LOCUS_30410 36926 37687 gene locus_tag LOCUS_30420 36926 37687 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797618.1 protein_id gnl|my_center|LOCUS_30420 38013 39068 gene locus_tag LOCUS_30430 gene psbD 38013 39068 CDS product photosystem II D2 protein (photosystem q(a) protein) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056308.1 protein_id gnl|my_center|LOCUS_30430 39052 40434 gene locus_tag LOCUS_30440 gene psbC 39052 40434 CDS product photosystem II reaction center protein CP43 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024124637.1 protein_id gnl|my_center|LOCUS_30440 41545 40466 gene locus_tag LOCUS_30450 gene cobD 41545 40466 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058099.1 protein_id gnl|my_center|LOCUS_30450 41885 41601 gene locus_tag LOCUS_30460 41885 41601 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921010.1 protein_id gnl|my_center|LOCUS_30460 42431 42916 gene locus_tag LOCUS_30470 42431 42916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 42993 43469 gene locus_tag LOCUS_30480 gene ureE 42993 43469 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057206.1 protein_id gnl|my_center|LOCUS_30480 43851 44132 gene locus_tag LOCUS_30490 43851 44132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 45136 44156 gene locus_tag LOCUS_30500 45136 44156 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041243618.1 protein_id gnl|my_center|LOCUS_30500 45220 45822 gene locus_tag LOCUS_30510 45220 45822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 46117 47574 gene locus_tag LOCUS_30520 46117 47574 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057458.1 protein_id gnl|my_center|LOCUS_30520 47580 48074 gene locus_tag LOCUS_30530 47580 48074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 49105 48227 gene locus_tag LOCUS_30540 49105 48227 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_30540 49417 49109 gene locus_tag LOCUS_30550 49417 49109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 50840 49779 gene locus_tag LOCUS_30560 50840 49779 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057101.1 protein_id gnl|my_center|LOCUS_30560 51516 50998 gene locus_tag LOCUS_30570 51516 50998 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058171.1 protein_id gnl|my_center|LOCUS_30570 51733 52359 gene locus_tag LOCUS_30580 51733 52359 CDS product DUF3038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799761.1 protein_id gnl|my_center|LOCUS_30580 52362 53015 gene locus_tag LOCUS_30590 52362 53015 CDS product DUF4335 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056686.1 protein_id gnl|my_center|LOCUS_30590 53334 53026 gene locus_tag LOCUS_30600 53334 53026 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_30600 53592 53999 gene locus_tag LOCUS_30610 gene speD 53592 53999 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496461.1 protein_id gnl|my_center|LOCUS_30610 54059 54364 gene locus_tag LOCUS_30620 54059 54364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 54443 54955 gene locus_tag LOCUS_30630 54443 54955 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798971.1 protein_id gnl|my_center|LOCUS_30630 55567 54917 gene locus_tag LOCUS_30640 55567 54917 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_30640 56455 56147 gene locus_tag LOCUS_30650 56455 56147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 57462 56764 gene locus_tag LOCUS_30660 57462 56764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 59153 57465 gene locus_tag LOCUS_30670 59153 57465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 60589 59357 gene locus_tag LOCUS_30680 60589 59357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 62678 60942 gene locus_tag LOCUS_30690 62678 60942 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_30690 63345 63560 gene locus_tag LOCUS_30700 63345 63560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 63553 63981 gene locus_tag LOCUS_30710 63553 63981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 64586 64894 gene locus_tag LOCUS_30720 64586 64894 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_30720 >Feature sequence29 714 343 gene locus_tag LOCUS_30730 714 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30730 1492 1016 gene locus_tag LOCUS_30740 1492 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30740 1672 4242 gene locus_tag LOCUS_30750 1672 4242 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058092.1 protein_id gnl|my_center|LOCUS_30750 4821 4285 gene locus_tag LOCUS_30760 4821 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524130.1 protein_id gnl|my_center|LOCUS_30760 6131 4917 gene locus_tag LOCUS_30770 6131 4917 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798964.1 protein_id gnl|my_center|LOCUS_30770 7412 6312 gene locus_tag LOCUS_30780 7412 6312 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055976.1 protein_id gnl|my_center|LOCUS_30780 8689 7544 gene locus_tag LOCUS_30790 8689 7544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 9750 8923 gene locus_tag LOCUS_30800 9750 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 9991 10713 gene locus_tag LOCUS_30810 gene grpE 9991 10713 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057154.1 protein_id gnl|my_center|LOCUS_30810 11471 10803 gene locus_tag LOCUS_30820 11471 10803 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920819.1 protein_id gnl|my_center|LOCUS_30820 13526 11562 gene locus_tag LOCUS_30830 13526 11562 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_30830 13617 13754 gene locus_tag LOCUS_30840 gene rpmH 13617 13754 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141474.1 protein_id gnl|my_center|LOCUS_30840 13781 14143 gene locus_tag LOCUS_30850 13781 14143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30850 14133 14528 gene locus_tag LOCUS_30860 14133 14528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30860 14613 15761 gene locus_tag LOCUS_30870 gene yidC 14613 15761 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056448.1 protein_id gnl|my_center|LOCUS_30870 15761 16255 gene locus_tag LOCUS_30880 15761 16255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142229.1 protein_id gnl|my_center|LOCUS_30880 16658 16449 gene locus_tag LOCUS_30890 16658 16449 CDS product glycogen debranching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921159.1 protein_id gnl|my_center|LOCUS_30890 18349 16670 gene locus_tag LOCUS_30900 18349 16670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 18926 18351 gene locus_tag LOCUS_30910 18926 18351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 19163 19357 gene locus_tag LOCUS_30920 19163 19357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 21372 19714 gene locus_tag LOCUS_30930 21372 19714 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_30930 23142 21613 gene locus_tag LOCUS_30940 23142 21613 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056367.1 protein_id gnl|my_center|LOCUS_30940 23739 25211 gene locus_tag LOCUS_30950 gene gatB 23739 25211 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058226.1 protein_id gnl|my_center|LOCUS_30950 25453 26103 gene locus_tag LOCUS_30960 25453 26103 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142458.1 protein_id gnl|my_center|LOCUS_30960 26573 26121 gene locus_tag LOCUS_30970 26573 26121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 27389 26622 gene locus_tag LOCUS_30980 27389 26622 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920643.1 protein_id gnl|my_center|LOCUS_30980 27878 28876 gene locus_tag LOCUS_30990 27878 28876 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799453.1 protein_id gnl|my_center|LOCUS_30990 28895 29752 gene locus_tag LOCUS_31000 28895 29752 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167919.1 protein_id gnl|my_center|LOCUS_31000 29765 31171 gene locus_tag LOCUS_31010 29765 31171 CDS product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124536.1 protein_id gnl|my_center|LOCUS_31010 32060 31113 gene locus_tag LOCUS_31020 gene miaA 32060 31113 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056495.1 protein_id gnl|my_center|LOCUS_31020 34489 32636 gene locus_tag LOCUS_31030 gene ftsH3 34489 32636 CDS product ATP-dependent zinc metalloprotease FtsH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055986.1 protein_id gnl|my_center|LOCUS_31030 34762 36009 gene locus_tag LOCUS_31040 34762 36009 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140224.1 protein_id gnl|my_center|LOCUS_31040 36012 37139 gene locus_tag LOCUS_31050 36012 37139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 37155 39617 gene locus_tag LOCUS_31060 37155 39617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 39849 43061 gene locus_tag LOCUS_31070 39849 43061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 43206 43367 gene locus_tag LOCUS_31080 43206 43367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 43371 43718 gene locus_tag LOCUS_31090 43371 43718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 43727 44071 gene locus_tag LOCUS_31100 43727 44071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 44084 44380 gene locus_tag LOCUS_31110 44084 44380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 44530 44691 gene locus_tag LOCUS_31120 44530 44691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 44778 45071 gene locus_tag LOCUS_31130 44778 45071 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143513.1 protein_id gnl|my_center|LOCUS_31130 45068 45406 gene locus_tag LOCUS_31140 45068 45406 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460613.1 protein_id gnl|my_center|LOCUS_31140 45838 45590 gene locus_tag LOCUS_31150 45838 45590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 46058 45822 gene locus_tag LOCUS_31160 46058 45822 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259539.1 protein_id gnl|my_center|LOCUS_31160 46280 46468 gene locus_tag LOCUS_31170 46280 46468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 47071 46514 gene locus_tag LOCUS_31180 47071 46514 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_31180 47250 47744 gene locus_tag LOCUS_31190 47250 47744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 47888 48988 gene locus_tag LOCUS_31200 47888 48988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 49048 49656 gene locus_tag LOCUS_31210 49048 49656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 49786 52623 gene locus_tag LOCUS_31220 49786 52623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 52950 53261 gene locus_tag LOCUS_31230 52950 53261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 55854 53530 gene locus_tag LOCUS_31240 55854 53530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 56673 56332 gene locus_tag LOCUS_31250 56673 56332 CDS product DUF565 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057010.1 protein_id gnl|my_center|LOCUS_31250 57350 56676 gene locus_tag LOCUS_31260 57350 56676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 58050 57361 gene locus_tag LOCUS_31270 58050 57361 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056725.1 protein_id gnl|my_center|LOCUS_31270 59215 58451 gene locus_tag LOCUS_31280 59215 58451 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056927.1 protein_id gnl|my_center|LOCUS_31280 59408 59653 gene locus_tag LOCUS_31290 59408 59653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 59842 60393 gene locus_tag LOCUS_31300 59842 60393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 60885 60481 gene locus_tag LOCUS_31310 60885 60481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 61127 60882 gene locus_tag LOCUS_31320 61127 60882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 >Feature sequence30 1402 143 gene locus_tag LOCUS_31330 1402 143 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142579.1 protein_id gnl|my_center|LOCUS_31330 2683 1406 gene locus_tag LOCUS_31340 2683 1406 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_31340 2923 4752 gene locus_tag LOCUS_31350 2923 4752 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143667.1 protein_id gnl|my_center|LOCUS_31350 4752 5849 gene locus_tag LOCUS_31360 4752 5849 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_31360 5955 6045 gene locus_tag LOCUS_t00230 5955 6045 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9817 6335 gene locus_tag LOCUS_31370 gene mfd 9817 6335 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056796.1 protein_id gnl|my_center|LOCUS_31370 10488 11411 gene locus_tag LOCUS_31380 10488 11411 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_31380 11422 12117 gene locus_tag LOCUS_31390 11422 12117 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_31390 12330 12551 gene locus_tag LOCUS_31400 12330 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 12810 12577 gene locus_tag LOCUS_31410 12810 12577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 13237 13575 gene locus_tag LOCUS_31420 13237 13575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 14430 14696 gene locus_tag LOCUS_31430 14430 14696 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928542.1 protein_id gnl|my_center|LOCUS_31430 14686 14889 gene locus_tag LOCUS_31440 14686 14889 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140566.1 protein_id gnl|my_center|LOCUS_31440 16512 15646 gene locus_tag LOCUS_31450 16512 15646 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142331.1 protein_id gnl|my_center|LOCUS_31450 16806 17786 gene locus_tag LOCUS_31460 16806 17786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 17982 18923 gene locus_tag LOCUS_31470 17982 18923 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_31470 18913 19743 gene locus_tag LOCUS_31480 18913 19743 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524099.1 protein_id gnl|my_center|LOCUS_31480 19746 21272 gene locus_tag LOCUS_31490 19746 21272 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_31490 21321 21941 gene locus_tag LOCUS_31500 21321 21941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 22054 22629 gene locus_tag LOCUS_31510 22054 22629 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141894.1 protein_id gnl|my_center|LOCUS_31510 23287 22985 gene locus_tag LOCUS_31520 23287 22985 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_31520 23514 23284 gene locus_tag LOCUS_31530 23514 23284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 24381 23674 gene locus_tag LOCUS_31540 24381 23674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 24765 25118 gene locus_tag LOCUS_31550 24765 25118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 25121 25498 gene locus_tag LOCUS_31560 25121 25498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 26174 26401 gene locus_tag LOCUS_31570 26174 26401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 26454 26771 gene locus_tag LOCUS_31580 26454 26771 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_31580 27285 27034 gene locus_tag LOCUS_31590 27285 27034 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080272.1 protein_id gnl|my_center|LOCUS_31590 29315 27834 gene locus_tag LOCUS_31600 29315 27834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 30311 29406 gene locus_tag LOCUS_31610 30311 29406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 30652 31401 gene locus_tag LOCUS_31620 30652 31401 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038849.1 protein_id gnl|my_center|LOCUS_31620 31544 31768 gene locus_tag LOCUS_31630 31544 31768 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_31630 32447 32145 gene locus_tag LOCUS_31640 32447 32145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 32851 32432 gene locus_tag LOCUS_31650 32851 32432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 34324 33110 gene locus_tag LOCUS_31660 34324 33110 CDS product ISL3-like element ISBma1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538232.1 protein_id gnl|my_center|LOCUS_31660 34791 35405 gene locus_tag LOCUS_31670 34791 35405 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162810208.1 protein_id gnl|my_center|LOCUS_31670 35523 35918 gene locus_tag LOCUS_31680 35523 35918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 35921 36328 gene locus_tag LOCUS_31690 35921 36328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 39570 37048 gene locus_tag LOCUS_31700 39570 37048 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141000.1 protein_id gnl|my_center|LOCUS_31700 40062 39769 gene locus_tag LOCUS_31710 40062 39769 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_31710 40895 40602 gene locus_tag LOCUS_31720 40895 40602 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_31720 41371 41117 gene locus_tag LOCUS_31730 41371 41117 CDS product DUF3493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057674.1 protein_id gnl|my_center|LOCUS_31730 41431 41502 gene locus_tag LOCUS_t00240 41431 41502 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 42224 41715 gene locus_tag LOCUS_31740 42224 41715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928632.1 protein_id gnl|my_center|LOCUS_31740 43262 42258 gene locus_tag LOCUS_31750 43262 42258 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142039.1 protein_id gnl|my_center|LOCUS_31750 45148 44168 gene locus_tag LOCUS_31760 45148 44168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 47851 45227 gene locus_tag LOCUS_31770 47851 45227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 49023 47896 gene locus_tag LOCUS_31780 gene rfbE 49023 47896 CDS product GDP-perosamine synthase RfbE/PerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875215.1 protein_id gnl|my_center|LOCUS_31780 49553 49020 gene locus_tag LOCUS_31790 49553 49020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 51171 49984 gene locus_tag LOCUS_31800 51171 49984 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_31800 51475 52980 gene locus_tag LOCUS_31810 51475 52980 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_31810 52993 53514 gene locus_tag LOCUS_31820 52993 53514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 54462 53989 gene locus_tag LOCUS_31830 54462 53989 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058266.1 protein_id gnl|my_center|LOCUS_31830 55650 54811 gene locus_tag LOCUS_31840 55650 54811 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920966.1 protein_id gnl|my_center|LOCUS_31840 57748 55730 gene locus_tag LOCUS_31850 57748 55730 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057837.1 protein_id gnl|my_center|LOCUS_31850 58648 57818 gene locus_tag LOCUS_31860 gene ntrB 58648 57818 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920965.1 protein_id gnl|my_center|LOCUS_31860 60119 58761 gene locus_tag LOCUS_31870 60119 58761 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057835.1 protein_id gnl|my_center|LOCUS_31870 60714 61736 gene locus_tag LOCUS_31880 60714 61736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 62241 62005 gene locus_tag LOCUS_31890 62241 62005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 63618 62545 gene locus_tag LOCUS_31900 63618 62545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 64149 63694 gene locus_tag LOCUS_31910 64149 63694 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057290.1 protein_id gnl|my_center|LOCUS_31910 >Feature sequence31 545 3556 gene locus_tag LOCUS_31920 545 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 4161 3766 gene locus_tag LOCUS_31930 4161 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 4538 4831 gene locus_tag LOCUS_31940 4538 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 5894 4818 gene locus_tag LOCUS_31950 gene hrcA 5894 4818 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056606.1 protein_id gnl|my_center|LOCUS_31950 6376 6038 gene locus_tag LOCUS_31960 6376 6038 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055899.1 protein_id gnl|my_center|LOCUS_31960 6586 6813 gene locus_tag LOCUS_31970 6586 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 7024 10047 gene locus_tag LOCUS_31980 7024 10047 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058009.1 protein_id gnl|my_center|LOCUS_31980 10067 10321 gene locus_tag LOCUS_31990 10067 10321 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144349.1 protein_id gnl|my_center|LOCUS_31990 10391 12673 gene locus_tag LOCUS_32000 gene recJ 10391 12673 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056029.1 protein_id gnl|my_center|LOCUS_32000 13683 12736 gene locus_tag LOCUS_32010 gene speE 13683 12736 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583812.1 protein_id gnl|my_center|LOCUS_32010 13858 14847 gene locus_tag LOCUS_32020 13858 14847 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057151.1 protein_id gnl|my_center|LOCUS_32020 14978 15268 gene locus_tag LOCUS_32030 14978 15268 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141164.1 protein_id gnl|my_center|LOCUS_32030 15258 15611 gene locus_tag LOCUS_32040 15258 15611 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_32040 16757 15825 gene locus_tag LOCUS_32050 16757 15825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 17174 16905 gene locus_tag LOCUS_32060 gene rpmA 17174 16905 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140826.1 protein_id gnl|my_center|LOCUS_32060 17598 17209 gene locus_tag LOCUS_32070 gene rplU 17598 17209 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056022.1 protein_id gnl|my_center|LOCUS_32070 17794 18714 gene locus_tag LOCUS_32080 gene murQ 17794 18714 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057013.1 protein_id gnl|my_center|LOCUS_32080 18742 20232 gene locus_tag LOCUS_32090 18742 20232 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057032.1 protein_id gnl|my_center|LOCUS_32090 20413 20811 gene locus_tag LOCUS_32100 20413 20811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 20921 21499 gene locus_tag LOCUS_32110 20921 21499 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125221.1 protein_id gnl|my_center|LOCUS_32110 21967 21671 gene locus_tag LOCUS_32120 21967 21671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 22995 22486 gene locus_tag LOCUS_32130 22995 22486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 23206 22997 gene locus_tag LOCUS_32140 23206 22997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 23563 23255 gene locus_tag LOCUS_32150 23563 23255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 23826 23563 gene locus_tag LOCUS_32160 23826 23563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 27303 23959 gene locus_tag LOCUS_32170 27303 23959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 27893 27534 gene locus_tag LOCUS_32180 27893 27534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 28839 28105 gene locus_tag LOCUS_32190 28839 28105 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056776.1 protein_id gnl|my_center|LOCUS_32190 30262 28871 gene locus_tag LOCUS_32200 30262 28871 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142146.1 protein_id gnl|my_center|LOCUS_32200 32893 30740 gene locus_tag LOCUS_32210 32893 30740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 35065 32906 gene locus_tag LOCUS_32220 35065 32906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 37238 35085 gene locus_tag LOCUS_32230 37238 35085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 39406 37256 gene locus_tag LOCUS_32240 39406 37256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 40094 39654 gene locus_tag LOCUS_32250 40094 39654 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058261.1 protein_id gnl|my_center|LOCUS_32250 40174 41235 gene locus_tag LOCUS_32260 40174 41235 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942993.1 protein_id gnl|my_center|LOCUS_32260 41960 41280 gene locus_tag LOCUS_32270 41960 41280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 43001 42186 gene locus_tag LOCUS_32280 43001 42186 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142967.1 protein_id gnl|my_center|LOCUS_32280 43251 43009 gene locus_tag LOCUS_32290 43251 43009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 43373 45337 gene locus_tag LOCUS_32300 43373 45337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056981.1 protein_id gnl|my_center|LOCUS_32300 46952 45996 gene locus_tag LOCUS_32310 46952 45996 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047962736.1 protein_id gnl|my_center|LOCUS_32310 48205 47354 gene locus_tag LOCUS_32320 48205 47354 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_32320 48410 48889 gene locus_tag LOCUS_32330 48410 48889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 49212 49012 gene locus_tag LOCUS_32340 49212 49012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 49426 49202 gene locus_tag LOCUS_32350 49426 49202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 49669 49896 gene locus_tag LOCUS_32360 49669 49896 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142023.1 protein_id gnl|my_center|LOCUS_32360 49893 50279 gene locus_tag LOCUS_32370 49893 50279 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_32370 50858 50430 gene locus_tag LOCUS_32380 50858 50430 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393815.1 protein_id gnl|my_center|LOCUS_32380 51097 50858 gene locus_tag LOCUS_32390 51097 50858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 51696 51286 gene locus_tag LOCUS_32400 51696 51286 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_32400 51904 51689 gene locus_tag LOCUS_32410 51904 51689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142425.1 protein_id gnl|my_center|LOCUS_32410 52282 52088 gene locus_tag LOCUS_32420 52282 52088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 53958 52360 gene locus_tag LOCUS_32430 53958 52360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 58581 54007 gene locus_tag LOCUS_32440 gene gltB 58581 54007 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_32440 59023 58742 gene locus_tag LOCUS_32450 59023 58742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 59275 59108 gene locus_tag LOCUS_32460 59275 59108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 59736 59365 gene locus_tag LOCUS_32470 59736 59365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 60028 59729 gene locus_tag LOCUS_32480 60028 59729 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759700.1 protein_id gnl|my_center|LOCUS_32480 60708 60148 gene locus_tag LOCUS_32490 60708 60148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 61070 61291 gene locus_tag LOCUS_32500 61070 61291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 61281 61601 gene locus_tag LOCUS_32510 61281 61601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 63022 61829 gene locus_tag LOCUS_32520 63022 61829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32520 63487 63053 gene locus_tag LOCUS_32530 63487 63053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32530 63886 64077 gene locus_tag LOCUS_32540 63886 64077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 >Feature sequence32 134 367 gene locus_tag LOCUS_32550 134 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 437 919 gene locus_tag LOCUS_32560 437 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 1116 1388 gene locus_tag LOCUS_32570 1116 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 1561 1908 gene locus_tag LOCUS_32580 1561 1908 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057655.1 protein_id gnl|my_center|LOCUS_32580 1905 3341 gene locus_tag LOCUS_32590 1905 3341 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920933.1 protein_id gnl|my_center|LOCUS_32590 3338 3721 gene locus_tag LOCUS_32600 3338 3721 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057653.1 protein_id gnl|my_center|LOCUS_32600 3718 3969 gene locus_tag LOCUS_32610 3718 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057652.1 protein_id gnl|my_center|LOCUS_32610 3966 4235 gene locus_tag LOCUS_32620 3966 4235 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920932.1 protein_id gnl|my_center|LOCUS_32620 4244 4786 gene locus_tag LOCUS_32630 4244 4786 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057650.1 protein_id gnl|my_center|LOCUS_32630 4786 5448 gene locus_tag LOCUS_32640 4786 5448 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057649.1 protein_id gnl|my_center|LOCUS_32640 6594 5638 gene locus_tag LOCUS_32650 6594 5638 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047962736.1 protein_id gnl|my_center|LOCUS_32650 7063 9159 gene locus_tag LOCUS_32660 7063 9159 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109314215.1 protein_id gnl|my_center|LOCUS_32660 9167 9838 gene locus_tag LOCUS_32670 9167 9838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 12197 10026 gene locus_tag LOCUS_32680 12197 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 12492 13094 gene locus_tag LOCUS_32690 gene lepB 12492 13094 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929024.1 protein_id gnl|my_center|LOCUS_32690 14212 13355 gene locus_tag LOCUS_32700 14212 13355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 14867 14193 gene locus_tag LOCUS_32710 14867 14193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 15679 14864 gene locus_tag LOCUS_32720 15679 14864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 16913 15954 gene locus_tag LOCUS_32730 16913 15954 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524103.1 protein_id gnl|my_center|LOCUS_32730 18852 17059 gene locus_tag LOCUS_32740 gene typA 18852 17059 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058116.1 protein_id gnl|my_center|LOCUS_32740 19709 19005 gene locus_tag LOCUS_32750 19709 19005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 19833 20492 gene locus_tag LOCUS_32760 19833 20492 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920805.1 protein_id gnl|my_center|LOCUS_32760 21299 20736 gene locus_tag LOCUS_32770 21299 20736 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_32770 22098 21796 gene locus_tag LOCUS_32780 22098 21796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 22961 22269 gene locus_tag LOCUS_32790 22961 22269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 24195 22936 gene locus_tag LOCUS_32800 24195 22936 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817269.1 protein_id gnl|my_center|LOCUS_32800 24439 25803 gene locus_tag LOCUS_32810 24439 25803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 26157 26585 gene locus_tag LOCUS_32820 gene psb27 26157 26585 CDS product photosystem II protein Psb27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058295.1 protein_id gnl|my_center|LOCUS_32820 26922 29291 gene locus_tag LOCUS_32830 26922 29291 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921058.1 protein_id gnl|my_center|LOCUS_32830 29637 29458 gene locus_tag LOCUS_32840 29637 29458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 33266 30219 gene locus_tag LOCUS_32850 33266 30219 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057001.1 protein_id gnl|my_center|LOCUS_32850 34155 33478 gene locus_tag LOCUS_32860 34155 33478 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058023.1 protein_id gnl|my_center|LOCUS_32860 34650 36038 gene locus_tag LOCUS_32870 34650 36038 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057595.1 protein_id gnl|my_center|LOCUS_32870 36041 36541 gene locus_tag LOCUS_32880 36041 36541 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920767.1 protein_id gnl|my_center|LOCUS_32880 36669 37256 gene locus_tag LOCUS_32890 36669 37256 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057311.1 protein_id gnl|my_center|LOCUS_32890 37318 38127 gene locus_tag LOCUS_32900 37318 38127 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920882.1 protein_id gnl|my_center|LOCUS_32900 38238 39875 gene locus_tag LOCUS_32910 38238 39875 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_32910 40044 40469 gene locus_tag LOCUS_32920 40044 40469 CDS product photosystem I reaction center subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125882.1 protein_id gnl|my_center|LOCUS_32920 40875 42395 gene locus_tag LOCUS_32930 gene trpE 40875 42395 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057509.1 protein_id gnl|my_center|LOCUS_32930 43845 42691 gene locus_tag LOCUS_32940 43845 42691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 44241 44456 gene locus_tag LOCUS_32950 44241 44456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 44936 45478 gene locus_tag LOCUS_32960 44936 45478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 45615 46025 gene locus_tag LOCUS_32970 gene gloA 45615 46025 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143550.1 protein_id gnl|my_center|LOCUS_32970 46047 46523 gene locus_tag LOCUS_32980 46047 46523 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_32980 47195 46542 gene locus_tag LOCUS_32990 gene nusB 47195 46542 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056630.1 protein_id gnl|my_center|LOCUS_32990 48814 47351 gene locus_tag LOCUS_33000 48814 47351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 49784 49197 gene locus_tag LOCUS_33010 gene hemJ 49784 49197 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143033.1 protein_id gnl|my_center|LOCUS_33010 51318 50347 gene locus_tag LOCUS_33020 51318 50347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 52691 51339 gene locus_tag LOCUS_33030 52691 51339 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057393.1 protein_id gnl|my_center|LOCUS_33030 54016 52730 gene locus_tag LOCUS_33040 54016 52730 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_33040 54511 55779 gene locus_tag LOCUS_33050 54511 55779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055996.1 protein_id gnl|my_center|LOCUS_33050 56120 57385 gene locus_tag LOCUS_33060 gene purD 56120 57385 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920939.1 protein_id gnl|my_center|LOCUS_33060 57610 58836 gene locus_tag LOCUS_33070 57610 58836 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_33070 59005 60561 gene locus_tag LOCUS_33080 59005 60561 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057727.1 protein_id gnl|my_center|LOCUS_33080 61603 60695 gene locus_tag LOCUS_33090 61603 60695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 >Feature sequence33 1250 108 gene locus_tag LOCUS_33100 1250 108 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_33100 3095 1518 gene locus_tag LOCUS_33110 3095 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 4428 3097 gene locus_tag LOCUS_33120 gene dnaB 4428 3097 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125984.1 protein_id gnl|my_center|LOCUS_33120 5735 4548 gene locus_tag LOCUS_33130 5735 4548 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_33130 5943 6731 gene locus_tag LOCUS_33140 gene cobM 5943 6731 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056411.1 protein_id gnl|my_center|LOCUS_33140 7564 7097 gene locus_tag LOCUS_33150 gene tspO 7564 7097 CDS product tryptophan-rich sensory protein TspO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338115.1 protein_id gnl|my_center|LOCUS_33150 7915 7574 gene locus_tag LOCUS_33160 7915 7574 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_33160 9538 8024 gene locus_tag LOCUS_33170 9538 8024 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003043195.1 protein_id gnl|my_center|LOCUS_33170 10971 9838 gene locus_tag LOCUS_33180 10971 9838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 11459 11238 gene locus_tag LOCUS_33190 11459 11238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 12882 11773 gene locus_tag LOCUS_33200 12882 11773 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524107.1 protein_id gnl|my_center|LOCUS_33200 13459 12902 gene locus_tag LOCUS_33210 13459 12902 CDS product Ycf51 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056935.1 protein_id gnl|my_center|LOCUS_33210 13436 14053 gene locus_tag LOCUS_33220 13436 14053 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_33220 14361 14678 gene locus_tag LOCUS_33230 14361 14678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 14675 15037 gene locus_tag LOCUS_33240 14675 15037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 15037 15729 gene locus_tag LOCUS_33250 gene queC 15037 15729 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126004.1 protein_id gnl|my_center|LOCUS_33250 16328 15756 gene locus_tag LOCUS_33260 16328 15756 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_33260 16807 16637 gene locus_tag LOCUS_33270 16807 16637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 17007 17960 gene locus_tag LOCUS_33280 17007 17960 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056398.1 protein_id gnl|my_center|LOCUS_33280 18052 18744 gene locus_tag LOCUS_33290 18052 18744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 18763 19158 gene locus_tag LOCUS_33300 18763 19158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 19614 20570 gene locus_tag LOCUS_33310 19614 20570 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047962736.1 protein_id gnl|my_center|LOCUS_33310 21370 20780 gene locus_tag LOCUS_33320 21370 20780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 21808 22119 gene locus_tag LOCUS_33330 21808 22119 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836217.1 protein_id gnl|my_center|LOCUS_33330 22064 22315 gene locus_tag LOCUS_33340 22064 22315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 22639 22379 gene locus_tag LOCUS_33350 22639 22379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 22784 23917 gene locus_tag LOCUS_33360 22784 23917 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_33360 24296 23967 gene locus_tag LOCUS_33370 24296 23967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143983.1 protein_id gnl|my_center|LOCUS_33370 24963 24679 gene locus_tag LOCUS_33380 24963 24679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 25598 27985 gene locus_tag LOCUS_33390 25598 27985 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_33390 28382 28140 gene locus_tag LOCUS_33400 28382 28140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 29969 28443 gene locus_tag LOCUS_33410 gene lnt 29969 28443 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057504.1 protein_id gnl|my_center|LOCUS_33410 30194 30964 gene locus_tag LOCUS_33420 30194 30964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 31442 31056 gene locus_tag LOCUS_33430 31442 31056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140108.1 protein_id gnl|my_center|LOCUS_33430 31962 32909 gene locus_tag LOCUS_33440 31962 32909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 33373 34002 gene locus_tag LOCUS_33450 33373 34002 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056926.1 protein_id gnl|my_center|LOCUS_33450 34340 34990 gene locus_tag LOCUS_33460 34340 34990 CDS product DUF3318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056895.1 protein_id gnl|my_center|LOCUS_33460 35104 36099 gene locus_tag LOCUS_33470 35104 36099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 36086 36538 gene locus_tag LOCUS_33480 36086 36538 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_33480 37990 36545 gene locus_tag LOCUS_33490 37990 36545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 39325 38072 gene locus_tag LOCUS_33500 gene sbcD 39325 38072 CDS product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057812.1 protein_id gnl|my_center|LOCUS_33500 39511 39368 gene locus_tag LOCUS_33510 39511 39368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 40032 40427 gene locus_tag LOCUS_33520 40032 40427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 40620 41720 gene locus_tag LOCUS_33530 gene aroB 40620 41720 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056627.1 protein_id gnl|my_center|LOCUS_33530 42833 41697 gene locus_tag LOCUS_33540 42833 41697 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921229.1 protein_id gnl|my_center|LOCUS_33540 43073 44257 gene locus_tag LOCUS_33550 43073 44257 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_33550 44257 44505 gene locus_tag LOCUS_33560 44257 44505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 44593 44775 gene locus_tag LOCUS_33570 44593 44775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 45830 44835 gene locus_tag LOCUS_33580 45830 44835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 47090 46068 gene locus_tag LOCUS_33590 47090 46068 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090038.1 protein_id gnl|my_center|LOCUS_33590 48355 47090 gene locus_tag LOCUS_33600 48355 47090 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_33600 48944 48486 gene locus_tag LOCUS_33610 48944 48486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 50349 49069 gene locus_tag LOCUS_33620 50349 49069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 51953 50529 gene locus_tag LOCUS_33630 51953 50529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 53175 52135 gene locus_tag LOCUS_33640 53175 52135 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550405.1 protein_id gnl|my_center|LOCUS_33640 54155 53370 gene locus_tag LOCUS_33650 54155 53370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 54610 54281 gene locus_tag LOCUS_33660 54610 54281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 55529 55137 gene locus_tag LOCUS_33670 55529 55137 CDS product DUF4278 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056168.1 protein_id gnl|my_center|LOCUS_33670 56139 55684 gene locus_tag LOCUS_33680 56139 55684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 56572 57621 gene locus_tag LOCUS_33690 56572 57621 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799453.1 protein_id gnl|my_center|LOCUS_33690 57695 57623 gene locus_tag LOCUS_t00250 57695 57623 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 57907 58105 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58124 59434 gene locus_tag LOCUS_33700 58124 59434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 59497 60234 gene locus_tag LOCUS_33710 59497 60234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 60506 60354 gene locus_tag LOCUS_33720 60506 60354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 61285 60530 gene locus_tag LOCUS_33730 61285 60530 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530111.1 protein_id gnl|my_center|LOCUS_33730 >Feature sequence34 773 84 gene locus_tag LOCUS_33740 773 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 1045 1308 gene locus_tag LOCUS_33750 1045 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 1283 1825 gene locus_tag LOCUS_33760 1283 1825 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057399.1 protein_id gnl|my_center|LOCUS_33760 2017 3924 gene locus_tag LOCUS_33770 gene mnmG 2017 3924 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056385.1 protein_id gnl|my_center|LOCUS_33770 7348 4307 gene locus_tag LOCUS_33780 7348 4307 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_33780 7990 7739 gene locus_tag LOCUS_33790 7990 7739 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405518.1 protein_id gnl|my_center|LOCUS_33790 8281 8030 gene locus_tag LOCUS_33800 8281 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 8320 8583 gene locus_tag LOCUS_33810 8320 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 8580 8945 gene locus_tag LOCUS_33820 8580 8945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531260.1 protein_id gnl|my_center|LOCUS_33820 9510 8971 gene locus_tag LOCUS_33830 9510 8971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 10696 9698 gene locus_tag LOCUS_33840 10696 9698 CDS product IS630-like element ISTth6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926103.1 protein_id gnl|my_center|LOCUS_33840 10806 11033 gene locus_tag LOCUS_33850 10806 11033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 11766 11374 gene locus_tag LOCUS_33860 11766 11374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 12138 12671 gene locus_tag LOCUS_33870 12138 12671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 13505 13068 gene locus_tag LOCUS_33880 13505 13068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 15020 13620 gene locus_tag LOCUS_33890 15020 13620 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141482.1 protein_id gnl|my_center|LOCUS_33890 15390 15163 gene locus_tag LOCUS_33900 15390 15163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 16951 15974 gene locus_tag LOCUS_33910 16951 15974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 17221 17412 gene locus_tag LOCUS_33920 17221 17412 CDS product DUF2949 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921037.1 protein_id gnl|my_center|LOCUS_33920 18132 17674 gene locus_tag LOCUS_33930 18132 17674 CDS product nitrate reductase associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057196.1 protein_id gnl|my_center|LOCUS_33930 19045 18206 gene locus_tag LOCUS_33940 19045 18206 CDS product prephenate/arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921244.1 protein_id gnl|my_center|LOCUS_33940 19413 19051 gene locus_tag LOCUS_33950 19413 19051 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875991.1 protein_id gnl|my_center|LOCUS_33950 19518 19970 gene locus_tag LOCUS_33960 19518 19970 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056191.1 protein_id gnl|my_center|LOCUS_33960 20765 19989 gene locus_tag LOCUS_33970 20765 19989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 21276 20956 gene locus_tag LOCUS_33980 21276 20956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 21747 22337 gene locus_tag LOCUS_33990 gene cbiT 21747 22337 CDS product precorrin-6Y C5,15-methyltransferase subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057353.1 protein_id gnl|my_center|LOCUS_33990 22386 23297 gene locus_tag LOCUS_34000 22386 23297 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057942.1 protein_id gnl|my_center|LOCUS_34000 23352 24869 gene locus_tag LOCUS_34010 gene cobA 23352 24869 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920993.1 protein_id gnl|my_center|LOCUS_34010 24948 25274 gene locus_tag LOCUS_34020 24948 25274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 25689 25342 gene locus_tag LOCUS_34030 25689 25342 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_34030 26102 25794 gene locus_tag LOCUS_34040 26102 25794 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142093.1 protein_id gnl|my_center|LOCUS_34040 26648 26154 gene locus_tag LOCUS_34050 gene msrA 26648 26154 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 protein_id gnl|my_center|LOCUS_34050 27408 26641 gene locus_tag LOCUS_34060 gene panB 27408 26641 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928599.1 protein_id gnl|my_center|LOCUS_34060 28104 27412 gene locus_tag LOCUS_34070 gene bchM 28104 27412 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056304.1 protein_id gnl|my_center|LOCUS_34070 28316 29737 gene locus_tag LOCUS_34080 gene pyk 28316 29737 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143313.1 protein_id gnl|my_center|LOCUS_34080 29936 30733 gene locus_tag LOCUS_34090 gene modA 29936 30733 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032249.1 protein_id gnl|my_center|LOCUS_34090 30930 32768 gene locus_tag LOCUS_34100 30930 32768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 32887 33339 gene locus_tag LOCUS_34110 32887 33339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 33621 33887 gene locus_tag LOCUS_34120 33621 33887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 33983 35359 gene locus_tag LOCUS_34130 33983 35359 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088430287.1 protein_id gnl|my_center|LOCUS_34130 35506 37404 gene locus_tag LOCUS_34140 35506 37404 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920663.1 protein_id gnl|my_center|LOCUS_34140 37505 38356 gene locus_tag LOCUS_34150 gene murI 37505 38356 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056314.1 protein_id gnl|my_center|LOCUS_34150 39705 40643 gene locus_tag LOCUS_34160 39705 40643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 41639 40716 gene locus_tag LOCUS_34170 41639 40716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 42430 41717 gene locus_tag LOCUS_34180 42430 41717 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107286.1 protein_id gnl|my_center|LOCUS_34180 43548 42523 gene locus_tag LOCUS_34190 43548 42523 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194045.1 protein_id gnl|my_center|LOCUS_34190 44221 43586 gene locus_tag LOCUS_34200 gene gmhA2 44221 43586 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857991.1 protein_id gnl|my_center|LOCUS_34200 44825 45484 gene locus_tag LOCUS_34210 44825 45484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 45481 46707 gene locus_tag LOCUS_34220 45481 46707 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_34220 46789 47907 gene locus_tag LOCUS_34230 46789 47907 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023661.1 protein_id gnl|my_center|LOCUS_34230 48488 48306 gene locus_tag LOCUS_34240 48488 48306 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061317.1 protein_id gnl|my_center|LOCUS_34240 48676 48485 gene locus_tag LOCUS_34250 48676 48485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 49312 48899 gene locus_tag LOCUS_34260 49312 48899 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_34260 49541 49299 gene locus_tag LOCUS_34270 49541 49299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 50889 49672 gene locus_tag LOCUS_34280 50889 49672 CDS product ISAs1-like element ISSod22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072192.1 protein_id gnl|my_center|LOCUS_34280 51665 51045 gene locus_tag LOCUS_34290 51665 51045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 52075 51755 gene locus_tag LOCUS_34300 52075 51755 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084909.1 protein_id gnl|my_center|LOCUS_34300 52253 52080 gene locus_tag LOCUS_34310 52253 52080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 52575 52309 gene locus_tag LOCUS_34320 gene relE3 52575 52309 CDS product type II toxin-antitoxin system toxin RelE3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870615.1 protein_id gnl|my_center|LOCUS_34320 52781 52572 gene locus_tag LOCUS_34330 52781 52572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 53199 52864 gene locus_tag LOCUS_34340 53199 52864 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084909.1 protein_id gnl|my_center|LOCUS_34340 54378 53380 gene locus_tag LOCUS_34350 54378 53380 CDS product IS630-like element ISTth6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926103.1 protein_id gnl|my_center|LOCUS_34350 54687 54454 gene locus_tag LOCUS_34360 54687 54454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 55368 55072 gene locus_tag LOCUS_34370 55368 55072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 55752 55498 gene locus_tag LOCUS_34380 55752 55498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 56072 55854 gene locus_tag LOCUS_34390 56072 55854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 58166 56451 gene locus_tag LOCUS_34400 58166 56451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 58685 58365 gene locus_tag LOCUS_34410 58685 58365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 58819 58697 gene locus_tag LOCUS_34420 58819 58697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 58972 59202 gene locus_tag LOCUS_34430 58972 59202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 60998 59574 gene locus_tag LOCUS_34440 60998 59574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 >Feature sequence35 3976 2924 gene locus_tag LOCUS_34450 3976 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 5820 4348 gene locus_tag LOCUS_34460 5820 4348 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142768.1 protein_id gnl|my_center|LOCUS_34460 6628 5936 gene locus_tag LOCUS_34470 6628 5936 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143961.1 protein_id gnl|my_center|LOCUS_34470 7384 6650 gene locus_tag LOCUS_34480 7384 6650 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143961.1 protein_id gnl|my_center|LOCUS_34480 8035 7406 gene locus_tag LOCUS_34490 8035 7406 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141012.1 protein_id gnl|my_center|LOCUS_34490 8833 8057 gene locus_tag LOCUS_34500 8833 8057 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143961.1 protein_id gnl|my_center|LOCUS_34500 9113 9583 gene locus_tag LOCUS_34510 9113 9583 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_34510 10209 9673 gene locus_tag LOCUS_34520 10209 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 11149 10298 gene locus_tag LOCUS_34530 gene htpX 11149 10298 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257483.1 protein_id gnl|my_center|LOCUS_34530 11695 12438 gene locus_tag LOCUS_34540 11695 12438 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530095.1 protein_id gnl|my_center|LOCUS_34540 12618 12941 gene locus_tag LOCUS_34550 12618 12941 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140295.1 protein_id gnl|my_center|LOCUS_34550 13095 13868 gene locus_tag LOCUS_34560 gene cbiQ 13095 13868 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140294.1 protein_id gnl|my_center|LOCUS_34560 13883 14659 gene locus_tag LOCUS_34570 13883 14659 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140293.1 protein_id gnl|my_center|LOCUS_34570 14770 15960 gene locus_tag LOCUS_34580 14770 15960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 18604 16364 gene locus_tag LOCUS_34590 18604 16364 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920844.1 protein_id gnl|my_center|LOCUS_34590 18942 19235 gene locus_tag LOCUS_34600 18942 19235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057054.1 protein_id gnl|my_center|LOCUS_34600 19323 20393 gene locus_tag LOCUS_34610 19323 20393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 21114 20410 gene locus_tag LOCUS_34620 gene rnc 21114 20410 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142642.1 protein_id gnl|my_center|LOCUS_34620 21989 22816 gene locus_tag LOCUS_34630 21989 22816 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_34630 23948 22794 gene locus_tag LOCUS_34640 23948 22794 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055884.1 protein_id gnl|my_center|LOCUS_34640 24096 25685 gene locus_tag LOCUS_34650 24096 25685 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_34650 26246 27433 gene locus_tag LOCUS_34660 26246 27433 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056984.1 protein_id gnl|my_center|LOCUS_34660 27860 27591 gene locus_tag LOCUS_34670 27860 27591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 28017 29213 gene locus_tag LOCUS_34680 28017 29213 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_34680 30833 29325 gene locus_tag LOCUS_34690 30833 29325 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056298.1 protein_id gnl|my_center|LOCUS_34690 31614 32528 gene locus_tag LOCUS_34700 31614 32528 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056269.1 protein_id gnl|my_center|LOCUS_34700 32530 33717 gene locus_tag LOCUS_34710 32530 33717 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920967.1 protein_id gnl|my_center|LOCUS_34710 36898 33839 gene locus_tag LOCUS_34720 36898 33839 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014855724.1 protein_id gnl|my_center|LOCUS_34720 38368 37181 gene locus_tag LOCUS_34730 38368 37181 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_34730 39338 38427 gene locus_tag LOCUS_34740 39338 38427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 40194 39760 gene locus_tag LOCUS_34750 40194 39760 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057040.1 protein_id gnl|my_center|LOCUS_34750 40392 42188 gene locus_tag LOCUS_34760 40392 42188 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199341128.1 protein_id gnl|my_center|LOCUS_34760 42725 44821 gene locus_tag LOCUS_34770 gene pta 42725 44821 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_34770 46769 48637 gene locus_tag LOCUS_34780 46769 48637 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920876.1 protein_id gnl|my_center|LOCUS_34780 48747 49001 gene locus_tag LOCUS_34790 48747 49001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057356.1 protein_id gnl|my_center|LOCUS_34790 48994 49296 gene locus_tag LOCUS_34800 48994 49296 CDS product DUF3181 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920922.1 protein_id gnl|my_center|LOCUS_34800 49549 50634 gene locus_tag LOCUS_34810 gene ald 49549 50634 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143957.1 protein_id gnl|my_center|LOCUS_34810 50675 51454 gene locus_tag LOCUS_34820 50675 51454 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175245.1 protein_id gnl|my_center|LOCUS_34820 52556 51582 gene locus_tag LOCUS_34830 52556 51582 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220240.1 protein_id gnl|my_center|LOCUS_34830 57808 53111 gene locus_tag LOCUS_34840 57808 53111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 58364 58212 gene locus_tag LOCUS_34850 58364 58212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 >Feature sequence36 127 528 gene locus_tag LOCUS_34860 127 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 606 1091 gene locus_tag LOCUS_34870 606 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 2191 1640 gene locus_tag LOCUS_34880 2191 1640 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201440.1 protein_id gnl|my_center|LOCUS_34880 2322 2396 gene locus_tag LOCUS_t00260 2322 2396 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3330 2437 gene locus_tag LOCUS_34890 3330 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 4857 3370 gene locus_tag LOCUS_34900 4857 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 5932 4868 gene locus_tag LOCUS_34910 5932 4868 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546142.1 protein_id gnl|my_center|LOCUS_34910 7231 5960 gene locus_tag LOCUS_34920 7231 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 8692 7271 gene locus_tag LOCUS_34930 8692 7271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 9938 8871 gene locus_tag LOCUS_34940 9938 8871 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_34940 10788 10009 gene locus_tag LOCUS_34950 10788 10009 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142987.1 protein_id gnl|my_center|LOCUS_34950 11725 10892 gene locus_tag LOCUS_34960 11725 10892 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143597.1 protein_id gnl|my_center|LOCUS_34960 13053 11818 gene locus_tag LOCUS_34970 13053 11818 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057937.1 protein_id gnl|my_center|LOCUS_34970 13207 13419 gene locus_tag LOCUS_34980 13207 13419 CDS product DUF2839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057932.1 protein_id gnl|my_center|LOCUS_34980 14484 13543 gene locus_tag LOCUS_34990 14484 13543 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125025.1 protein_id gnl|my_center|LOCUS_34990 14862 15308 gene locus_tag LOCUS_35000 14862 15308 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391317.1 protein_id gnl|my_center|LOCUS_35000 15431 15901 gene locus_tag LOCUS_35010 15431 15901 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_35010 16686 15898 gene locus_tag LOCUS_35020 16686 15898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058196.1 protein_id gnl|my_center|LOCUS_35020 17423 16917 gene locus_tag LOCUS_35030 17423 16917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 18237 17689 gene locus_tag LOCUS_35040 18237 17689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 18717 18364 gene locus_tag LOCUS_35050 18717 18364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 19156 18803 gene locus_tag LOCUS_35060 19156 18803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 19594 19241 gene locus_tag LOCUS_35070 19594 19241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 20144 19680 gene locus_tag LOCUS_35080 20144 19680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 20628 20230 gene locus_tag LOCUS_35090 20628 20230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 21227 20853 gene locus_tag LOCUS_35100 21227 20853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 21333 22529 gene locus_tag LOCUS_35110 21333 22529 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_35110 22839 22540 gene locus_tag LOCUS_35120 22839 22540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 23968 22910 gene locus_tag LOCUS_35130 gene acsF 23968 22910 CDS product magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057559.1 protein_id gnl|my_center|LOCUS_35130 26140 24176 gene locus_tag LOCUS_35140 26140 24176 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056928.1 protein_id gnl|my_center|LOCUS_35140 26502 26684 gene locus_tag LOCUS_35150 26502 26684 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140794.1 protein_id gnl|my_center|LOCUS_35150 26866 27465 gene locus_tag LOCUS_35160 26866 27465 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144254.1 protein_id gnl|my_center|LOCUS_35160 29165 27582 gene locus_tag LOCUS_35170 29165 27582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 30471 29176 gene locus_tag LOCUS_35180 30471 29176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 31040 30789 gene locus_tag LOCUS_35190 31040 30789 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056719.1 protein_id gnl|my_center|LOCUS_35190 31708 31112 gene locus_tag LOCUS_35200 31708 31112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 31990 32553 gene locus_tag LOCUS_35210 31990 32553 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_35210 32559 33128 gene locus_tag LOCUS_35220 32559 33128 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_35220 34028 33267 gene locus_tag LOCUS_35230 gene folD 34028 33267 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920629.1 protein_id gnl|my_center|LOCUS_35230 34187 34924 gene locus_tag LOCUS_35240 34187 34924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 34965 35252 gene locus_tag LOCUS_35250 34965 35252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35250 35357 35776 gene locus_tag LOCUS_35260 35357 35776 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057899.1 protein_id gnl|my_center|LOCUS_35260 35877 37244 gene locus_tag LOCUS_35270 35877 37244 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172187164.1 protein_id gnl|my_center|LOCUS_35270 38188 37622 gene locus_tag LOCUS_35280 gene recR 38188 37622 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058038.1 protein_id gnl|my_center|LOCUS_35280 38935 38333 gene locus_tag LOCUS_35290 38935 38333 CDS product DUF4330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920747.1 protein_id gnl|my_center|LOCUS_35290 39145 41184 gene locus_tag LOCUS_35300 gene speA 39145 41184 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057644.1 protein_id gnl|my_center|LOCUS_35300 41262 43277 gene locus_tag LOCUS_35310 41262 43277 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056499.1 protein_id gnl|my_center|LOCUS_35310 43837 44112 gene locus_tag LOCUS_35320 43837 44112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 44316 44594 gene locus_tag LOCUS_35330 44316 44594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 45533 45048 gene locus_tag LOCUS_35340 45533 45048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 47956 45824 gene locus_tag LOCUS_35350 47956 45824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 48053 50032 gene locus_tag LOCUS_35360 48053 50032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 50051 50443 gene locus_tag LOCUS_35370 50051 50443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 51441 50944 gene locus_tag LOCUS_35380 51441 50944 CDS product type II toxin-antitoxin system YhaV family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084500.1 protein_id gnl|my_center|LOCUS_35380 51779 51444 gene locus_tag LOCUS_35390 51779 51444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 52051 53229 gene locus_tag LOCUS_35400 52051 53229 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920638.1 protein_id gnl|my_center|LOCUS_35400 54301 54810 gene locus_tag LOCUS_35410 54301 54810 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921201.1 protein_id gnl|my_center|LOCUS_35410 54970 55653 gene locus_tag LOCUS_35420 54970 55653 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058093.1 protein_id gnl|my_center|LOCUS_35420 57020 55971 gene locus_tag LOCUS_35430 57020 55971 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057531.1 protein_id gnl|my_center|LOCUS_35430 57155 57082 gene locus_tag LOCUS_t00270 57155 57082 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 58101 57202 gene locus_tag LOCUS_35440 gene speB 58101 57202 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_35440 >Feature sequence37 689 120 gene locus_tag LOCUS_35450 689 120 CDS product IS607-like element IS1535 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404760.1 protein_id gnl|my_center|LOCUS_35450 1472 780 gene locus_tag LOCUS_35460 1472 780 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057508.1 protein_id gnl|my_center|LOCUS_35460 1946 2134 gene locus_tag LOCUS_35470 1946 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 2119 2415 gene locus_tag LOCUS_35480 2119 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 3940 2489 gene locus_tag LOCUS_35490 3940 2489 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_35490 4236 5894 gene locus_tag LOCUS_35500 4236 5894 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_35500 6174 7082 gene locus_tag LOCUS_35510 6174 7082 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085605.1 protein_id gnl|my_center|LOCUS_35510 7291 7556 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccaactaatcctatttgacctaataggtaagg 9202 7580 gene locus_tag LOCUS_35520 9202 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 9615 9208 gene locus_tag LOCUS_35530 9615 9208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 10462 9635 gene locus_tag LOCUS_35540 gene cmr4 10462 9635 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880200.1 protein_id gnl|my_center|LOCUS_35540 10730 10605 gene locus_tag LOCUS_35550 10730 10605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 11856 10873 gene locus_tag LOCUS_35560 11856 10873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 13291 11867 gene locus_tag LOCUS_35570 13291 11867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 13919 13299 gene locus_tag LOCUS_35580 13919 13299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 15125 14232 gene locus_tag LOCUS_35590 15125 14232 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224783972.1 protein_id gnl|my_center|LOCUS_35590 15551 15198 gene locus_tag LOCUS_35600 15551 15198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 16169 15567 gene locus_tag LOCUS_35610 16169 15567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 16723 17420 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccttacctattaggtcaaataggattagttggaaac 18070 19353 gene locus_tag LOCUS_35620 18070 19353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 19919 19386 gene locus_tag LOCUS_35630 gene dps 19919 19386 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258826.1 protein_id gnl|my_center|LOCUS_35630 20405 20178 gene locus_tag LOCUS_35640 20405 20178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 20614 20408 gene locus_tag LOCUS_35650 20614 20408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 21058 20708 gene locus_tag LOCUS_35660 21058 20708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 21998 21267 gene locus_tag LOCUS_35670 21998 21267 CDS product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465158.1 protein_id gnl|my_center|LOCUS_35670 22209 23159 gene locus_tag LOCUS_35680 22209 23159 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143271.1 protein_id gnl|my_center|LOCUS_35680 23570 23172 gene locus_tag LOCUS_35690 23570 23172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 23831 25000 gene locus_tag LOCUS_35700 23831 25000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 25025 26128 gene locus_tag LOCUS_35710 25025 26128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 26572 26282 gene locus_tag LOCUS_35720 26572 26282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 26894 26532 gene locus_tag LOCUS_35730 26894 26532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 27339 27524 gene locus_tag LOCUS_35740 27339 27524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 28365 27628 gene locus_tag LOCUS_35750 28365 27628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 30139 28445 gene locus_tag LOCUS_35760 30139 28445 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969043.1 protein_id gnl|my_center|LOCUS_35760 31063 30173 gene locus_tag LOCUS_35770 31063 30173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 31747 31265 gene locus_tag LOCUS_35780 31747 31265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 32355 32131 gene locus_tag LOCUS_35790 32355 32131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 33228 32371 gene locus_tag LOCUS_35800 33228 32371 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_35800 33415 33206 gene locus_tag LOCUS_35810 33415 33206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 34771 33437 gene locus_tag LOCUS_35820 gene clpX 34771 33437 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056361.1 protein_id gnl|my_center|LOCUS_35820 35483 34782 gene locus_tag LOCUS_35830 gene clpP 35483 34782 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056360.1 protein_id gnl|my_center|LOCUS_35830 37340 35946 gene locus_tag LOCUS_35840 gene tig 37340 35946 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144179.1 protein_id gnl|my_center|LOCUS_35840 37665 38702 gene locus_tag LOCUS_35850 37665 38702 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524132.1 protein_id gnl|my_center|LOCUS_35850 38970 39863 gene locus_tag LOCUS_35860 gene dapA 38970 39863 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057061.1 protein_id gnl|my_center|LOCUS_35860 40106 41854 gene locus_tag LOCUS_35870 40106 41854 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057062.1 protein_id gnl|my_center|LOCUS_35870 42025 42795 gene locus_tag LOCUS_35880 gene larB 42025 42795 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057031.1 protein_id gnl|my_center|LOCUS_35880 42869 44779 gene locus_tag LOCUS_35890 gene dxs 42869 44779 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056470.1 protein_id gnl|my_center|LOCUS_35890 45148 45444 gene locus_tag LOCUS_35900 45148 45444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 45441 45794 gene locus_tag LOCUS_35910 45441 45794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 45904 46125 gene locus_tag LOCUS_35920 45904 46125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 46127 46312 gene locus_tag LOCUS_35930 46127 46312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 47022 47321 gene locus_tag LOCUS_35940 47022 47321 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_35940 47305 47703 gene locus_tag LOCUS_35950 47305 47703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 49972 47879 gene locus_tag LOCUS_35960 49972 47879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 50874 50248 gene locus_tag LOCUS_35970 50874 50248 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929250.1 protein_id gnl|my_center|LOCUS_35970 51409 52917 gene locus_tag LOCUS_35980 51409 52917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 >Feature sequence38 186 587 gene locus_tag LOCUS_35990 186 587 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141008.1 protein_id gnl|my_center|LOCUS_35990 3579 1300 gene locus_tag LOCUS_36000 gene glgB 3579 1300 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_36000 4236 3988 gene locus_tag LOCUS_36010 4236 3988 CDS product TatA/E family twin arginine-targeting protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057225.1 protein_id gnl|my_center|LOCUS_36010 4535 4341 gene locus_tag LOCUS_36020 gene psbH 4535 4341 CDS product photosystem II reaction center protein PsbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057226.1 protein_id gnl|my_center|LOCUS_36020 4980 5579 gene locus_tag LOCUS_36030 4980 5579 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932882.1 protein_id gnl|my_center|LOCUS_36030 5762 6556 gene locus_tag LOCUS_36040 5762 6556 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142238.1 protein_id gnl|my_center|LOCUS_36040 6516 7412 gene locus_tag LOCUS_36050 6516 7412 CDS product MnmC family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920906.1 protein_id gnl|my_center|LOCUS_36050 7632 8525 gene locus_tag LOCUS_36060 7632 8525 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224783972.1 protein_id gnl|my_center|LOCUS_36060 10944 8761 gene locus_tag LOCUS_36070 10944 8761 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921160.1 protein_id gnl|my_center|LOCUS_36070 11329 13737 gene locus_tag LOCUS_36080 11329 13737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 13789 14148 gene locus_tag LOCUS_36090 gene grxD 13789 14148 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125804.1 protein_id gnl|my_center|LOCUS_36090 14292 14558 gene locus_tag LOCUS_36100 14292 14558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 14555 14965 gene locus_tag LOCUS_36110 14555 14965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 16761 15022 gene locus_tag LOCUS_36120 16761 15022 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929136.1 protein_id gnl|my_center|LOCUS_36120 16967 17851 gene locus_tag LOCUS_36130 gene lipA 16967 17851 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056422.1 protein_id gnl|my_center|LOCUS_36130 18203 19336 gene locus_tag LOCUS_36140 18203 19336 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056272.1 protein_id gnl|my_center|LOCUS_36140 21123 19597 gene locus_tag LOCUS_36150 gene bchB 21123 19597 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058224.1 protein_id gnl|my_center|LOCUS_36150 21875 21279 gene locus_tag LOCUS_36160 21875 21279 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140153.1 protein_id gnl|my_center|LOCUS_36160 22059 22415 gene locus_tag LOCUS_36170 22059 22415 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057662.1 protein_id gnl|my_center|LOCUS_36170 23016 22429 gene locus_tag LOCUS_36180 23016 22429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 23715 23242 gene locus_tag LOCUS_36190 23715 23242 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057630.1 protein_id gnl|my_center|LOCUS_36190 24229 23894 gene locus_tag LOCUS_36200 24229 23894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141134.1 protein_id gnl|my_center|LOCUS_36200 25545 24502 gene locus_tag LOCUS_36210 gene dcm 25545 24502 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964364.1 protein_id gnl|my_center|LOCUS_36210 26511 26960 gene locus_tag LOCUS_36220 26511 26960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 27026 27316 gene locus_tag LOCUS_36230 27026 27316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 29054 27405 gene locus_tag LOCUS_36240 29054 27405 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057114.1 protein_id gnl|my_center|LOCUS_36240 31004 29346 gene locus_tag LOCUS_36250 31004 29346 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057517.1 protein_id gnl|my_center|LOCUS_36250 32395 31184 gene locus_tag LOCUS_36260 32395 31184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 34892 32937 gene locus_tag LOCUS_36270 34892 32937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 35870 34956 gene locus_tag LOCUS_36280 gene hslO 35870 34956 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056651.1 protein_id gnl|my_center|LOCUS_36280 35955 36371 gene locus_tag LOCUS_36290 35955 36371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143307.1 protein_id gnl|my_center|LOCUS_36290 36542 37978 gene locus_tag LOCUS_36300 gene ffh 36542 37978 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057808.1 protein_id gnl|my_center|LOCUS_36300 38950 37982 gene locus_tag LOCUS_36310 gene thiL 38950 37982 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921033.1 protein_id gnl|my_center|LOCUS_36310 39032 40228 gene locus_tag LOCUS_36320 39032 40228 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_36320 40274 40468 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41320 40649 gene locus_tag LOCUS_36330 41320 40649 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056716.1 protein_id gnl|my_center|LOCUS_36330 42189 42608 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42797 44278 gene locus_tag LOCUS_36340 42797 44278 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056715.1 protein_id gnl|my_center|LOCUS_36340 44436 45059 gene locus_tag LOCUS_36350 44436 45059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 45086 46174 gene locus_tag LOCUS_36360 gene cax 45086 46174 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_36360 46854 46177 gene locus_tag LOCUS_36370 gene rsmG 46854 46177 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799336.1 protein_id gnl|my_center|LOCUS_36370 47580 46933 gene locus_tag LOCUS_36380 47580 46933 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920666.1 protein_id gnl|my_center|LOCUS_36380 47666 48580 gene locus_tag LOCUS_36390 47666 48580 CDS product Sll0314/Alr1548 family TPR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524124.1 protein_id gnl|my_center|LOCUS_36390 49074 50114 gene locus_tag LOCUS_36400 49074 50114 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142617.1 protein_id gnl|my_center|LOCUS_36400 51840 50254 gene locus_tag LOCUS_36410 51840 50254 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057166.1 protein_id gnl|my_center|LOCUS_36410 >Feature sequence39 530 75 gene locus_tag LOCUS_36420 530 75 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929341.1 protein_id gnl|my_center|LOCUS_36420 1003 842 gene locus_tag LOCUS_36430 1003 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 1138 1938 gene locus_tag LOCUS_36440 1138 1938 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_36440 2936 2088 gene locus_tag LOCUS_36450 gene nadC 2936 2088 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057550.1 protein_id gnl|my_center|LOCUS_36450 3574 3008 gene locus_tag LOCUS_36460 3574 3008 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_36460 3736 4203 gene locus_tag LOCUS_36470 3736 4203 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057639.1 protein_id gnl|my_center|LOCUS_36470 4246 4497 gene locus_tag LOCUS_36480 4246 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 4537 5580 gene locus_tag LOCUS_36490 4537 5580 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_36490 5904 6956 gene locus_tag LOCUS_36500 5904 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 7299 7679 gene locus_tag LOCUS_36510 7299 7679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057706.1 protein_id gnl|my_center|LOCUS_36510 8185 7718 gene locus_tag LOCUS_36520 8185 7718 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141481.1 protein_id gnl|my_center|LOCUS_36520 8687 8196 gene locus_tag LOCUS_36530 8687 8196 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_36530 9189 8698 gene locus_tag LOCUS_36540 9189 8698 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_36540 9495 10412 gene locus_tag LOCUS_36550 9495 10412 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017291357.1 protein_id gnl|my_center|LOCUS_36550 11016 10414 gene locus_tag LOCUS_36560 11016 10414 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142793.1 protein_id gnl|my_center|LOCUS_36560 11885 11247 gene locus_tag LOCUS_36570 11885 11247 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058292.1 protein_id gnl|my_center|LOCUS_36570 12272 13813 gene locus_tag LOCUS_36580 12272 13813 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_36580 15271 14237 gene locus_tag LOCUS_36590 15271 14237 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_36590 15798 16919 gene locus_tag LOCUS_36600 gene pstS 15798 16919 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530168.1 protein_id gnl|my_center|LOCUS_36600 17014 17973 gene locus_tag LOCUS_36610 gene pstC 17014 17973 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124751.1 protein_id gnl|my_center|LOCUS_36610 18220 19041 gene locus_tag LOCUS_36620 gene pstA 18220 19041 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140450.1 protein_id gnl|my_center|LOCUS_36620 19235 20038 gene locus_tag LOCUS_36630 gene pstB 19235 20038 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124749.1 protein_id gnl|my_center|LOCUS_36630 20130 20927 gene locus_tag LOCUS_36640 gene pstB 20130 20927 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124749.1 protein_id gnl|my_center|LOCUS_36640 21255 22280 gene locus_tag LOCUS_36650 21255 22280 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140012.1 protein_id gnl|my_center|LOCUS_36650 22373 23308 gene locus_tag LOCUS_36660 gene pstC 22373 23308 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140013.1 protein_id gnl|my_center|LOCUS_36660 23311 24234 gene locus_tag LOCUS_36670 gene pstA 23311 24234 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941758.1 protein_id gnl|my_center|LOCUS_36670 24252 25034 gene locus_tag LOCUS_36680 gene pstB 24252 25034 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107795169.1 protein_id gnl|my_center|LOCUS_36680 26112 25087 gene locus_tag LOCUS_36690 26112 25087 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140012.1 protein_id gnl|my_center|LOCUS_36690 26521 27285 gene locus_tag LOCUS_36700 gene map 26521 27285 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142406.1 protein_id gnl|my_center|LOCUS_36700 27443 27751 gene locus_tag LOCUS_36710 27443 27751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 27664 28860 gene locus_tag LOCUS_36720 27664 28860 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_36720 28967 29944 gene locus_tag LOCUS_36730 28967 29944 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920725.1 protein_id gnl|my_center|LOCUS_36730 30546 29941 gene locus_tag LOCUS_36740 gene cobO 30546 29941 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056120.1 protein_id gnl|my_center|LOCUS_36740 31364 30621 gene locus_tag LOCUS_36750 31364 30621 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929431.1 protein_id gnl|my_center|LOCUS_36750 32356 31571 gene locus_tag LOCUS_36760 32356 31571 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929431.1 protein_id gnl|my_center|LOCUS_36760 34635 32947 gene locus_tag LOCUS_36770 34635 32947 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898994.1 protein_id gnl|my_center|LOCUS_36770 35669 34986 gene locus_tag LOCUS_36780 35669 34986 CDS product Mo-dependent nitrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142802.1 protein_id gnl|my_center|LOCUS_36780 37303 35918 gene locus_tag LOCUS_36790 37303 35918 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 protein_id gnl|my_center|LOCUS_36790 38275 37349 gene locus_tag LOCUS_36800 38275 37349 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056512.1 protein_id gnl|my_center|LOCUS_36800 38885 38541 gene locus_tag LOCUS_36810 38885 38541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 39118 38882 gene locus_tag LOCUS_36820 39118 38882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 39494 42364 gene locus_tag LOCUS_36830 gene polA 39494 42364 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057179.1 protein_id gnl|my_center|LOCUS_36830 42369 42614 gene locus_tag LOCUS_36840 42369 42614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 42690 42899 gene locus_tag LOCUS_36850 42690 42899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 43300 43743 gene locus_tag LOCUS_36860 43300 43743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 43698 44249 gene locus_tag LOCUS_36870 43698 44249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36870 45830 44748 gene locus_tag LOCUS_36880 45830 44748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36880 46049 47707 gene locus_tag LOCUS_36890 46049 47707 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_36890 49148 48354 gene locus_tag LOCUS_36900 gene trpA 49148 48354 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056294.1 protein_id gnl|my_center|LOCUS_36900 49413 50330 gene locus_tag LOCUS_36910 49413 50330 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_36910 >Feature sequence40 609 319 gene locus_tag LOCUS_36920 609 319 CDS product DUF2288 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086400.1 protein_id gnl|my_center|LOCUS_36920 1578 9305 gene locus_tag LOCUS_36930 1578 9305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 9432 10751 gene locus_tag LOCUS_36940 9432 10751 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447772.1 protein_id gnl|my_center|LOCUS_36940 10968 11846 gene locus_tag LOCUS_36950 10968 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 12085 13392 gene locus_tag LOCUS_36960 12085 13392 CDS product ABC exporter membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056492.1 protein_id gnl|my_center|LOCUS_36960 13463 14578 gene locus_tag LOCUS_36970 gene devC 13463 14578 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056491.1 protein_id gnl|my_center|LOCUS_36970 14599 15306 gene locus_tag LOCUS_36980 14599 15306 CDS product DevA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_36980 15367 15460 gene locus_tag LOCUS_t00280 15367 15460 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 15479 16285 gene locus_tag LOCUS_36990 15479 16285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 18156 16282 gene locus_tag LOCUS_37000 gene mrdA 18156 16282 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057025.1 protein_id gnl|my_center|LOCUS_37000 19649 18540 gene locus_tag LOCUS_37010 19649 18540 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144408.1 protein_id gnl|my_center|LOCUS_37010 19733 23278 gene locus_tag LOCUS_37020 19733 23278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 23590 24087 gene locus_tag LOCUS_37030 23590 24087 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_37030 24736 24323 gene locus_tag LOCUS_37040 24736 24323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 25236 24793 gene locus_tag LOCUS_37050 25236 24793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 25650 25342 gene locus_tag LOCUS_37060 25650 25342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 25972 26322 gene locus_tag LOCUS_37070 25972 26322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 26300 26662 gene locus_tag LOCUS_37080 26300 26662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 26899 27519 gene locus_tag LOCUS_37090 26899 27519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142966.1 protein_id gnl|my_center|LOCUS_37090 27725 28888 gene locus_tag LOCUS_37100 27725 28888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 29132 32695 gene locus_tag LOCUS_37110 gene metH 29132 32695 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921137.1 protein_id gnl|my_center|LOCUS_37110 33531 32845 gene locus_tag LOCUS_37120 33531 32845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929300.1 protein_id gnl|my_center|LOCUS_37120 33599 34903 gene locus_tag LOCUS_37130 gene hisD 33599 34903 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337274.1 protein_id gnl|my_center|LOCUS_37130 35884 36048 gene locus_tag LOCUS_37140 35884 36048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 37085 36012 gene locus_tag LOCUS_37150 37085 36012 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920924.1 protein_id gnl|my_center|LOCUS_37150 37394 37684 gene locus_tag LOCUS_37160 37394 37684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 37892 38581 gene locus_tag LOCUS_37170 37892 38581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 38701 39273 gene locus_tag LOCUS_37180 38701 39273 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056726.1 protein_id gnl|my_center|LOCUS_37180 39273 39593 gene locus_tag LOCUS_37190 39273 39593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 40818 39772 gene locus_tag LOCUS_37200 gene hemW 40818 39772 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799709.1 protein_id gnl|my_center|LOCUS_37200 40843 41094 gene locus_tag LOCUS_37210 40843 41094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 41206 42285 gene locus_tag LOCUS_37220 41206 42285 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055863.1 protein_id gnl|my_center|LOCUS_37220 42901 42623 gene locus_tag LOCUS_37230 42901 42623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 43263 44600 gene locus_tag LOCUS_37240 gene trmFO 43263 44600 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056303.1 protein_id gnl|my_center|LOCUS_37240 44662 45159 gene locus_tag LOCUS_37250 44662 45159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 48110 45462 gene locus_tag LOCUS_37260 gene mutS 48110 45462 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058073.1 protein_id gnl|my_center|LOCUS_37260 48815 48306 gene locus_tag LOCUS_37270 gene apcB 48815 48306 CDS product allophycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057869.1 protein_id gnl|my_center|LOCUS_37270 50137 48998 gene locus_tag LOCUS_37280 gene proB 50137 48998 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057952.1 protein_id gnl|my_center|LOCUS_37280 >Feature sequence41 1379 1705 gene locus_tag LOCUS_37290 1379 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 1743 1952 gene locus_tag LOCUS_37300 1743 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 2115 3017 gene locus_tag LOCUS_37310 2115 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_37310 3547 3047 gene locus_tag LOCUS_37320 3547 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 3732 5504 gene locus_tag LOCUS_37330 3732 5504 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141880.1 protein_id gnl|my_center|LOCUS_37330 6534 5491 gene locus_tag LOCUS_37340 6534 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 6600 7109 gene locus_tag LOCUS_37350 6600 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 7399 7824 gene locus_tag LOCUS_37360 7399 7824 CDS product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816150.1 protein_id gnl|my_center|LOCUS_37360 7954 7884 gene locus_tag LOCUS_t00290 7954 7884 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8777 8040 gene locus_tag LOCUS_37370 8777 8040 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056544.1 protein_id gnl|my_center|LOCUS_37370 9868 9044 gene locus_tag LOCUS_37380 9868 9044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 10510 9872 gene locus_tag LOCUS_37390 10510 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 11506 11255 gene locus_tag LOCUS_37400 11506 11255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 12287 13834 gene locus_tag LOCUS_37410 12287 13834 CDS product bifunctional pantoate--beta-alanine ligase/(d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058282.1 protein_id gnl|my_center|LOCUS_37410 13819 14319 gene locus_tag LOCUS_37420 13819 14319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 14330 16153 gene locus_tag LOCUS_37430 14330 16153 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057687.1 protein_id gnl|my_center|LOCUS_37430 16168 16491 gene locus_tag LOCUS_37440 16168 16491 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056944.1 protein_id gnl|my_center|LOCUS_37440 16498 17016 gene locus_tag LOCUS_37450 16498 17016 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140843.1 protein_id gnl|my_center|LOCUS_37450 17438 17100 gene locus_tag LOCUS_37460 gene psb28 17438 17100 CDS product photosystem II reaction center protein Psb28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920702.1 protein_id gnl|my_center|LOCUS_37460 18646 19650 gene locus_tag LOCUS_37470 18646 19650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 19873 21381 gene locus_tag LOCUS_37480 19873 21381 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920839.1 protein_id gnl|my_center|LOCUS_37480 22956 21409 gene locus_tag LOCUS_37490 22956 21409 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142479.1 protein_id gnl|my_center|LOCUS_37490 23569 23234 gene locus_tag LOCUS_37500 23569 23234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 23746 25347 gene locus_tag LOCUS_37510 23746 25347 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057237.1 protein_id gnl|my_center|LOCUS_37510 26069 27319 gene locus_tag LOCUS_37520 gene rpoD 26069 27319 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173878.1 protein_id gnl|my_center|LOCUS_37520 27534 27827 gene locus_tag LOCUS_37530 gene rpsT 27534 27827 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057030.1 protein_id gnl|my_center|LOCUS_37530 27878 28657 gene locus_tag LOCUS_37540 27878 28657 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057029.1 protein_id gnl|my_center|LOCUS_37540 28848 32159 gene locus_tag LOCUS_37550 gene rpoB 28848 32159 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056489.1 protein_id gnl|my_center|LOCUS_37550 32459 36463 gene locus_tag LOCUS_37560 32459 36463 CDS product DNA-directed RNA polymerase subunit beta'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056487.1 protein_id gnl|my_center|LOCUS_37560 37017 36943 gene locus_tag LOCUS_t00300 37017 36943 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 37573 37058 gene locus_tag LOCUS_37570 37573 37058 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057519.1 protein_id gnl|my_center|LOCUS_37570 37765 37679 gene locus_tag LOCUS_t00310 37765 37679 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 38365 39126 gene locus_tag LOCUS_37580 38365 39126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 39202 42171 gene locus_tag LOCUS_37590 39202 42171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 42374 44143 gene locus_tag LOCUS_37600 42374 44143 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966765.1 protein_id gnl|my_center|LOCUS_37600 44901 44140 gene locus_tag LOCUS_37610 gene hisA 44901 44140 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140708.1 protein_id gnl|my_center|LOCUS_37610 45271 45552 gene locus_tag LOCUS_37620 45271 45552 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057702.1 protein_id gnl|my_center|LOCUS_37620 45536 46087 gene locus_tag LOCUS_37630 45536 46087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 46814 46530 gene locus_tag LOCUS_37640 46814 46530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37640 >Feature sequence42 1052 105 gene locus_tag LOCUS_37650 1052 105 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056589.1 protein_id gnl|my_center|LOCUS_37650 2289 1237 gene locus_tag LOCUS_37660 gene hemE 2289 1237 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125231.1 protein_id gnl|my_center|LOCUS_37660 2484 2855 gene locus_tag LOCUS_37670 2484 2855 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_37670 5209 2957 gene locus_tag LOCUS_37680 5209 2957 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_37680 6756 5593 gene locus_tag LOCUS_37690 6756 5593 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057642.1 protein_id gnl|my_center|LOCUS_37690 8049 6826 gene locus_tag LOCUS_37700 8049 6826 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902302.1 protein_id gnl|my_center|LOCUS_37700 8202 9389 gene locus_tag LOCUS_37710 8202 9389 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012165757.1 protein_id gnl|my_center|LOCUS_37710 9672 9938 gene locus_tag LOCUS_37720 9672 9938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141573.1 protein_id gnl|my_center|LOCUS_37720 10371 9943 gene locus_tag LOCUS_37730 10371 9943 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144326.1 protein_id gnl|my_center|LOCUS_37730 10620 10381 gene locus_tag LOCUS_37740 10620 10381 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144325.1 protein_id gnl|my_center|LOCUS_37740 11790 10909 gene locus_tag LOCUS_37750 11790 10909 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550718.1 protein_id gnl|my_center|LOCUS_37750 11970 13391 gene locus_tag LOCUS_37760 11970 13391 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057580.1 protein_id gnl|my_center|LOCUS_37760 13589 14806 gene locus_tag LOCUS_37770 13589 14806 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_37770 15298 14867 gene locus_tag LOCUS_37780 15298 14867 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_37780 15613 16542 gene locus_tag LOCUS_37790 15613 16542 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143656.1 protein_id gnl|my_center|LOCUS_37790 16630 16965 gene locus_tag LOCUS_37800 16630 16965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 17194 17466 gene locus_tag LOCUS_37810 17194 17466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 17765 22231 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccctaatagggtttaagattaattggaac 22737 22465 gene locus_tag LOCUS_37820 gene cas2 22737 22465 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256456.1 protein_id gnl|my_center|LOCUS_37820 23754 22750 gene locus_tag LOCUS_37830 gene cas1 23754 22750 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_37830 24353 23760 gene locus_tag LOCUS_37840 gene cas4 24353 23760 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_37840 25189 24356 gene locus_tag LOCUS_37850 25189 24356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 25755 25189 gene locus_tag LOCUS_37860 25755 25189 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143802.1 protein_id gnl|my_center|LOCUS_37860 25914 25765 gene locus_tag LOCUS_37870 25914 25765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 26840 26274 gene locus_tag LOCUS_37880 26840 26274 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143802.1 protein_id gnl|my_center|LOCUS_37880 27512 26850 gene locus_tag LOCUS_37890 27512 26850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 28520 27519 gene locus_tag LOCUS_37900 28520 27519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 31511 28545 gene locus_tag LOCUS_37910 31511 28545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 33528 31522 gene locus_tag LOCUS_37920 33528 31522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 34021 33866 gene locus_tag LOCUS_37930 34021 33866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 34083 34934 gene locus_tag LOCUS_37940 34083 34934 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142464.1 protein_id gnl|my_center|LOCUS_37940 35714 35040 gene locus_tag LOCUS_37950 35714 35040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 36777 35770 gene locus_tag LOCUS_37960 36777 35770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 40241 36795 gene locus_tag LOCUS_37970 40241 36795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 40668 40234 gene locus_tag LOCUS_37980 40668 40234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 41130 40672 gene locus_tag LOCUS_37990 41130 40672 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174492.1 protein_id gnl|my_center|LOCUS_37990 41755 41336 gene locus_tag LOCUS_38000 41755 41336 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391723.1 protein_id gnl|my_center|LOCUS_38000 42515 42255 gene locus_tag LOCUS_38010 42515 42255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 44712 42772 gene locus_tag LOCUS_38020 44712 42772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 45037 45900 gene locus_tag LOCUS_38030 45037 45900 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142464.1 protein_id gnl|my_center|LOCUS_38030 47138 45969 gene locus_tag LOCUS_38040 47138 45969 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058268.1 protein_id gnl|my_center|LOCUS_38040 >Feature sequence43 455 135 gene locus_tag LOCUS_38050 455 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 672 466 gene locus_tag LOCUS_38060 672 466 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_38060 933 709 gene locus_tag LOCUS_38070 933 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 1566 1000 gene locus_tag LOCUS_38080 1566 1000 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928692.1 protein_id gnl|my_center|LOCUS_38080 2468 1572 gene locus_tag LOCUS_38090 2468 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 2855 2502 gene locus_tag LOCUS_38100 2855 2502 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_38100 3335 2943 gene locus_tag LOCUS_38110 3335 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142930.1 protein_id gnl|my_center|LOCUS_38110 3846 3691 gene locus_tag LOCUS_38120 3846 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 4346 4050 gene locus_tag LOCUS_38130 4346 4050 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143494.1 protein_id gnl|my_center|LOCUS_38130 4630 4346 gene locus_tag LOCUS_38140 4630 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 5431 5652 gene locus_tag LOCUS_38150 5431 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 5639 5872 gene locus_tag LOCUS_38160 5639 5872 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813809.1 protein_id gnl|my_center|LOCUS_38160 6731 5970 gene locus_tag LOCUS_38170 6731 5970 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_38170 7474 6815 gene locus_tag LOCUS_38180 7474 6815 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141522.1 protein_id gnl|my_center|LOCUS_38180 8070 7492 gene locus_tag LOCUS_38190 8070 7492 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_38190 9330 9968 gene locus_tag LOCUS_38200 gene hisH 9330 9968 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057376.1 protein_id gnl|my_center|LOCUS_38200 10709 9957 gene locus_tag LOCUS_38210 10709 9957 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_38210 11964 10849 gene locus_tag LOCUS_38220 11964 10849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 12136 12792 gene locus_tag LOCUS_38230 12136 12792 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058278.1 protein_id gnl|my_center|LOCUS_38230 13334 12807 gene locus_tag LOCUS_38240 13334 12807 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143166.1 protein_id gnl|my_center|LOCUS_38240 13621 13328 gene locus_tag LOCUS_38250 13621 13328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 14413 13775 gene locus_tag LOCUS_38260 14413 13775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057488.1 protein_id gnl|my_center|LOCUS_38260 16044 14521 gene locus_tag LOCUS_38270 16044 14521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193329014.1 protein_id gnl|my_center|LOCUS_38270 16577 16861 gene locus_tag LOCUS_38280 16577 16861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 18847 16970 gene locus_tag LOCUS_38290 gene uvrC 18847 16970 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057590.1 protein_id gnl|my_center|LOCUS_38290 19388 19128 gene locus_tag LOCUS_38300 19388 19128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 20553 19468 gene locus_tag LOCUS_38310 gene leuB 20553 19468 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057439.1 protein_id gnl|my_center|LOCUS_38310 21897 20824 gene locus_tag LOCUS_38320 21897 20824 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143227.1 protein_id gnl|my_center|LOCUS_38320 22777 21902 gene locus_tag LOCUS_38330 gene rfbD 22777 21902 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_38330 23328 22783 gene locus_tag LOCUS_38340 gene rfbC 23328 22783 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771397.1 protein_id gnl|my_center|LOCUS_38340 23462 24556 gene locus_tag LOCUS_38350 gene bioB 23462 24556 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_38350 24627 25181 gene locus_tag LOCUS_38360 24627 25181 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406022.1 protein_id gnl|my_center|LOCUS_38360 25193 25660 gene locus_tag LOCUS_38370 gene lspA 25193 25660 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140076.1 protein_id gnl|my_center|LOCUS_38370 26155 25943 gene locus_tag LOCUS_38380 26155 25943 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_38380 26405 26250 gene locus_tag LOCUS_38390 26405 26250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38390 27006 26560 gene locus_tag LOCUS_38400 27006 26560 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_38400 27245 27003 gene locus_tag LOCUS_38410 27245 27003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 29123 27330 gene locus_tag LOCUS_38420 29123 27330 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928895.1 protein_id gnl|my_center|LOCUS_38420 29314 30036 gene locus_tag LOCUS_38430 29314 30036 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929431.1 protein_id gnl|my_center|LOCUS_38430 30061 30594 gene locus_tag LOCUS_38440 gene purE 30061 30594 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056434.1 protein_id gnl|my_center|LOCUS_38440 31865 30669 gene locus_tag LOCUS_38450 31865 30669 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_38450 31958 32758 gene locus_tag LOCUS_38460 31958 32758 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125923.1 protein_id gnl|my_center|LOCUS_38460 33142 33636 gene locus_tag LOCUS_38470 33142 33636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041243886.1 protein_id gnl|my_center|LOCUS_38470 35373 33733 gene locus_tag LOCUS_38480 gene cimA 35373 33733 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056694.1 protein_id gnl|my_center|LOCUS_38480 35436 35768 gene locus_tag LOCUS_38490 35436 35768 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141520.1 protein_id gnl|my_center|LOCUS_38490 35915 36460 gene locus_tag LOCUS_38500 35915 36460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056601.1 protein_id gnl|my_center|LOCUS_38500 37428 36457 gene locus_tag LOCUS_38510 gene sds 37428 36457 CDS product solanesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057594.1 protein_id gnl|my_center|LOCUS_38510 37772 38431 gene locus_tag LOCUS_38520 37772 38431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 39048 38428 gene locus_tag LOCUS_38530 39048 38428 CDS product CPP1-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058181.1 protein_id gnl|my_center|LOCUS_38530 40196 39135 gene locus_tag LOCUS_38540 40196 39135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 44219 40629 gene locus_tag LOCUS_38550 44219 40629 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766276.1 protein_id gnl|my_center|LOCUS_38550 44572 45150 gene locus_tag LOCUS_38560 44572 45150 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_38560 45648 46226 gene locus_tag LOCUS_38570 45648 46226 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_38570 >Feature sequence44 143 328 gene locus_tag LOCUS_38580 143 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141741.1 protein_id gnl|my_center|LOCUS_38580 1610 318 gene locus_tag LOCUS_38590 1610 318 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057246.1 protein_id gnl|my_center|LOCUS_38590 1856 2677 gene locus_tag LOCUS_38600 1856 2677 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928485.1 protein_id gnl|my_center|LOCUS_38600 2870 4117 gene locus_tag LOCUS_38610 gene ftsZ 2870 4117 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023065873.1 protein_id gnl|my_center|LOCUS_38610 4124 4924 gene locus_tag LOCUS_38620 gene thiD 4124 4924 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141510.1 protein_id gnl|my_center|LOCUS_38620 5198 6412 gene locus_tag LOCUS_38630 5198 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 6405 7541 gene locus_tag LOCUS_38640 6405 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 7544 9175 gene locus_tag LOCUS_38650 7544 9175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 9180 10262 gene locus_tag LOCUS_38660 9180 10262 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030141.1 protein_id gnl|my_center|LOCUS_38660 10262 12865 gene locus_tag LOCUS_38670 10262 12865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 14729 13218 gene locus_tag LOCUS_38680 14729 13218 CDS product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963438.1 protein_id gnl|my_center|LOCUS_38680 14932 15687 gene locus_tag LOCUS_38690 14932 15687 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246180.1 protein_id gnl|my_center|LOCUS_38690 15960 16355 gene locus_tag LOCUS_38700 15960 16355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 16409 17920 gene locus_tag LOCUS_38710 16409 17920 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921199.1 protein_id gnl|my_center|LOCUS_38710 18055 18408 gene locus_tag LOCUS_38720 18055 18408 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024124912.1 protein_id gnl|my_center|LOCUS_38720 20075 18468 gene locus_tag LOCUS_38730 gene lysS 20075 18468 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583287.1 protein_id gnl|my_center|LOCUS_38730 20296 20952 gene locus_tag LOCUS_38740 20296 20952 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056621.1 protein_id gnl|my_center|LOCUS_38740 21947 21291 gene locus_tag LOCUS_38750 21947 21291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 22622 23026 gene locus_tag LOCUS_38760 22622 23026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 23435 25639 gene locus_tag LOCUS_38770 23435 25639 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022220.1 protein_id gnl|my_center|LOCUS_38770 26216 25743 gene locus_tag LOCUS_38780 26216 25743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 27022 26615 gene locus_tag LOCUS_38790 27022 26615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 28336 27161 gene locus_tag LOCUS_38800 28336 27161 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142934.1 protein_id gnl|my_center|LOCUS_38800 28856 28344 gene locus_tag LOCUS_38810 28856 28344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 29273 28863 gene locus_tag LOCUS_38820 29273 28863 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143403.1 protein_id gnl|my_center|LOCUS_38820 29553 31262 gene locus_tag LOCUS_38830 gene menD 29553 31262 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055985.1 protein_id gnl|my_center|LOCUS_38830 31432 32661 gene locus_tag LOCUS_38840 31432 32661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 33078 32668 gene locus_tag LOCUS_38850 33078 32668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 33509 33252 gene locus_tag LOCUS_38860 33509 33252 CDS product chlororespiratory reduction protein 7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920866.1 protein_id gnl|my_center|LOCUS_38860 33541 35016 gene locus_tag LOCUS_38870 33541 35016 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345479.1 protein_id gnl|my_center|LOCUS_38870 35675 35400 gene locus_tag LOCUS_38880 35675 35400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 35844 35560 gene locus_tag LOCUS_38890 35844 35560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 36398 36673 gene locus_tag LOCUS_38900 36398 36673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327108.1 protein_id gnl|my_center|LOCUS_38900 36673 37038 gene locus_tag LOCUS_38910 36673 37038 CDS product clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327109.1 protein_id gnl|my_center|LOCUS_38910 37123 37350 gene locus_tag LOCUS_38920 37123 37350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 38235 37861 gene locus_tag LOCUS_38930 38235 37861 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142285.1 protein_id gnl|my_center|LOCUS_38930 38458 38228 gene locus_tag LOCUS_38940 38458 38228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 39835 38639 gene locus_tag LOCUS_38950 39835 38639 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_38950 40280 40573 gene locus_tag LOCUS_38960 40280 40573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 40721 42622 gene locus_tag LOCUS_38970 gene glmS 40721 42622 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921151.1 protein_id gnl|my_center|LOCUS_38970 42787 43104 gene locus_tag LOCUS_38980 42787 43104 CDS product DUF3067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056802.1 protein_id gnl|my_center|LOCUS_38980 43923 43291 gene locus_tag LOCUS_38990 43923 43291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 45066 44392 gene locus_tag LOCUS_39000 45066 44392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 44948 45178 gene locus_tag LOCUS_39010 44948 45178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 >Feature sequence45 276 1712 gene locus_tag LOCUS_39020 276 1712 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125901.1 protein_id gnl|my_center|LOCUS_39020 4502 1782 gene locus_tag LOCUS_39030 4502 1782 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057343.1 protein_id gnl|my_center|LOCUS_39030 4884 5471 gene locus_tag LOCUS_39040 4884 5471 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_39040 5518 6099 gene locus_tag LOCUS_39050 5518 6099 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_39050 7056 6418 gene locus_tag LOCUS_39060 gene purN 7056 6418 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524113.1 protein_id gnl|my_center|LOCUS_39060 7337 7053 gene locus_tag LOCUS_39070 7337 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 8947 7454 gene locus_tag LOCUS_39080 gene pap 8947 7454 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_39080 9153 10151 gene locus_tag LOCUS_39090 gene galE 9153 10151 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920997.1 protein_id gnl|my_center|LOCUS_39090 10383 10808 gene locus_tag LOCUS_39100 10383 10808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 11802 10921 gene locus_tag LOCUS_39110 11802 10921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 12175 13515 gene locus_tag LOCUS_39120 12175 13515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 13515 14474 gene locus_tag LOCUS_39130 13515 14474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 14471 15733 gene locus_tag LOCUS_39140 14471 15733 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920820.1 protein_id gnl|my_center|LOCUS_39140 15810 16055 gene locus_tag LOCUS_39150 15810 16055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 16055 16399 gene locus_tag LOCUS_39160 16055 16399 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928563.1 protein_id gnl|my_center|LOCUS_39160 17626 16439 gene locus_tag LOCUS_39170 17626 16439 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056077.1 protein_id gnl|my_center|LOCUS_39170 17809 17630 gene locus_tag LOCUS_39180 17809 17630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 18366 17968 gene locus_tag LOCUS_39190 18366 17968 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142893.1 protein_id gnl|my_center|LOCUS_39190 18565 18353 gene locus_tag LOCUS_39200 18565 18353 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142894.1 protein_id gnl|my_center|LOCUS_39200 20747 19212 gene locus_tag LOCUS_39210 gene purH 20747 19212 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057387.1 protein_id gnl|my_center|LOCUS_39210 21104 21679 gene locus_tag LOCUS_39220 21104 21679 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_39220 21672 21857 gene locus_tag LOCUS_39230 21672 21857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 22231 22965 gene locus_tag LOCUS_39240 22231 22965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 23822 22986 gene locus_tag LOCUS_39250 23822 22986 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921210.1 protein_id gnl|my_center|LOCUS_39250 23950 23865 gene locus_tag LOCUS_t00320 23950 23865 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 24129 25448 gene locus_tag LOCUS_39260 gene murA 24129 25448 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056623.1 protein_id gnl|my_center|LOCUS_39260 26177 25575 gene locus_tag LOCUS_39270 26177 25575 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_39270 27016 26606 gene locus_tag LOCUS_39280 27016 26606 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_39280 27318 27013 gene locus_tag LOCUS_39290 27318 27013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 28421 27462 gene locus_tag LOCUS_39300 28421 27462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_39300 29509 28538 gene locus_tag LOCUS_39310 29509 28538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_39310 29871 30512 gene locus_tag LOCUS_39320 29871 30512 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007353051.1 protein_id gnl|my_center|LOCUS_39320 30669 31517 gene locus_tag LOCUS_39330 30669 31517 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143051.1 protein_id gnl|my_center|LOCUS_39330 31527 31937 gene locus_tag LOCUS_39340 31527 31937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 33378 32014 gene locus_tag LOCUS_39350 33378 32014 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088430287.1 protein_id gnl|my_center|LOCUS_39350 34113 33775 gene locus_tag LOCUS_39360 34113 33775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 35310 34189 gene locus_tag LOCUS_39370 35310 34189 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379429.1 protein_id gnl|my_center|LOCUS_39370 35659 35405 gene locus_tag LOCUS_39380 35659 35405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 35929 36849 gene locus_tag LOCUS_39390 35929 36849 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_39390 38775 36898 gene locus_tag LOCUS_39400 gene ftsH 38775 36898 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 protein_id gnl|my_center|LOCUS_39400 40037 38853 gene locus_tag LOCUS_39410 40037 38853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 >Feature sequence46 1885 239 gene locus_tag LOCUS_39420 1885 239 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140397.1 protein_id gnl|my_center|LOCUS_39420 2031 2354 gene locus_tag LOCUS_39430 2031 2354 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057408.1 protein_id gnl|my_center|LOCUS_39430 3491 2355 gene locus_tag LOCUS_39440 3491 2355 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_39440 3664 4107 gene locus_tag LOCUS_39450 3664 4107 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_39450 4076 4900 gene locus_tag LOCUS_39460 4076 4900 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 protein_id gnl|my_center|LOCUS_39460 5282 5833 gene locus_tag LOCUS_39470 5282 5833 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056641.1 protein_id gnl|my_center|LOCUS_39470 7120 5945 gene locus_tag LOCUS_39480 7120 5945 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057862.1 protein_id gnl|my_center|LOCUS_39480 7158 8345 gene locus_tag LOCUS_39490 7158 8345 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218596652.1 protein_id gnl|my_center|LOCUS_39490 8608 9660 gene locus_tag LOCUS_39500 8608 9660 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057667.1 protein_id gnl|my_center|LOCUS_39500 10053 9664 gene locus_tag LOCUS_39510 10053 9664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056454.1 protein_id gnl|my_center|LOCUS_39510 10215 11312 gene locus_tag LOCUS_39520 gene queA 10215 11312 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056766.1 protein_id gnl|my_center|LOCUS_39520 11475 13163 gene locus_tag LOCUS_39530 11475 13163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 13404 14510 gene locus_tag LOCUS_39540 gene gcvT 13404 14510 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143519.1 protein_id gnl|my_center|LOCUS_39540 14742 14479 gene locus_tag LOCUS_39550 14742 14479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 16107 18125 gene locus_tag LOCUS_39560 16107 18125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 18195 19388 gene locus_tag LOCUS_39570 18195 19388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 19501 20478 gene locus_tag LOCUS_39580 19501 20478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 20500 23949 gene locus_tag LOCUS_39590 20500 23949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 24016 25569 gene locus_tag LOCUS_39600 24016 25569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 25711 27522 gene locus_tag LOCUS_39610 25711 27522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 27650 28411 gene locus_tag LOCUS_39620 27650 28411 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227680.1 protein_id gnl|my_center|LOCUS_39620 28496 29860 gene locus_tag LOCUS_39630 28496 29860 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055092.1 protein_id gnl|my_center|LOCUS_39630 29908 31671 gene locus_tag LOCUS_39640 29908 31671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 31805 32176 gene locus_tag LOCUS_39650 31805 32176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 32314 33291 gene locus_tag LOCUS_39660 32314 33291 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928642.1 protein_id gnl|my_center|LOCUS_39660 33370 34692 gene locus_tag LOCUS_39670 33370 34692 CDS product ABC exporter membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141428.1 protein_id gnl|my_center|LOCUS_39670 34689 35885 gene locus_tag LOCUS_39680 gene devC 34689 35885 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140489.1 protein_id gnl|my_center|LOCUS_39680 35934 36608 gene locus_tag LOCUS_39690 35934 36608 CDS product DevA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_39690 36966 38696 gene locus_tag LOCUS_39700 36966 38696 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057893.1 protein_id gnl|my_center|LOCUS_39700 39104 39526 gene locus_tag LOCUS_39710 39104 39526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 >Feature sequence47 616 74 gene locus_tag LOCUS_39720 616 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 889 653 gene locus_tag LOCUS_39730 889 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 2068 1085 gene locus_tag LOCUS_39740 2068 1085 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142039.1 protein_id gnl|my_center|LOCUS_39740 4168 2741 gene locus_tag LOCUS_39750 4168 2741 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057691.1 protein_id gnl|my_center|LOCUS_39750 4380 5615 gene locus_tag LOCUS_39760 4380 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 6570 5626 gene locus_tag LOCUS_39770 6570 5626 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119887.1 protein_id gnl|my_center|LOCUS_39770 6926 6573 gene locus_tag LOCUS_39780 6926 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941231.1 protein_id gnl|my_center|LOCUS_39780 7767 7045 gene locus_tag LOCUS_39790 7767 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 8240 8770 gene locus_tag LOCUS_39800 8240 8770 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144198.1 protein_id gnl|my_center|LOCUS_39800 10919 8760 gene locus_tag LOCUS_39810 10919 8760 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057539.1 protein_id gnl|my_center|LOCUS_39810 12788 10974 gene locus_tag LOCUS_39820 gene sppA 12788 10974 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_39820 13665 15035 gene locus_tag LOCUS_39830 13665 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 15251 16138 gene locus_tag LOCUS_39840 gene yhdJ 15251 16138 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258898.1 protein_id gnl|my_center|LOCUS_39840 16119 17198 gene locus_tag LOCUS_39850 16119 17198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 17297 18931 gene locus_tag LOCUS_39860 17297 18931 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058039.1 protein_id gnl|my_center|LOCUS_39860 19234 19944 gene locus_tag LOCUS_39870 19234 19944 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799326.1 protein_id gnl|my_center|LOCUS_39870 20141 21172 gene locus_tag LOCUS_39880 20141 21172 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144236.1 protein_id gnl|my_center|LOCUS_39880 21550 22668 gene locus_tag LOCUS_39890 21550 22668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 22687 25836 gene locus_tag LOCUS_39900 22687 25836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 25934 28264 gene locus_tag LOCUS_39910 25934 28264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 28271 28912 gene locus_tag LOCUS_39920 28271 28912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 28991 29224 gene locus_tag LOCUS_39930 28991 29224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 29979 29401 gene locus_tag LOCUS_39940 29979 29401 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_39940 30575 29985 gene locus_tag LOCUS_39950 30575 29985 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_39950 30868 32787 gene locus_tag LOCUS_39960 30868 32787 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057141.1 protein_id gnl|my_center|LOCUS_39960 32849 33298 gene locus_tag LOCUS_39970 32849 33298 CDS product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141484.1 protein_id gnl|my_center|LOCUS_39970 33545 34909 gene locus_tag LOCUS_39980 33545 34909 CDS product DUF3370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921041.1 protein_id gnl|my_center|LOCUS_39980 34994 35935 gene locus_tag LOCUS_39990 34994 35935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 37313 36342 gene locus_tag LOCUS_40000 37313 36342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 >Feature sequence48 353 883 gene locus_tag LOCUS_40010 gene rimI 353 883 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056322.1 protein_id gnl|my_center|LOCUS_40010 922 2112 gene locus_tag LOCUS_40020 922 2112 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142859.1 protein_id gnl|my_center|LOCUS_40020 2227 2820 gene locus_tag LOCUS_40030 2227 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 2918 3424 gene locus_tag LOCUS_40040 2918 3424 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141597.1 protein_id gnl|my_center|LOCUS_40040 4289 3765 gene locus_tag LOCUS_40050 4289 3765 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356874.1 protein_id gnl|my_center|LOCUS_40050 4778 4329 gene locus_tag LOCUS_40060 4778 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 7024 5054 gene locus_tag LOCUS_40070 gene acs 7024 5054 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056731.1 protein_id gnl|my_center|LOCUS_40070 7276 7521 gene locus_tag LOCUS_40080 gene psaC 7276 7521 CDS product photosystem I iron-sulfur center protein PsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125916.1 protein_id gnl|my_center|LOCUS_40080 8541 7831 gene locus_tag LOCUS_40090 8541 7831 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928653.1 protein_id gnl|my_center|LOCUS_40090 8750 9478 gene locus_tag LOCUS_40100 8750 9478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 10284 9481 gene locus_tag LOCUS_40110 10284 9481 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194094.1 protein_id gnl|my_center|LOCUS_40110 10446 10523 gene locus_tag LOCUS_t00330 10446 10523 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 12354 10627 gene locus_tag LOCUS_40120 12354 10627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 13815 12619 gene locus_tag LOCUS_40130 gene tnpB 13815 12619 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_40130 14156 15265 gene locus_tag LOCUS_40140 gene thrC 14156 15265 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406172.1 protein_id gnl|my_center|LOCUS_40140 15925 15296 gene locus_tag LOCUS_40150 gene hisB 15925 15296 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055988.1 protein_id gnl|my_center|LOCUS_40150 17814 16300 gene locus_tag LOCUS_40160 17814 16300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 18664 17981 gene locus_tag LOCUS_40170 18664 17981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 19166 19378 gene locus_tag LOCUS_40180 19166 19378 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058042.1 protein_id gnl|my_center|LOCUS_40180 20282 19437 gene locus_tag LOCUS_40190 gene dapF 20282 19437 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058127.1 protein_id gnl|my_center|LOCUS_40190 20281 20556 gene locus_tag LOCUS_40200 20281 20556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 20916 22088 gene locus_tag LOCUS_40210 20916 22088 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250683.1 protein_id gnl|my_center|LOCUS_40210 22389 23228 gene locus_tag LOCUS_40220 22389 23228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 24701 25597 gene locus_tag LOCUS_40230 24701 25597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 26014 27132 gene locus_tag LOCUS_40240 26014 27132 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877834.1 protein_id gnl|my_center|LOCUS_40240 27172 28107 gene locus_tag LOCUS_40250 27172 28107 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118888.1 protein_id gnl|my_center|LOCUS_40250 28197 28820 gene locus_tag LOCUS_40260 28197 28820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 28798 28804 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28904 29356 gene locus_tag LOCUS_40270 28904 29356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 31182 29629 gene locus_tag LOCUS_40280 31182 29629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 31598 31299 gene locus_tag LOCUS_40290 31598 31299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 34141 31676 gene locus_tag LOCUS_40300 34141 31676 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 protein_id gnl|my_center|LOCUS_40300 34436 34242 gene locus_tag LOCUS_40310 34436 34242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 34628 35554 gene locus_tag LOCUS_40320 34628 35554 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220354845.1 protein_id gnl|my_center|LOCUS_40320 36097 36648 gene locus_tag LOCUS_40330 36097 36648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 >Feature sequence49 102 434 gene locus_tag LOCUS_40340 102 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 441 1271 gene locus_tag LOCUS_40350 441 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 1344 1520 gene locus_tag LOCUS_40360 1344 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 1834 3030 gene locus_tag LOCUS_40370 1834 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 3030 3743 gene locus_tag LOCUS_40380 3030 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 4077 4973 gene locus_tag LOCUS_40390 4077 4973 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 protein_id gnl|my_center|LOCUS_40390 5055 6764 gene locus_tag LOCUS_40400 gene ureC 5055 6764 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055860.1 protein_id gnl|my_center|LOCUS_40400 7156 6821 gene locus_tag LOCUS_40410 7156 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 7778 7536 gene locus_tag LOCUS_40420 7778 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 8156 8001 gene locus_tag LOCUS_40430 8156 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 8551 8153 gene locus_tag LOCUS_40440 8551 8153 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053649.1 protein_id gnl|my_center|LOCUS_40440 8825 8535 gene locus_tag LOCUS_40450 8825 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 9311 9027 gene locus_tag LOCUS_40460 9311 9027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 10312 9422 gene locus_tag LOCUS_40470 10312 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 11027 10638 gene locus_tag LOCUS_40480 11027 10638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 11580 11242 gene locus_tag LOCUS_40490 11580 11242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 12896 11742 gene locus_tag LOCUS_40500 12896 11742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 13179 13427 gene locus_tag LOCUS_40510 13179 13427 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_40510 13418 13786 gene locus_tag LOCUS_40520 13418 13786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 14254 13925 gene locus_tag LOCUS_40530 14254 13925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 14607 14251 gene locus_tag LOCUS_40540 14607 14251 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097692.1 protein_id gnl|my_center|LOCUS_40540 14813 15136 gene locus_tag LOCUS_40550 14813 15136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 15133 15546 gene locus_tag LOCUS_40560 15133 15546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 16875 15562 gene locus_tag LOCUS_40570 16875 15562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 16964 18121 gene locus_tag LOCUS_40580 16964 18121 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 protein_id gnl|my_center|LOCUS_40580 18472 18399 gene locus_tag LOCUS_t00340 18472 18399 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18516 19016 gene locus_tag LOCUS_40590 gene moaC 18516 19016 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087579.1 protein_id gnl|my_center|LOCUS_40590 22973 19308 gene locus_tag LOCUS_40600 22973 19308 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388379.1 protein_id gnl|my_center|LOCUS_40600 25211 23481 gene locus_tag LOCUS_40610 25211 23481 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141774.1 protein_id gnl|my_center|LOCUS_40610 25577 25867 gene locus_tag LOCUS_40620 25577 25867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 28372 26108 gene locus_tag LOCUS_40630 gene hypF 28372 26108 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880400.1 protein_id gnl|my_center|LOCUS_40630 29096 28422 gene locus_tag LOCUS_40640 29096 28422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141964.1 protein_id gnl|my_center|LOCUS_40640 29643 29149 gene locus_tag LOCUS_40650 29643 29149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 30166 30972 gene locus_tag LOCUS_40660 gene hisN 30166 30972 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_40660 31728 31021 gene locus_tag LOCUS_40670 gene rpe 31728 31021 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058202.1 protein_id gnl|my_center|LOCUS_40670 32024 32230 gene locus_tag LOCUS_40680 32024 32230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 >Feature sequence50 310 795 gene locus_tag LOCUS_40690 310 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 1289 1002 gene locus_tag LOCUS_40700 1289 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 1501 1292 gene locus_tag LOCUS_40710 1501 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 2099 1530 gene locus_tag LOCUS_40720 2099 1530 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_40720 3292 2210 gene locus_tag LOCUS_40730 gene psbA 3292 2210 CDS product photosystem II q(b) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057317.1 protein_id gnl|my_center|LOCUS_40730 3679 5928 gene locus_tag LOCUS_40740 3679 5928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 6318 6653 gene locus_tag LOCUS_40750 6318 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 6650 6835 gene locus_tag LOCUS_40760 6650 6835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 7968 6832 gene locus_tag LOCUS_40770 gene cofH 7968 6832 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057436.1 protein_id gnl|my_center|LOCUS_40770 8807 8106 gene locus_tag LOCUS_40780 gene psb29 8807 8106 CDS product photosystem II biogenesis protein Psp29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056976.1 protein_id gnl|my_center|LOCUS_40780 9161 9625 gene locus_tag LOCUS_40790 gene smpB 9161 9625 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057764.1 protein_id gnl|my_center|LOCUS_40790 9744 10292 gene locus_tag LOCUS_40800 9744 10292 CDS product DUF2808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056648.1 protein_id gnl|my_center|LOCUS_40800 10872 10555 gene locus_tag LOCUS_40810 10872 10555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 13589 11337 gene locus_tag LOCUS_40820 13589 11337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 15158 16192 gene locus_tag LOCUS_40830 gene pdhA 15158 16192 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057011.1 protein_id gnl|my_center|LOCUS_40830 16380 17162 gene locus_tag LOCUS_40840 16380 17162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 17390 17983 gene locus_tag LOCUS_40850 17390 17983 CDS product IS607-like element IS1602 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414146.1 protein_id gnl|my_center|LOCUS_40850 17955 18380 gene locus_tag LOCUS_40860 17955 18380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40860 18432 19193 gene locus_tag LOCUS_40870 18432 19193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40870 19745 19404 gene locus_tag LOCUS_40880 19745 19404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056249.1 protein_id gnl|my_center|LOCUS_40880 19780 20361 gene locus_tag LOCUS_40890 gene aat 19780 20361 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920768.1 protein_id gnl|my_center|LOCUS_40890 22118 22393 gene locus_tag LOCUS_40900 22118 22393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40900 22605 23711 gene locus_tag LOCUS_40910 22605 23711 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_40910 23759 25132 gene locus_tag LOCUS_40920 23759 25132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 26045 25323 gene locus_tag LOCUS_40930 26045 25323 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_40930 27778 26090 gene locus_tag LOCUS_40940 27778 26090 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088894694.1 protein_id gnl|my_center|LOCUS_40940 28174 27869 gene locus_tag LOCUS_40950 28174 27869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144163.1 protein_id gnl|my_center|LOCUS_40950 28447 29670 gene locus_tag LOCUS_40960 28447 29670 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888753.1 protein_id gnl|my_center|LOCUS_40960 30203 29997 gene locus_tag LOCUS_40970 gene yoeB 30203 29997 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_40970 30484 30254 gene locus_tag LOCUS_40980 30484 30254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 >Feature sequence51 816 481 gene locus_tag LOCUS_40990 816 481 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_40990 1106 813 gene locus_tag LOCUS_41000 1106 813 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143513.1 protein_id gnl|my_center|LOCUS_41000 1354 1279 gene locus_tag LOCUS_t00350 1354 1279 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1455 2330 gene locus_tag LOCUS_41010 gene lipA 1455 2330 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921111.1 protein_id gnl|my_center|LOCUS_41010 2886 2293 gene locus_tag LOCUS_41020 gene rdgB 2886 2293 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057634.1 protein_id gnl|my_center|LOCUS_41020 3043 3267 gene locus_tag LOCUS_41030 3043 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 3361 3804 gene locus_tag LOCUS_41040 3361 3804 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 protein_id gnl|my_center|LOCUS_41040 4886 3807 gene locus_tag LOCUS_41050 4886 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 6928 5366 gene locus_tag LOCUS_41060 6928 5366 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 protein_id gnl|my_center|LOCUS_41060 7205 7348 gene locus_tag LOCUS_41070 7205 7348 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124265.1 protein_id gnl|my_center|LOCUS_41070 7653 8948 gene locus_tag LOCUS_41080 7653 8948 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682315.1 protein_id gnl|my_center|LOCUS_41080 9093 11825 gene locus_tag LOCUS_41090 9093 11825 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939279.1 protein_id gnl|my_center|LOCUS_41090 12888 11869 gene locus_tag LOCUS_41100 gene pyrC 12888 11869 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_41100 13412 14464 gene locus_tag LOCUS_41110 13412 14464 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056261.1 protein_id gnl|my_center|LOCUS_41110 15105 15428 gene locus_tag LOCUS_41120 15105 15428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 15662 16279 gene locus_tag LOCUS_41130 15662 16279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 16480 18153 gene locus_tag LOCUS_41140 16480 18153 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120704930.1 protein_id gnl|my_center|LOCUS_41140 18344 19174 gene locus_tag LOCUS_41150 18344 19174 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_41150 19806 19252 gene locus_tag LOCUS_41160 19806 19252 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_41160 20420 20214 gene locus_tag LOCUS_41170 20420 20214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 20900 20439 gene locus_tag LOCUS_41180 20900 20439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 22102 20912 gene locus_tag LOCUS_41190 22102 20912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 22750 22130 gene locus_tag LOCUS_41200 22750 22130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 23407 23589 gene locus_tag LOCUS_41210 23407 23589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 23586 24644 gene locus_tag LOCUS_41220 23586 24644 CDS product DUF3326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056519.1 protein_id gnl|my_center|LOCUS_41220 24641 25222 gene locus_tag LOCUS_41230 24641 25222 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056337.1 protein_id gnl|my_center|LOCUS_41230 25289 25732 gene locus_tag LOCUS_41240 25289 25732 CDS product DUF3531 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056063.1 protein_id gnl|my_center|LOCUS_41240 25907 28261 gene locus_tag LOCUS_41250 25907 28261 CDS product GH116 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797719.1 protein_id gnl|my_center|LOCUS_41250 28698 30290 gene locus_tag LOCUS_41260 28698 30290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 30391 30855 gene locus_tag LOCUS_41270 30391 30855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 >Feature sequence52 704 916 gene locus_tag LOCUS_41280 704 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 1081 2079 gene locus_tag LOCUS_41290 1081 2079 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_41290 2869 2504 gene locus_tag LOCUS_41300 2869 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 3068 2862 gene locus_tag LOCUS_41310 3068 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 3688 3386 gene locus_tag LOCUS_41320 3688 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 4307 4035 gene locus_tag LOCUS_41330 4307 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_41330 4531 4304 gene locus_tag LOCUS_41340 4531 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 5375 4980 gene locus_tag LOCUS_41350 5375 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 5746 5372 gene locus_tag LOCUS_41360 5746 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 7807 7343 gene locus_tag LOCUS_41370 7807 7343 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141481.1 protein_id gnl|my_center|LOCUS_41370 8282 7824 gene locus_tag LOCUS_41380 8282 7824 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391317.1 protein_id gnl|my_center|LOCUS_41380 8757 8299 gene locus_tag LOCUS_41390 8757 8299 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_41390 9784 8801 gene locus_tag LOCUS_41400 gene msrP 9784 8801 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_41400 11255 9870 gene locus_tag LOCUS_41410 11255 9870 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_41410 11653 12408 gene locus_tag LOCUS_41420 11653 12408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 12800 14347 gene locus_tag LOCUS_41430 12800 14347 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140567.1 protein_id gnl|my_center|LOCUS_41430 14353 14499 gene locus_tag LOCUS_41440 14353 14499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 14718 15611 gene locus_tag LOCUS_41450 14718 15611 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224783972.1 protein_id gnl|my_center|LOCUS_41450 16131 15832 gene locus_tag LOCUS_41460 16131 15832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 16346 16128 gene locus_tag LOCUS_41470 16346 16128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 16638 16339 gene locus_tag LOCUS_41480 16638 16339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 18289 19623 gene locus_tag LOCUS_41490 18289 19623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 19898 21730 gene locus_tag LOCUS_41500 19898 21730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 21727 27879 gene locus_tag LOCUS_41510 21727 27879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 29443 29868 gene locus_tag LOCUS_41520 29443 29868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 >Feature sequence53 1101 463 gene locus_tag LOCUS_41530 gene sufR 1101 463 CDS product iron-sulfur cluster biosynthesis transcriptional regulator SufR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056342.1 protein_id gnl|my_center|LOCUS_41530 1325 2767 gene locus_tag LOCUS_41540 gene sufB 1325 2767 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_41540 2965 3735 gene locus_tag LOCUS_41550 gene sufC 2965 3735 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_41550 3936 5261 gene locus_tag LOCUS_41560 gene sufD 3936 5261 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057742.1 protein_id gnl|my_center|LOCUS_41560 5317 6579 gene locus_tag LOCUS_41570 5317 6579 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057903.1 protein_id gnl|my_center|LOCUS_41570 6614 8119 gene locus_tag LOCUS_41580 6614 8119 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188230548.1 protein_id gnl|my_center|LOCUS_41580 8381 8187 gene locus_tag LOCUS_41590 8381 8187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 9351 8611 gene locus_tag LOCUS_41600 9351 8611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 9992 10297 gene locus_tag LOCUS_41610 9992 10297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 11808 10483 gene locus_tag LOCUS_41620 11808 10483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 12065 13864 gene locus_tag LOCUS_41630 12065 13864 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184602.1 protein_id gnl|my_center|LOCUS_41630 13842 14204 gene locus_tag LOCUS_41640 13842 14204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 15220 14597 gene locus_tag LOCUS_41650 15220 14597 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057844.1 protein_id gnl|my_center|LOCUS_41650 17235 15559 gene locus_tag LOCUS_41660 gene ctaD 17235 15559 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057845.1 protein_id gnl|my_center|LOCUS_41660 18230 17265 gene locus_tag LOCUS_41670 18230 17265 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057846.1 protein_id gnl|my_center|LOCUS_41670 18545 19465 gene locus_tag LOCUS_41680 18545 19465 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057731.1 protein_id gnl|my_center|LOCUS_41680 19479 20429 gene locus_tag LOCUS_41690 19479 20429 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920945.1 protein_id gnl|my_center|LOCUS_41690 22259 20925 gene locus_tag LOCUS_41700 gene dnaA 22259 20925 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056451.1 protein_id gnl|my_center|LOCUS_41700 22430 23008 gene locus_tag LOCUS_41710 gene def 22430 23008 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206042.1 protein_id gnl|my_center|LOCUS_41710 23437 24093 gene locus_tag LOCUS_41720 gene folE 23437 24093 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015079151.1 protein_id gnl|my_center|LOCUS_41720 24329 25309 gene locus_tag LOCUS_41730 gene hemB 24329 25309 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_41730 25914 25306 gene locus_tag LOCUS_41740 25914 25306 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928520.1 protein_id gnl|my_center|LOCUS_41740 25992 28070 gene locus_tag LOCUS_41750 25992 28070 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920751.1 protein_id gnl|my_center|LOCUS_41750 >Feature sequence54 894 544 gene locus_tag LOCUS_41760 894 544 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_41760 1174 884 gene locus_tag LOCUS_41770 1174 884 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141164.1 protein_id gnl|my_center|LOCUS_41770 1983 1492 gene locus_tag LOCUS_41780 1983 1492 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120796836.1 protein_id gnl|my_center|LOCUS_41780 4251 2038 gene locus_tag LOCUS_41790 gene psaB 4251 2038 CDS product photosystem I core protein PsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056579.1 protein_id gnl|my_center|LOCUS_41790 6679 4430 gene locus_tag LOCUS_41800 gene psaA 6679 4430 CDS product photosystem I core protein PsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920748.1 protein_id gnl|my_center|LOCUS_41800 7186 8469 gene locus_tag LOCUS_41810 7186 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 8482 8649 gene locus_tag LOCUS_41820 8482 8649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 8957 9523 gene locus_tag LOCUS_41830 8957 9523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 10185 9646 gene locus_tag LOCUS_41840 10185 9646 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057562.1 protein_id gnl|my_center|LOCUS_41840 10830 10525 gene locus_tag LOCUS_41850 10830 10525 CDS product DUF2973 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057538.1 protein_id gnl|my_center|LOCUS_41850 11337 10930 gene locus_tag LOCUS_41860 11337 10930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 11979 11353 gene locus_tag LOCUS_41870 gene tenA 11979 11353 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066884.1 protein_id gnl|my_center|LOCUS_41870 12463 13362 gene locus_tag LOCUS_41880 12463 13362 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588823.1 protein_id gnl|my_center|LOCUS_41880 13818 13474 gene locus_tag LOCUS_41890 13818 13474 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_41890 14108 13815 gene locus_tag LOCUS_41900 14108 13815 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022117.1 protein_id gnl|my_center|LOCUS_41900 14546 14274 gene locus_tag LOCUS_41910 14546 14274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 14709 14500 gene locus_tag LOCUS_41920 14709 14500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 14960 14706 gene locus_tag LOCUS_41930 14960 14706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 15417 15172 gene locus_tag LOCUS_41940 15417 15172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 15661 15431 gene locus_tag LOCUS_41950 15661 15431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 17605 15947 gene locus_tag LOCUS_41960 17605 15947 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_41960 18588 17836 gene locus_tag LOCUS_41970 18588 17836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 19312 18860 gene locus_tag LOCUS_41980 19312 18860 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258781.1 protein_id gnl|my_center|LOCUS_41980 19548 19312 gene locus_tag LOCUS_41990 19548 19312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 19838 20050 gene locus_tag LOCUS_42000 19838 20050 CDS product DUF3148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921047.1 protein_id gnl|my_center|LOCUS_42000 21782 20181 gene locus_tag LOCUS_42010 21782 20181 CDS product peptide ligase PGM1-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 protein_id gnl|my_center|LOCUS_42010 22617 22123 gene locus_tag LOCUS_42020 22617 22123 CDS product photosystem I reaction center subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058243.1 protein_id gnl|my_center|LOCUS_42020 23169 22750 gene locus_tag LOCUS_42030 23169 22750 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174926.1 protein_id gnl|my_center|LOCUS_42030 23980 23180 gene locus_tag LOCUS_42040 gene cobA 23980 23180 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055999.1 protein_id gnl|my_center|LOCUS_42040 24541 24251 gene locus_tag LOCUS_42050 24541 24251 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_42050 24841 24551 gene locus_tag LOCUS_42060 24841 24551 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_42060 25115 24981 gene locus_tag LOCUS_42070 25115 24981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42070 26278 25415 gene locus_tag LOCUS_42080 26278 25415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 26491 26979 gene locus_tag LOCUS_42090 26491 26979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 >Feature sequence55 180 479 gene locus_tag LOCUS_42100 180 479 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_42100 463 882 gene locus_tag LOCUS_42110 463 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 1044 1937 gene locus_tag LOCUS_42120 1044 1937 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057737.1 protein_id gnl|my_center|LOCUS_42120 2057 2374 gene locus_tag LOCUS_42130 2057 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 2929 2375 gene locus_tag LOCUS_42140 2929 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 3868 3068 gene locus_tag LOCUS_42150 gene xth 3868 3068 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920930.1 protein_id gnl|my_center|LOCUS_42150 4475 3891 gene locus_tag LOCUS_42160 4475 3891 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057990.1 protein_id gnl|my_center|LOCUS_42160 5033 4575 gene locus_tag LOCUS_42170 gene rplI 5033 4575 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058245.1 protein_id gnl|my_center|LOCUS_42170 5548 5835 gene locus_tag LOCUS_42180 5548 5835 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929315.1 protein_id gnl|my_center|LOCUS_42180 6272 5832 gene locus_tag LOCUS_42190 6272 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920753.1 protein_id gnl|my_center|LOCUS_42190 6744 7004 gene locus_tag LOCUS_42200 gene grxC 6744 7004 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143672.1 protein_id gnl|my_center|LOCUS_42200 7020 8000 gene locus_tag LOCUS_42210 gene gshB 7020 8000 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056752.1 protein_id gnl|my_center|LOCUS_42210 8172 8483 gene locus_tag LOCUS_42220 8172 8483 CDS product DUF2499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057277.1 protein_id gnl|my_center|LOCUS_42220 8476 8781 gene locus_tag LOCUS_42230 8476 8781 CDS product DUF3593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144013.1 protein_id gnl|my_center|LOCUS_42230 9091 10110 gene locus_tag LOCUS_42240 9091 10110 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125825.1 protein_id gnl|my_center|LOCUS_42240 10365 11240 gene locus_tag LOCUS_42250 10365 11240 CDS product Tab2/Atab2 family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057821.1 protein_id gnl|my_center|LOCUS_42250 12754 11285 gene locus_tag LOCUS_42260 12754 11285 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042464373.1 protein_id gnl|my_center|LOCUS_42260 15039 12868 gene locus_tag LOCUS_42270 15039 12868 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_42270 15457 15843 gene locus_tag LOCUS_42280 15457 15843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 16091 16468 gene locus_tag LOCUS_42290 16091 16468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 16872 16573 gene locus_tag LOCUS_42300 16872 16573 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929718.1 protein_id gnl|my_center|LOCUS_42300 17665 16976 gene locus_tag LOCUS_42310 17665 16976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 18579 18791 gene locus_tag LOCUS_42320 18579 18791 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048048124.1 protein_id gnl|my_center|LOCUS_42320 18788 19012 gene locus_tag LOCUS_42330 18788 19012 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755925.1 protein_id gnl|my_center|LOCUS_42330 19090 19362 gene locus_tag LOCUS_42340 19090 19362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 19432 19620 gene locus_tag LOCUS_42350 19432 19620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 19726 19971 gene locus_tag LOCUS_42360 19726 19971 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391712.1 protein_id gnl|my_center|LOCUS_42360 19971 20192 gene locus_tag LOCUS_42370 19971 20192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 21668 20289 gene locus_tag LOCUS_42380 21668 20289 CDS product folate/biopterin family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055871.1 protein_id gnl|my_center|LOCUS_42380 22128 23504 gene locus_tag LOCUS_42390 22128 23504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 23533 24222 gene locus_tag LOCUS_42400 23533 24222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 >Feature sequence56 537 190 gene locus_tag LOCUS_42410 537 190 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140974.1 protein_id gnl|my_center|LOCUS_42410 766 695 gene locus_tag LOCUS_t00360 766 695 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 848 1384 gene locus_tag LOCUS_42420 848 1384 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143393.1 protein_id gnl|my_center|LOCUS_42420 3144 1624 gene locus_tag LOCUS_42430 3144 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 4098 3223 gene locus_tag LOCUS_42440 gene proC 4098 3223 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140706.1 protein_id gnl|my_center|LOCUS_42440 4732 4160 gene locus_tag LOCUS_42450 4732 4160 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928580.1 protein_id gnl|my_center|LOCUS_42450 5712 5053 gene locus_tag LOCUS_42460 5712 5053 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056880.1 protein_id gnl|my_center|LOCUS_42460 5988 5716 gene locus_tag LOCUS_42470 5988 5716 CDS product PipX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057448.1 protein_id gnl|my_center|LOCUS_42470 6496 8037 gene locus_tag LOCUS_42480 6496 8037 CDS product NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055900.1 protein_id gnl|my_center|LOCUS_42480 9545 8868 gene locus_tag LOCUS_42490 9545 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 11876 9843 gene locus_tag LOCUS_42500 11876 9843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 13424 12282 gene locus_tag LOCUS_42510 gene ychF 13424 12282 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057426.1 protein_id gnl|my_center|LOCUS_42510 13653 15311 gene locus_tag LOCUS_42520 13653 15311 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_42520 16022 18055 gene locus_tag LOCUS_42530 16022 18055 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058192.1 protein_id gnl|my_center|LOCUS_42530 19863 18250 gene locus_tag LOCUS_42540 19863 18250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 20460 20281 gene locus_tag LOCUS_42550 20460 20281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 20955 20803 gene locus_tag LOCUS_42560 20955 20803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 21196 21014 gene locus_tag LOCUS_42570 21196 21014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 21769 21431 gene locus_tag LOCUS_42580 21769 21431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 >Feature sequence57 983 207 gene locus_tag LOCUS_42590 983 207 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_42590 2183 1527 gene locus_tag LOCUS_42600 2183 1527 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057529.1 protein_id gnl|my_center|LOCUS_42600 3096 2206 gene locus_tag LOCUS_42610 3096 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 3175 3735 gene locus_tag LOCUS_42620 3175 3735 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056696.1 protein_id gnl|my_center|LOCUS_42620 4112 4387 gene locus_tag LOCUS_42630 4112 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 4669 5658 gene locus_tag LOCUS_42640 4669 5658 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928617.1 protein_id gnl|my_center|LOCUS_42640 6615 5665 gene locus_tag LOCUS_42650 6615 5665 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479942.1 protein_id gnl|my_center|LOCUS_42650 7479 6628 gene locus_tag LOCUS_42660 gene lgt 7479 6628 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057991.1 protein_id gnl|my_center|LOCUS_42660 7552 7636 gene locus_tag LOCUS_t00370 7552 7636 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8381 7737 gene locus_tag LOCUS_42670 8381 7737 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_42670 11274 8656 gene locus_tag LOCUS_42680 gene clpB 11274 8656 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057229.1 protein_id gnl|my_center|LOCUS_42680 12062 12751 gene locus_tag LOCUS_42690 12062 12751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 14932 13031 gene locus_tag LOCUS_42700 14932 13031 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929297.1 protein_id gnl|my_center|LOCUS_42700 15327 15590 gene locus_tag LOCUS_42710 gene hybG 15327 15590 CDS product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817175.1 protein_id gnl|my_center|LOCUS_42710 15707 16819 gene locus_tag LOCUS_42720 gene hypD 15707 16819 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225639.1 protein_id gnl|my_center|LOCUS_42720 16912 17265 gene locus_tag LOCUS_42730 16912 17265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 17744 17262 gene locus_tag LOCUS_42740 17744 17262 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056347.1 protein_id gnl|my_center|LOCUS_42740 17996 18190 gene locus_tag LOCUS_42750 17996 18190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 18193 18867 gene locus_tag LOCUS_42760 18193 18867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143006.1 protein_id gnl|my_center|LOCUS_42760 19458 19039 gene locus_tag LOCUS_42770 19458 19039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 19711 19451 gene locus_tag LOCUS_42780 19711 19451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 >Feature sequence58 564 1073 gene locus_tag LOCUS_42790 564 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 1115 1804 gene locus_tag LOCUS_42800 1115 1804 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056116.1 protein_id gnl|my_center|LOCUS_42800 2748 1951 gene locus_tag LOCUS_42810 2748 1951 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124285.1 protein_id gnl|my_center|LOCUS_42810 3111 4319 gene locus_tag LOCUS_42820 3111 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 4353 5345 gene locus_tag LOCUS_42830 4353 5345 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057700.1 protein_id gnl|my_center|LOCUS_42830 5411 5878 gene locus_tag LOCUS_42840 5411 5878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 7534 5873 gene locus_tag LOCUS_42850 7534 5873 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_42850 7606 7818 gene locus_tag LOCUS_42860 7606 7818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140926.1 protein_id gnl|my_center|LOCUS_42860 8561 7815 gene locus_tag LOCUS_42870 8561 7815 CDS product circadian clock KaiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920713.1 protein_id gnl|my_center|LOCUS_42870 9911 8652 gene locus_tag LOCUS_42880 9911 8652 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056402.1 protein_id gnl|my_center|LOCUS_42880 10678 11643 gene locus_tag LOCUS_42890 10678 11643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 11640 12050 gene locus_tag LOCUS_42900 11640 12050 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142297.1 protein_id gnl|my_center|LOCUS_42900 13109 12051 gene locus_tag LOCUS_42910 13109 12051 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140935.1 protein_id gnl|my_center|LOCUS_42910 13236 14519 gene locus_tag LOCUS_42920 13236 14519 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057168.1 protein_id gnl|my_center|LOCUS_42920 14677 15372 gene locus_tag LOCUS_42930 14677 15372 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037770.1 protein_id gnl|my_center|LOCUS_42930 15376 17511 gene locus_tag LOCUS_42940 15376 17511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 17940 18332 gene locus_tag LOCUS_42950 17940 18332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 19193 18798 gene locus_tag LOCUS_42960 19193 18798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 >Feature sequence59 956 426 gene locus_tag LOCUS_42970 956 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 2221 1139 gene locus_tag LOCUS_42980 gene psbA 2221 1139 CDS product photosystem II q(b) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057317.1 protein_id gnl|my_center|LOCUS_42980 2401 2817 gene locus_tag LOCUS_42990 gene msrB 2401 2817 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 protein_id gnl|my_center|LOCUS_42990 3073 2870 gene locus_tag LOCUS_43000 3073 2870 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056799.1 protein_id gnl|my_center|LOCUS_43000 4134 3649 gene locus_tag LOCUS_43010 gene apcB 4134 3649 CDS product allophycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056800.1 protein_id gnl|my_center|LOCUS_43010 4699 4214 gene locus_tag LOCUS_43020 gene apcA 4699 4214 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056801.1 protein_id gnl|my_center|LOCUS_43020 5625 4996 gene locus_tag LOCUS_43030 gene ruvA 5625 4996 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056382.1 protein_id gnl|my_center|LOCUS_43030 5797 6918 gene locus_tag LOCUS_43040 5797 6918 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141501.1 protein_id gnl|my_center|LOCUS_43040 8172 7024 gene locus_tag LOCUS_43050 8172 7024 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056563.1 protein_id gnl|my_center|LOCUS_43050 8393 9418 gene locus_tag LOCUS_43060 8393 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 9496 10098 gene locus_tag LOCUS_43070 9496 10098 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040689791.1 protein_id gnl|my_center|LOCUS_43070 10283 10110 gene locus_tag LOCUS_43080 10283 10110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 10631 10999 gene locus_tag LOCUS_43090 10631 10999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 11043 12854 gene locus_tag LOCUS_43100 11043 12854 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_43100 12996 13931 gene locus_tag LOCUS_43110 12996 13931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 13935 14180 gene locus_tag LOCUS_43120 13935 14180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 15579 14206 gene locus_tag LOCUS_43130 15579 14206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 16026 16412 gene locus_tag LOCUS_43140 16026 16412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 16502 16906 gene locus_tag LOCUS_43150 16502 16906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 16991 17425 gene locus_tag LOCUS_43160 16991 17425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 17685 17488 gene locus_tag LOCUS_43170 17685 17488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 18534 18097 gene locus_tag LOCUS_43180 gene cynS 18534 18097 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896757.1 protein_id gnl|my_center|LOCUS_43180 >Feature sequence60 2288 561 gene locus_tag LOCUS_43190 2288 561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142325.1 protein_id gnl|my_center|LOCUS_43190 3215 2661 gene locus_tag LOCUS_43200 gene cysC 3215 2661 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256588.1 protein_id gnl|my_center|LOCUS_43200 3504 5672 gene locus_tag LOCUS_43210 3504 5672 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920783.1 protein_id gnl|my_center|LOCUS_43210 5988 6818 gene locus_tag LOCUS_43220 5988 6818 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641277.1 protein_id gnl|my_center|LOCUS_43220 7573 6974 gene locus_tag LOCUS_43230 gene coaE 7573 6974 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056742.1 protein_id gnl|my_center|LOCUS_43230 8360 7635 gene locus_tag LOCUS_43240 8360 7635 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057336.1 protein_id gnl|my_center|LOCUS_43240 8693 8989 gene locus_tag LOCUS_43250 8693 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007358131.1 protein_id gnl|my_center|LOCUS_43250 10875 9076 gene locus_tag LOCUS_43260 gene thrS 10875 9076 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216087114.1 protein_id gnl|my_center|LOCUS_43260 11010 11921 gene locus_tag LOCUS_43270 11010 11921 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530028.1 protein_id gnl|my_center|LOCUS_43270 13115 12012 gene locus_tag LOCUS_43280 13115 12012 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 protein_id gnl|my_center|LOCUS_43280 13655 13218 gene locus_tag LOCUS_43290 13655 13218 CDS product DUF4079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144373.1 protein_id gnl|my_center|LOCUS_43290 13660 16296 gene locus_tag LOCUS_43300 13660 16296 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057830.1 protein_id gnl|my_center|LOCUS_43300 16471 17718 gene locus_tag LOCUS_43310 16471 17718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 >Feature sequence61 1501 485 gene locus_tag LOCUS_43320 1501 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 3214 1538 gene locus_tag LOCUS_43330 3214 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 4268 3285 gene locus_tag LOCUS_43340 4268 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 5739 4432 gene locus_tag LOCUS_43350 5739 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 8293 5993 gene locus_tag LOCUS_43360 8293 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 9384 8353 gene locus_tag LOCUS_43370 9384 8353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 10109 9426 gene locus_tag LOCUS_43380 10109 9426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 10526 11254 gene locus_tag LOCUS_43390 10526 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 12326 11367 gene locus_tag LOCUS_43400 gene cysK 12326 11367 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056355.1 protein_id gnl|my_center|LOCUS_43400 12614 12868 gene locus_tag LOCUS_43410 12614 12868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 14341 12887 gene locus_tag LOCUS_43420 14341 12887 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258690.1 protein_id gnl|my_center|LOCUS_43420 15003 14344 gene locus_tag LOCUS_43430 15003 14344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 15812 17452 gene locus_tag LOCUS_43440 15812 17452 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056997.1 protein_id gnl|my_center|LOCUS_43440 >Feature sequence62 <1 936 gene locus_tag LOCUS_43450 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990677.1:PKD domain-containing protein note possible pseudo, internal stop codon, frameshifted 1116 4256 gene locus_tag LOCUS_43460 1116 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 4443 4766 gene locus_tag LOCUS_43470 4443 4766 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142103.1 protein_id gnl|my_center|LOCUS_43470 5654 4767 gene locus_tag LOCUS_43480 gene mraY 5654 4767 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799153.1 protein_id gnl|my_center|LOCUS_43480 6143 5880 gene locus_tag LOCUS_43490 6143 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 6562 6140 gene locus_tag LOCUS_43500 6562 6140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 6666 6989 gene locus_tag LOCUS_43510 6666 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 7883 7467 gene locus_tag LOCUS_43520 gene atpC 7883 7467 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056376.1 protein_id gnl|my_center|LOCUS_43520 9406 7958 gene locus_tag LOCUS_43530 gene atpD 9406 7958 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056375.1 protein_id gnl|my_center|LOCUS_43530 10127 10267 gene locus_tag LOCUS_43540 10127 10267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 12535 10424 gene locus_tag LOCUS_43550 gene recQ 12535 10424 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929065.1 protein_id gnl|my_center|LOCUS_43550 13269 12658 gene locus_tag LOCUS_43560 13269 12658 CDS product DUF3318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058121.1 protein_id gnl|my_center|LOCUS_43560 14935 14060 gene locus_tag LOCUS_43570 14935 14060 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056139.1 protein_id gnl|my_center|LOCUS_43570 16297 14939 gene locus_tag LOCUS_43580 gene der 16297 14939 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056722.1 protein_id gnl|my_center|LOCUS_43580 16450 16701 gene locus_tag LOCUS_43590 16450 16701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 16679 16921 gene locus_tag LOCUS_43600 16679 16921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 >Feature sequence63 1475 756 gene locus_tag LOCUS_43610 1475 756 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056123.1 protein_id gnl|my_center|LOCUS_43610 1920 2270 gene locus_tag LOCUS_43620 1920 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 2842 3969 gene locus_tag LOCUS_43630 2842 3969 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 protein_id gnl|my_center|LOCUS_43630 4947 3970 gene locus_tag LOCUS_43640 gene mdh 4947 3970 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142537.1 protein_id gnl|my_center|LOCUS_43640 5189 4974 gene locus_tag LOCUS_43650 gene ndhO 5189 4974 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055872.1 protein_id gnl|my_center|LOCUS_43650 8071 5420 gene locus_tag LOCUS_43660 8071 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 9599 8250 gene locus_tag LOCUS_43670 gene murD 9599 8250 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055928.1 protein_id gnl|my_center|LOCUS_43670 9988 11100 gene locus_tag LOCUS_43680 9988 11100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 11495 12505 gene locus_tag LOCUS_43690 gene prfB 11495 12505 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126988096.1 protein_id gnl|my_center|LOCUS_43690 12587 12838 gene locus_tag LOCUS_43700 12587 12838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 14094 12931 gene locus_tag LOCUS_43710 gene hemH 14094 12931 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920998.1 protein_id gnl|my_center|LOCUS_43710 14214 14837 gene locus_tag LOCUS_43720 14214 14837 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141483.1 protein_id gnl|my_center|LOCUS_43720 14937 15491 gene locus_tag LOCUS_43730 14937 15491 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056346.1 protein_id gnl|my_center|LOCUS_43730 15744 16499 gene locus_tag LOCUS_43740 15744 16499 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891922.1 protein_id gnl|my_center|LOCUS_43740 >Feature sequence64 385 1173 gene locus_tag LOCUS_43750 385 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 2290 1298 gene locus_tag LOCUS_43760 gene ilvC 2290 1298 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_43760 2802 3917 gene locus_tag LOCUS_43770 gene pilM 2802 3917 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921030.1 protein_id gnl|my_center|LOCUS_43770 3927 4697 gene locus_tag LOCUS_43780 3927 4697 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058175.1 protein_id gnl|my_center|LOCUS_43780 4694 5485 gene locus_tag LOCUS_43790 4694 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 5557 7638 gene locus_tag LOCUS_43800 5557 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 8103 8300 gene locus_tag LOCUS_43810 8103 8300 CDS product DUF751 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057323.1 protein_id gnl|my_center|LOCUS_43810 8342 8728 gene locus_tag LOCUS_43820 gene rbfA 8342 8728 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057468.1 protein_id gnl|my_center|LOCUS_43820 8935 10515 gene locus_tag LOCUS_43830 8935 10515 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056886.1 protein_id gnl|my_center|LOCUS_43830 11711 10512 gene locus_tag LOCUS_43840 11711 10512 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057470.1 protein_id gnl|my_center|LOCUS_43840 12051 12521 gene locus_tag LOCUS_43850 gene tsaE 12051 12521 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142985.1 protein_id gnl|my_center|LOCUS_43850 >Feature sequence65 1584 271 gene locus_tag LOCUS_43860 1584 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 2459 1587 gene locus_tag LOCUS_43870 2459 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 3681 2881 gene locus_tag LOCUS_43880 3681 2881 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048869675.1 protein_id gnl|my_center|LOCUS_43880 3895 4974 gene locus_tag LOCUS_43890 3895 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142156.1 protein_id gnl|my_center|LOCUS_43890 5256 6293 gene locus_tag LOCUS_43900 gene csaB 5256 6293 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140747.1 protein_id gnl|my_center|LOCUS_43900 6568 6918 gene locus_tag LOCUS_43910 6568 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055984.1 protein_id gnl|my_center|LOCUS_43910 7488 6919 gene locus_tag LOCUS_43920 7488 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 8145 7507 gene locus_tag LOCUS_43930 8145 7507 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920671.1 protein_id gnl|my_center|LOCUS_43930 9373 8468 gene locus_tag LOCUS_43940 9373 8468 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929260.1 protein_id gnl|my_center|LOCUS_43940 9509 10027 gene locus_tag LOCUS_43950 9509 10027 CDS product cofactor assembly of complex C subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143752.1 protein_id gnl|my_center|LOCUS_43950 10035 10451 gene locus_tag LOCUS_43960 10035 10451 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056339.1 protein_id gnl|my_center|LOCUS_43960 10455 11084 gene locus_tag LOCUS_43970 10455 11084 CDS product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140730.1 protein_id gnl|my_center|LOCUS_43970 11211 12551 gene locus_tag LOCUS_43980 11211 12551 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190570100.1 protein_id gnl|my_center|LOCUS_43980 >Feature sequence66 275 2281 gene locus_tag LOCUS_43990 275 2281 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056767.1 protein_id gnl|my_center|LOCUS_43990 2426 3475 gene locus_tag LOCUS_44000 2426 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056254.1 protein_id gnl|my_center|LOCUS_44000 3625 5223 gene locus_tag LOCUS_44010 3625 5223 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125969.1 protein_id gnl|my_center|LOCUS_44010 5457 6665 gene locus_tag LOCUS_44020 5457 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 7366 6677 gene locus_tag LOCUS_44030 7366 6677 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056267.1 protein_id gnl|my_center|LOCUS_44030 8796 7462 gene locus_tag LOCUS_44040 8796 7462 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799062.1 protein_id gnl|my_center|LOCUS_44040 9954 8806 gene locus_tag LOCUS_44050 9954 8806 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056182.1 protein_id gnl|my_center|LOCUS_44050 10315 11115 gene locus_tag LOCUS_44060 10315 11115 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057950.1 protein_id gnl|my_center|LOCUS_44060 11143 12324 gene locus_tag LOCUS_44070 11143 12324 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920982.1 protein_id gnl|my_center|LOCUS_44070 >Feature sequence67 494 321 gene locus_tag LOCUS_44080 494 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 818 498 gene locus_tag LOCUS_44090 818 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44090 1060 815 gene locus_tag LOCUS_44100 1060 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 2240 1320 gene locus_tag LOCUS_44110 2240 1320 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142039.1 protein_id gnl|my_center|LOCUS_44110 2838 3347 gene locus_tag LOCUS_44120 gene hoxE 2838 3347 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257070.1 protein_id gnl|my_center|LOCUS_44120 3376 4983 gene locus_tag LOCUS_44130 3376 4983 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257071.1 protein_id gnl|my_center|LOCUS_44130 5106 5591 gene locus_tag LOCUS_44140 5106 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056916.1 protein_id gnl|my_center|LOCUS_44140 5884 7257 gene locus_tag LOCUS_44150 5884 7257 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920957.1 protein_id gnl|my_center|LOCUS_44150 7425 7739 gene locus_tag LOCUS_44160 7425 7739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 7992 8204 gene locus_tag LOCUS_44170 7992 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 8346 9506 gene locus_tag LOCUS_44180 8346 9506 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_44180 9511 10596 gene locus_tag LOCUS_44190 gene orr 9511 10596 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_44190 >Feature sequence68 303 923 gene locus_tag LOCUS_44200 303 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 1145 975 gene locus_tag LOCUS_44210 1145 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057753.1 protein_id gnl|my_center|LOCUS_44210 1962 1234 gene locus_tag LOCUS_44220 1962 1234 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920695.1 protein_id gnl|my_center|LOCUS_44220 3311 2331 gene locus_tag LOCUS_44230 gene chlG 3311 2331 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920891.1 protein_id gnl|my_center|LOCUS_44230 4394 3318 gene locus_tag LOCUS_44240 4394 3318 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141227.1 protein_id gnl|my_center|LOCUS_44240 4641 4417 gene locus_tag LOCUS_44250 4641 4417 CDS product DUF2862 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056374.1 protein_id gnl|my_center|LOCUS_44250 5599 5267 gene locus_tag LOCUS_44260 5599 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 6741 5845 gene locus_tag LOCUS_44270 6741 5845 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057164.1 protein_id gnl|my_center|LOCUS_44270 7071 7790 gene locus_tag LOCUS_44280 7071 7790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 8758 7904 gene locus_tag LOCUS_44290 8758 7904 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190557989.1 protein_id gnl|my_center|LOCUS_44290 8948 9679 gene locus_tag LOCUS_44300 8948 9679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 >Feature sequence69 3301 245 gene locus_tag LOCUS_44310 gene ppc 3301 245 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057749.1 protein_id gnl|my_center|LOCUS_44310 3797 3609 gene locus_tag LOCUS_44320 3797 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 4081 3794 gene locus_tag LOCUS_44330 gene minE 4081 3794 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057853.1 protein_id gnl|my_center|LOCUS_44330 4911 4111 gene locus_tag LOCUS_44340 gene minD 4911 4111 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057852.1 protein_id gnl|my_center|LOCUS_44340 5903 5070 gene locus_tag LOCUS_44350 gene minC 5903 5070 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141990.1 protein_id gnl|my_center|LOCUS_44350 6260 5910 gene locus_tag LOCUS_44360 6260 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 6438 6947 gene locus_tag LOCUS_44370 6438 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 7370 7690 gene locus_tag LOCUS_44380 7370 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 7680 8123 gene locus_tag LOCUS_44390 gene yhaV 7680 8123 CDS product type II toxin-antitoxin system ribonuclease toxin YhaV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347267.1 protein_id gnl|my_center|LOCUS_44390 >Feature sequence70 2180 165 gene locus_tag LOCUS_44400 2180 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 3527 2358 gene locus_tag LOCUS_44410 3527 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 4971 3634 gene locus_tag LOCUS_44420 4971 3634 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_44420 4919 5101 gene locus_tag LOCUS_44430 4919 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 5641 6099 gene locus_tag LOCUS_44440 5641 6099 CDS product DUF3172 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920879.1 protein_id gnl|my_center|LOCUS_44440 6690 6373 gene locus_tag LOCUS_44450 6690 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 7744 6764 gene locus_tag LOCUS_44460 7744 6764 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 protein_id gnl|my_center|LOCUS_44460 >Feature sequence71 496 837 gene locus_tag LOCUS_44470 496 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 2146 1076 gene locus_tag LOCUS_44480 2146 1076 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106290870.1 protein_id gnl|my_center|LOCUS_44480 3237 2143 gene locus_tag LOCUS_44490 3237 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 5113 3446 gene locus_tag LOCUS_44500 gene nadB 5113 3446 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058240.1 protein_id gnl|my_center|LOCUS_44500 5713 5306 gene locus_tag LOCUS_44510 gene psbU 5713 5306 CDS product photosystem II complex extrinsic protein PsbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058241.1 protein_id gnl|my_center|LOCUS_44510 6074 5892 gene locus_tag LOCUS_44520 6074 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 6192 6827 gene locus_tag LOCUS_44530 6192 6827 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058094.1 protein_id gnl|my_center|LOCUS_44530 >Feature sequence72 1484 930 gene locus_tag LOCUS_44540 gene gmk 1484 930 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055909.1 protein_id gnl|my_center|LOCUS_44540 1766 1497 gene locus_tag LOCUS_44550 1766 1497 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_44550 2245 2451 gene locus_tag LOCUS_44560 2245 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 2580 3065 gene locus_tag LOCUS_44570 gene psbV 2580 3065 CDS product photosystem II cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057125.1 protein_id gnl|my_center|LOCUS_44570 3822 3118 gene locus_tag LOCUS_44580 3822 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 4894 3800 gene locus_tag LOCUS_44590 4894 3800 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_44590 5075 6580 gene locus_tag LOCUS_44600 5075 6580 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058059.1 protein_id gnl|my_center|LOCUS_44600 >Feature sequence73 1502 87 gene locus_tag LOCUS_44610 gene argH 1502 87 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056221.1 protein_id gnl|my_center|LOCUS_44610 2593 1982 gene locus_tag LOCUS_44620 2593 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 2924 2601 gene locus_tag LOCUS_44630 2924 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 3170 3808 gene locus_tag LOCUS_44640 3170 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 5558 6289 gene locus_tag LOCUS_44650 5558 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 6264 6464 gene locus_tag LOCUS_44660 6264 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 >Feature sequence74 1163 876 gene locus_tag LOCUS_44670 1163 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 1831 1178 gene locus_tag LOCUS_44680 gene upp 1831 1178 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920929.1 protein_id gnl|my_center|LOCUS_44680 2238 2056 gene locus_tag LOCUS_44690 2238 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 2658 2305 gene locus_tag LOCUS_44700 2658 2305 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057416.1 protein_id gnl|my_center|LOCUS_44700 2900 2829 gene locus_tag LOCUS_t00380 2900 2829 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4978 3080 gene locus_tag LOCUS_44710 4978 3080 CDS product NAD(P)H-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057958.1 protein_id gnl|my_center|LOCUS_44710 5883 5200 gene locus_tag LOCUS_44720 5883 5200 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920655.1 protein_id gnl|my_center|LOCUS_44720 >Feature sequence75 138 794 gene locus_tag LOCUS_44730 138 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 1176 1808 gene locus_tag LOCUS_44740 1176 1808 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104477.1 protein_id gnl|my_center|LOCUS_44740 1783 2739 gene locus_tag LOCUS_44750 1783 2739 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209769.1 protein_id gnl|my_center|LOCUS_44750 2895 3377 gene locus_tag LOCUS_44760 2895 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 3419 4273 gene locus_tag LOCUS_44770 3419 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 4658 4308 gene locus_tag LOCUS_44780 4658 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 4887 5159 gene locus_tag LOCUS_44790 4887 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 >Feature sequence76 839 1057 gene locus_tag LOCUS_44800 839 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 1057 2691 gene locus_tag LOCUS_44810 1057 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 >Feature sequence77 430 131 gene locus_tag LOCUS_44820 430 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 1601 498 gene locus_tag LOCUS_44830 1601 498 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057962.1 protein_id gnl|my_center|LOCUS_44830 2924 1641 gene locus_tag LOCUS_44840 2924 1641 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057961.1 protein_id gnl|my_center|LOCUS_44840 >Feature sequence78 152 1897 gene locus_tag LOCUS_44850 152 1897 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929293.1 protein_id gnl|my_center|LOCUS_44850 2082 2804 gene locus_tag LOCUS_44860 2082 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 2873 3172 gene locus_tag LOCUS_44870 2873 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 >Feature sequence79 888 133 gene locus_tag LOCUS_44880 888 133 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143324.1 protein_id gnl|my_center|LOCUS_44880 1638 889 gene locus_tag LOCUS_44890 1638 889 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143325.1 protein_id gnl|my_center|LOCUS_44890 2938 2063 gene locus_tag LOCUS_44900 2938 2063 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_44900 >Feature sequence80 219 548 gene locus_tag LOCUS_44910 219 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 1480 713 gene locus_tag LOCUS_44920 1480 713 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618819.1 protein_id gnl|my_center|LOCUS_44920 1755 2831 gene locus_tag LOCUS_44930 1755 2831 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970073.1 protein_id gnl|my_center|LOCUS_44930 >Feature sequence81 545 183 gene locus_tag LOCUS_44940 545 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 876 538 gene locus_tag LOCUS_44950 876 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 2617 1055 gene locus_tag LOCUS_44960 2617 1055 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920919.1 protein_id gnl|my_center|LOCUS_44960 >Feature sequence82 338 1402 gene locus_tag LOCUS_44970 338 1402 CDS product IS4-like element ISLpn9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946555.1 protein_id gnl|my_center|LOCUS_44970 2483 1458 gene locus_tag LOCUS_44980 2483 1458 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057039.1 protein_id gnl|my_center|LOCUS_44980 >Feature sequence83 207 134 gene locus_tag LOCUS_t00390 207 134 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 354 827 gene locus_tag LOCUS_44990 354 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 1203 1535 gene locus_tag LOCUS_45000 1203 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 1844 2077 gene locus_tag LOCUS_45010 1844 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 >Feature sequence84 <1 2251 gene locus_tag LOCUS_45020 <1 2251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058185.1:CHAT domain-containing protein >Feature sequence85 749 246 gene locus_tag LOCUS_45030 749 246 CDS product NAD(P)H-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057270.1 protein_id gnl|my_center|LOCUS_45030 1493 750 gene locus_tag LOCUS_45040 gene ndhK 1493 750 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056552.1 protein_id gnl|my_center|LOCUS_45040 1903 1541 gene locus_tag LOCUS_45050 gene ndhC 1903 1541 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986108.1 protein_id gnl|my_center|LOCUS_45050 >Feature sequence86 420 920 gene locus_tag LOCUS_45060 420 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 1291 2208 gene locus_tag LOCUS_45070 gene thrB 1291 2208 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057602.1 protein_id gnl|my_center|LOCUS_45070 >Feature sequence87 321 82 gene locus_tag LOCUS_45080 321 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 556 2028 gene locus_tag LOCUS_45090 556 2028 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057582.1 protein_id gnl|my_center|LOCUS_45090 >Feature sequence88 92 583 gene locus_tag LOCUS_45100 92 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 1130 558 gene locus_tag LOCUS_45110 1130 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 1623 1120 gene locus_tag LOCUS_45120 1623 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 >Feature sequence89 643 1473 gene locus_tag LOCUS_45130 643 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 >Feature sequence90 <1 614 gene locus_tag LOCUS_45140 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162305080.1:calcium-binding protein 785 1441 gene locus_tag LOCUS_45150 785 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 >Feature sequence91 931 347 gene locus_tag LOCUS_45160 931 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 1328 1128 gene locus_tag LOCUS_45170 1328 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 >Feature sequence92 548 288 gene locus_tag LOCUS_45180 548 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 763 548 gene locus_tag LOCUS_45190 763 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 >Feature sequence93 315 25 gene locus_tag LOCUS_45200 315 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 1150 488 gene locus_tag LOCUS_45210 1150 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 >Feature sequence94 819 181 gene locus_tag LOCUS_45220 819 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 >Feature sequence95 >Feature sequence96 837 145 gene locus_tag LOCUS_45230 837 145 CDS product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485755.1 protein_id gnl|my_center|LOCUS_45230