COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..85473 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(784..1728) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354235.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene rbsK CDS complement(1839..2729) product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056271.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene rbsB CDS complement(2754..3719) product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211858.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene rbsC CDS complement(3724..5229) product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387770.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene rbsA CDS complement(5237..5656) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301979.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene rbsD CDS complement(5823..7691) product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102319.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene kup CDS 7914..9410 product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299914.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene ravA CDS 9404..10855 product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956642.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene viaA CDS complement(10860..11528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 note possible pseudo, frameshifted CDS complement(11545..11847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 note possible pseudo, frameshifted CDS 11999..12457 product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432970.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene asnC CDS 12547..12990 product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763724.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene mioC CDS 13369..15258 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499788.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene mnmG CDS 15322..15945 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932839.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene rsmG CDS 16550..16942 product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116695.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene atpI CDS 16951..17766 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135625.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene atpB CDS 17813..18052 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene atpE CDS 18114..18584 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052217.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene atpF CDS 18599..19132 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288587.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene atpH CDS 19145..20686 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176745.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene atpA CDS 20737..21600 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896498.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene atpG CDS 21627..23009 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190506.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene atpD CDS 23030..23449 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251965.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 23802..25172 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933736.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene glmU CDS 25334..27163 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334099.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene glmS CDS 27477..28517 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867146.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene pstS CDS 28604..29563 product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741620.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene pstC CDS 29563..30453 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251998.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene pstA CDS 30636..31409 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063125.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene pstB CDS 31424..32149 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377786.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene phoU CDS 32435..33271 product transcriptional antiterminator BglG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295251.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene bglG CDS 33405..35282 product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137296.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene bglF CDS 35301..36713 product 6-phospho-beta-glucosidase BglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643228.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene bglB CDS 36782..38398 product carbohydrate-specific porin BglH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489881.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene bglH CDS 38425..39594 product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336377.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 39609..40331 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766900.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(40393..40980) product PF03691 family colicin E2 tolerance protein CbrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193072.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene cbrC CDS complement(41029..41496) product protein CbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116777.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(41563..42228) product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086486.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene yieH CDS 42393..43730 product adenine permease AdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019348.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene adeP CDS complement(43784..44350) product class I chromate reductase YieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291268.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene yieF CDS complement(44372..45121) product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296581.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(45278..46246) product HTH-type transcriptional regulator YidZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311238.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene yidZ CDS complement(46212..47387) product multidrug efflux MFS transporter MdtL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085982.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene mdtL CDS complement(47519..48766) product low affinity tryptophan permease TnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131925.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene tnaB CDS complement(48857..50272) product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295247.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene tnaA CDS complement(50810..52174) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282346.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene mnmE CDS complement(52280..53926) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378250.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene yidC CDS complement(54150..54476) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239730.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene rnpA CDS complement(54526..54666) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831330.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene rpmH CDS 55342..56676 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059111.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene dnaA CDS 56681..57781 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673464.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene dnaN CDS 57781..58854 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060112.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene recF CDS 58883..60007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 note possible pseudo, frameshifted assembly_gap 59949..59957 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 60004..61248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 note possible pseudo, frameshifted CDS 61441..61839 product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522208.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 61954..62766 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985549.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene yidA CDS complement(62812..63468) product protein YidX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772934.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene yidX CDS 63746..64435 product D-galactonate utilization transcriptional regulator DgoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174305.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene dgoR CDS 64432..65310 product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127091.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene dgoK CDS 65294..65911 product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198722.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene dgoA CDS 65908..67056 product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705001.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene dgoD CDS 67176..68468 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354284.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(68465..69529) product colicin M resistance lipid reductase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340434.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene cbrA CDS 69630..70844 product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723257.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(70846..71106) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313407.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 71484..71897 product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243437.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene ibpA CDS 72009..72437 product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243431.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene ibpB CDS 72633..74294 product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279752.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(74291..75007) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300779.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 75303..76409 product alpha-glucoside-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952140.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 76434..76919 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492410.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 76919..77557 product inactive 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311230.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 77557..77733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(77730..78623) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013540.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 78790..80505 product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087145.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 80502..81995 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828527.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(82042..82491) product protein YidI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511289.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene yidI CDS 82599..82946 product YidH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703959.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 82936..83298 product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113432.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 83295..83792 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148061.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(83800..84960) product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306726.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene emrD sequence002 source 1..79081 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 200..1792 product PTS maltose transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125583.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene malX CDS 1802..2974 product bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459379.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene malY CDS 3078..4079 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567490.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene add CDS complement(4113..5153) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282550.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 5404..5619 product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217950.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene ydgT CDS 5705..6145 product DUF2569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310854.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 6222..6803 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133193.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene rsxA CDS 6803..7381 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991805.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene rsxB CDS 7374..9476 product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915778.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene rsxC assembly_gap 9131..9215 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9477..10535 product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231927.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene rsxD CDS 10539..11159 product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920784.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene rsxG CDS 11163..11858 product electron transport complex subunit RsxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289652.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene rsxE CDS 11858..12493 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030339.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene nth CDS 13104..14606 product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100932.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene dtpA CDS 14712..15317 product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765749.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene gstA CDS complement(15361..16224) product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307229.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene pdxY CDS complement(16283..17557) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295400.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene tyrS CDS complement(17686..18342) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282319.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene pdxH CDS complement(18401..18730) product C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178044.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene mliC CDS complement(18828..19937) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835039.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene anmK CDS 20211..20678 product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597196.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene slyB CDS complement(20725..21159) product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296943.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene slyA CDS 21360..21596 product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670998.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 21599..22456 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300356.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 22456..24468 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994333.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(24469..24990) product superoxide dismutase [Cu-Zn] SodC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296937.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene sodC CDS complement(25071..25967) product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250656.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 26358..26957 product DNA-binding transcriptional regulator NemR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032936.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene nemR CDS 26994..28091 product N-ethylmaleimide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093589.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene nemA CDS 28172..28579 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237796.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene gloA CDS 28682..29329 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282283.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene rnt CDS 29422..34038 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310858.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(34089..34436) product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108172.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene grxD CDS complement(34518..34670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 34770..35585 product peptidoglycan DD-endopeptidase MepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101193.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene mepH CDS 35713..36294 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007283.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene sodB CDS complement(36456..37625) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701040.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 38179..39204 product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190982.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene purR CDS complement(39201..40133) product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269501.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene punR CDS 40246..41457 product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182347.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene punC CDS 41748..42896 product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098896.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene cfa CDS complement(42936..43577) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493947.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene ribE CDS 43792..45165 product multidrug efflux MATE transporter MdtK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174940.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene mdtK CDS complement(45206..46462) product AIDA repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534271.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 tRNA 46770..46846 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 46851..46927 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 47035..47340 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212657.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 47466..49070 product FAD-NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716950.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(49082..49846) product protein YdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587525.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene ydhT CDS complement(49898..50683) product thiosulfate reductase cytochrome B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069979.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(50680..51234) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310861.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(51412..52050) product YdhW family putative oxidoreductase system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517579.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(52063..54165) product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273527.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(54186..54812) product ferredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070230.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(55267..55476) product fumarate hydratase FumD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528342.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene fumD CDS 56033..57445 product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295403.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene pykF CDS 57756..57992 product murein lipoprotein Lpp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648420.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene lpp CDS complement(58056..59060) product L,D-transpeptidase LdtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817105.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene ldtE CDS complement(59209..59625) product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196530.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene sufE CDS complement(59638..60858) product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577988.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene sufS CDS complement(60855..62126) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907979.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene sufD CDS complement(62101..62847) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948863.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene sufC CDS complement(62857..64344) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089364.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene sufB CDS complement(64353..64721) product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367160.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene sufA CDS complement(65269..65457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(65557..65967) product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637982.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene menI CDS complement(65964..69020) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613008.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 69409..70521 product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene ydiK CDS 70950..71306 product YdiL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310864.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 71406..72620 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795537.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 72847..74112 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081197.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 74124..74990 product quinate/shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383469.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene ydiB CDS 75021..75779 product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860201.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene aroD CDS 75922..77517 product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805700.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 77531..78682 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347850.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 sequence003 source 1..72273 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(127..1170) product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295485.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene selD CDS complement(1287..1838) product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339283.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 1999..3855 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259810.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene sppA CDS 4022..5038 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170162.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene ansA CDS 5049..5690 product bifunctional pyrazinamidase/nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135066.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(5783..7141) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438807.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(7258..8016) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719096.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(8153..9133) product NADH-dependent methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723710.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene ydjG CDS complement(9143..10090) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369231.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(10095..10931) product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878893.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(10952..11929) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798110.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(12012..13391) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435292.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(13418..14494) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645221.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(14864..15136) product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300415.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(15178..15591) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284618.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene msrB CDS 15933..16928 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153502.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene gapA CDS 17012..17896 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335909.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(17944..18798) product methylglyoxal reductase YeaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186371.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene yeaE CDS complement(18888..19634) product scaffolding protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163771.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene mipA CDS 20070..22004 product protein kinase YeaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019882.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene yeaG CDS 22117..23400 product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219687.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 23679..25022 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616411.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 25203..26693 product diguanylate cyclase DgcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766132.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene dgcJ CDS 26736..27239 product mischarged aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138043.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene yeaK CDS 27514..27960 product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460707.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(27917..28351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 28835..30016 product 2-nitroimidazole transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128491.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene nimT CDS 30071..30418 product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326526.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(30440..30694) product DUF333 domain-containing lipoprotein YoaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691930.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene yoaF CDS 30877..31902 product diguanylate cyclase DgcP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310896.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene dgcP CDS complement(32169..32417) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512153.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(32565..32747) product DUF1869 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513737.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(32751..33110) product DUF1971 domain-containing protein YeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939317.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene yeaR CDS complement(33283..33921) product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457206.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene leuE CDS complement(34048..34971) product DNA-binding transcriptional regulator DmlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061575.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene dmlR CDS 35074..36159 product multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978494.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene dmlA CDS 36365..37795 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301380.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 37827..38951 product carnitine monooxygenase subunit YeaW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067822.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene yeaW CDS 39007..39972 product carnitine monooxygenase subunit YeaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287026.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene yeaX CDS complement(40026..41153) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109156.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene rnd CDS complement(41223..42974) product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954305.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene fadD CDS complement(43113..43694) product Slp family lipoprotein YeaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290576.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene yeaY CDS complement(43734..44429) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220966.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene tsaB CDS complement(44487..46397) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128841.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 46526..46873 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310311.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 47235..47594 product DUF1889 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307845.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(47714..47893) product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457334.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 47967..49328 product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854958.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene pabB CDS 49332..49910 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456715.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 50094..51458 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624298.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene sdaA CDS 51589..53187 product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295494.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(53191..54747) product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394983.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene yoaE CDS 55210..56181 product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150543.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene manX CDS 56244..57044 product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406926.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene manY CDS 57057..57908 product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228655.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene manZ CDS 57963..58421 product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156255.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 58850..59416 product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296134.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene mntP CDS complement(59413..59778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 assembly_gap 59864..60037 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(60487..60696) product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062678.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene cspE CDS complement(61522..61809) product YebO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006866.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 62186..62425 product YobH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211011.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(62569..63360) product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262203.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene kdgR CDS 63537..64910 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127216.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(64956..65795) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984520.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene htpX CDS complement(66029..68077) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055791.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene prc CDS complement(68097..68795) product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431381.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene proQ CDS complement(68892..69389) product L-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043877.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene msrC CDS 69564..70802 product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207282.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene yebS assembly_gap 71430..71445 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence004 source 1..48218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 469..1986 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334220.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene purF CDS 2081..2650 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825700.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene ubiX CDS 2916..3698 product lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748271.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene argT CDS 3919..4701 product histidine ABC transporter substrate-binding protein HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737621.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene hisJ CDS 4791..5477 product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965522.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene hisQ CDS 5474..6190 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569958.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 6198..6971 product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293613.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene hisP CDS 7168..8058 product recombination-promoting nuclease RpnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156149.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene rpnB CDS complement(8106..8999) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028341.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(9020..9382) product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068457.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene folX CDS complement(9439..10086) product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566471.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene yfcG CDS 10222..10866 product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042442.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene yfcF CDS 10922..11473 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977007.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene yfcE CDS 11531..12073 product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437935.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene yfcD CDS complement(12106..13584) product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274493.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene yfcC CDS 13529..13693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(13816..15960) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086722.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene pta CDS complement(16035..17237) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095707.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene ackA CDS 17575..18030 product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106627.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene yfbV CDS 18113..18607 product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426124.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 18618..19268 product hexitol phosphatase HxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203392.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene hxpA CDS 19355..21187 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012899.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(21246..21845) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813859.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene yfbR CDS complement(21929..23146) product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074527.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene alaA CDS 24066..25004 product transcriptional regulator LrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622280.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene lrhA CDS 25635..26078 product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062997.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene nuoA CDS 26094..26756 product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386733.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene nuoB CDS 26850..28652 product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247878.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene nuoC CDS 28655..29155 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545042.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene nuoE CDS 29152..30489 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789500.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene nuoF CDS 30542..33268 product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190939.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene nuoG CDS 33265..34242 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118512.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene nuoH CDS 34257..34799 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172749.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene nuoI CDS 34811..35365 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393511.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene nuoJ CDS 35362..35664 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612644.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene nuoK CDS 35661..37502 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056643.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene nuoL CDS 37666..39195 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926441.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene nuoM CDS 39202..40659 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156701.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene nuoN CDS complement(40743..41591) product tetratricopeptide repeat protein YfbP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767280.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene yfbP CDS complement(41650..42126) product protein YfbO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188051.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene yfbO CDS 42281..42997 product protein YfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455114.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene yfbN CDS complement(43270..43773) product YfbM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525360.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(43876..44694) product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719999.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 44985..46712 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244806.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(46783..47991) product deubiquitinase ElaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393504.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene elaD sequence005 source 1..44366 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 533..1330 product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158931.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene fhuC CDS 1330..2220 product Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310529.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene fhuD CDS 2217..4199 product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044072.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene fhuB CDS complement(4357..5637) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045315.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene hemL CDS 5972..7123 product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845394.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene clcA CDS 7205..7549 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295564.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene erpA CDS complement(7596..8219) product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964221.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(8257..9057) product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129927.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene btuF CDS complement(9050..9748) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689844.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene mtnN CDS 9832..11349 product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057073.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene dgt CDS 11479..12903 product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753946.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene degP CDS 13058..14215 product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929443.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene cdaR CDS complement(14304..14690) product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272188.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(14852..15595) product phosphodiesterase YaeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625631.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene yaeI CDS complement(15718..16542) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186650.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene dapD CDS complement(16573..19245) product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094586.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene glnD CDS complement(19307..20101) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018194.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene map CDS 20469..21194 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246882.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene rpsB CDS 21452..22303 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818114.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene tsf CDS 22450..23175 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224573.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene pyrH CDS 23467..24024 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622418.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene frr CDS 24116..25312 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811923.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene ispC CDS 25570..26259 product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295562.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene ispU CDS 26380..27129 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922446.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene cdsA CDS 27141..28493 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295561.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene rseP CDS 28523..30955 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240896.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene bamA CDS 31077..31562 product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758956.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene skp CDS 31566..32591 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139279.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene lpxD CDS 32696..33151 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210739.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene fabZ CDS 33155..33943 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565966.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene lpxA CDS 33943..35091 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139654.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene lpxB CDS 35088..35684 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569430.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene rnhB CDS 35721..39203 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294757.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene dnaE CDS 39216..40175 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055741.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene accA CDS 40274..42289 product lysine decarboxylase LdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020973.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene ldcC CDS 42472..42861 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901099.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 42926..44224 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176549.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene tilS sequence006 source 1..43798 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 341..997 product carbon-nitrogen hydrolase family protein YobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011658.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene yobB CDS 1021..1683 product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944256.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene exoX CDS complement(1680..3740) product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936927.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene ptrB CDS complement(3949..4608) product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024757.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(4935..5291) product protein YebF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350516.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene yebF CDS complement(5358..5648) product DNA damage-inducible protein YebG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257738.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene yebG CDS 5782..6960 product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173484.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene purT CDS complement(7016..7657) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800512.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene kdgA CDS complement(7694..9505) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069467.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene edd CDS complement(9740..11215) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301727.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene zwf CDS complement(11381..11530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155622.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 11553..12422 product DNA-binding transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056706.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene hexR CDS 12550..13992 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091148.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene pyk CDS complement(14123..15094) product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448381.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene lpxM CDS complement(15214..16536) product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001184045.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene mepM CDS complement(16552..17610) product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069410.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene znuA CDS 17563..18318 product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202996.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene znuC CDS 18315..19100 product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571480.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene znuB CDS 19176..19787 product galactoside O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335915.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene lacA CDS complement(19890..21044) product cyanate transporter CynX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927953.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene cynX CDS complement(21077..22504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(22572..22904) product head decoration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201478.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(22914..24257) product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123254.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(24238..25812) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001316944.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(25827..26033) product gpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198149.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(26033..27955) product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027292.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(27930..28247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 28170..29081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(29135..29725) product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276305.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene yajL CDS complement(29688..29867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 note possible pseudo, frameshifted CDS complement(29893..30606) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705865.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene panE note possible pseudo, frameshifted CDS 30774..31265 product nucleotide binding protein YajQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138904.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene yajQ CDS complement(31393..32757) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000963.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(32906..33796) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971336.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene cyoE CDS complement(33808..34137) product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019869.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(34137..34751) product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179819.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(34741..36732) product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467180.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene cyoB CDS complement(36754..37641) product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239436.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene cyoA CDS complement(38161..39636) product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098429.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene ampG CDS complement(39680..40258) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295326.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 40563..40880 product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973448.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene bolA CDS 41224..42522 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198384.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene tig CDS 42768..43391 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122253.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene clpP sequence007 source 1..41747 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1324..2223) product L-lysine exporter LysO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491142.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene lysO CDS complement(2718..3422) product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298299.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene aqpZ CDS 3839..5497 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599802.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(5494..6486) product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241033.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 6619..7716 product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746442.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene macA CDS 7713..9659 product macrolide ABC transporter ATP-binding protein/permease MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188144.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene macB CDS complement(9732..9956) product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410785.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene cspD CDS 10279..10599 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520781.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene clpS CDS 10630..12906 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934041.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene clpA tRNA complement(13250..13337) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(13591..13809) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene infA CDS complement(14094..14798) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241678.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene aat CDS complement(14840..16561) product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202177.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene cydC CDS complement(16562..18328) product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043598.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene cydD CDS complement(18451..19416) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537418.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene trxB CDS 19961..20455 product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228473.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene lrp CDS 20590..24462 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097320.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 24618..25232 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976047.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene lolA CDS 25243..26586 product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067755.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene rarA CDS 26677..27969 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886683.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene serS CDS 28208..30652 product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850303.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene dmsA CDS 30663..31280 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213098.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene dmsB CDS 31282..32145 product dimethyl sulfoxide reductase anchor subunit DmsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534637.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene dmsC CDS complement(32180..32806) product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165879.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene ycaC CDS 33120..34268 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109259.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 34478..35908 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918506.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(35909..36817) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242684.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 36917..37507 product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190363.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(37589..38329) product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111043.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene pflA CDS complement(38521..40803) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292822.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene pflB CDS complement(40858..41520) product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642546.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene focA assembly_gap 41524..41556 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence008 source 1..40525 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(127..1887) product 30S ribosomal protein S12 methylthiotransferase accessory factor YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295344.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene ycaO CDS 2017..2709 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642849.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 2908..3996 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057138.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene serC CDS 4067..5350 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445231.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene aroA CDS 5519..6283 product metallopeptidase YcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350496.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene ycaL CDS 6456..7139 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125016.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene cmk CDS 7250..8923 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140327.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene rpsA CDS 9083..9367 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167336.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene ihfB CDS 9575..10726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 note possible pseudo, frameshifted CDS 11031..11840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 11877..13625 product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551270.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene msbA CDS 13622..14608 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570539.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene lpxK CDS 14645..15877 product winged helix DNA-binding protein YcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056538.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 15929..16111 product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350058.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene ycaR CDS 16108..16854 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011603.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene kdsB CDS 17008..17901 product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436922.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(17878..18657) product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899600.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene elyC CDS 18793..19578 product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298300.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene cmoM CDS 19575..20897 product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288850.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene mukF CDS 20905..21582 product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295347.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene mukE CDS 21582..26009 product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572698.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene mukB CDS 26270..28117 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925969.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene ldtD CDS 28298..28846 product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295932.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 28873..29520 product hydroxyacylglutathione hydrolase GloC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109486.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene gloC CDS complement(29742..30932) product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462687.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene aspC CDS 30919..31101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196607.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(31117..32205) product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977920.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene ompF CDS complement(32808..34208) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117881.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene asnS CDS complement(34377..35084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(35099..35530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 assembly_gap 35114..35118 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 35748..38360 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193841.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene pepN CDS complement(38403..39170) product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090506.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene ssuB CDS complement(39167..39958) product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235203.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene ssuC CDS complement(39969..40523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 sequence009 source 1..38625 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 389..2407 product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121433.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene fadH CDS complement(2452..2868) product type II toxin-antitoxin system antitoxin HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560266.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene higA CDS complement(2865..3179) product type II toxin-antitoxin system toxin HigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550189.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene higB CDS complement(3463..4599) product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018695.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene rlmG CDS 4684..5187 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333820.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 5264..5956 product vancomycin high temperature exclusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942548.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 6035..7021 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617698.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 7304..8269 product TerC family membrane protein Alx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098806.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene alx CDS 8668..9912 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211655.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene sstT CDS complement(9917..10468) product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128135.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(10551..12038) product altronate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199390.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene uxaA CDS complement(12053..13465) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187442.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene uxaC CDS 13948..15246 product hexuronate transporter ExuT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226465.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene exuT CDS 15376..16152 product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406488.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene exuR CDS 16497..17159 product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422149.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene yqjA CDS 17163..17546 product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166760.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene mzrA CDS 17693..18061 product DUF1090 family protein YqjC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295543.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene yqjC CDS 18099..18404 product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031415.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 18407..18811 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785722.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 18801..19100 product YqjK-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096091.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 19196..19678 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603618.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 19748..20734 product glutathionyl-hydroquinone reductase YqjG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531213.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene yqjG CDS 21028..21393 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384145.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 21635..21991 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198807.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(22042..22938) product DNA-binding transcriptional regulator YhaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041009.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene yhaJ CDS 23043..23744 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633576.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 23767..23931 product protein YhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001345966.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene yhaL CDS complement(24065..25375) product cysteine desulfidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460499.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene cyuA CDS complement(25403..26734) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401598.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(27009..28373) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622126.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene tdcG CDS complement(28445..28834) product enamine/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719990.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(28848..31142) product 2-ketobutyrate formate-lyase/pyruvate formate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861734.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene tdcE CDS complement(31176..32384) product propionate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295545.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene tdcD CDS complement(32410..33741) product threonine/serine transporter TdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107723.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene tdcC CDS complement(33763..34752) product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548347.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene tdcB CDS complement(34851..35789) product transcriptional regulator TdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104211.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene tdcA CDS 36578..37117 product protein YhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675733.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene yhaB CDS 37139..38326 product YhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484600.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 sequence010 source 1..38356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 27..102 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 rRNA 144..254 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS complement(488..1246) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078349.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(1254..2357) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300681.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(2367..3566) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019655.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(3616..4533) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738579.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(5071..5292) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825639.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(5545..8424) product multidrug efflux RND transporter permease subunit AcrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273238.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene acrF CDS complement(8429..8647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 note possible pseudo, frameshifted CDS complement(8659..9816) product multidrug efflux RND transporter periplasmic adaptor subunit AcrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160334.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene acrE CDS 10215..10877 product multidrug efflux transporter transcriptional repressor AcrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129518.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene acrS CDS complement(11143..12027) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258895.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene yhdJ CDS complement(12113..12409) product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene fis CDS complement(12435..13307) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219652.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene dusB CDS complement(13729..14610) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145827.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene prmA CDS complement(14622..16073) product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175728.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene panF CDS complement(16063..16305) product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381173.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(16414..17763) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884639.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene accC CDS complement(17774..18244) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354622.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene accB CDS complement(18217..18405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(19222..20196) product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148481.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 20348..22288 product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241469.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene csrD CDS 22593..23636 product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913396.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene mreB CDS 23702..24805 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802511.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene mreC CDS 24805..25293 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179409.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene mreD CDS 25302..25895 product nucleoside triphosphate pyrophosphatase YhdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203105.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene yhdE CDS 25885..27354 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123197.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene rng CDS 27422..31222 product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253618.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene yhdP CDS 31652..33097 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055909.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene tldD assembly_gap 33163..33235 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(33297..33734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 note possible pseudo, frameshifted CDS complement(33674..34228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 note possible pseudo, frameshifted CDS 34411..34614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 34622..35554 product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854021.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene aaeA CDS 35560..37527 product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510962.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene aaeB CDS 37619..37927 product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029013.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(37983..38297) product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509740.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene yhcN sequence011 source 1..37257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..608 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000212470.1:transcriptional regulator EbgR locus_tag LOCUS_04850 CDS 792..3884 product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082856.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene ebgA CDS 3881..4330 product beta-galactosidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219954.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 4393..5826 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285432.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 5960..7030 product protein YgjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767652.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene ygjJ CDS 7047..9398 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695487.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene ygjK CDS complement(9523..9849) product DUF2502 domain-containing protein YpeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490072.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene ypeC CDS complement(9964..11220) product ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903148.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 11424..12389 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170346.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene glk CDS 12608..12934 product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038456.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 12956..14203 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985359.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 14218..15303 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173288.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene ypdF CDS 15303..16340 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366028.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene ypdE CDS 16365..18860 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955906.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene ptsP CDS complement(18863..19720) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646835.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(19733..20467) product two-component system response regulator YpdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295458.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene ypdB CDS complement(20482..22161) product two-component system sensor histidine kinase YpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544359.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene ypdA CDS 22555..23793 product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785931.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene alaC CDS complement(24285..25205) product kdo(2)-lipid IV(A) palmitoleoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484404.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene lpxP CDS 25558..25800 product YfdY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609275.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(25877..26152) product colanic acid biosynthesis lipoprotein YpdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867631.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene ypdI CDS 26448..27083 product YfdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825600.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 27668..28846 product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106759.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene frc CDS 28930..30594 product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283490.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene oxc CDS 30664..31608 product transporter YfdV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955028.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene yfdV CDS 31682..32827 product CoA:oxalate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296867.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene yfdE CDS complement(32883..36476) product acid-sensing system histidine kinase EvgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326970.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene evgS CDS complement(36481..37095) product acid-sensing system DNA-binding response regulator EvgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991370.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene evgA sequence012 source 1..37143 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(384..629) product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217754.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene dinI CDS complement(703..1623) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126534.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene pyrC CDS complement(1855..2415) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295443.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(2549..3196) product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780912.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene grxB CDS complement(3260..4468) product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092206.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene mdtH CDS 4704..5288 product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468186.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene rimJ CDS 5299..5946 product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877107.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 5948..6871 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736158.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 6981..8516 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050683.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene murJ CDS complement(8556..8972) product flagella biosynthesis chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197363.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene flgN CDS complement(8977..9270) product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020880.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene flgM CDS complement(9346..10005) product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905458.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene flgA CDS 10160..10576 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884702.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene flgB CDS 10580..10984 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196460.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene flgC CDS 10996..11691 product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020486.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene flgD CDS 11716..12924 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885873.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene flgE CDS 12944..13699 product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349316.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene flgF CDS 13871..14653 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625837.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene flgG CDS 14706..15404 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295442.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene flgH CDS 15416..16513 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589326.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene flgI CDS 16513..17454 product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295441.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene flgJ CDS 17520..19163 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096479.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene flgK CDS 19175..20128 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212782.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene flgL CDS complement(20324..23509) product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827360.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene rne CDS 24082..25041 product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846343.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene rluC CDS complement(25153..25776) product 7-methyl-GTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974786.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene yceF CDS 25936..26457 product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174481.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene yceD CDS 26509..26682 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290727.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene rpmF CDS 26763..27833 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197597.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene plsX CDS 27901..28854 product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288132.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene fabH CDS 28870..29799 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191372.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene fabD CDS 29812..30546 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008535.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene fabG CDS 30757..30993 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103754.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene acpP CDS 31081..32322 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044679.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene fabF CDS 32442..33251 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478681.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene pabC CDS 33254..34276 product cell division protein YceG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756827.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene yceG CDS 34266..34907 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257000.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene tmk CDS 34904..35908 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267956.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene holB CDS 35919..36716 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480245.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 sequence013 source 1..35421 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2456..3148) product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988364.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene fimC CDS complement(3368..3910) product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776555.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene fimA CDS 4381..5247 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729160.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene folD CDS 5249..5461 product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310620.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene ybcJ CDS 5569..6090 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143542.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(6126..7511) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912385.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene cysS CDS 7685..8179 product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255997.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene ppiB CDS 8182..8904 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212247.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene lpxH CDS 9022..9531 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295318.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene purE CDS 9528..10595 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815571.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene purK CDS complement(10790..11683) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855379.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(11680..12495) product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152519.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(12506..13765) product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495367.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(13775..15442) product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580829.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 15759..16808 product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703900.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene allD CDS 16830..18065 product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310618.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene allC CDS 18076..18861 product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540997.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene allE CDS complement(19089..20234) product glycerate 3-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333621.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene glxK CDS complement(20256..20822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 note possible pseudo, internal stop codon CDS complement(20838..21557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 note possible pseudo, internal stop codon CDS complement(21614..22975) product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006900.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene allB CDS complement(23035..24489) product putative allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401100.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(24658..25536) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765839.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene glxR CDS complement(25636..26412) product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943544.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene hyi CDS complement(26425..28206) product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096881.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene gcl CDS complement(28296..29066) product HTH-type transcriptional repressor AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141275.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene allR CDS complement(29189..29671) product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776377.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene allA CDS 29901..30827 product HTH-type transcriptional activator AllS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460145.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene allS CDS 30896..31990 product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157938.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene mnmH CDS 32106..32477 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903287.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(32992..33189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 note possible pseudo, frameshifted CDS complement(33222..33452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001320180.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(33463..34173) product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300714.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(34173..34541) product YbbC/YhhH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877768.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(34581..35162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 sequence014 source 1..35371 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(264..1661) product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784827.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene ccp CDS 2065..3714 product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934216.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(3765..4367) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167676.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 4905..5786 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357790.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 5835..6848 product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191237.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene yhjD CDS 7259..8581 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149003.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 assembly_gap 8613..8648 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8730..10790) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296794.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(10860..11495) product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295219.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene pdeH CDS 11859..12788 product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037562.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene kdgK CDS complement(12884..14380) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163141.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(14601..15887) product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858214.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene dctA CDS complement(16070..18019) product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266293.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene hmsP CDS complement(18140..21613) product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225124.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene bcsC CDS complement(21595..22701) product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311203.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene bcsZ CDS complement(22708..25047) product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001407405.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene bcsB CDS complement(25058..27676) product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025892.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene bcsA CDS complement(27673..28401) product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279528.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene bcsQ CDS complement(28437..28625) product cellulose biosynthesis protein BcsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063318.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene bcsR CDS 28910..30469 product cellulose biosynthesis c-di-GMP-binding protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204931.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene bcsE CDS 30466..30657 product cellulose biosynthesis protein BcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988308.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene bcsF CDS 30654..32333 product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191622.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene bcsG CDS complement(32420..32695) product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254108.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 33003..34274 product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295225.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(34304..35308) product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107012.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene dppF sequence015 source 1..35147 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(338..739) product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190062.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene nikR CDS complement(745..1551) product nickel import ATP-binding protein NikE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173631.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene nikE CDS complement(1548..2312) product nickel import ATP-binding protein NikD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136229.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene nikD CDS complement(2312..3145) product nickel ABC transporter permease subunit NikC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008963.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene nikC CDS complement(3142..4086) product nickel ABC transporter permease subunit NikB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947068.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene nikB CDS complement(4086..5660) product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953361.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene nikA CDS complement(5771..6358) product 4'-phosphopantetheinyl transferase AcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285774.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene acpT CDS complement(6413..7462) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300885.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 7561..8811 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240225.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(8815..9372) product phage sensitivity protein DcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245295.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene dcrB CDS complement(9445..10110) product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100469.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 10331..10576 product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130621.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene tusA CDS complement(10678..12876) product Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106551.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene zntA CDS complement(12950..13576) product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964718.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 13717..14076 product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042895.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(14079..14348) product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311191.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(14338..14934) product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743193.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene rsmD CDS 15084..16577 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040654.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene ftsY CDS 16580..17248 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617723.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene ftsE CDS 17241..18299 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042003.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene ftsX CDS 18544..19398 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130217.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene rpoH CDS 19669..20772 product branched chain amino acid ABC transporter substrate-binding protein LivJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021996.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene livJ CDS complement(20960..21343) product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778768.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene panM CDS 21713..22876 product high-affinity branched-chain amino acid ABC transporter substrate-binding protein LivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827696.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene livK CDS 22924..23850 product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295111.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene livH CDS 23847..25124 product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803813.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene livM CDS 25121..25888 product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082101.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene livG CDS 25890..26603 product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416891.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene livF CDS 27002..28318 product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803190.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene ugpB CDS 28416..29303 product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099289.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene ugpA CDS 29300..30145 product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572177.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene ugpE CDS 30147..31217 product sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907792.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene ugpC CDS 31214..31957 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073623.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene ugpQ CDS complement(31944..32384) product DUF2756 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825996.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 32504..34246 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595082.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene ggt CDS complement(34284..34568) product YrhB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634159.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(34768..34923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 sequence016 source 1..34763 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 472..562 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(613..1095) product RadC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001407480.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(1104..1562) product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211841.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(2460..3575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 3631..3879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 4445..4645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 note possible pseudo, internal stop codon, frameshifted CDS 4721..5314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 note possible pseudo, internal stop codon CDS 5327..5641 product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065803.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(5866..6333) product protein YfjT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702495.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene yfjT CDS complement(6357..6800) product lipoprotein YfjS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824222.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene yfjS CDS complement(6800..7036) product protein YpjK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144029.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene ypjK CDS complement(7077..7778) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189409.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(7995..8816) product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197391.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(8908..9771) product GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787597.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(10126..10497) product type II toxin-antitoxin system antitoxin RnlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461704.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene rnlB CDS complement(10490..11563) product type II toxin-antitoxin system toxin mRNA endoribonuclease RnlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155570.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene rnlA CDS 11705..11968 product DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502050.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 12328..13944 product anti-bacteriophage protein AbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445380.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene abpA CDS 13941..16130 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136402.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(16308..16934) product inovirus Gp2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220524.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 16907..17134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(17087..18496) product YfjI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481742.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(18625..18837) product DNA-binding transcriptional activator AlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065343.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene alpA CDS 18881..19837 product protein YfjH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510827.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene yfjH CDS complement(20081..21322) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101723.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 tmRNA complement(21526..21888) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(22103..22585) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162574.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene smpB CDS 22717..23193 product type II toxin-antitoxin system toxin RatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600189.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene ratA CDS 23183..23473 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117838.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(23535..23876) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203437.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene bamE CDS complement(24025..25686) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880910.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene recN CDS complement(25772..26650) product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059169.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene nadK CDS 26773..27366 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393454.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene grpE CDS complement(27421..28683) product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723175.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(28728..29423) product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001338897.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 29337..29573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 29686..31047 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460035.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene ffh CDS 31296..31544 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256450.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene rpsP CDS 31563..32111 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043335.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene rimM CDS 32142..32909 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264777.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene trmD CDS 32951..33298 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065253.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene rplS CDS complement(33374..33856) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589847.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 misc_feature complement(33872..>34763) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000969032.1:diguanylate cyclase DgcN locus_tag LOCUS_06880 sequence017 source 1..33633 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 382..999 product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647891.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(1026..1931) product cystine transporter YijE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271242.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene yijE CDS complement(2024..4204) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295695.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene katG CDS complement(4533..5423) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007523.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene metF CDS complement(5772..8204) product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110772.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene metL CDS complement(8207..9367) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295694.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene metB CDS 9644..9961 product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852812.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene metJ assembly_gap 10045..10083 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10148..10756 product YiiX family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797353.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(10817..11029) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710769.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene rpmE CDS 11232..13430 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301269.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene priA CDS 13586..14611 product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644904.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene cytR CDS 14808..15662 product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068828.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene ftsN CDS 15755..16285 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208242.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene hslV CDS 16295..17626 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293341.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene hslU CDS 17693..18619 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139496.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene menA CDS 18712..19197 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872908.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene rraA CDS complement(19282..19521) product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295521.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene zapB CDS 19952..20797 product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084268.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene glpF CDS 20799..22328 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136788.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene glpK CDS 22334..23473 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250644.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene glpX CDS 23570..24316 product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796332.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene fpr CDS complement(24321..24749) product universal stress protein UspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323556.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene uspD CDS complement(24776..25075) product DUF406 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655989.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(25287..25727) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155257.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 25828..26427 product YiiQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802216.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 26535..27302 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216325.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene tpiA CDS complement(27357..28112) product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326656.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene cdh CDS complement(28167..29156) product sulfate/thiosulfate ABC transporter substrate-binding protein Sbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045689.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene sbp CDS complement(29476..30438) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591795.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene pfkA CDS complement(30619..31521) product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076742.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene fieF CDS complement(31670..32170) product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223800.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene cpxP CDS 32320..33018 product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033722.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene cpxR sequence018 source 1..33569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(123..584) product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148581.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene pyrI CDS complement(597..1532) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013046.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene pyrB CDS complement(1951..2346) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230281.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(2477..3190) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500727.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene bdcA CDS 3261..3854 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256658.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 3999..4451 product toxin-antitoxin biofilm protein TabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583469.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene tabA CDS 4574..6388 product protein YjgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036434.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene yjgL CDS complement(6444..7448) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012931.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene argF CDS 7610..8026 product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002952.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene rraB CDS complement(8171..8674) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059402.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 8840..10063 product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079634.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(10119..10409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(10406..11656) product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050265.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene wzxE CDS complement(11658..12788) product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612043.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene rffA CDS complement(12793..13467) product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145183.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene rffC CDS complement(13445..13609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 note possible pseudo, internal stop codon CDS complement(13715..14326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 note possible pseudo, internal stop codon CDS complement(14345..15412) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226601.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene rffG CDS complement(15412..16674) product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006621.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene wecC CDS complement(16671..17801) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340422.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene wecB CDS complement(17857..18903) product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295256.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene wzzE CDS complement(18915..20018) product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050960.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene wecA CDS complement(20030..20248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127070.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(20258..21517) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054527.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene rho CDS complement(21844..22173) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305383.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene trxA CDS 22304..23569 product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047499.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene rhlB CDS 23705..25189 product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295254.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene gppA CDS complement(25236..27257) product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238899.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene rep CDS 27474..27692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 note possible pseudo, frameshifted CDS 28121..28402 product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140251.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene ppiC CDS complement(28489..29964) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024939.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene ilvC CDS 30114..31007 product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365791.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene ilvY CDS complement(31059..32603) product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785596.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene ilvA misc_feature complement(32606..>33569) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001127399.1:dihydroxy-acid dehydratase locus_tag LOCUS_07540 sequence019 source 1..33459 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 291..1634 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013789.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 1859..3514 product glucan biosynthesis protein OpgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375961.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene opgD CDS 3654..3878 product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296778.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 3941..4480 product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140873.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene rimL CDS complement(4472..5452) product YdcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234042.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene ydcK CDS 5576..6568 product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301046.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene tehA CDS 6565..7158 product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586732.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene tehB CDS 7460..8128 product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261013.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 8720..9868 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251043.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(9908..11083) product BenE family transporter YdcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236265.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene ydcO CDS 11175..11711 product DNA-binding transcriptional regulator SutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429155.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene sutR CDS 11784..13745 product 23S rRNA 5-hydroxycytidine C2501 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303492.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene rlhA CDS complement(13837..14007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 14490..14927 product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209405.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene hicB CDS 15006..16412 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760626.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 16657..17802 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047424.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 17832..18833 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220396.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 18834..19775 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251304.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 19765..20559 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555471.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 20581..22005 product aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163872.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene patD CDS 22317..22565 product GhoT/OrtT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732115.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 22651..22884 product DUF2526 family protein YdcY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018633.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene ydcY CDS complement(22885..23334) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076535.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(23331..23849) product L-methionine sulfoximine/L-methionine sulfone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310799.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene mddA CDS 24030..25067 product NADPH-dependent curcumin/dihydrocurcumin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531462.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene curA CDS 25265..25930 product colanic acid/biofilm transcriptional regulator McbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300742.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene mcbR CDS complement(25966..27984) product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689363.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene pqqU CDS 28310..29371 product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550695.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(29484..30983) product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300590.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene ansP CDS 31250..31867 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598857.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 sequence020 source 1..33000 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 52..1893 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107467.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene ftsH CDS 1983..2831 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311155.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene folP CDS 2824..4161 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071134.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene glmM CDS 4389..4721 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295556.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene secG tRNA 4736..4822 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 5389..6906 product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333576.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(6914..8257) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207680.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene argG tRNA 8605..8681 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 8918..9340 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296446.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene rimP CDS 9368..10855 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031057.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene nusA CDS 10880..13552 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133044.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene infB CDS 13716..14117 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040205.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene rbfA CDS 14117..15061 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089698.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene truB CDS 15210..15479 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059466.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene rpsO CDS 15726..17861 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295554.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene pnp CDS 17970..18854 product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802080.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene nlpI CDS 19034..20920 product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301504.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene deaD CDS 21074..22318 product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224351.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene mtr CDS complement(22436..23443) product luciferase-like monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130380.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(23524..24402) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301318.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(24411..25406) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311152.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 25615..26139 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295552.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 26133..26636 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908554.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(26623..26925) product DNA damage response exodeoxyribonuclease YhbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189333.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene yhbQ CDS 26976..27419 product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449030.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(27399..27917) product protein/nucleic acid deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037608.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene yhbO CDS 28045..28680 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300423.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 28753..29793 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147574.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(29907..30482) product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646033.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene dolP CDS complement(30492..31082) product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158034.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene diaA CDS complement(31102..31497) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246830.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 misc_feature complement(31455..>33000) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000249104.1:penicillin-binding protein activator LpoA locus_tag LOCUS_08140 sequence021 source 1..32626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1089 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000195274.1:DNA topoisomerase IV subunit B locus_tag LOCUS_08150 CDS complement(1137..1451) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958598.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(1482..2063) product NADPH:quinone oxidoreductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065430.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene mdaB CDS 2382..2714 product DUF2645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917684.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(2760..4109) product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673402.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene qseC CDS complement(4106..4765) product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221495.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene qseB CDS 4917..5309 product OB fold stress tolerance protein YgiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712658.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene ygiW CDS 5362..5844 product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183505.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 6049..6345 product type II toxin-antitoxin system toxin MqsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415584.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene mqsR CDS 6347..6742 product type II toxin-antitoxin system antitoxin MqsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650107.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene mqsA CDS 6875..8482 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295629.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 8620..10878 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281881.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene parC CDS 11112..11849 product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965722.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene plsC CDS 11924..13336 product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059388.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene ftsP CDS 13447..15666 product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095187.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(15709..15966) product lipoprotein YqhH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848528.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene yqhH CDS complement(16017..16943) product YbjP/YqhG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691619.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(17143..17970) product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013149.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene dkgA CDS complement(18075..19238) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058802.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene yqhD CDS 19432..20331 product DNA-binding transcriptional regulator YqhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350547.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene yqhC CDS complement(20371..21030) product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268419.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene yghB CDS complement(21170..22357) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301079.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene metC CDS 22609..23343 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527844.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene exbB CDS 23350..23775 product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240712.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene exbD CDS complement(23935..24819) product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018760.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene yghA CDS 25010..25504 product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439331.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(25544..26584) product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262172.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene gpr CDS 26741..26884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08420 note possible pseudo, frameshifted CDS 26862..27215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 note possible pseudo, frameshifted CDS 27215..27625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 note possible pseudo, frameshifted CDS 27744..28031 product DUF2623 family protein YghW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059136.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene yghW CDS 28220..29338 product hydrogenase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145410.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene hybO CDS 29341..30327 product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081870.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene hybA CDS 30317..31495 product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017703.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene hybB assembly_gap 31629..31705 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence022 source 1..32607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(422..2050) product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857257.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene glpA CDS 2323..3681 product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948731.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene glpT CDS 3686..4762 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779105.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene glpQ CDS complement(4804..5010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009396.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 5225..5875 product lipopolysaccharide kinase InaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301050.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene inaA CDS complement(5929..6183) product ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135040.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene yfaE CDS complement(6183..7352) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299501.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene nrdB assembly_gap 7403..7436 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7476..9761) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075164.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene nrdA CDS 10745..14209 product AIDA-I family autotransporter adhesin YfaL/EhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220077.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene yfaL CDS complement(14337..15059) product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990765.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 15206..17833 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281242.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene gyrA CDS 17982..19670 product DUF2138 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012305.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 19667..20290 product DUF1175 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295211.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 20434..24327 product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001442934.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 note possible pseudo, internal stop codon CDS 24343..24828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 note possible pseudo, internal stop codon CDS 24829..26478 product YfaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104549.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 26483..27259 product YfaP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225852.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(27333..28517) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786547.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene atoB CDS complement(28548..29870) product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580275.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(29867..30517) product acetate CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339065.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene atoA CDS complement(30517..31179) product acetate CoA-transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850540.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene atoD misc_feature complement(31375..>32607) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000125282.1:acetoacetate metabolism transcriptional regulator AtoC locus_tag LOCUS_08700 sequence023 source 1..32327 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 325..615 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768384.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 675..1595 product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001407592.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 1643..1969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 note possible pseudo, frameshifted CDS 2293..3681 product nitrate/nitrite transporter NarU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207901.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene narU CDS 3763..7506 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032939.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 7503..9041 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702650.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene narH CDS 9038..9748 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571681.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene narJ CDS 9748..10425 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160108.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene narI tRNA complement(11143..11227) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 assembly_gap 11456..11544 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11723..12565) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555857.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene purU CDS complement(12615..13073) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307143.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 13147..14091 product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190792.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene rssA CDS 14183..15196 product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193447.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene rssB CDS 15398..16306 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718995.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene galU CDS complement(16450..16863) product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287378.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene hns CDS 17468..18085 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068077.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene tdk CDS complement(18367..18957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 note possible pseudo, frameshifted CDS complement(18909..19139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 note possible pseudo, frameshifted CDS complement(19078..19263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 note possible pseudo, frameshifted CDS complement(19387..22062) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301653.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene adhE CDS 22539..23186 product NAAT family transporter YchE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616554.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene ychE CDS complement(23344..23640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211509.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 23924..25555 product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295623.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene oppA CDS 25641..26561 product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911112.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene oppB CDS 26576..27484 product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979661.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene oppC CDS 27496..28509 product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110948.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene oppD CDS 28506..29510 product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994905.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene oppF CDS complement(29563..29892) product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366959.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(29927..31387) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214516.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene cls CDS complement(31758..32294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 sequence024 source 1..32152 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 312..971 product YjfK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012550.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 989..1387 product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547760.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 1397..2035 product DUF1190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101658.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 2038..3201 product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943959.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 3285..4910 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350567.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(5027..5302) product DUF1471 family protease activator YjfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811566.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene yjfN CDS complement(5451..5720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 5962..6711 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569707.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene yjfP CDS complement(6708..7463) product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133631.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene ulaR CDS complement(7571..8641) product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295191.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene ulaG CDS 8990..10387 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350568.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene ulaA CDS 10403..10708 product PTS ascorbate transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218362.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene ulaB CDS 10718..11182 product PTS ascorbate transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776517.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene ulaC CDS 11196..11846 product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056749.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene ulaD CDS 11856..12710 product L-ribulose-5-phosphate 3-epimerase UlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949502.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene ulaE CDS 12710..13396 product L-ribulose-5-phosphate 4-epimerase UlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170847.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene ulaF CDS complement(13526..13801) product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324306.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 14128..14523 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216676.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene rpsF CDS 14530..14844 product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315977.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene priB CDS 14849..15076 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene rpsR CDS 15118..15567 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196062.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene rplI CDS complement(15638..16432) product DUF2686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174714.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 16779..17105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(17089..17727) product cell division protein YtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119478.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene ytfB CDS 17945..18565 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311330.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene fklB CDS 18874..20286 product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228371.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene cycA CDS complement(20331..20993) product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331456.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene ytfE CDS complement(21101..22066) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350569.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(22174..23034) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560561.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene qorB CDS 23033..23503 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307543.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(23632..25575) product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589431.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene cpdB CDS 25765..26505 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886919.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene cysQ CDS 26717..27655 product protein YtfI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937655.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene ytfI CDS complement(27718..28272) product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175279.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 28597..28803 product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689228.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(28882..30225) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935036.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(30548..31186) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295196.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene msrA CDS 31243..31422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 sequence025 source 1..31778 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 349..497 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 939..1655 product N-acetylneuraminic acid outer membrane channel NanC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295734.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene nanC CDS 1675..2781 product N-acetylneuraminate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309184.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene nanM CDS 2819..3826 product 9-O-acetyl-N-acetylneuraminic acid deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991438.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(4409..5425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 note possible pseudo, frameshifted CDS complement(5392..5601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 note possible pseudo, frameshifted CDS 6387..6644 product YjhX family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054376.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 6656..7201 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309181.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 7257..8003 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354251.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 8789..9910 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010829.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 9907..10185 product PTS sugar transporter subunit IIB SgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722973.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene sgcB CDS 10197..11510 product PTS sugar transporter subunit IIC SgcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460843.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene sgcC CDS 11523..12329 product BtpA family protein SgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118626.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene sgcQ CDS 12460..12891 product SgcA family PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606406.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene sgcA CDS 12903..13535 product ribulose-phosphate 3 epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600622.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 13552..14334 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082780.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 14637..15425 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251798.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 15430..16335 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714563.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 16346..18313 product xylonate dehydratase YjhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116326.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene yjhG CDS 18420..19769 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128363.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 20224..21102 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373366.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(21216..21425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 note possible pseudo, internal stop codon CDS complement(21426..21611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(21638..21862) product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303900.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 22205..22726 product RNA polymerase sigma factor FecI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283626.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene fecI CDS 22723..23676 product fec operon regulator FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068910.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene fecR CDS 23763..26087 product Fe(3+) dicitrate transport protein FecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188283.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene fecA CDS 26132..27034 product Fe(3+) dicitrate ABC transporter substrate-binding protein FecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879155.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene fecB CDS 27031..28029 product iron-dicitrate ABC transporter permease FecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125187.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene fecC CDS 28026..28982 product Fe(3+) dicitrate ABC transporter permease subunit FecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684852.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene fecD CDS 28983..29750 product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175457.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene fecE CDS complement(30307..30564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(30647..30889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 note possible pseudo, frameshifted CDS complement(30886..31323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 note possible pseudo, frameshifted sequence026 source 1..31718 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 494..1564 product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197881.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene dadX CDS complement(1950..3686) product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340194.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(3781..4695) product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051560.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene ldcA CDS 4668..4856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 4795..5406 product membrane-bound lytic murein transglycosylase EmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301104.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene emtA CDS complement(5408..6142) product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020169.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 6343..6597 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310727.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 6775..7215 product protein YcgY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615067.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene ycgY CDS complement(7294..8991) product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841714.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene treA CDS complement(9311..10729) product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301101.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene dhaM CDS complement(10740..11372) product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059411.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene dhaL CDS complement(11383..12453) product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733715.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene dhaK CDS 12759..14600 product dihydroxyacetone kinase operon transcriptional regulator DhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350505.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene dhaR CDS complement(14700..17567) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001334788.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(18336..19427) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505866.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene ychF CDS complement(19544..20128) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152933.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene pth CDS 20406..20684 product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823885.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene ychH CDS complement(20739..22418) product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033352.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene dauA CDS complement(22543..23556) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119392.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene prs CDS complement(23641..24492) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260332.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene ispE CDS complement(24492..25115) product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130692.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene lolB CDS 25329..26585 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299679.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene hemA CDS 26627..27709 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804726.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene prfA CDS 27709..28542 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456467.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene prmC CDS 28539..28931 product invasion regulator SirB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200374.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene sirB2 CDS 28935..29744 product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257044.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene sirB1 CDS 29780..30634 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811065.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene kdsA CDS complement(30783..30917) product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517635.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(31318..31452) product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517635.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 sequence027 source 1..31710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(88..1272) product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982994.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene csiE CDS complement(1559..2413) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297705.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(2558..3361) product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553451.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene suhB CDS 3480..4220 product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940019.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene trmJ assembly_gap 4319..4364 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4647..5135 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241357.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene iscR CDS 5247..6461 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295373.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene iscS CDS 6489..6716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 note possible pseudo, internal stop codon CDS 6717..6875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 note possible pseudo, internal stop codon CDS 6892..7215 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028953.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene iscA CDS 7311..7826 product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384413.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene hscB CDS 7843..9693 product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196613.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene hscA CDS 9695..10030 product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124469.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene fdx CDS 10042..10242 product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523616.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene iscX CDS 10420..11703 product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133592.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene pepB CDS 11845..12621 product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295479.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene sseB CDS complement(13439..14284) product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108626.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene sseA CDS 14491..19452 product alpha2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736312.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene yfhM CDS 19588..21765 product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137675.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene pbpC CDS 21914..22345 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963837.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene ndk CDS 22495..23649 product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003317.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 23934..24947 product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090866.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene rodZ CDS 24974..26092 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551807.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene ispG CDS 26203..27477 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107167.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene hisS CDS 27495..28115 product ancillary SecYEG translocon subunit YfgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409205.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene yfgM CDS 28126..29304 product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177052.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene bamB CDS 29422..30894 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249410.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene der CDS 30964..31179 product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301158.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 misc_feature complement(31176..>31710) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000937912.1:exodeoxyribonuclease VII large subunit locus_tag LOCUS_10270 sequence028 source 1..30077 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(226..2160) product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484984.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene rnb CDS complement(2228..3355) product CMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335988.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(3499..4287) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506490.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene fabI CDS complement(4655..4882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 4811..4975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(5076..5882) product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573407.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene sapF CDS complement(5884..6876) product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128858.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene sapD CDS complement(6876..7766) product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146163.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene sapC CDS complement(7753..8718) product putrescine ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583277.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene sapB CDS complement(8715..10316) product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250216.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene sapA CDS complement(10671..10916) product YmjA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015110.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(11050..12435) product putrescine/proton symporter PuuP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996856.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene puuP CDS complement(12738..14156) product glutamate-putrescine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296746.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene puuA CDS 14380..15132 product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300506.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene puuD CDS 15159..15716 product HTH-type transcriptional regulator PuuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278727.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene puuR CDS 15991..17478 product aldehyde dehydrogenase PuuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009090.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene puuC CDS 17480..18760 product gamma-glutamylputrescine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134870.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene puuB CDS 18798..20063 product 4-aminobutyrate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069229.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene puuE CDS complement(20183..21160) product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301108.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene pspF CDS 21327..21995 product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511025.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene pspA CDS 22049..22273 product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274963.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene pspB CDS 22273..22632 product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907387.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene pspC CDS 22641..22862 product phage shock protein PspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295585.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene pspD CDS 22937..23251 product thiosulfate sulfurtransferase PspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473109.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene pspE CDS 23464..25143 product glucosylglycerate phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810499.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene ycjM CDS 25157..26449 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597466.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 26470..27351 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080790.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 27338..28180 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224659.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 28211..29263 product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737347.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 sequence029 source 1..28451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1095 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000081983.1:succinylornithine/acetylornithine transaminase locus_tag LOCUS_10570 CDS 1092..2168 product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989419.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene astA assembly_gap 2061..2070 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2152..3630 product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177206.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene astD CDS 3627..4970 product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994973.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene astB CDS 4963..5931 product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368506.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene astE CDS 6261..6746 product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228984.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene spy CDS 6949..7524 product environmental stress-induced protein Ves inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300480.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene ves CDS complement(7484..8371) product excinuclease Cho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252397.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene cho CDS complement(8601..9428) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175026.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene nadE CDS 9630..9968 product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039044.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene osmE CDS 10267..10587 product PTS N,N'-diacetylchitobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412169.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene chbB CDS 10672..12030 product PTS N,N'-diacetylchitobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073041.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene chbC CDS 12081..12431 product PTS N,N'-diacetylchitobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968919.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene chbA CDS 12442..13281 product transcriptional regulator ChbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983647.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene chbR CDS 13386..14738 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078765.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene celF CDS 14751..15500 product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440471.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene chbG CDS complement(15791..18052) product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077872.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene katE CDS 18343..18498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 18787..19590 product protein YdjO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310874.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene ydjO CDS complement(19594..20985) product cystine/sulfocysteine:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010696.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene tcyP CDS complement(21118..21708) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297653.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(21871..22539) product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106833.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene hxpB CDS 22686..23222 product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222163.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(23263..24123) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267650.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(24229..24519) product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146159.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene ghoS CDS complement(24620..25549) product 6-phosphofructokinase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251727.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene pfkB CDS 25884..26594 product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771391.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(26926..27732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 sequence030 source 1..27860 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1006..1833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 note possible pseudo, frameshifted assembly_gap 1247..1253 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1844..2911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 note possible pseudo, frameshifted CDS 3784..4938 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062128.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene metK CDS 5362..6756 product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112301.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene galP CDS 6875..7330 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300769.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 7425..8132 product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286500.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene endA CDS 8212..8943 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222509.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene rsmE CDS 8956..9906 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593273.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene gshB CDS 10015..10578 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053178.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 10578..10994 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017106.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene ruvX CDS complement(11178..12059) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326494.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 12176..12880 product pyridoxal phosphate homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997795.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene yggS CDS 12898..13464 product osmotic shock tolerance protein YggT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094831.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene yggT CDS 13461..13751 product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994920.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene yggU CDS 13759..14352 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174777.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene rdgB CDS 14345..15481 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239943.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene hemW CDS complement(15612..17093) product dipeptide permease DtpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032689.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene dtpD CDS 17364..18107 product radiation resistance protein YbgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798871.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene ybgI CDS 18130..18786 product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188343.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene pxpB CDS 18780..19712 product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912724.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene pxpC CDS 19702..20436 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687112.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene pxpA CDS 20472..21263 product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113989.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene nei CDS complement(21260..22306) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336221.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(22458..23519) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272410.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(23516..24244) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142799.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(24259..26715) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350492.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(26766..27332) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472412.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 sequence031 source 1..27632 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 270..2867 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307570.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene acnB CDS 3043..3405 product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384306.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene yacL CDS complement(3443..4237) product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734287.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene speD CDS complement(4253..5119) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818411.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene speE CDS complement(5225..5572) product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295568.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 5738..7288 product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189647.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene cueO CDS complement(7490..9880) product quinoprotein glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306211.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene gcd CDS 10086..10622 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683335.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene hpt CDS complement(10663..11325) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651599.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene can CDS 11434..12360 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150637.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 12357..13127 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972203.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 13232..13672 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901987.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 13736..14965 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277917.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(14969..15349) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621515.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene panD CDS 15623..16525 product recombination-promoting nuclease RpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339954.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene rpnC CDS complement(16599..17450) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905383.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene panC CDS complement(17462..18256) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805497.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene panB CDS complement(18370..19608) product fimbrial tip-adhesin YadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848455.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene yadC CDS complement(19658..20254) product fimbrial-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553749.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(20281..20886) product fimbrial-like protein YadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310526.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene yadL CDS complement(20898..21431) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598300.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(21484..24081) product Yad fimbria usher protein HtrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151605.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene htrE CDS complement(24116..24856) product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465928.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(24954..25538) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038438.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(25908..26387) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215139.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene folK CDS complement(26384..27232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 note possible pseudo, internal stop codon sequence032 source 1..27559 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(153..965) product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769303.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene ydgH note possible pseudo, internal stop codon CDS 1489..3021 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300486.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene pntA CDS 3032..4420 product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014036.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene pntB CDS complement(4445..5479) product AI-2 transporter TqsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118241.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene tqsA CDS 5891..6256 product multidrug/spermidine efflux SMR transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276149.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene mdtJ CDS 6243..6572 product multidrug/spermidine efflux SMR transporter subunit MdtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046661.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene mdtI CDS complement(6611..7432) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260865.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(7708..8043) product acid resistance repetitive basic protein Asr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743951.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene asr CDS complement(8440..9693) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091840.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 9800..10693 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019525.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 10828..12048 product DNA-binding transcriptional repressor Mlc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225262.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene mlc CDS 12173..12868 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919231.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene bioD CDS complement(12821..14077) product voltage-gated ClC-type chloride channel ClcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350514.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene clcB CDS complement(14272..14886) product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148710.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene dmsD CDS complement(14929..15783) product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526503.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(15785..16402) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213028.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene dmsB CDS complement(16413..18839) product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340362.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(18897..21323) product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041675.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(21522..21827) product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300836.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 21899..22645 product YnfC family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571976.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(22648..23208) product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138581.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene speG CDS complement(23243..23584) product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705211.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 23719..24045 product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598292.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 24082..24270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 24251..25465 product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295394.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene rspA CDS 25477..26496 product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836066.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 misc_feature complement(26684..>27559) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000877001.1:site-specific integrase locus_tag LOCUS_11640 sequence033 source 1..26878 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(329..1840) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493470.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(1863..2846) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142427.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(2943..6224) product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333903.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 6336..7535 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200769.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 assembly_gap 7649..7737 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7787..9040) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919159.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene glyA CDS 9368..10558 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883122.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene hmpA CDS complement(10603..10941) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914032.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene glnB CDS complement(11002..12336) product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295369.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene glrR CDS complement(12326..12973) product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215861.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene qseG CDS 12973..13137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(13204..14586) product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311037.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene qseE CDS complement(15189..17981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 note possible pseudo, internal stop codon CDS complement(18129..19076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 note possible pseudo, internal stop codon CDS 19334..20890 product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734212.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene mltF CDS complement(20887..21390) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297409.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene tadA CDS complement(21448..22083) product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190655.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene yfhb CDS 22220..23140 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455839.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 23271..23456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(24151..24531) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986023.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene acpS CDS complement(24531..25262) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297412.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene pdxJ CDS complement(25274..26002) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399404.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene recO misc_feature complement(26014..>26878) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000020749.1:GTPase Era locus_tag LOCUS_11860 sequence034 source 1..26346 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 142..399 product DUF2534 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605090.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(449..1399) product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262123.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene uspE CDS complement(1551..2303) product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611911.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene fnr CDS complement(2498..3013) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945011.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene ogt CDS complement(3024..4430) product p-aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062973.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene abgT CDS complement(4587..6032) product p-aminobenzoyl-glutamate hydrolase subunit AbgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156451.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene abgB CDS complement(6032..7342) product p-aminobenzoyl-glutamate hydrolase subunit AbgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444929.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene abgA CDS 7518..8426 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885458.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 8756..9319 product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046829.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene smrA CDS complement(9340..10572) product diguanylate cyclase DgcM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628058.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene dgcM CDS 10827..11810 product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387388.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene zntB CDS 12288..13661 product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123737.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene dbpA CDS complement(13790..14725) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157406.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene ttcA CDS complement(14777..15541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(16014..16229) product excisionase XisR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079604.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene xisR CDS complement(16308..16517) product double-strand break reduction protein RcbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276809.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene rcbA CDS complement(16510..16743) product type I toxin-antitoxin system endodeoxyribonuclease toxin RalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317028.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene ralR CDS complement(16761..17570) product recombination protein RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166319.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene recT CDS complement(17563..20163) product exodeoxyribonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105143.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene recE CDS complement(20265..20540) product protein RacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632297.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(20615..20791) product YdaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001352098.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(20785..21006) product killing protein KilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560225.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene kilR CDS 21325..21936 product superinfection exclusion B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001312793.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(21933..22088) product YdaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169151.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(22099..22233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(22542..23018) product DNA-binding transcriptional repressor RacR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948459.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene racR CDS 23142..23438 product toxin YdaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712069.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene ydaS CDS 23461..23883 product toxin YdaT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000693797.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 23896..24753 product YdaU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899748.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 24760..25506 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788970.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 25529..26089 product DUF1627 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450663.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 sequence035 source 1..26274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(584..1636) product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041964.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene rsgA CDS 1731..2276 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295188.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene orn tRNA 2487..2562 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 2599..2674 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 2710..2785 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(3055..4194) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294219.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene queG CDS 4208..5740 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295189.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene nnr CDS 5712..6173 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981977.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene tsaE CDS 6192..7529 product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990333.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene amiB CDS 7539..8294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 8307..8618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 9015..10088 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810253.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 10153..13662 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115094.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene mfd CDS 13809..14768 product L,D-transpeptidase LdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300895.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene ldtC CDS complement(14850..15107) product multiple stress resistance protein BhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800153.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene bhsA CDS 15348..15980 product TetR family copper-responsive transcriptional repressor ComR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336528.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene comR CDS complement(16042..16581) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043459.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(16791..18095) product NADH-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211045.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene ndh CDS complement(18495..19037) product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587933.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene ycfP CDS complement(19060..20085) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529320.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene nagZ CDS complement(20096..20920) product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116592.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene thiK CDS complement(20901..21545) product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164439.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene lpoB CDS complement(21556..21909) product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225295.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(21936..22295) product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807125.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene hinT CDS 22629..24818 product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953441.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene fhuE misc_feature complement(24878..>26274) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000475719.1:PTS glucose transporter subunit IIBC locus_tag LOCUS_12400 sequence036 source 1..26055 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 797..2419 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265681.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene pckA CDS complement(2495..3838) product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253696.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene envZ CDS complement(3844..4563) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene ompR CDS 4791..5267 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856737.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene greB CDS 5364..7685 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980727.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 8142..8369 product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200455.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene feoA CDS 8386..10707 product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737039.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene feoB CDS 10707..10943 product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157586.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene feoC CDS 11146..12024 product recombination-promoting nuclease RpnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039062.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene rpnA CDS complement(12053..12823) product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060070.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene bioH CDS 12897..13544 product DNA utilization protein GntX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333371.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene gntX CDS 13603..14178 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619389.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene nfuA CDS 14538..15854 product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131758.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene gntT CDS complement(15965..18049) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444342.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene malQ CDS complement(18059..20452) product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081909.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene malP CDS 21064..23769 product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906961.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene malT CDS complement(23812..24828) product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335950.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene rtcA misc_feature complement(24832..>26055) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001105504.1:RNA-splicing ligase RtcB locus_tag LOCUS_12580 sequence037 source 1..25441 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2345 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000286312.1:fimbrial biogenesis usher protein locus_tag LOCUS_12590 CDS 2336..3406 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165668.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 3508..3960 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730630.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 3968..4483 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919497.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 4506..5186 product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307699.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 5297..6307 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295352.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene pyrD CDS 6481..7023 product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295353.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene zapC CDS complement(7020..8129) product 6-N-hydroxylaminopurine resistance protein YcbX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212426.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene ycbX CDS 8373..10481 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086539.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene rlmKL CDS 10493..12400 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053099.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 12530..13783 product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333176.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene pqiA CDS 13788..15428 product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445533.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene pqiB CDS 15425..15988 product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759120.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene pqiC CDS 16244..16411 product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828648.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene rmf CDS complement(16481..17107) product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018747.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene fabA CDS complement(17068..18828) product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156518.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 19014..19466 product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877161.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene matP CDS complement(19542..20582) product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750416.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene ompA CDS 20737..20955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(20939..21454) product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288710.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene sulA CDS 21667..22296 product CRP-S regulon transcriptional coactivator Sxy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839153.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene sxy CDS complement(22259..24421) product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875023.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene yccS CDS complement(24431..24877) product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261236.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 sequence038 source 1..25388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 181..1611 product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333507.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(1652..2395) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311257.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 2430..2648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 2948..5734 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250006.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene polA CDS complement(6115..6747) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183349.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene yihA CDS 7329..7838 product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295266.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene yihI CDS 8027..9400 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116090.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene hemN CDS complement(9851..11269) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188777.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene glnG CDS complement(11272..12321) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190577.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene glnL CDS complement(12607..14016) product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271717.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene glnA CDS 14389..16212 product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570668.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene typA CDS 16429..17139 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829798.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 17252..18127 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256396.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 18229..19494 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956313.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(19585..20277) product porin OmpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723465.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene ompL CDS complement(20345..21748) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295267.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(21791..23176) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018380.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(23222..25258) product sulfoquinovosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380843.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene yihQ sequence039 source 1..25267 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(272..2341) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291772.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene glyS CDS complement(2351..3262) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168544.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene glyQ CDS complement(3357..3656) product YsaB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980107.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 3831..4826 product O-acetyltransferase WecH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182650.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene wecH CDS complement(4868..5305) product inner membrane protein YiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296808.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene yiaA CDS complement(5351..5692) product inner membrane protein YiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295228.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene yiaB CDS complement(5861..7315) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275334.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene xylB CDS complement(7387..8709) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149591.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene xylA CDS 9075..10067 product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694881.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene xylF CDS 10145..11686 product D-xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146473.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene xylG CDS 11664..12845 product xylose ABC transporter permease XylH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045978.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene xylH CDS 12923..13765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 note possible pseudo, frameshifted CDS 13789..14097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 note possible pseudo, frameshifted CDS complement(14293..14865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 15437..17467 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761225.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene malS CDS 17645..18898 product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144363.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene avtA CDS complement(19049..19522) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300918.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(19624..20472) product IclR family transcriptional regulator YiaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514240.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene yiaJ CDS 20673..21671 product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869037.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene yiaK CDS 21683..22150 product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576079.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 22268..22741 product 2,3-diketo-L-gulonate TRAP transporter small permease YiaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721664.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene yiaM assembly_gap 23286..23484 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 23679..24182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 24195..25181 product 2,3-diketo-L-gulonate transporter substrate-binding protein YiaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776887.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene yiaO sequence040 source 1..25229 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..788 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001295313.1:isochorismate synthase EntC locus_tag LOCUS_13230 CDS 798..2408 product (2,3-dihydroxybenzoyl)adenylate synthase EntE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026812.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene entE CDS 2422..3279 product enterobactin biosynthesis bifunctional isochorismatase/aryl carrier protein EntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007138.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene entB CDS 3279..4025 product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase EntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347651.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene entA CDS 4028..4441 product proofreading thioesterase EntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637953.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene entH CDS 4622..6727 product pyruvate/proton symporter CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043156.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene cstA assembly_gap 6859..6883 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6934..7131 product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460431.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(7141..8229) product hydroxycarboxylate dehydrogenase HcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120441.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene hcxA CDS 8338..9498 product methionine-oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183907.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene ybdL CDS complement(9499..10128) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502945.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(10101..11321) product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029814.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(11468..12370) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002474.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(12579..13325) product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913829.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene dsbG CDS 13697..14260 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052796.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene ahpC CDS 14505..16070 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887629.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene ahpF CDS complement(16191..16619) product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278509.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene uspG CDS 16840..18078 product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646173.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(18309..18719) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089731.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene rnk CDS complement(18949..19755) product ribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643397.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene rna CDS complement(19869..21332) product citrate/succinate antiporter CitT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050323.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene citT CDS complement(21383..22261) product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062457.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene citG CDS complement(22236..22787) product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550422.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene citX CDS complement(22791..23228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 note possible pseudo, frameshifted CDS complement(23216..24292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 note possible pseudo, frameshifted CDS complement(24303..25211) product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622357.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene citE sequence041 source 1..24520 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2284 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000900941.1:YdbH family protein locus_tag LOCUS_13480 CDS 2281..2466 product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698145.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 2531..2800 product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300734.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(2972..3877) product transcriptional regulator FeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067514.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene feaR CDS 4113..5612 product phenylacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138615.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene feaB CDS complement(5670..7943) product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535469.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene tynA CDS complement(8191..10236) product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186469.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene paaZ CDS 10521..11450 product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191077.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene paaA CDS 11462..11749 product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073393.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene paaB CDS 11758..12504 product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072837.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene paaC CDS 12519..13016 product phenylacetate degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189201.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene paaD CDS 13024..14094 product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206388.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene paaK CDS 14091..14858 product 2,3-dehydroadipyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292353.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 14858..15646 product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969784.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene paaG CDS 15693..17075 product 3-hydroxyacyl-CoA dehydrogenase PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973360.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene paaC CDS 17065..17487 product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018413.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene paaI CDS 17487..18692 product bifunctional 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206197.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene paaJ CDS 18719..20032 product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632280.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene paaF CDS 20133..21083 product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039887.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene paaX CDS 21065..21655 product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123464.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene paaY sequence042 source 1..23843 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 788..1144 product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258236.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 1148..2275 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277801.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene dapE CDS 2303..2503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(2613..3311) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679799.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene ypfH CDS complement(3385..5373) product tRNA cytosine(34) acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829360.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene tmcA CDS complement(5388..5735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 note possible pseudo, frameshifted CDS complement(5720..6265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 note possible pseudo, frameshifted assembly_gap 5793..5832 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6433..7146) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295467.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene purC CDS complement(7359..8393) product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297320.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene bamC CDS complement(8410..9288) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311023.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene dapA CDS 9434..10006 product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176187.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 10006..10476 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068682.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene bcp CDS 10729..11346 product hydrogenase 4 subunit HyfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336048.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene hyfA CDS 11346..13364 product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339455.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene hyfB CDS 13375..14322 product hydrogenase 4 subunit HyfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311024.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene hyfC CDS 14339..15778 product hydrogenase 4 subunit HyfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429104.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene hyfD CDS 15790..16440 product hydrogenase 4 membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147991.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene hyfE CDS 16445..18025 product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122577.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene hyfF CDS 18015..19682 product hydrogenase 4 catalytic subunit HyfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102321.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene hyfG CDS 19692..20111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 note possible pseudo, frameshifted assembly_gap 20095..20103 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 20629..20827 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 20843..21106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 21099..21512 product hydrogenase 4 assembly chaperone HyfJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326580.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene hyfJ CDS 21542..23542 product DNA-binding transcriptional regulator HyfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251544.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene hyfR assembly_gap 21547..21596 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence043 source 1..23375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(835..1383) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621065.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(1683..2012) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276008.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene zapA CDS 2180..2758 product UPF0149 family protein YgfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295378.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene ygfB CDS 2784..4109 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290136.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene pepP CDS 4106..5284 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111195.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene ubiH CDS 5307..6509 product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192229.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene ubiI CDS 6957..8051 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068701.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene gcvT CDS 8075..8464 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295377.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene gcvH CDS 8583..11456 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195062.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene gcvP assembly_gap 11554..11633 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11882..12544 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951964.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(12601..14034) product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295376.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene bglA CDS 14079..14390 product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182957.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene yqfB CDS 14554..15213 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250274.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(15409..16389) product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886062.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene ygfZ CDS 16632..16898 product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354046.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene sdhE CDS 16879..17286 product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244777.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(17326..17847) product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055874.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene fldB CDS 17959..18855 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806638.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene xerD CDS 18880..19590 product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715214.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene dsbC CDS 19596..21329 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813200.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene recJ CDS 21637..22518 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723217.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene prfB note possible pseudo, frameshifted sequence044 source 1..22848 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(277..1299) product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172465.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene lsrB CDS complement(1311..2303) product autoinducer 2 ABC transporter permease LsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222721.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene lsrD CDS complement(2303..3331) product autoinducer 2 ABC transporter permease LsrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911184.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene lsrC CDS complement(3325..4860) product autoinducer 2 ABC transporter ATP-binding protein LsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194860.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene lsrA CDS 5109..6062 product transcriptional regulator LsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154342.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene lsrR CDS 6141..7733 product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113108.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene lsrK CDS 8402..12241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 note possible pseudo, frameshifted CDS 12285..13685 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083595.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 13890..14174 product type II toxin-antitoxin system antitoxin HipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301023.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene hipB CDS 14174..15496 product type II toxin-antitoxin system serine/threonine protein kinase toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125439.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene hipA CDS 15814..15993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 16349..17071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 17084..17587 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825452.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 17646..18560 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520676.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 18894..21173 product acid resistance putative oxidoreductase YdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726691.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene ydeP CDS 21421..21618 product two-component system connector SafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543384.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene safA CDS 21693..22454 product acid stress response transcriptional regulator YdeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060495.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene ydeO sequence045 source 1..22615 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(26..844) product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257409.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene glsB CDS complement(908..2296) product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156615.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene sad CDS 2397..3278 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366501.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 3356..4471 product putative protein YneK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258599.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene yneK CDS 4621..5811 product L-arabinose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210785.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene ydeA CDS complement(5836..6501) product NAAT family transporter MarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885033.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene marC CDS 6713..7147 product multiple antibiotic resistance transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843414.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene marR CDS 7167..7550 product MDR efflux pump AcrAB transcriptional activator MarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091199.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene marA CDS 7582..7800 product multiple antibiotic resistance protein MarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803657.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene marB CDS complement(7831..8730) product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087187.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene eamA CDS 9012..10112 product efflux MFS transporter YdeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054204.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene ydeE CDS complement(10553..11443) product diguanylate cyclase DgcZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592814.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene dgcZ CDS complement(11698..12090) product YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671737.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene ydeI CDS 12366..12884 product 2-oxo-tetronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024746.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(12928..14973) product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210373.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene dcp CDS 15110..15856 product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636571.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene ydfG CDS 15945..16631 product DNA-binding transcriptional regulator rspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215549.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene rspR CDS 16808..17011 product putative selenium delivery protein YdfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214712.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene ydfZ CDS complement(17046..18506) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527743.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(18595..19878) product MHS family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347482.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 20665..20898 product cold shock protein YdfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836768.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene ydfK CDS 21215..21805 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078177.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(21903..22478) product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885611.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 sequence046 source 1..22382 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(1320..1395) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(1435..1510) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 1746..2090 product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472021.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 2113..2484 product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826503.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(2536..3951) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695655.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene gltX tRNA 4210..4285 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 4330..4405 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 4452..4527 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 4532..4607 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(4872..5756) product DNA-binding transcriptional regulator XapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442949.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene xapR CDS complement(5797..5955) product DUF1427 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651752.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(6008..7264) product xanthosine/proton symporter XapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020402.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene xapB CDS complement(7324..8157) product xanthosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084573.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene xapA CDS 8406..9170 product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716421.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(9209..10135) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109794.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 10225..11223 product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765610.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(11220..11438) product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410201.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(11440..12705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 note possible pseudo, frameshifted CDS complement(12684..13427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 note possible pseudo, frameshifted CDS complement(13498..13932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 14023..14349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 14714..15475 product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254839.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene cysZ CDS 15660..16631 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034402.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene cysK CDS 17015..17272 product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene ptsH CDS 17317..19044 product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623140.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene ptsI CDS 19085..19594 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522247.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene crr CDS complement(19637..20488) product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096674.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene pdxK CDS 20593..20967 product YfeK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719962.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 21000..21734 product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745534.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 sequence047 source 1..22039 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 190..603 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301418.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(648..965) product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295356.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene hspQ CDS complement(1023..2213) product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116297.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene rlmI CDS 2308..2586 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048252.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene yccX CDS complement(2583..2912) product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904442.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene tusE CDS complement(3003..3662) product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375136.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene yccA tRNA complement(3869..3956) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 4383..5501 product hydrogenase 1 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058323.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene hyaA CDS 5498..7291 product Ni/Fe-hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107384.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene hyaB CDS 7310..8017 product Ni/Fe-hydrogenase b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186424.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene hyaC CDS 8014..8601 product hydrogenase 1 maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003671.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 8598..8996 product hydrogenase-1 operon protein HyaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063978.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene hyaE CDS 8993..9850 product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004899.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 9984..11528 product cytochrome bd-II oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263582.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene appC CDS 11540..12676 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460803.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene appB CDS 12861..14159 product bifunctional acid phosphatase/4-phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300464.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene appA CDS complement(14274..16439) product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208650.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene etk CDS complement(16474..16920) product protein-tyrosine-phosphatase Etp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057871.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene etp CDS complement(16908..18047) product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295357.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(18093..20189) product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742328.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(20189..20935) product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038079.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(20932..21576) product lipoprotein GfcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247610.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene gfcB CDS complement(21683..21988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032438.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 sequence048 source 1..21713 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 399..1934 product acid resistance gamma-aminobutyrate antiporter GadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246019.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene gadC CDS complement(2099..2275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 2230..3384 product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350395.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 3748..5130 product diguanylate cyclase DosC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426292.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene dosC CDS 5155..7554 product oxygen-sensing cyclic-di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360132.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene dosP CDS 7812..8393 product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285833.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene ddpX CDS 8503..9957 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830550.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 9959..10981 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145123.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 10978..11874 product D,D-dipeptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979626.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 11871..12857 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193547.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 12850..13776 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285536.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(13832..14263) product peroxiredoxin OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152305.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene osmC CDS 14263..14466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 14608..14823 product biofilm-dependent modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495771.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene bdm CDS 14925..15062 product stationary-phase-induced ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841554.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene sra CDS 15219..16916 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433476.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene maeA CDS 17050..18060 product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642433.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene adhP CDS 18206..18490 product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781370.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(18897..19550) product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045648.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene fdnI CDS complement(19510..20427) product formate dehydrogenase N subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240582.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene fdnH misc_feature complement(20440..>21713) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010723100.1:formate dehydrogenase-N subunit alpha locus_tag LOCUS_15170 sequence049 source 1..21646 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 285..1145 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809262.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene rsmI CDS complement(1188..2279) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816992.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(2290..4731) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355538.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(4835..5434) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044775.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(5610..6194) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045432.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(6595..7296) product galactosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311150.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(7351..8142) product PTS galactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534347.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene agaD CDS complement(8132..8935) product PTS galactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544489.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene agaC CDS complement(8974..9450) product PTS galactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203711.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene agaB CDS complement(9617..10477) product tagatose-bisphosphate aldolase subunit KbaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022766.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene kbaY CDS complement(10490..11644) product AgaS family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114869.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(11995..12498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(12518..12919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(12930..13403) product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336162.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene agaV CDS complement(13426..14706) product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681920.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene kbaZ CDS 14955..15764 product aga operon transcriptional regulator AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072187.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene agaR CDS complement(15819..16283) product type II toxin-antitoxin system ribonuclease toxin YhaV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347273.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene yhaV CDS complement(16283..16618) product type II toxin-antitoxin system antitoxin PrlF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307405.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene prlF CDS complement(16767..18338) product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273753.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene garD CDS 18713..20047 product galactarate/glucarate/glycerate transporter GarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599636.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene garP CDS 20063..20833 product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058209.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene garL sequence050 source 1..21557 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1388..1813) product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065769.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene arsC CDS complement(1826..3115) product arsenite/antimonite:H(+) antiporter ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922639.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene arsB CDS complement(3169..3522) product As(III)-sensing metalloregulatory transcriptional repressor ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008957.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene arsR CDS complement(4061..4234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004976829.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 4196..4345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(4399..5751) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160816.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene gorA CDS complement(5823..6665) product 23S rRNA (adenine(2030)-N(6))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300574.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene rlmJ CDS 6868..8910 product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298719.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene prlC CDS 8918..9670 product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686620.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene rsmJ CDS complement(9719..11188) product dipeptide/tripeptide permease DtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098652.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene dtpB CDS 11143..11322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(11505..11939) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323571.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene uspA CDS 12330..12665 product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626187.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene uspB CDS complement(12845..14344) product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902780.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene pitA CDS 14576..15778 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439170.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(16093..17145) product DUF2776 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028905.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 17528..18766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 note possible pseudo, frameshifted CDS 18763..19134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 note possible pseudo, frameshifted CDS 19396..21018 product YhiJ/YhiL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393583.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 sequence051 source 1..20986 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1294..1953) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189743.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene rpiA CDS complement(2009..2239) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545308.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 2381..3274 product DNA-binding transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828351.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene argP CDS 3478..5622 product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073223.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene scpA CDS 5615..6610 product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606525.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene meaB CDS 6621..7406 product methylmalonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122080.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene scpB CDS 7430..8908 product propionyl-CoA:succinate CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449965.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene scpC CDS complement(8905..9801) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350807.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(9968..10708) product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669834.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(10801..11436) product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493352.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene argO CDS complement(11575..12435) product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389818.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene mscS assembly_gap 12647..12701 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12774..13853) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034372.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene fbaA CDS complement(14068..15231) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111269.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene pgk CDS complement(15281..16300) product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218480.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene epd CDS complement(16585..17298) product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687705.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(17295..17804) product fumarase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224147.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene fumE CDS complement(17826..18791) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987283.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene glpX CDS complement(18788..20065) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853247.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 misc_feature complement(20080..>20986) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000428788.1:PTS mannitol transporter subunit IICB locus_tag LOCUS_15760 sequence052 source 1..20867 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1662..2093 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156181.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 2235..2486 product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024392.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene grxC CDS 2549..3016 product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003377.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene secB CDS 3016..4035 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076194.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene gpsA CDS 4115..4936 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277561.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene cysE CDS complement(4989..5462) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932347.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene trmL CDS complement(5660..6850) product quinone-dependent L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586962.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene lldD CDS complement(6847..7623) product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636500.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene lldR CDS complement(7623..9278) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295233.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene lldP CDS complement(9650..10012) product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665680.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 10297..10506 product protein YibT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517100.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene yibT CDS complement(10518..11105) product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228269.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene mtlR CDS complement(11105..12253) product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645439.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene mtlD CDS complement(12483..14396) product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093247.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene mtlA CDS 14933..15295 product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479624.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 15298..16434 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364939.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(16997..17332) product Imm57 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326561.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(17421..17714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(18039..18410) product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642478.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(18755..19450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 note possible pseudo, internal stop codon, frameshifted CDS complement(19498..20340) product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072850.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 misc_feature complement(20361..>20867) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000015300.1:RHS element protein RhsA locus_tag LOCUS_15980 sequence053 source 1..20518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(398..1057) product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159065.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene glnP CDS complement(1196..1942) product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843866.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene glnH CDS complement(2346..2849) product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100800.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene dps CDS complement(3148..4035) product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295297.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene rhtA CDS 4388..4903 product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295296.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene ompX CDS complement(4952..6535) product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054678.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene opgE CDS complement(6807..6935) product manganase accumulation protein MntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001761.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene mntS CDS 7121..7588 product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091016.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene mntR CDS 7585..8703 product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056457.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(8762..9682) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056384.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene ldtB CDS 9901..11493 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961458.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(11734..12999) product DUF1479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168797.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(13151..13966) product sugar-phosphatase YbiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114272.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene ybiV CDS complement(14112..16544) product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209309.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(16550..17449) product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295295.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 17580..18242 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336208.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene fsa CDS complement(18318..19067) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829217.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene moeB CDS complement(19067..20302) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397340.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene moeA sequence054 source 1..20329 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 436..2190 product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784470.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(2261..3718) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102483.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene lpdA CDS complement(4010..5902) product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963564.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene aceF CDS complement(5917..8580) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003820.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene aceE CDS complement(8741..9505) product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331776.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene pdhR CDS 10046..11419 product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969915.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene aroP CDS complement(11462..12316) product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172005.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene ampE CDS complement(12313..12864) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923721.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene ampD CDS 12952..13845 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135174.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene nadC CDS 14048..14488 product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360904.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene ppdD CDS 14498..15883 product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025145.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene gspE CDS 15873..17075 product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157266.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene hofC CDS complement(17110..18153) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217338.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene guaC CDS 18378..18998 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269520.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene coaE CDS 18998..19741 product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194734.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene zapD CDS 19751..19948 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005042.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene yacG sequence055 source 1..19751 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 276..1667 product hexose-6-phosphate:phosphate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879194.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene uhpT CDS complement(1713..3479) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065718.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene adeD CDS 3654..4988 product adenine permease AdeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001403836.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene adeQ CDS 5041..5493 product DUF1198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295241.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 5704..6894 product purine ribonucleoside efflux pump NepI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288549.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene nepI CDS complement(6935..7228) product protein YicS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805509.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene yicS CDS 7450..8268 product lipoprotein NlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779426.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene nlpA CDS complement(8272..9195) product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535961.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(9306..10490) product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172878.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 tRNA complement(11127..11221) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 11514..12896 product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834439.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 12906..15224 product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702898.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene yicI CDS complement(15277..16986) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300954.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(17107..18498) product xanthine/proton symporter XanP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295238.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene xanP sequence056 source 1..19687 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1351..3024) product multidrug efflux transporter permease subunit MdtO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275207.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene mdtO note possible pseudo, frameshifted CDS complement(3406..4437) product multidrug efflux transporter periplasmic adaptor subunit MdtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446378.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene mdtN CDS complement(4456..4731) product YtcA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295389.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(4940..6925) product alkyl sulfatase YjcS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066019.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene yjcS CDS complement(7198..8127) product allose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171687.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene alsK CDS complement(8111..8806) product D-allulose-6-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311314.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene alsE CDS complement(8817..9797) product D-allose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000507106.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene alsC CDS complement(9776..11308) product D-allose ABC transporter ATP-binding protein AlsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235257.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene alsA CDS complement(11435..12370) product D-allose transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046187.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene alsB CDS complement(12429..13319) product als operon DNA-binding transcriptional repressor AlsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083216.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene alsR CDS 13678..14127 product bifunctional allose-6-phosphate isomerase/ribose-5-phosphate isomerase RpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716794.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene rpiB CDS 14196..14525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(14672..15430) product phosphonate metabolism protein PhnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059908.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene phnP CDS complement(15432..15866) product aminoalkylphosphonate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110490.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene phnO CDS complement(15853..16410) product ribose 1,5-bisphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971886.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene phnN CDS complement(16410..17546) product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586325.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene phnM CDS complement(17543..18223) product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611405.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene phnL CDS complement(18334..19092) product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075514.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene phnK misc_feature complement(19089..>19687) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000002303.1:alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ locus_tag LOCUS_16640 sequence057 source 1..19533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 202..1071 product YjeJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008040.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(1274..1627) product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558209.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(1765..3411) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729117.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene groL CDS complement(3455..3748) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026276.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 4024..4827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 note possible pseudo, internal stop codon CDS 4840..5280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 note possible pseudo, internal stop codon CDS complement(5296..5772) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267448.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene fxsA CDS 6109..7545 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069437.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene aspA CDS 7663..8964 product anaerobic C4-dicarboxylate transporter DcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961959.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene dcuA CDS 9080..9418 product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883400.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene cutA CDS 9394..11091 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068922.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene dsbD CDS 11128..11703 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188520.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 tRNA 11810..11885 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 12502..14040 product lysine decarboxylation/transport transcriptional activator CadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187173.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene cadC CDS 14405..15739 product cadaverine/lysine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092909.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene cadB CDS 15819..17966 product lysine decarboxylase CadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295383.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene cadA CDS 18025..19482 product dipeptide/tripeptide permease DtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856829.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene dtpC sequence058 source 1..18889 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1334..2134) product DUF218 domain-containing protein YdcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027942.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene ydcF CDS complement(2406..4304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 note possible pseudo, frameshifted CDS complement(4304..6325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 note possible pseudo, frameshifted CDS 6526..7131 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048950.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene azoR CDS complement(7185..8453) product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001375099.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(8491..10077) product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431845.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(10264..11160) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890941.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(11160..11627) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177515.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(11936..14242) product DUF2773 domain-containing bactofilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910026.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(14305..15165) product pyridoxine 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097801.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene pdxI CDS complement(15373..18696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 sequence059 source 1..18859 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 322..1050 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047091.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene mtgA CDS complement(1047..1679) product PhoP regulatory network protein YrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620405.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene yrbL CDS complement(1893..2165) product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216791.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene npr CDS complement(2162..3016) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243741.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene rapZ CDS complement(3062..3553) product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183676.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene ptsN CDS complement(3671..3958) product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176599.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene hpf CDS complement(3981..5414) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809057.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene rpoN CDS complement(5462..6187) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224099.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene lptB CDS complement(6194..6751) product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669785.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene lptA CDS complement(6720..7295) product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030537.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene lptC CDS complement(7292..7858) product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030005.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene kdsC CDS complement(7879..8865) product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295557.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene kdsD CDS complement(8879..9856) product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922901.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 10066..10875 product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438245.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene mlaF CDS 10883..11665 product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925795.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene mlaE CDS 11670..12221 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296448.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene mlaD CDS 12240..12875 product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476487.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene mlaC CDS 12875..13168 product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004488.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene mlaB CDS 13313..13582 product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568740.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene ibaG CDS 13637..14896 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357259.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene murA CDS complement(14944..15222) product DNA-binding transcriptional regulator SfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445413.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene sfsB CDS complement(15450..16421) product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047336.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene ispB CDS 16680..16991 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271401.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene rplU CDS 17012..17269 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940595.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene rpmA CDS 17396..18361 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813037.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 sequence060 source 1..18717 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(280..750) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257846.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene argR CDS 1185..2123 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295272.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene mdh CDS complement(2186..3253) product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497723.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene degS CDS complement(3343..4710) product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295271.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene degQ CDS complement(4864..5268) product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295270.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene zapG CDS 5612..6583 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192332.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene zapE CDS 6802..7230 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene rplM CDS 7246..7638 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene rpsI CDS 8033..8671 product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257293.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene sspA CDS 8677..9174 product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366129.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene sspB CDS complement(9217..10584) product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467018.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene dcuC CDS 10973..11755 product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523845.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene nanR CDS 11877..12770 product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224714.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene nanA CDS 12879..14369 product sialic acid transporter NanT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108454.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene nanT CDS 14417..15106 product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054239.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 15103..15978 product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209011.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene nanK CDS 15975..16439 product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979882.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene nanQ CDS complement(16499..17047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(17811..18527) product DUF1120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067008.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 sequence061 source 1..18428 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 141..371 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 415..1149 product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039850.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene cysH CDS 1508..4174 product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433152.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene cas3 CDS 4589..6097 product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050401.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene casA CDS 6090..6572 product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752800.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene casB CDS 6585..7676 product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064450.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene cas7e CDS 8955..9872 product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220066.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene cas1e CDS 9874..10158 product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001381369.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene cas2e repeat_region 10264..10965 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gagttccccgcgccagcggggataaaccg CDS complement(11048..12085) product alkaline phosphatase isozyme conversion aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490428.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene iap CDS 12337..13245 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372108.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene cysD CDS 13247..14674 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090361.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene cysN CDS 14674..15279 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173673.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene cysC CDS 15329..15652 product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246104.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 15637..15858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 15846..16157 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517476.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene ftsB CDS 16176..16886 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246138.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene ispD CDS 16886..17365 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219242.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene ispF CDS 17362..18411 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568943.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene truD sequence062 source 1..18062 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(907..1869) product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386551.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene ybiB CDS complement(1897..4047) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340191.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene dinG CDS 4200..4649 product N-glycosidase YbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145126.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene ybiA CDS complement(4881..5756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 note possible pseudo, frameshifted CDS complement(5671..6261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 note possible pseudo, frameshifted assembly_gap 5764..5780 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6490..7161 product DNA-binding transcriptional regulator CecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340357.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene cecR CDS 7161..8159 product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976409.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene hlyD CDS 8152..9888 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996107.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 9881..11014 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070131.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 11039..12169 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469031.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 assembly_gap 11069..11103 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12131..12541) product YbhQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871982.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 12674..13435 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113348.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 13432..14673 product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650337.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene clsB CDS 14673..15629 product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045450.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 assembly_gap 16103..16162 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16624..17349) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373624.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(17486..17938) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852296.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene moaE sequence063 source 1..17957 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 50..850 product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317901.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene tcyJ CDS 955..1941 product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128215.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene dcyD CDS 1956..2624 product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158220.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene tcyL CDS 2621..3373 product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272991.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene yecC CDS 3603..4325 product transcriptional regulator SdiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152715.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene sdiA CDS complement(4393..4617) product DUF2594 family protein YecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106474.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene yecF CDS 5076..5732 product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611335.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene uvrY CDS 5795..7561 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283421.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene uvrC CDS 7618..8166 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160187.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene pgsA tRNA 8318..8393 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 8448..8521 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 8534..8620 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 8816..9481 product UPF0149 family protein YecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847902.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene yecA CDS complement(9543..10754) product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797560.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene tyrP CDS 10945..11184 product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377225.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(11222..11719) product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917208.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene ftnA CDS 12677..12928 product DUF2766 family protein YecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082127.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene yecJ CDS complement(13007..13510) product non-heme ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179469.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 14307..15296 product arabinose ABC transporter substrate-binding protein AraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548675.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene araF CDS 15366..16880 product arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187819.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene araG CDS 16895..17881 product arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100205.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene araH sequence064 source 1..17916 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(730..1560) product fructoselysine 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847837.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene frlC CDS complement(1610..2632) product fructoselysine 6-phosphate deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295163.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene frlB CDS complement(2653..4041) product fructoselysine/psicoselysine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535505.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene frlA CDS complement(4285..4452) product YhfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031834.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(4699..6072) product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349855.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene cysG CDS complement(6091..6897) product nitrite transporter NirC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493556.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene nirC CDS complement(7023..7349) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084764.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene nirD CDS complement(7346..9889) product NADPH-nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049208.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene nirB CDS complement(10151..11332) product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185247.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene tsgA CDS 11603..12175 product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477225.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene ppiA CDS 12280..12447 product YhfG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736862.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 12437..13039 product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280641.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 13071..13634 product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601847.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene pabA CDS 13720..14940 product bifunctional acetylornithine/succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963792.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene argD CDS complement(15007..17010) product YccS/YhfK family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484349.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(17148..17780) product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242755.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene crp sequence065 source 1..17866 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1850..3499 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789986.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene pgi assembly_gap 3530..3608 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4075..4317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 4431..5069 product YjbF family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295278.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 5066..5803 product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595558.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 5803..7899 product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745776.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 8494..8904 product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202902.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene psiE CDS complement(8948..10423) product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097274.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene xylE CDS complement(10795..11685) product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252058.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene malG CDS complement(11700..13244) product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297290.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene malF CDS complement(13398..14588) product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695387.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene malE CDS 14953..16068 product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179165.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene malK CDS 16140..17480 product maltoporin LamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973663.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene lamB assembly_gap 17606..17643 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence066 source 1..17569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(948..1850) product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084677.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene dppC CDS complement(1860..2879) product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938855.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene dppB CDS complement(3187..4794) product dipeptide ABC transporter substrate-binding protein DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222883.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene dppA tRNA complement(5537..5613) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(5705..7354) product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269197.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene eptB CDS complement(7720..8928) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189019.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(9157..9855) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299523.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 10013..10576 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438957.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene tag CDS 10573..11013 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617473.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(10982..13261) product biotin sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013950.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene bisC CDS 13468..14127 product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747625.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 14231..15205 product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805038.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene ghrB CDS complement(15255..15965) product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602794.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 16399..16689 product HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455798.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 16970..17182 product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014594.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene cspA sequence067 source 1..17549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 59..499 product DNA utilization protein HofO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055759.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene hofO CDS 489..893 product DNA utilization protein HofP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264141.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene hofP CDS 805..2043 product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815987.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene hofQ CDS 2444..2965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 3022..4110 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439848.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene aroB CDS 4202..5488 product cell division protein DamX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343215.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene damX CDS 5715..6431 product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742143.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene dam CDS 6449..7126 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816280.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene rpe CDS 7119..7877 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031729.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene gph CDS 7870..8874 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165552.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene trpS assembly_gap 8914..8949 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9124..10029 product GntR family transcriptional regulator YhfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254790.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene yhfZ CDS 10046..10408 product PRD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295165.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 10492..11655 product YhfX family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497334.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 11655..12881 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090644.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 12878..13756 product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007010.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 13767..14120 product DUF2620 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719728.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 14132..15436 product YhfT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366857.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 15448..16533 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847144.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 assembly_gap 16588..16613 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16634..17431) product DNA-binding transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276847.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene frlR sequence068 source 1..17545 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(247..852) product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295259.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene ubiJ CDS complement(866..1621) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227958.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene ubiE CDS complement(1716..3143) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347714.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene rmuC CDS complement(3284..4045) product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045177.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene udp CDS 4307..5122 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336442.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(5162..7423) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153907.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene metE CDS 7660..8613 product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573621.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene metR CDS complement(8501..9400) product biotin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196238.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene bioP CDS complement(9476..10276) product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285362.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene yigL CDS complement(10284..11306) product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487654.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene pldB CDS 11417..12037 product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171707.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene rhtB CDS complement(12099..12719) product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928824.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene rhtC CDS complement(12783..14618) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099855.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene recQ CDS complement(14745..15614) product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259700.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene pldA CDS 15779..16246 product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277142.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene yigI CDS 16298..17188 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339104.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene rarD sequence069 source 1..17476 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 33..449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(513..1028) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130211.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene luxS CDS complement(1178..2734) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611804.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene gshA CDS complement(2807..3235) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287454.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(3232..3798) product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273290.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene yqaB tRNA complement(4079..4155) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(4354..4430) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(4493..4569) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 4753..4824 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(4768..4844) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(4848..4940) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(5256..5441) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene csrA CDS complement(5676..8306) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047184.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene alaS CDS complement(8434..8934) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140508.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene recX CDS complement(9003..10064) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963143.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene recA CDS complement(10144..10641) product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene pncC CDS complement(10786..11871) product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295177.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene mltB CDS 12127..12690 product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573321.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene srlA CDS 12687..13646 product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148878.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene srlE CDS 13657..14028 product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216194.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene srlB CDS 14032..14811 product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077358.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene srlD CDS 14916..15275 product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252908.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene gutM CDS 15342..16115 product glucitol operon DNA-binding transcriptional repressor SrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804550.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene srlR CDS 16108..17073 product arabinose-5-phosphate isomerase GutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287420.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene gutQ sequence070 source 1..17306 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 246..1124 product YjcZ-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169188.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 1388..2890 product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298520.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene proP CDS complement(3067..4167) product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300761.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene pmrB CDS complement(4168..4836) product two-component system response regulator BasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697926.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene basR CDS complement(4833..6446) product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919792.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene eptA CDS complement(6580..7917) product arginine/agmatine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093154.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene adiC CDS complement(8054..8815) product DNA-binding transcriptional activator AdiY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217060.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene adiY CDS complement(9140..11410) product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001381593.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene adiA CDS complement(11606..11788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 note possible pseudo, internal stop codon CDS complement(11804..12514) product transcriptional regulator MelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090758.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene melR note possible pseudo, internal stop codon CDS 12797..14152 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986601.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene melA CDS 14267..15676 product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028111.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene melB CDS complement(15815..16444) product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198773.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 misc_feature complement(16566..>17306) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000066681.1:class I fumarate hydratase locus_tag LOCUS_18950 sequence071 source 1..16833 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 590..1879 product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450476.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene sdaC CDS 1937..3304 product L-serine ammonia-lyase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626422.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene sdaB CDS 3416..4171 product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268232.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene xni CDS complement(4226..5374) product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013588.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene fucO CDS complement(5402..6049) product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440781.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene fucA CDS 6596..7912 product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528603.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene fucP CDS 7945..9720 product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724153.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene fucI CDS 9829..11247 product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808376.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene fucK CDS 11249..11671 product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920840.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene fucU CDS 11729..12460 product L-fucose operon activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642344.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene fucR CDS complement(12504..13604) product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045520.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene rlmM CDS complement(13597..13992) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203905.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(14011..14928) product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044401.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene gcvA CDS complement(15271..15498) product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750398.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 sequence072 source 1..16528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 350..1627 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891564.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene waaA CDS 1635..2114 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171866.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene coaD CDS complement(2153..2962) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114543.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene mutM CDS complement(3060..3227) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051798.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene rpmG CDS complement(3248..3484) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091955.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene rpmB CDS complement(3701..4369) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350561.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene radC CDS 4541..5761 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050139.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene coaBC CDS 5739..6197 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976073.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene dut CDS 6304..6900 product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311223.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene slmA CDS complement(6937..7578) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806177.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene pyrE CDS complement(7644..8360) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247093.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene rph CDS 8487..9350 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621340.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 9571..10395 product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350563.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene dinD CDS 10685..11302 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924289.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(11299..12981) product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870036.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene ligB CDS 13239..13862 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295237.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene gmk CDS 13917..14192 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene rpoZ CDS 14211..16325 product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280488.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene spoT sequence073 source 1..16514 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..1010 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130305.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene clpX CDS 1198..3552 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295325.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene lon CDS 3761..4033 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043542.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene hupB CDS 4225..6096 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969372.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene ppiD CDS 6247..6618 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680312.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 6712..7110 product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194534.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene fadM CDS complement(7162..7857) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817220.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene queC CDS complement(7922..9385) product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238234.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 9715..10533 product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336137.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene cof CDS 10686..11144 product DNA-binding transcriptional regulator DecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884589.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene decR CDS 11174..12946 product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235649.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 12939..14720 product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256201.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 14901..15239 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780338.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene glnK sequence074 source 1..16453 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 63..404 product type IV toxin-antitoxin system toxin YkfI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854672.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene ykfI tRNA complement(786..861) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(976..2229) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893278.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene proA CDS complement(2241..3344) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285288.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene proB CDS 3632..4687 product phosphoporin PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749863.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene phoE CDS complement(4726..5127) product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174689.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene crl CDS complement(5185..6429) product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189532.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene frsA CDS complement(6521..6979) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291990.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene gpt CDS 7240..8697 product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292994.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene pepD CDS complement(8754..9254) product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602135.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene prfH CDS complement(9223..9489) product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295202.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(9795..10169) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059892.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(10257..10655) product type II toxin-antitoxin system mRNA interferase toxin YafO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263489.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene yafO CDS complement(10658..10951) product type I toxin-antitoxin system antitoxin YafN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554758.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene yafN CDS complement(11003..12058) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226164.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene dinB CDS complement(12129..12899) product putative lateral flagellar export/assembly protein LafU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207556.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene lafU CDS 12859..14598 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301901.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 assembly_gap 14636..14833 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 15466..15495 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15508..16134) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056849.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 16172..16339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 sequence075 source 1..16302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(781..1977) product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921791.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene hemY CDS complement(1980..3161) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138997.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene hemX CDS complement(3183..3923) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026046.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene hemD CDS complement(3920..4882) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606154.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene hemC CDS 5248..7794 product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281668.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene cyaA CDS complement(7834..8154) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999947.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene cyaY CDS 8617..8820 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799889.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 8857..9681 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160654.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene dapF CDS 9678..10145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 note possible pseudo, internal stop codon CDS 10194..10385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 note possible pseudo, internal stop codon CDS 10382..11278 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130691.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene xerC CDS 11278..11994 product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213584.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene yigB CDS 12078..14240 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383406.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene uvrD CDS complement(14387..15151) product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951133.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 sequence076 source 1..16293 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(557..1456) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131782.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene hisG CDS 1935..2186 product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259255.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene yefM CDS 2183..2437 product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene yoeB CDS 2520..3344 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754737.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 3369..4319 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803351.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 4586..5944 product putrescine/proton symporter PlaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019197.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene plaP CDS 6123..7181 product thiosulfate utilization transporter TsuA/YeeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492339.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene tsuA CDS 7195..7422 product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234896.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(7465..8892) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980589.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene sbcB CDS 9224..10267 product serine-type D-Ala-D-Ala carboxypeptidase DacD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830156.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene dacD CDS 10386..10859 product DNA gyrase inhibitor SbmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105415.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene sbmC CDS 11057..12115 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200891.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 12287..12616 product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450409.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(13514..13708) product DUF5983 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988600.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(13705..14079) product type IV toxin-antitoxin system cytoskeleton-binding toxin CbtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854814.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene cbtA CDS complement(14168..14536) product type IV toxin-antitoxin system cytoskeleton bundling-enhancing antitoxin CbeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285584.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene cbeA CDS complement(14610..14831) product DUF987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692323.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(14894..15340) product RadC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187523.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 misc_feature complement(15337..>16293) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001350525.1:protein YeeR locus_tag LOCUS_19910 sequence077 source 1..16107 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(609..2888) product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294387.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(2899..3987) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350535.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(4294..4611) product protein YehK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636925.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene yehK CDS complement(4672..8304) product DUF4132 domain-containing protein YehI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356817.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene yehI CDS complement(8314..9255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 note possible pseudo, frameshifted CDS complement(9218..11155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 note possible pseudo, internal stop codon, frameshifted CDS complement(11267..12091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 note possible pseudo, internal stop codon CDS complement(12232..14274) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350533.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene metG CDS 14397..15506 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005448.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene apbC CDS 15769..16050 product YehE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324851.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 sequence078 source 1..15692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(810..3146) product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809774.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene arcB CDS complement(3242..4204) product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299745.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 4738..9306 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213702.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene gltB CDS 9319..10737 product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081674.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene gltD CDS 11297..12061 product DUF1120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465371.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 12233..12907 product fimbria/pilus chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311157.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 12928..15309 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914994.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 sequence079 source 1..15658 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(98..1201) product bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374004.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene gldA CDS complement(1212..1874) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424840.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene fsa CDS complement(1886..4387) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174077.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene ptsP CDS 4696..5775 product PTS fructose transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004446.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 5790..6110 product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161265.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 6161..8458 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184811.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 8424..9302 product [formate-C-acetyltransferase]-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204105.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 9304..9645 product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323846.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(9632..10483) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274636.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(10698..12431) product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556306.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(12613..15264) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005586.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene ppc sequence080 source 1..15497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(144..2567) product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017354.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene plsB CDS 2738..3106 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002907.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene dgkA CDS 3216..3824 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646078.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene lexA CDS 3897..5189 product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134731.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene dinF CDS 5305..5514 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030593.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(5556..6071) product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295691.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene zur CDS 6389..6643 product protein YjbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912571.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene yjbL CDS 6667..7374 product DUF2713 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311303.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 7833..8774 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298868.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene dusA CDS 8908..9150 product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891404.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene pspG CDS complement(9316..10299) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235508.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 10382..11797 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918363.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene dnaB CDS 11850..12929 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147328.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 gene alr CDS 13182..14375 product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486985.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene tyrB assembly_gap 14406..14611 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 14903..15000 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence081 source 1..15243 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(126..755) product enterobactin synthase subunit EntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001749708.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene entD assembly_gap 780..873 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(902..3142) product siderophore enterobactin receptor FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034943.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene fepA CDS 3385..4587 product enterochelin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125843.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene fes CDS 4590..4808 product enterobactin biosynthesis protein YbdZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885798.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene ybdZ CDS 4805..8686 product enterobactin non-ribosomal peptide synthetase EntF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077805.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene entF CDS 9031..10035 product LPS O-antigen length regulator Wzz(fepE) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096692.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene wzz(fepE) CDS complement(10032..10466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 note possible pseudo, internal stop codon CDS complement(10494..10847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 note possible pseudo, internal stop codon CDS complement(10844..11836) product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640988.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene fepG CDS complement(11833..12849) product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453810.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene fepD CDS 12948..14198 product enterobactin transporter EntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041786.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene entS CDS complement(14202..15158) product Fe2+-enterobactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234311.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene fepB sequence082 source 1..15038 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 395..799 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148908.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(854..1723) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274680.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(1777..1995) product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907085.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(1989..3011) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057356.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(3011..4924) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634798.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 5055..5606 product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987657.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene kefG CDS 5606..7411 product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399147.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene kefB CDS 7421..7621 product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007730.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 7716..8306 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861334.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene slyD CDS complement(8355..8573) product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153615.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 8794..9606 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838250.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene fkpA CDS 9773..10495 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091466.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 10495..10881 product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209680.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene tusD CDS 10881..11240 product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820714.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene tusC CDS 11248..11535 product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903373.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene tusB CDS 11661..12035 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001319024.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene rpsL CDS 12132..12671 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138045.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene rpsG CDS 12699..14813 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124700.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene fusA sequence083 source 1..15021 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1335..3638 product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287458.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene pgaA CDS 3647..5665 product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945561.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene pgaB CDS 5778..6983 product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610451.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene pgaC CDS 6985..7398 product poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061095.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene pgaD CDS complement(7448..8512) product phosphate starvation-inducible protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258765.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene phoH CDS complement(8857..10128) product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199471.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene efeB CDS complement(10134..11261) product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154398.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene efeO CDS complement(11319..12038) product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497942.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(12691..14199) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018479.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene putP CDS complement(14358..14510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 14622..14960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20740 sequence084 source 1..14837 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(219..1583) product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627995.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene ppnN CDS complement(1730..2578) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100421.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene queF CDS 2646..3191 product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342431.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene syd CDS 3813..4142 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206990.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 4142..4924 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890001.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene truC CDS 4942..5391 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807753.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 5826..7178 product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097072.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 gene gudP CDS 7180..8520 product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235391.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 8541..9881 product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098255.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene gudD CDS complement(10113..12869) product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186450.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene barA CDS 12926..14227 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046812.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene rlmD CDS 14275..14550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 sequence085 source 1..14827 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 230..1798 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884361.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene cydA CDS 1814..2953 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568275.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene cydB CDS 3081..3374 product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034602.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene ybgE CDS 3524..3928 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098384.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene ybgC CDS 3925..4617 product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131314.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene tolQ CDS 4621..5049 product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090097.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene tolR CDS 5114..6379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 6512..7804 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295307.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene tolB CDS 7839..8360 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295306.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene pal CDS 8370..9161 product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097571.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene cpoB tRNA 9326..9401 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 9537..9612 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 9615..9690 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 9840..9915 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 9919..9994 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA 10141..10216 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA 10349..10424 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 10857..11900 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115290.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene nadA CDS 11938..12657 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345410.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene pnuC CDS complement(12654..13595) product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951276.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene zitB CDS complement(13709..14089) product YbgS-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784351.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 sequence086 source 1..14754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 467..1141 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719011.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 1157..3637 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945454.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 3653..4687 product putative fimbrial-like adhesin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405713.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(4769..5107) product Ni(II)/Co(II) efflux transporter accessory subunit RcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153067.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene rcnB CDS complement(5326..6150) product nickel/cobalt efflux protein RcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134636.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene rcnA CDS 6271..6543 product Ni(II)/Co(II)-binding transcriptional repressor RcnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019944.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene rcnR CDS 6766..7554 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195564.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene thiM CDS 7551..8351 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822274.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene thiD CDS 8416..9234 product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351783.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 9286..10032 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434038.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(10006..10971) product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012001.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(10968..11972) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846217.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(11969..13246) product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858484.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 13503..14555 product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129551.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene fbaB sequence087 source 1..14637 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(143..334) product YfgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076001.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 352..504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017552.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 851..2929 product cyclic-guanylate-specific phosphodiesterase PdeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772731.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene pdeF CDS complement(2968..4509) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121363.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene ppx CDS complement(4514..6586) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529576.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene ppk1 CDS complement(6752..7390) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028612.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene purN CDS complement(7390..8442) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336050.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene purM CDS 8752..9378 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295473.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene upp CDS 9464..10753 product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198328.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene uraA CDS 10803..11549 product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247065.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(11687..12046) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166446.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene arsC CDS complement(12067..13530) product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489667.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene bepA CDS 13743..14015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 note possible pseudo, frameshifted sequence088 source 1..14593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 188..910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 note possible pseudo, frameshifted CDS 859..1263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 note possible pseudo, frameshifted assembly_gap 883..900 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1264..2082) product bifunctional pyridoxal phosphate/fructose-1,6-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300666.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene ybhA CDS 2237..3232 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815435.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene pgl CDS complement(3273..4031) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643361.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 4515..5462 product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723652.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 5538..6971 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036475.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 7154..9415 product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593938.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(9649..10932) product putative acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091569.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(11084..11560) product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767389.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(11619..12851) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295303.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene bioA CDS 12995..14035 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951213.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene bioB sequence089 source 1..14583 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 52..600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 597..2441 product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087218.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 2722..3183 product YehR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295429.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(3223..3693) product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950409.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(3740..4459) product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598641.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene btsR CDS complement(4456..6156) product two-component regulatory system sensor histidine kinase BtsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295431.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene btsS CDS 6363..7094 product HTH-type transcriptional regulator MlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240401.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene mlrA CDS complement(7242..7973) product glycine betaine ABC transporter permease YehW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783123.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene yehW CDS complement(7978..8904) product glycine betaine ABC transporter ATP binding protein YehX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569315.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene yehX CDS complement(8897..10054) product glycine betaine ABC transporter permease YehY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220837.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene yehY CDS complement(10061..10978) product glycine betaine ABC transporter substrate-binding protein OsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130308.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene osmF CDS complement(11189..13486) product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871504.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene bglX CDS 13682..14491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 sequence090 source 1..14549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2192 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000263098.1:DNA-directed RNA polymerase subunit beta locus_tag LOCUS_21530 CDS 2269..6492 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653944.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene rpoC CDS 6705..7244 product heat-shock protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307500.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(7654..8787) product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847447.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene thiH CDS complement(8784..9554) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944104.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene thiG CDS complement(9556..9756) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166226.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene thiS CDS complement(9740..10495) product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999737.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene thiF CDS complement(10488..11123) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284615.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene thiE CDS complement(11123..13018) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276926.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene thiC CDS complement(13251..13727) product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934302.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene rsd sequence091 source 1..14490 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1169..4267) product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502395.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene ygfK CDS complement(4589..5167) product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272828.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene mocA CDS 5561..6040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 6088..7713 product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020381.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene yqeB CDS complement(7934..8866) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037992.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene arcC CDS complement(8914..10299) product D-phenylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264442.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene hyuA CDS complement(10352..11563) product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107125.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(11621..12817) product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110493.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene dpaL CDS complement(12875..14062) product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978544.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene ygeW sequence092 source 1..14384 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001125331.1:TIGR04211 family SH3 domain-containing protein locus_tag LOCUS_21720 CDS 604..1842 product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708487.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene cca CDS complement(2031..2852) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281927.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene bacA CDS complement(2942..3313) product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295541.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene folB CDS 3415..4032 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272796.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene plsY CDS complement(4045..4977) product DNA-binding transcriptional activator TtdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935206.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene ttdR CDS 5184..6095 product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986797.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene ttdA CDS 6092..6697 product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722957.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene ttdB CDS 6745..8208 product L-tartrate/succinate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804973.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene ttdT CDS complement(8251..9264) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264352.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene tsaD CDS 9502..9717 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene rpsU CDS 9828..11573 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918827.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene dnaG CDS 11768..13609 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437376.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene rpoD CDS complement(13688..14194) product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228937.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene mug sequence093 source 1..14016 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 276..479 product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503931.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene tatE CDS complement(580..1506) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042632.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene lipA CDS complement(1715..2668) product YbeF family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378026.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(2927..3568) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284027.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene lipB CDS complement(3669..3932) product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850550.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene ybeD CDS complement(4042..5253) product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092082.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene dacA CDS 5170..5415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(5392..6480) product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231430.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene rlpA CDS complement(6491..7603) product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131719.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene mrdB CDS complement(7606..9507) product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776191.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene mrdA CDS complement(9538..10005) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776104.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene rlmH CDS complement(10009..10326) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161664.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene rsfS CDS complement(10586..11197) product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241872.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(11221..11862) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838889.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene nadD CDS complement(11864..12895) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620535.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene holA CDS complement(12895..13476) product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269673.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene lptE misc_feature complement(13491..>14016) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001340834.1:leucine--tRNA ligase locus_tag LOCUS_22020 sequence094 source 1..13984 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(383..3184) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181473.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene sucA CDS 3476..4798 product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477807.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene deoA CDS 4850..6073 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816471.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene deoB CDS 6130..6849 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224877.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene deoD CDS 7016..8347 product type II toxin-antitoxin system HipA family toxin YjjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293115.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene yjjJ CDS complement(8348..9364) product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105884.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene lplA CDS complement(9392..10036) product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124615.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 10142..11110 product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132955.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene serB CDS 11159..12541 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029687.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene radA CDS 12562..13794 product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093814.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene nadR sequence095 source 1..13873 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1081 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000291549.1:lactose permease locus_tag LOCUS_22130 CDS complement(1251..2402) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298964.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene argE CDS 2556..3560 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935370.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene argC CDS 3571..4344 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295507.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene argB CDS 4405..5778 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230087.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene argH CDS 6045..6962 product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025939.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene oxyR CDS complement(6945..8345) product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120810.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene sthA CDS 8622..9326 product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470429.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene fabR CDS 9326..9685 product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806411.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(9725..10825) product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187022.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene trmA CDS 11194..13038 product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591359.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene btuB CDS 12983..13840 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201820.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene murI sequence096 source 1..13317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(629..1552) product formate hydrogenlyase subunit HycD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115223.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene hycD CDS complement(1555..3381) product formate hydrogenlyase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274396.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene hycC CDS complement(3378..3989) product formate hydrogenlyase subunit HycB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079186.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene hycB CDS complement(4114..4575) product formate hydrogenlyase regulator HycA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158056.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene hycA CDS 4787..5137 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508457.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene hypA CDS 5141..6013 product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337665.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene hypB CDS 6004..6276 product hydrogenase 3 maturation protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334881.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene hypC CDS 6276..7397 product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212985.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene hypD CDS 7394..8404 product hydrogenase maturation carbamoyl dehydratase HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059922.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene hypE CDS 8478..10556 product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301332.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene flhA CDS complement(10593..10946) product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015497.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 sequence097 source 1..13125 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 551..865 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274299.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene fliE CDS 1214..1564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 note possible pseudo, frameshifted CDS 2026..2217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(2486..2965) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494172.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(3076..3744) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334583.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(3853..4086) product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790504.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene yedF CDS complement(4083..5288) product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118897.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene yedE CDS 5475..5888 product lipoprotein YedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350519.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene yedD CDS complement(5922..7409) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245695.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene amyA CDS complement(7487..7852) product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015033.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene fliT CDS complement(7852..8262) product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270671.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene fliS CDS complement(8287..9693) product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146784.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene fliD CDS 9959..11455 product H48 family flagellin FliC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079739.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene fliC CDS 11776..12495 product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087467.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene fliA CDS 12541..13092 product flagella biosynthesis regulatory protein FliZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350518.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene fliZ sequence098 source 1..12959 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..556 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000210111.1:gluconate transporter note possible pseudo, frameshifted locus_tag LOCUS_22510 CDS 556..1020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 note possible pseudo, frameshifted CDS complement(1077..1670) product NAAT family transporter YhgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002544.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene yhgN CDS 1863..2966 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799956.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene asd CDS 3239..5425 product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283723.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene glgB CDS 5422..7395 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192523.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene glgX CDS 7413..8708 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253975.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene glgC CDS 8708..10141 product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197646.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene glgA CDS 10160..12607 product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993449.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene glgP sequence099 source 1..12698 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(116..505) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736007.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene mutT CDS complement(565..3270) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905789.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene secA CDS complement(3332..3919) product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014321.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene secM CDS complement(4075..4992) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595482.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene lpxC CDS complement(5093..6244) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462776.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene ftsZ CDS complement(6305..7567) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588474.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene ftsA CDS complement(7564..8394) product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075748.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene ftsQ CDS complement(8396..9316) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130056.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene ddlB CDS complement(9309..10784) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096049.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene murC CDS complement(10838..11905) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016560.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene murG CDS complement(11902..12603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 sequence100 source 1..12687 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(17..1510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 1793..1975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(2127..3809) product glycolate permease GlcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259302.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene glcA CDS complement(4164..6335) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084131.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene glcB CDS complement(6357..6761) product GlcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853256.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(6766..7989) product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194661.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene glcF CDS complement(8000..9052) product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943100.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene glcE CDS complement(9052..10551) product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026117.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 gene glcD CDS 10802..11566 product transcriptional regulator GlcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297764.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene glcC misc_feature complement(11573..>12687) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000981816.1:protein YghO locus_tag LOCUS_22800 sequence101 source 1..12648 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 256..2454 product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040195.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene speF CDS 2451..3770 product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075845.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene potE CDS 4119..4328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 note possible pseudo, internal stop codon CDS 4407..4769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22840 note possible pseudo, internal stop codon CDS complement(4810..5274) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856353.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 assembly_gap 5372..5465 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5547..7187) product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297249.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene pgm CDS complement(7213..7758) product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848387.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene seqA CDS 7943..8707 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773288.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene ybfF CDS 8778..9140 product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291238.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene ybfE CDS 9280..9810 product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018618.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene fldA CDS 10099..10545 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131702.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene fur CDS complement(10629..10955) product ChiQ/YbfN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733579.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene chiQ CDS complement(11005..12411) product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258819.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene chiP sequence102 source 1..12622 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 20..1381 product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734671.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene phoQ CDS 1457..2578 product [50S ribosomal protein L16]-arginine 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456506.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene roxA CDS complement(2627..3853) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359434.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene pepT CDS 3909..4124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310720.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 4121..5239 product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531594.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene potA CDS 5223..6080 product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799401.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene potB CDS 6077..6871 product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580316.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene potC CDS 6868..7914 product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759317.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene potD CDS 7972..8433 product DUF3592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076376.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 8430..9218 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713462.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(9338..10177) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952737.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene cobB CDS complement(10193..11104) product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291270.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene nagK CDS complement(11133..12377) product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251348.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene lolE sequence103 source 1..12586 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(271..687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(684..2627) product cytochrome c-type biogenesis heme lyase CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982447.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene ccmF CDS complement(2624..3103) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026418.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene ccmE CDS complement(3100..3309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(3306..4067) product heme exporter protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295447.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene ccmC CDS complement(4085..4747) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971730.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene ccmB CDS complement(4744..5367) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525587.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene ccmA CDS complement(5380..5982) product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528376.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene napC CDS complement(5992..6441) product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835174.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene napB CDS complement(6438..7301) product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013515.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene napH CDS complement(7288..7902) product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091291.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene napG CDS complement(7990..10476) product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778061.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene napA CDS complement(10473..10736) product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557378.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene napD CDS 11329..11493 product protein YojO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296837.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene yojO CDS 11628..12116 product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849209.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene eco sequence104 source 1..12455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(206..1153) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264861.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene dusC CDS 1392..1790 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295452.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 1787..2482 product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968208.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 2612..3496 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553555.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 gene cdd CDS 3646..4365 product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920064.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene sanA CDS 4368..4607 product DUF2542 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383096.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 4801..6039 product NAD-dependent dihydropyrimidine dehydrogenase subunit PreT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136389.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 gene preT CDS 6033..7268 product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956071.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 gene preA assembly_gap 7322..7336 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7409..8419) product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275118.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene mglC CDS complement(8435..9064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23310 note possible pseudo, frameshifted CDS complement(8995..9936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 note possible pseudo, frameshifted CDS complement(9997..10995) product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036964.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene mglB CDS complement(11275..12315) product HTH-type transcriptional regulator GalS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628648.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene galS sequence105 source 1..12235 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(22..1425) product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075716.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(1437..1724) product ethanolamine utilization microcompartment protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762196.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene eutN CDS complement(1831..2124) product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene eutM CDS complement(2163..3179) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582977.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene pta CDS complement(3176..3979) product ethanolamine utilization cob(I)yrinic acid a,c-diamide adenosyltransferase EutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651298.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene eutT CDS complement(3976..4677) product ethanolamine utilization acetate kinase EutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733906.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene eutQ CDS complement(4652..5131) product ethanolamine utilization acetate kinase EutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820763.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene eutP CDS complement(5144..5479) product ethanolamine utilization microcompartment protein EutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356956.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene eutS CDS complement(5772..8051) product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342644.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene maeB CDS 8340..9290 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003709.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene tal CDS 9310..11298 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087280.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene tkt CDS 11612..12055 product PTS mannitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239650.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene cmtB sequence106 source 1..12206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 322..1704 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412379.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 1741..2463 product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520804.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene folM CDS complement(2460..2795) product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524868.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 2924..3643 product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092508.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene rstA CDS 3647..4948 product two-component system sensor histidine kinase RstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732512.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene rstB CDS 5012..5953 product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135181.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene tus CDS complement(5950..7353) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099085.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene fumC CDS complement(7496..9142) product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066639.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene fumB CDS 9341..10516 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170664.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene manA CDS 10617..12125 product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043339.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 sequence107 source 1..12117 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(470..1408) product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292460.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 gene psuG CDS complement(1396..2337) product pseudouridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208118.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(2760..4451) product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854447.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene fruA CDS complement(4468..5406) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091263.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene fruK CDS complement(5406..6449) product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487223.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene fruB CDS 6903..8084 product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551980.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene setB CDS complement(8081..8335) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389030.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 8490..9062 product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136827.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene yeiP CDS 9285..10751 product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091940.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 10869..11855 product zinc-binding GTPase YeiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198828.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene yeiR sequence108 source 1..12100 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(590..802) product cold shock-like protein CspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087763.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene cspH CDS 1088..1300 product cold shock protein CspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066490.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene cspG CDS 1694..1867 product addiction module toxin, GnsA/GnsB family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019197.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(1916..2989) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829662.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(3061..5775) product TMAO reductase system sensor histidine kinase/response regulator TorS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300633.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene torS CDS 5888..6916 product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264933.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene torT CDS complement(6889..7581) product two-component system response regulator TorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120125.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene torR CDS 7711..8883 product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230242.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene torC CDS 8883..11429 product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062091.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene torA CDS 11426..12025 product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209894.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene torD sequence109 source 1..11929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1263..1856) product reactive chlorine species resistance protein RclC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299021.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene rclC CDS complement(1868..2104) product reactive chlorine resistance periplasmic protein RclB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000474084.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene rclB CDS complement(2213..3538) product reactive chlorine resistance oxidoreductase RclA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046307.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene rclA CDS 3764..4618 product reactive chlorine-specific transcriptional regulator RclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339594.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene rclR CDS 5145..5864 product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102108.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS 5875..7302 product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023927.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 7295..7990 product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370307.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(8233..8901) product protein YkgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209100.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 gene ykgH CDS complement(9114..10784) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159094.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene betA misc_feature complement(10798..>11929) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000089110.1:betaine-aldehyde dehydrogenase locus_tag LOCUS_23860 sequence110 source 1..11866 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(52..3060) product Tn3-like element Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143760.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(3082..3219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 3224..3775 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213258.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 3791..5887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(5991..6224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(6234..7100) product 2-hydroxy-6-oxonona-2,4-dienedioate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121907.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene mhpC CDS complement(7118..8062) product 3-carboxyethylcatechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543457.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene mhpB CDS complement(8064..9728) product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007407.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 9919..10752 product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301325.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 sequence111 source 1..11856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 602..1153 product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730806.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene smrB CDS complement(1224..2045) product fimbrial adhesin YfcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698745.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene yfcO CDS complement(2047..2586) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043398.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(2583..3071) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232541.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(3068..3565) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311011.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(3580..4332) product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281606.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(4352..5248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24020 note possible pseudo, internal stop codon CDS complement(5261..6940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 note possible pseudo, internal stop codon CDS complement(7079..7642) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033316.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(8323..8808) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195819.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene sixA CDS complement(9011..11155) product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426176.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene fadJ misc_feature complement(11155..>11856) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000531952.1:acetyl-CoA C-acyltransferase FadI locus_tag LOCUS_24070 sequence112 source 1..11845 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 505..1473 product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178677.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene hcr CDS 1606..3324 product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815337.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene poxB CDS 3361..4362 product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566376.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene ltaE CDS 4373..5803 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136554.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 5866..6915 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069300.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS complement(6912..7742) product N-acetylmuramoyl-L-alanine amidase AmiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252135.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene amiD CDS complement(7739..8062) product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160737.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 8188..8703 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270734.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 8849..9649 product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027205.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene artP CDS 9667..10398 product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756569.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene artJ CDS 10405..11121 product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001691.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene artQ CDS 11121..11789 product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464491.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene artM sequence113 source 1..11792 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1144..1464) product phosphate starvation-inducible protein PsiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295332.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene psiF CDS complement(1583..2998) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814403.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene phoA CDS complement(3099..3359) product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792970.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene iraP CDS 3822..4916 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413677.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene ddlA CDS complement(4940..5152) product DUF2754 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295334.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 5412..5720 product YaiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763151.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(5779..6873) product surface-exposed outer membrane lipoprotein YaiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092067.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 gene yaiW CDS complement(6886..8106) product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301663.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 gene sbmA CDS 8458..9615 product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830741.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene ampH CDS complement(9616..10239) product hydrogen peroxide resistance inhibitor IprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295335.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene iprA misc_feature complement(10327..>11792) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000556441.1:autotransporter outer membrane beta-barrel domain-containing protein locus_tag LOCUS_24300 sequence114 source 1..11749 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 499..1074 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749261.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(1116..2168) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144615.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 2393..3313 product kdo(2)-lipid IV(A) lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183364.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene lpxL CDS 3485..4711 product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074172.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene mdtG CDS 4794..5168 product acidic protein MsyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180056.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(5169..5396) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237205.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(5569..8112) product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295445.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene mdoH CDS complement(8105..9658) product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001343212.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene mdoG CDS 10034..11191 product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070375.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene mdoC CDS complement(11199..11444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 sequence115 source 1..11590 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 580..686 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(750..3191) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076332.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene rnr CDS complement(3230..3655) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177639.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene nsrR CDS complement(3860..5158) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527955.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene purA CDS complement(5262..5459) product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089295.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(5541..6545) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232412.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene hflC CDS complement(6548..7570) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312488.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene hflK note possible pseudo, frameshifted CDS complement(7506..7805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 note possible pseudo, frameshifted CDS complement(7891..9171) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460362.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene hflX CDS complement(9247..9555) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051883.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene hfq CDS complement(9641..10591) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280345.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 misc_feature complement(10584..>11590) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001122505.1:DNA mismatch repair endonuclease MutL locus_tag LOCUS_24510 sequence116 source 1..11492 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(431..1519) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065016.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(1522..2379) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873894.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 gene nfo CDS complement(2453..3502) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182053.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS 3676..4482 product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548294.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene yieE CDS 4687..6156 product lysine-specific permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253273.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene lysP CDS 6546..8441 product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489247.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene cirA CDS complement(8473..9309) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425438.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene yeiG CDS 9567..10235 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139613.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene folE CDS 10252..11409 product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440926.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene yeiB sequence117 source 1..11391 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(355..1311) product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812053.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene rseB CDS complement(1311..1961) product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168459.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene rseA CDS complement(1994..2569) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295364.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene rpoE CDS 2977..4599 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094491.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene nadB CDS complement(4584..5243) product tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295363.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene trmN CDS 5453..6787 product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219203.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene srmB assembly_gap 6852..6967 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 8444..8539 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9131..9820 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262716.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 gene ung CDS complement(9868..10905) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997403.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 sequence118 source 1..11180 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(271..1020) product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029474.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene btuD CDS complement(1020..1571) product bifunctional thioredoxin/glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154168.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene btuE CDS complement(1634..2614) product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956528.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene btuC CDS complement(2715..3014) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229265.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene ihfA CDS complement(3019..5406) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672380.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene pheT CDS complement(5421..6404) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018596.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene pheS CDS complement(6855..7211) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124850.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene rplT CDS complement(7264..7461) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124225.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene rpmI CDS complement(7558..7992) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058403.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene infC CDS complement(8104..10032) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144202.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 gene thrS CDS 10556..11029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 note possible pseudo, frameshifted sequence119 source 1..11086 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 405..1007 product lipopolysaccharide core heptose(II)-phosphate phosphatase Ais inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879112.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene ais CDS complement(1046..1471) product nucleoside triphosphatase NudI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300564.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 gene nudI CDS 1750..2292 product YfaZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300392.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 2392..3594 product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921621.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 3814..4596 product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894185.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS 4611..5816 product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001319848.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene rhmD CDS 5873..7162 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100890.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 7180..7983 product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992954.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene yfaU CDS complement(8024..8926) product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140553.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(9119..10309) product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000379.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene glpC misc_feature complement(10306..>11086) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001209927.1:glycerol-3-phosphate dehydrogenase subunit GlpB locus_tag LOCUS_24900 sequence120 source 1..11081 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(291..1001) product fimbrial chaperone EcpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350485.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene ecpE CDS complement(970..2541) product fimbrial adhesin EcpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310578.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene ecpD CDS complement(2603..3127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 note possible pseudo, frameshifted CDS complement(3054..5165) product fimbrial usher EcpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131096.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene ecpC note possible pseudo, frameshifted CDS complement(5191..5859) product fimbrial chaperone EcpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716398.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene ecpB CDS complement(5917..6504) product common pilus major fimbrillin subunit EcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730972.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene ecpA CDS complement(6579..7121) product ECP biosynthesis operon DNA-binding transcriptional regulator EcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220247.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene ecpR CDS 8005..8172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(8347..8613) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803998.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 10190..11077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25000 sequence121 source 1..11011 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(177..716) product DNA utilization protein HofN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069315.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene hofN CDS complement(716..1495) product DNA utilization protein HofM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295166.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene hofM CDS 1636..4167 product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336003.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene mrcA CDS complement(4333..4893) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045744.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene nudE CDS 5213..7348 product intracellular growth attenuator protein IgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104533.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene igaA CDS 7413..8081 product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936227.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene yrfG CDS 8092..8493 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660483.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene hslR CDS 8518..9216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 note possible pseudo, frameshifted CDS 9188..9391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 note possible pseudo, frameshifted CDS complement(9454..10962) product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370879.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 sequence122 source 1..10980 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(29..946) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904502.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 1092..1769 product iron ABC transporter ATP-binding protein FetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157540.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene fetA CDS 1756..2535 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295323.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene fetB CDS complement(2598..3452) product chaperedoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300573.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene cnoX CDS complement(3513..4322) product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148959.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene ybbO CDS complement(4312..4968) product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297298.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene tesA CDS 4906..5592 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110573.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS 5589..8003 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561872.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 sequence123 source 1..10908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(110..661) product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166270.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene yjgA CDS 755..2107 product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162171.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene pmbA CDS 2349..2651 product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232245.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene cybC CDS complement(2696..3160) product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106233.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 gene nrdG CDS complement(3318..5456) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187778.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 gene nrdD CDS complement(5850..7505) product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336303.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 gene treC CDS complement(7555..8976) product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001407733.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene treB CDS complement(9095..10042) product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181307.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene treR sequence124 source 1..10776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 48..704 product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141337.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene pphB CDS complement(755..1522) product DNA-binding transcriptional repressor YgbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300386.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene ygbI CDS 1718..2626 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848004.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 2623..3789 product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393459.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 3881..4519 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278994.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 4524..5300 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136934.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 5434..6753 product GntP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104441.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(6847..7839) product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081588.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene rpoS CDS complement(7902..9041) product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272590.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene nlpD CDS complement(9181..9807) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254708.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene pcm CDS complement(9801..10562) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295182.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene surE sequence125 source 1..10551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 475..858 product cell division protein DrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313057.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene drpB CDS 898..1593 product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365562.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 1660..3078 product DNA-cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157239.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene dcm CDS 3059..3529 product VSPR family DNA mismatch endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786005.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene vsr CDS complement(3518..4438) product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212226.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene yedA CDS 4611..5528 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922686.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 5607..5789 product DUF2158 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009307.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 5978..7654 product cellulose biosynthesis regulator diguanylate cyclase DgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350521.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 gene dgcQ CDS complement(7651..8466) product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491520.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(8764..8991) product peroxide/acid resistance protein YodD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844800.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene yodD CDS 9154..9342 product protein DsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867217.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene dsrB CDS complement(9386..10009) product transcriptional regulator RcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104001.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene rcsA sequence126 source 1..10430 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1122..1886 product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692135.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 1906..2844 product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080722.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 2900..4189 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278525.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 4186..4479 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081081.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 4482..6182 product medium-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553704.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene fadK CDS complement(6239..8617) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069375.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene ppsA CDS 9031..9783 product posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368046.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene ppsR sequence127 source 1..10408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2433 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001126348.1:carbamoyl-phosphate synthase large subunit locus_tag LOCUS_25570 CDS complement(2481..2660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 2695..3090 product carnitine metabolism transcriptional regulator CaiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333125.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene caiF CDS complement(3176..3766) product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122871.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene caiE CDS complement(3772..4557) product crotonobetainyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295419.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 gene caiD CDS complement(4666..6234) product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350478.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene caiC CDS complement(6293..7510) product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349936.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene caiB CDS complement(7639..8781) product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347117.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene caiA CDS complement(8812..10152) product L-carnitine/gamma-butyrobetaine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787104.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 gene caiT sequence128 source 1..10278 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(178..1104) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937424.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene gluQRS CDS complement(1141..1596) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155227.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 gene dksA CDS complement(1774..2478) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000396036.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene sfsA CDS complement(2493..3023) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294700.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene thpR CDS 3052..5526 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938639.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene hrpB CDS 5529..5735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 5722..8256 product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918162.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene mrcB sequence129 source 1..10176 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1711 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000965936.1:fatty acid oxidation complex subunit alpha FadB locus_tag LOCUS_25730 CDS 1721..2884 product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438725.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene fadA CDS complement(3265..3966) product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209826.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene fre CDS complement(4012..5505) product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339804.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 gene ubiD CDS 5672..6160 product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192396.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene rfaH CDS complement(6157..6939) product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459630.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene tatD CDS complement(6981..7757) product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109942.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene tatC CDS complement(7760..8275) product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459594.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene tatB CDS complement(8279..8548) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295260.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene tatA CDS complement(8627..10138) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187530.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene ubiB sequence130 source 1..9914 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(24..1283) product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311268.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene rhaA CDS complement(1280..2749) product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144073.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 gene rhaB CDS 3037..3873 product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217137.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene rhaS CDS 4010..4795 product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336056.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene rhaR CDS complement(4792..5826) product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063526.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene rhaT CDS 6111..6731 product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122641.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene sodA CDS 6991..7974 product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166063.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene kdgT CDS 8123..8797 product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270260.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 gene yiiM assembly_gap 8869..8875 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8909..9883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 sequence131 source 1..9910 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(333..1625) product penicillin binding protein PBP4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001327042.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene pbp4b CDS complement(1642..3066) product PTS N-acetylmuramic acid transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040483.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 gene murP CDS complement(3070..3966) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159160.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 gene murQ CDS 4130..4987 product HTH-type transcriptional regulator MurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966470.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 gene murR CDS 5116..5907 product SDR family oxidoreductase UcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517431.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 gene ucpA CDS 6211..7227 product thiosulfate/sulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290230.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 gene cysP CDS 7227..8060 product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458406.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 gene cysT CDS 8060..8935 product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852686.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene cysW CDS 8925..9461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26000 note possible pseudo, frameshifted sequence132 source 1..9856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(558..1670) product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126072.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene potF CDS complement(2021..2497) product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203025.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(2585..3487) product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684321.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene rimK CDS complement(3548..4270) product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189159.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 gene nfsA CDS complement(4254..4541) product DUF1418 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201560.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 4701..4958 product glutaredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195240.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene grxA CDS 5635..7320 product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024876.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(7495..8031) product DNA-binding transcriptional regulator RcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295289.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 gene rcdA CDS 8115..9323 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217859.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 sequence133 source 1..9840 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(260..454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 766..1296 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564489.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 gene rppH CDS 1309..3555 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957910.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene ptsP CDS 3706..4581 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204658.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 gene lgt CDS 4588..5382 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816232.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene thyA CDS 5566..6036 product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 6027..6590 product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144315.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 6587..6994 product DUF2509 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078376.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 6979..7302 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276460.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 sequence134 source 1..9814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001269327.1:autotransporter assembly complex protein TamA locus_tag LOCUS_26190 CDS 1207..4986 product autotransporter assembly complex protein TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060911.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene tamB CDS 4989..5330 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219160.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS 5542..5793 product type II toxin-antitoxin system antitoxin ChpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223208.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 gene chpS CDS 5787..6137 product endoribonuclease toxin ChpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239577.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 gene chpB CDS complement(6217..6747) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055075.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 gene ppa CDS 7057..8013 product galactofuranose ABC transporter substrate-binding protein YtfQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265913.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene ytfQ CDS 8153..9655 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205805.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 sequence135 source 1..9682 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 212..1153 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091499.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 1204..2490 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287715.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 2487..2774 product ferredoxin-like protein FixX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203741.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene fixX CDS 2831..4162 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183198.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 4270..4800 product glutathione-regulated potassium-efflux system oxidoreductase KefF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600725.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene kefF CDS 4793..6655 product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377098.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene kefC CDS 6736..7326 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301983.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene folA CDS complement(7404..8246) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257192.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene apaH CDS complement(8253..8630) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610901.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene apaG CDS complement(8633..9454) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065381.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene rsmA sequence136 source 1..9670 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(797..2032) product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019827.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene narK CDS complement(2283..2501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069498.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 2527..4323 product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918073.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene narX CDS 4316..4966 product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070491.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene narL CDS complement(4967..6361) product inverse autotransporter invasin YchO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086217.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene ychO CDS 6546..6899 product DsrE/F sulfur relay family protein YchN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169669.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene ychN CDS complement(6943..7617) product glutathione-specific gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336325.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene chaC CDS complement(7796..8026) product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146444.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene chaB CDS 8296..9396 product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063607.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene chaA sequence137 source 1..9658 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 521..865 product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202798.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(869..2458) product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194927.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene yejF CDS complement(2460..3485) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088923.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(3485..4579) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501604.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(4580..6400) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637046.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(6476..7969) product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470560.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(8213..8779) product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241011.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene mepS sequence138 source 1..9630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 647..730 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1402..2289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26530 note possible pseudo, frameshifted assembly_gap 2217..2284 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2286..2924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26540 note possible pseudo, frameshifted assembly_gap 2877..2918 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3026..3457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26550 note possible pseudo, frameshifted assembly_gap 3529..3635 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3954..4139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001328114.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS 4453..5547 product DNA-binding transcriptional activator/c-di-GMP phosphodiesterase PdeL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301264.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 gene pdeL CDS complement(5589..6521) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084394.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(6613..7110) product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013892.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 7368..7973 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023635.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 8013..8876 product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310582.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 sequence139 source 1..9565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1070..1651 product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009885.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene acpH CDS complement(1656..3473) product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930752.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene malZ CDS complement(3629..5002) product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295329.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene proY CDS complement(5078..6397) product branched-chain amino acid transporter carrier protein BrnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149639.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene brnQ CDS complement(6804..8099) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893623.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene phoR CDS complement(8157..8846) product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113933.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene phoB sequence140 source 1..9515 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 319..591 product DUF3811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207634.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(724..1596) product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936377.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene rluF CDS 1808..2497 product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421763.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene pepE CDS complement(2588..4219) product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956830.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS complement(4439..6952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 note possible pseudo, internal stop codon CDS complement(6983..8122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 note possible pseudo, internal stop codon CDS 8322..9146 product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226403.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene iclR sequence141 source 1..9515 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 738..1538 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237072.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene nagB CDS 1598..2746 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271153.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene nagA CDS 2755..3975 product DNA-binding transcriptional regulator NagC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187594.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene nagC CDS 4023..4775 product ribonucleotide monophosphatase NagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153129.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene nagD CDS 5164..6828 product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337077.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene asnB tRNA 7208..7284 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 7294..7378 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 assembly_gap 7422..7544 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 7578..7654 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 7702..7776 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 7814..7888 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(8042..9217) product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184541.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene ubiF sequence142 source 1..9496 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 414..1751 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098105.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 1729..2508 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299652.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS 2505..3365 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299097.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(3513..4088) product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130266.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(4105..4365) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109529.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(4356..5657) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301334.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(5705..6070) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987944.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene queD CDS 6386..8185 product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211913.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene cysJ sequence143 source 1..9232 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(246..1442) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860444.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(1566..2123) product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362029.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 note possible pseudo, internal stop codon CDS complement(2561..2785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 2739..3701 product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018417.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene tauA CDS 3714..4481 product taurine ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939375.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene tauB CDS 4478..5305 product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114620.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene tauC CDS 5302..6153 product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004027.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene tauD CDS complement(6260..7234) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295337.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene hemB CDS 7758..9218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26970 sequence144 source 1..9144 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 360..1004 product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983609.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene cheZ CDS 1206..2354 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278954.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene flhB CDS 2347..4425 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066983.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene flhA CDS 4425..4817 product flagellar protein FlhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259583.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene flhe CDS complement(4937..5425) product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299676.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(5602..7335) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025322.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene argS CDS 7551..8117 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326725.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS 8131..8877 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185741.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene cutC sequence145 source 1..9134 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(764..1198) product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300461.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene uspF CDS complement(1285..2370) product porin OmpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837921.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene ompN assembly_gap 1310..1333 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2737..6261) product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628244.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 gene nifJ CDS 6535..6801 product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295715.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(6798..7220) product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298828.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 gene hslJ CDS complement(7331..8320) product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762236.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene ldhA sequence146 source 1..9007 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(51..1502) product co-chaperone DjlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300403.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene djlC CDS complement(1499..2113) product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030934.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 2308..2862 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035674.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(2872..4299) product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786572.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(4296..5003) product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367023.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 5167..6144 product Sel1 family TPR-like repeat protein YbeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578178.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene ybeQ CDS complement(6214..6696) product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044880.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 sequence147 source 1..8989 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 59..1237 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127781.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(1234..2229) product flagella biosynthesis regulator Flk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615834.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene flk CDS 2328..3464 product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699148.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene pdxB CDS 3530..4543 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289167.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 4543..5355 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283586.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene truA CDS 5438..6097 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364335.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 6253..7167 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118404.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene accD CDS 7237..8505 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584546.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 gene folC sequence148 source 1..8865 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(305..2317) product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292679.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene opgB CDS complement(2571..3065) product DUF2501 domain-containing protein YjjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001308243.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 gene yjjA CDS complement(3114..3851) product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799911.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene dnaC CDS complement(3854..4393) product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098818.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene dnaT CDS complement(4500..4973) product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538191.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS complement(4964..5674) product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001338213.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS 6353..7078 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936635.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS 7090..7713 product DNA-binding transcriptional activator BglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094869.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene bglJ CDS complement(7751..8539) product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331618.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 gene fhuF sequence149 source 1..8814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3055..4770) product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300881.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene narQ CDS 4961..6940 product formate-dependent uric acid utilization protein AegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078880.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene aegA CDS 7008..7583 product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300814.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene nudK CDS 7868..8752 product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270542.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 sequence150 source 1..8778 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(814..1899) product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386618.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene acrA CDS 2149..2796 product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101737.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 gene acrR CDS 2924..6286 product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177732.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene mscK CDS complement(6498..6659) product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051153.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene rsmS CDS complement(6673..7200) product primosomal replication protein N'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844874.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene priC CDS 7270..7647 product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188905.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 7800..8351 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127356.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene apt sequence151 source 1..8619 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(142..510) product protein YffN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683389.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene yffN CDS complement(522..767) product protein YffM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723122.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene yffM assembly_gap 1113..1159 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1259..1900) product protein YffL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458337.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene yffL CDS complement(2091..3299) product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047773.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 3478..4839 product ethanolamine ammonia-lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769961.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene eutB CDS 4860..5747 product ethanolamine ammonia-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372316.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene eutC CDS 5757..6179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27530 note possible pseudo, internal stop codon, frameshifted assembly_gap 6104..6132 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6353..6853 product ethanolamine utilization microcompartment protein EutK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606257.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 gene eutK CDS 6899..7951 product HTH-type transcriptional regulator EutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753690.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene eutR misc_feature complement(7957..>8619) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000801365.1:oxygen-dependent coproporphyrinogen oxidase locus_tag LOCUS_27560 sequence152 source 1..8548 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 257..1324 product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080105.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene hisB CDS 1324..1914 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103560.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene hisH CDS 1914..2651 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586462.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene hisA CDS 2633..3409 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880182.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene hisF CDS 3403..4014 product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954911.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene hisIE CDS complement(4110..5090) product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393575.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene wzzB CDS complement(5236..6402) product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704857.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene ugd CDS complement(6651..8057) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043484.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene gndA sequence153 source 1..8326 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2240 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001267253.1:mechanosensitive channel protein locus_tag LOCUS_27650 CDS complement(2237..3163) product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295299.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 gene rlmF CDS 3439..3699 product DUF1471 family periplasmic protein McbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710619.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene mcbA CDS complement(3754..4002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 3964..6246 product catecholate siderophore receptor Fiu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000430057.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 6288..6965 product PKHD-type hydroxylase YbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990177.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene ybiX CDS 7039..7305 product C4-type zinc finger protein YbiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146343.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene ybiI CDS 7570..7830 product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849301.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene ybiJ CDS complement(8059..8292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27730 sequence154 source 1..8232 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(410..1204) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365173.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS 1342..1683 product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617184.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 assembly_gap 1724..1883 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2029..4533) product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083955.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene copA CDS 4795..5727 product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883034.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene glsA CDS 5730..7022 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982172.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS 7147..7554 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026747.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene cueR CDS complement(7555..8013) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970323.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 sequence155 source 1..8229 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(116..1042) product aldose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052655.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS complement(1156..2397) product sulfoquinovose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870916.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene yihS CDS complement(2414..3292) product sulfofructosephosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046453.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene yihT CDS complement(3316..4212) product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718893.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene yihU CDS 4380..5276 product sulfofructose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621656.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 gene yihV CDS 5310..6095 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059678.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 6194..6793 product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295269.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene yihX CDS 6787..7659 product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920762.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS 7656..8093 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560983.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 gene dtd sequence156 source 1..8204 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..619 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000946934.1:exodeoxyribonuclease V subunit gamma locus_tag LOCUS_27900 CDS 795..3683 product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138201.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene ptrA CDS 3676..7218 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285993.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene recB sequence157 source 1..8197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 119..1270 product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741518.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene yiaY CDS 1435..2973 product aldehyde dehydrogenase AldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183980.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 gene aldB CDS complement(3192..3404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332751.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 3518..3841 product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478195.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 3847..4983 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364884.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS complement(4980..5954) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164036.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 6078..6818 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906819.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(7165..7860) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893142.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 gene araD sequence158 source 1..8181 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 316..1131 product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188362.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene ygiD CDS complement(1169..2329) product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442860.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(2335..2877) product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831543.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(3154..4635) product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735278.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 gene tolC CDS 4840..5469 product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917117.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 gene nudF CDS 5470..5892 product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833393.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS 5917..6744 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444747.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 gene cpdA CDS 6744..7325 product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105733.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 gene yqiA sequence159 source 1..8074 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(14..793) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000563040.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(790..1863) product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299799.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS complement(1985..2146) product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176651.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(2273..2878) product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295748.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 gene osmY CDS complement(3271..4860) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175940.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 gene prfC CDS complement(4951..5628) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870710.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 gene yjjG CDS complement(5643..6089) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092461.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 gene rimI CDS complement(6058..6471) product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204012.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 gene holD CDS 6574..7605 product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272330.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 gene rsmC tRNA 7873..7959 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 7988..8074 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 sequence160 source 1..8071 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1203..2132) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208520.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 gene ilvE CDS complement(2152..2415) product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983255.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 gene ilvM CDS complement(2412..2948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28200 note possible pseudo, frameshifted CDS complement(3073..4056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28210 note possible pseudo, frameshifted CDS 4647..6167 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058964.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(6192..6530) product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841001.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 gene maoP CDS 6649..7488 product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379245.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene hdfR tRNA complement(7584..7659) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(7668..7744) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 rRNA complement(7802..7912) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence161 source 1..7875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..994 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000179510.1:mal regulon transcriptional regulator MalI locus_tag LOCUS_28250 CDS 1106..1873 product 7-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483353.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene hdhA CDS 2094..2684 product DNA-binding transcriptional regulator UidR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969092.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 gene uidR CDS 3075..4886 product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945878.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene uidA CDS 4883..6256 product glucuronide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075849.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 gene uidB CDS 6307..7560 product glucuronide uptake porin UidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227023.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene uidC sequence162 source 1..7819 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(5..736) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340895.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene dnaQ CDS 801..1268 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917883.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene rnhA CDS complement(1265..1987) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326702.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS 2021..2776 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052715.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene gloB CDS 2986..4206 product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644685.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 gene mltD CDS complement(4254..4877) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016007.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(4881..5684) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230983.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS 5925..6839 product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648572.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 gene yafC CDS complement(6836..7639) product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997010.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene dkgB sequence163 source 1..7786 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 291..797 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084387.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene tpx CDS complement(841..2382) product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300658.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 gene tyrR CDS complement(2530..3591) product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138728.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS complement(3588..4985) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825775.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 5141..6139 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075375.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(6250..7155) product monomeric porin OmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735257.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 gene ompG sequence164 source 1..7746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..828 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000111836.1:acyl-CoA synthetase FdrA locus_tag LOCUS_28460 CDS 828..2954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 3056..3595 product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096705.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 3617..3820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(3719..4552) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000419081.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 gene fghA CDS complement(4646..5755) product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842106.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene frmA CDS complement(5790..6065) product formaldehyde-responsive transcriptional repressor FrmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141271.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 gene frmR CDS complement(6253..7026) product YaiO family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000596084.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(7028..7471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 sequence165 source 1..7727 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2594..3697 product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865568.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 gene ompC CDS 3809..4864 product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406064.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 gene apbE CDS complement(4986..5204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 5187..6002 product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710375.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene ada CDS 6002..6652 product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884971.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 gene alkB sequence166 source 1..7695 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 16..534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS 569..1654 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333535.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 gene aroC CDS 1658..2482 product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043825.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 gene mepA CDS 2482..3291 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447361.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS 3291..3839 product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089222.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 gene epmC CDS 3873..4151 product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559764.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(4272..6278) product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683799.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene mnmC CDS 6437..7657 product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817178.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene fabB sequence167 source 1..7571 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 150..305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28680 note possible pseudo, internal stop codon CDS 341..1708 product guanine/hypoxanthine transporter GhxQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012163.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 gene ghxQ CDS complement(1744..2232) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838428.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(2232..3110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28710 note possible pseudo, frameshifted CDS complement(3104..4171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28720 note possible pseudo, frameshifted assembly_gap 3149..3191 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4592..6040 product urate/proton symporter UacT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295374.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene uacT CDS 6290..6838 product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192820.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene idi CDS complement(6882..7571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28750 sequence168 source 1..7462 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..802 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001256538.1:phosphatidylglycerophosphatase B locus_tag LOCUS_28760 CDS 951..1259 product lipopolysaccharide assembly protein LapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876286.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 gene lapA CDS 1266..2435 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891353.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 gene lapB CDS 2677..3366 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176270.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 gene pyrF CDS 3366..3692 product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295580.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 gene yciH CDS complement(3818..4036) product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498253.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene osmB CDS complement(4305..5054) product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088620.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(5144..5317) product protein YciZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288368.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 gene yciZ CDS complement(5465..7363) product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859945.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 gene pdeR sequence169 source 1..7378 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(173..694) product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001341279.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 gene yjjX CDS 737..1384 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942344.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 gene gpmB CDS complement(1381..2250) product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371666.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene robA CDS 2461..2934 product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875487.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene creA CDS 2947..3636 product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188654.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene creB CDS 3636..5060 product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219577.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene creC CDS 5118..6470 product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920294.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 gene creD CDS complement(6530..7246) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194358.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 gene arcA sequence170 source 1..7353 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1359 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001192973.1:fumarate reductase (quinol) flavoprotein subunit locus_tag LOCUS_28930 CDS 1352..2086 product fumarate reductase iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829498.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene frdB CDS 2097..2492 product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208757.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene frdC CDS 2503..2862 product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299198.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene frdD CDS 2925..4058 product BlaEC family class C beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336292.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 gene ampC CDS 4147..4680 product lipocalin Blc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238378.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene blc CDS complement(4677..4994) product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118482.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene sugE CDS complement(5170..5316) product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239596.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 gene ecnB CDS complement(5604..6170) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257278.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene efp CDS 6212..7240 product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940549.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene epmB sequence171 source 1..7349 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(40..576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(581..1045) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133106.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene fliL CDS complement(1150..2277) product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620071.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(2274..2717) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807579.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 gene fliJ CDS complement(2736..4109) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213294.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 gene fliI CDS complement(4109..4795) product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282715.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 gene fliH CDS complement(4788..5783) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067950.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene fliG CDS complement(5776..7329) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994429.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 gene fliF sequence172 source 1..7294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(809..2149) product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899522.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 gene dcuB CDS complement(2720..3439) product two-component system response regulator DcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611288.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene dcuR CDS complement(3436..5055) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216477.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 5248..5478 product 4Fe-4S mono-cluster protein YjdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371704.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene yjdI CDS 5490..5762 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405651.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS 5989..6285 product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398619.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 gene ghoS CDS 6313..6486 product type V toxin-antitoxin system toxin GhoT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173343.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 gene ghoT CDS complement(6605..7294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 sequence173 source 1..7273 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 159..698 product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326929.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 997..1881 product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295328.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene tsx CDS complement(2058..2405) product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974813.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene yajD CDS complement(2534..3505) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046637.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene secF CDS complement(3516..5330) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934822.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene secD CDS complement(5391..5723) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007629.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene yajC CDS complement(5746..6873) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667319.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 sequence174 source 1..7250 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 93..386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 615..2912 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360263.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 2920..4248 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086904.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(4295..5620) product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049367.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene rimO CDS 5833..6216 product biofilm formation regulator BssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497137.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene bssR sequence175 source 1..7062 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..726 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001132469.1:efflux RND transporter permease AcrB locus_tag LOCUS_29310 CDS 1272..1646 product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344800.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene tomB CDS 1672..1890 product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291435.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 2062..2613 product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102564.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 gene maa CDS 2729..3199 product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136192.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS 3357..4913 product cyclic-guanylate-specific phosphodiesterase PdeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310610.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene pdeB CDS complement(4955..5308) product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878140.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 5687..5998 product DNA base-flipping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300427.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 gene atl CDS complement(6029..6601) product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779842.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS 6819..6995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29400 note possible pseudo, internal stop codon sequence176 source 1..6963 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 432..746 product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619493.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 gene rhaM CDS 1047..1493 product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729595.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 1504..2955 product PTS fructose-like transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446023.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS 2945..4015 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019484.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 4015..5763 product putative frv operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931299.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS complement(5813..6868) product YiiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295677.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 sequence177 source 1..6944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(282..845) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896738.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 gene idnK CDS 1062..2093 product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197411.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 gene idnD CDS 2117..2881 product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998695.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 gene idnO CDS 2943..4262 product gnt-II system L-idonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128335.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 gene idnT CDS 4329..5327 product DNA-binding transcriptional regulator IdnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309159.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 gene idnR CDS 5405..6907 product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294573.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 sequence178 source 1..6935 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(130..1212) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295681.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 gene lptG CDS complement(1212..2219) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584114.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 gene lptF CDS 2579..4090 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397144.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene pepA CDS 4250..4693 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786400.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene holC sequence179 source 1..6909 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1012..2469) product PTS cellobiose/arbutin/salicin transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107828.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene ascF CDS 2738..3739 product DNA-binding transcriptional regulator AscG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001394680.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene ascG CDS 3888..4415 product electron transport protein HydN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078777.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 gene hydN CDS 4568..6820 product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107704.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 gene hypF sequence180 source 1..6898 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001295576.1:type I DNA topoisomerase locus_tag LOCUS_29610 CDS 1210..2184 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776253.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 gene cysB CDS 2515..2643 product YmiA family putative membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908596.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 2646..2813 product protein YciX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297116.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 gene yciX CDS 3186..5861 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099535.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene acnA CDS complement(5925..6515) product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176295.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 gene ribA sequence181 source 1..6832 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..592 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000118826.1:8-amino-7-oxononanoate synthase locus_tag LOCUS_29670 CDS 579..1427 product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246761.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene bioC CDS 1420..2097 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044843.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene bioD CDS 2676..4697 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042533.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 gene uvrB assembly_gap 4753..4823 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4891..5799) product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295302.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene yvcK sequence182 source 1..6818 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 21..941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(1003..2334) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237947.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene argA CDS 2566..3819 product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016907.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 gene amiC tRNA complement(3893..3969) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 4208..5275 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678646.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 gene mltA assembly_gap 5369..5450 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5520..6326 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117728.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene tcdA sequence183 source 1..6696 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(62..220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(217..867) product protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393555.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene yabP CDS complement(1162..1977) product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200579.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene djlA CDS 2232..2963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29800 note possible pseudo, internal stop codon CDS 2994..4586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29810 note possible pseudo, internal stop codon CDS 4639..5925 product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800457.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 gene surA sequence184 source 1..6685 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001215339.1:ABC transporter substrate-binding protein locus_tag LOCUS_29830 CDS 886..2388 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224958.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS 2388..3041 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300558.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 3108..4415 product thiosulfate sulfurtransferase YnjE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350515.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 gene ynjE CDS complement(4424..5044) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295484.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS 5131..5538 product CTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781888.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 gene nudG CDS complement(5504..5776) product YnjH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085240.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 sequence185 source 1..6652 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(452..1540) product multidrug efflux RND transporter subunit MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678989.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene mdtA CDS 2587..3246 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003154.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 3324..4004 product protein-serine/threonine phosphatase PphC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119090.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 gene pphC assembly_gap 4027..4242 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4265..4681) product DUF2314 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722348.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 sequence186 source 1..6646 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1025 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001194582.1:anthranilate synthase component I locus_tag LOCUS_29940 CDS 1025..2620 product bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763511.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 gene trpD CDS 2621..3982 product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983871.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene trpCF CDS 3994..5187 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209520.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene trpB CDS 5187..5495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 note possible pseudo, frameshifted CDS 5476..5979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29990 note possible pseudo, frameshifted CDS 6336..6539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30000 sequence187 source 1..6610 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(105..668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30010 note possible pseudo, frameshifted CDS complement(665..892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30020 note possible pseudo, frameshifted CDS 985..1368 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939747.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene crcB CDS complement(1422..1631) product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034825.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene cspE CDS complement(1806..2366) product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103094.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene pagP CDS 2955..4340 product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955063.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene dcuC CDS complement(4381..5061) product two-component response regulator DpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126500.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene dpiA misc_feature complement(5030..>6610) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000939767.1:sensor histidine kinase DpiB locus_tag LOCUS_30080 sequence188 source 1..6593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 322..1062 product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225679.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene dpaA CDS complement(1033..1800) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333380.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS complement(2006..2584) product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284050.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 gene lpcA CDS 2824..5268 product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973083.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 gene fadE CDS complement(5311..5784) product Ivy family C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532698.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 gene ivy sequence189 source 1..6438 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 574..1875 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046281.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene ygiF CDS 1898..4738 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301081.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 gene glnE CDS 4786..6219 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869178.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 gene hldE sequence190 source 1..6336 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(376..897) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295503.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 gene ruvC CDS complement(932..1672) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907248.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS complement(1701..2210) product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300367.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 gene nudB CDS complement(2271..4043) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258678.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 gene aspS CDS 4353..4919 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891621.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS 4916..5734 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639274.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 5787..6182 product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252980.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 sequence191 source 1..6210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 410..1060 product biofilm master transcriptional regulator CsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481509.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 gene csgD CDS 1065..1454 product curli production assembly/transport protein CsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833288.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 gene csgE CDS 1479..1895 product curli production assembly/transport protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264088.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 gene csgF CDS 1922..2755 product curli production assembly/transport protein CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189321.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 gene csgG CDS complement(2819..3340) product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307110.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(3412..3966) product molecular chaperone YcdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001921.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 gene ycdY CDS complement(3990..4727) product zinc-binding phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283667.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene ycdX CDS complement(4782..5720) product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351317.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 gene ghrA tRNA 5954..6041 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 sequence192 source 1..6209 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 134..721 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295414.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 gene mog CDS complement(756..1322) product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528538.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene satP CDS complement(1471..1638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30340 note possible pseudo, internal stop codon CDS complement(1654..2184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30350 note possible pseudo, internal stop codon CDS complement(2181..2591) product DUF2541 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843565.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS 2968..4884 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516135.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 gene dnaK CDS 4973..6103 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118476.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene dnaJ sequence193 source 1..6199 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3630 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001326840.1:trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase locus_tag LOCUS_30390 CDS complement(3670..4308) product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191701.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene rutR CDS 4593..5687 product pyrimidine utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326839.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 gene rutA sequence194 source 1..6148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1990..2241 product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031530.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(2277..3326) product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422045.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 gene sohB CDS 3546..4304 product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559286.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS 4301..4891 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278906.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene cobO CDS complement(4931..5806) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291216.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 gene rluB sequence195 source 1..6037 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 458..1579 product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225229.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 gene tyrA CDS complement(1622..2782) product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200120.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene pheA CDS complement(3032..3373) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178456.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 gene raiA CDS complement(3644..4381) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197686.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene bamD CDS 4516..5409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30510 assembly_gap 5172..5248 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5303..5572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30520 sequence196 source 1..6022 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 99..1523 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162740.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 gene miaB CDS 1676..2716 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018040.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 2713..3180 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084469.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene ybeY CDS 3270..4148 product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278605.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene corC CDS 4173..5711 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853021.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene lnt sequence197 source 1..6017 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(890..1348) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295770.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene mraZ CDS complement(1950..2636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 2737..4728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 4740..5399 product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525176.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 gene rluA sequence198 source 1..5977 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(284..1789) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448136.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene glpD CDS 1979..2305 product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371928.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 gene glpE CDS 2350..3180 product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928723.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 gene glpG CDS 3197..3955 product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815099.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(3937..5535) product DNA-binding transcriptional regulator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232948.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene rtcR sequence199 source 1..5954 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(976..3135) product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899054.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 gene aas CDS 3720..4751 product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201063.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene galR misc_feature complement(4758..>5954) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001120711.1:diaminopimelate decarboxylase locus_tag LOCUS_30690 sequence200 source 1..5940 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 283..1569 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781074.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 gene thrC CDS 1922..2083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30710 assembly_gap 2126..2200 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2299..3075) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906197.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene yaaA CDS complement(3145..4575) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112606.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 assembly_gap 5613..5723 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5789..5938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30740 sequence201 source 1..5887 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1061..1288 product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135667.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS 1308..3068 product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256203.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 gene yejM tRNA 3143..3219 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS complement(3322..5655) product autotransporter YejO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554226.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 gene yejO sequence202 source 1..5867 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(113..1396) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785834.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 gene gltA CDS 1378..1569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333072.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS 2090..2494 product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263355.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 gene sdhC CDS 2488..2835 product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254365.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 gene sdhD CDS 2835..4601 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775540.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene sdhA CDS 4617..5333 product succinate dehydrogenase iron-sulfur subunit SdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235254.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene sdhB sequence203 source 1..5844 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..703 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001177086.1:glutamate/aspartate ABC transporter substrate-binding protein GltI locus_tag LOCUS_30840 CDS 873..1613 product glutamate/aspartate ABC transporter permease GltJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020941.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 gene gltJ CDS 1613..2287 product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272824.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene gltK CDS 2287..3012 product glutamate/aspartate ABC transporter ATP-binding protein GltL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631384.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 gene gltL CDS 3130..4065 product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207520.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene rihA CDS 4149..4394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30890 note possible pseudo, internal stop codon CDS 4437..5819 product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367875.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene hscC note possible pseudo, internal stop codon sequence204 source 1..5787 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 20..502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS 503..1918 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130850.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS 1915..4050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS 4241..4573 product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350529.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 sequence205 source 1..5732 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(247..1059) product 3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281379.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene hcaB CDS complement(1056..1376) product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080102.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(1376..1894) product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276072.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(1891..3252) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211172.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS 3388..4278 product DNA-binding transcriptional regulator HcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423261.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 gene hcaR CDS 4438..5577 product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244193.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 sequence206 source 1..5636 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1217..2002) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021334.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS 2321..3598 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164544.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS 3625..5103 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039688.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 sequence207 source 1..5470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 424..810 product 3-aminoacrylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126780.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene rutC CDS 818..1618 product pyrimidine utilization protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777653.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 gene rutD CDS 1628..2218 product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001176.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 2229..2723 product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028083.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 gene rutF CDS 2744..4072 product pyrimidine utilization transport protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326838.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene rutG CDS complement(4329..4502) product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273658.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 sequence208 source 1..5452 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1054..2520 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299507.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene guaB CDS 2589..4166 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138270.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene guaA CDS complement(4259..4798) product DUF5384 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755173.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS complement(4814..5329) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295476.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 sequence209 source 1..5443 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1381 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000122013.1:DNA polymerase III subunit gamma/tau note possible pseudo, frameshifted locus_tag LOCUS_31140 CDS 1275..1592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 note possible pseudo, frameshifted CDS 1645..1974 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS 1974..2579 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195025.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene recR CDS 2689..4563 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678201.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene htpG CDS 4744..5388 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220233.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene adk sequence210 source 1..5388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(332..1984) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771748.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene ushA CDS 2202..3422 product fosmidomycin MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251608.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 gene fsr CDS 3660..5336 product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546237.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 gene ybaL sequence211 source 1..5368 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 131..1066 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350523.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 gene ldtA tRNA complement(1122..1197) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS 1524..2441 product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011462.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 gene nac CDS 2543..3493 product HTH-type transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011008.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 gene cbl tRNA complement(3531..3606) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS 3872..5254 product toxic metabolite efflux MATE transporter YeeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943916.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 gene yeeO sequence212 source 1..5322 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..909 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000702551.1:nitrate reductase subunit beta locus_tag LOCUS_31270 CDS 909..1604 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166353.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 gene narW CDS 1601..2281 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617115.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene narI CDS 2360..3253 product PhzF family isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804385.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(3349..4194) product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187925.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 gene nhoA CDS 4367..4936 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085899.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS complement(4933..5166) product tautomerase PptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120143.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 gene pptA sequence213 source 1..5267 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(67..642) product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140187.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 gene gmhB CDS 830..1861 product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594006.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 gene metN CDS 1854..2507 product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294600.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS 2547..3191 product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874227.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 gene metQ note possible pseudo, internal stop codon CDS 3240..3362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31380 note possible pseudo, internal stop codon CDS 3480..3884 product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202329.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene rcsF CDS 3881..4588 product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094011.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 sequence214 source 1..5252 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 342..674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31420 note possible pseudo, internal stop codon CDS 780..1604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31430 note possible pseudo, internal stop codon CDS 1614..2066 product PTS galactitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182899.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene gatA CDS 2097..2381 product PTS galactitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823270.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene gatB CDS 2385..3740 product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490679.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 3788..4828 product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844219.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 gene gatD sequence215 source 1..5125 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 688..993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31480 note possible pseudo, internal stop codon CDS 1039..1410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31490 note possible pseudo, internal stop codon CDS 1410..1736 product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107564.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 1926..2645 product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984796.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 2821..3867 product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394140.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene ansB CDS 3984..4991 product DUF1202 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745210.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 sequence216 source 1..5028 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(365..2191) product two-component system sensor histidine kinase AtoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559125.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene atoS CDS 2358..5009 product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876011.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene rcsC sequence217 source 1..4990 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 139..1008 product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214331.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 1033..3462 product trimethylamine N-oxide reductase TorZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176781.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene torZ CDS complement(3626..4597) product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564725.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene cmoB sequence218 source 1..4949 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(38..583) product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853959.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 gene hemG CDS complement(595..2046) product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545677.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene trkH CDS complement(2085..2702) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001308167.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS complement(2699..4030) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444561.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 gene pepQ sequence219 source 1..4888 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1012..2184) product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326681.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene emrA CDS complement(2311..2841) product multidrug efflux transporter EmrAB transcriptional repressor EmrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378442.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 gene emrR CDS complement(2932..3267) product L-valine transporter subunit YgaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119763.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene ygaH CDS complement(3257..3994) product L-valine exporter subunit YgaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445651.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene ygaZ misc_feature complement(4118..>4888) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000169332.1:MFS transporter locus_tag LOCUS_31670 sequence220 source 1..4665 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 160..270 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS 598..1896 product alpha-ketoglutarate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841103.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 gene kgtP CDS complement(1893..2165) product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300818.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(2262..3620) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949265.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 gene pssA CDS complement(3731..4630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31710 sequence221 source 1..4644 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..725 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001300708.1:serine-type D-Ala-D-Ala carboxypeptidase locus_tag LOCUS_31720 CDS complement(772..1530) product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450121.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 gene deoR CDS complement(1588..2184) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295291.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene ybjG CDS 2469..3701 product multidrug efflux MFS transporter MdfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180089.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene mdfA CDS complement(3742..4026) product protein YbjH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605480.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene ybjH CDS complement(4112..4642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 sequence222 source 1..4622 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..534 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000217234.1:TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase locus_tag LOCUS_31780 CDS 531..1883 product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055129.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 gene wzyE CDS 1886..2626 product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064040.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 gene wecG CDS 2817..4202 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774731.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 tRNA 4305..4381 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA 4440..4515 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA 4536..4622 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 sequence223 source 1..4612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(236..436) product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417058.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 602..1147 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185290.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS 1144..1566 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635537.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 gene arfB CDS 1580..2290 product envelope stress response activation lipoprotein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239163.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 gene nlpE assembly_gap 2391..2424 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2483..3037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(3361..4446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 note possible pseudo, internal stop codon sequence224 source 1..4594 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 660..1346 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223132.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 1707..4169 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264707.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 gene thrA sequence225 source 1..4582 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(590..1549) product aliphatic sulfonate ABC transporter substrate-binding protein SsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244308.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 gene ssuA CDS complement(1542..2117) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263933.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 gene ssuE CDS 2473..3012 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750293.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 assembly_gap 3372..3518 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3857..3934 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence226 source 1..4575 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(119..400) product DUF2773 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942006.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(608..892) product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941942.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 gene ppnP CDS complement(964..1641) product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276420.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(1899..2090) product protein YaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142439.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 gene yaiA CDS complement(2140..2607) product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193393.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene aroL CDS complement(2847..3305) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158159.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS 3425..4234 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295331.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 gene proC sequence227 source 1..4536 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 159..1637 product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854633.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 gene uxaB assembly_gap 331..358 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1844..2758 product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313828.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(2762..3520) product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286597.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 gene tam CDS complement(3577..3867) product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558527.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 gene lsrG misc_feature complement(3891..>4536) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000774165.1:3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase locus_tag LOCUS_32040 sequence228 source 1..4518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 39..911 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723275.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS 898..1893 product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000596014.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 gene yjfF CDS complement(1926..2924) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853753.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 gene fbp CDS 3100..4473 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219813.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 gene mpl sequence229 source 1..4511 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 297..599 product YjeO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276180.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(628..3951) product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236847.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene mscM misc_feature complement(3973..>4511) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000934933.1:archaetidylserine decarboxylase locus_tag LOCUS_32110 sequence230 source 1..4492 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 284..772 product hydrogenase-2 assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134014.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 gene hybE CDS 765..1106 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544953.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene hypA CDS 1119..1367 product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334896.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 gene hybG CDS complement(1490..2356) product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295515.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 gene yghU CDS 2561..4420 product bifunctional glutathionylspermidine amidase/synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297309.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene gss sequence231 source 1..4451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000673575.1:Obg family GTPase CgtA locus_tag LOCUS_32170 CDS complement(926..2245) product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212619.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene dacB CDS 2607..3083 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148001.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 gene greA CDS complement(3239..3532) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054420.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene yhbY CDS 3658..4287 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145975.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 gene rlmE sequence232 source 1..4436 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(43..444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(359..1639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32230 note possible pseudo, frameshifted assembly_gap 466..530 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2147..3436 product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301395.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 gene ygjG CDS complement(3478..3810) product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450594.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 sequence233 source 1..4434 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(95..1939) product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582468.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 gene selB CDS complement(1936..3327) product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206275.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene selA CDS complement(3425..4033) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779792.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 sequence234 source 1..4427 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(138..1805) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046749.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene ettA CDS 2016..2702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 note possible pseudo, frameshifted CDS 2744..3952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32310 note possible pseudo, frameshifted CDS 4042..4368 product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068679.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 gene trpR sequence235 source 1..4358 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 47..499 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004655.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 gene fkpB CDS 501..1451 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166395.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene ispH CDS 1517..2431 product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239142.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene rihC CDS 2598..3419 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543604.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 gene dapB sequence236 source 1..4351 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..976 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000373021.1:NADP-specific glutamate dehydrogenase locus_tag LOCUS_32370 CDS complement(2261..4222) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235800.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 gene topB sequence237 source 1..4281 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(577..3210) product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648976.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 gene mngB CDS complement(3228..4226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32400 sequence238 source 1..4254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(29..781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32410 misc_feature complement(778..>4254) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000040458.1:nitrate reductase Z subunit alpha locus_tag LOCUS_32420 sequence239 source 1..4206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(641..1255) product YagU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019920.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 1673..2362 product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070700.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 gene paoA CDS 2359..3315 product aldehyde oxidoreductase FAD-binding subunit PaoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643333.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 gene paoB CDS 3312..4184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 sequence240 source 1..4172 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(78..1550) product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096869.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 gene modF CDS complement(1618..2406) product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147439.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 gene modE CDS 2535..2684 product multidrug efflux pump accessory protein AcrZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891515.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 gene acrZ CDS 2838..3611 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101984.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 gene modA sequence241 source 1..4164 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1071..1520 product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492656.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene alaE CDS complement(1557..1901) product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281320.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS 2053..2382 product DUF883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295174.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS 2630..2875 product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223227.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene nrdH CDS 2872..3282 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080947.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene nrdI sequence242 source 1..4160 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1089 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000626685.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase locus_tag LOCUS_32560 CDS 1083..2165 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964131.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene mraY CDS 2168..3484 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796481.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene murD sequence243 source 1..4153 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 112..1140 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016699.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 gene murB CDS 1137..2102 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654630.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 gene birA CDS complement(2131..3057) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023081.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene coaA tRNA 3443..3518 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA 3527..3611 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA 3728..3802 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA 3809..3884 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 sequence244 source 1..4092 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 212..1639 product S-methylmethionine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393629.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene mmuP CDS 1626..2558 product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081352.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 gene mmuM CDS complement(2667..3713) product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192349.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 gene fbpC sequence245 source 1..4085 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..677 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001221332.1:exonuclease subunit SbcD locus_tag LOCUS_32650 CDS 674..2239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32660 note possible pseudo, frameshifted CDS 2163..3803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670 note possible pseudo, frameshifted sequence246 source 1..4059 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 379..1050 product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220281.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 gene nrfC CDS 1047..2003 product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195171.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 gene nrfD CDS 2059..3741 product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311310.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 sequence247 source 1..4027 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..575 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001352260.1:16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF locus_tag LOCUS_32710 CDS 693..929 product YebV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295499.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 assembly_gap 1048..1093 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1237..1896) product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812724.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 gene pphA CDS complement(2289..2630) product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976476.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS complement(2643..3515) product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879289.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 gene copD CDS complement(3519..3893) product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168747.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 gene yobA sequence248 source 1..4025 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(291..3161) product molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583615.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS complement(3158..3937) product molybdopterin-dependent oxidoreductase FAD-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572462.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 gene ygfM sequence249 source 1..4014 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(97..813) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532923.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS complement(1156..2610) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060244.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene amn misc_feature complement(2712..>4014) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000378575.1:shikimate transporter locus_tag LOCUS_32810 sequence250 source 1..3960 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(211..1140) product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027703.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 gene fdhE CDS complement(1137..1772) product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829013.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 gene fdoI CDS complement(1769..2671) product formate dehydrogenase O subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331377.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 gene fdoH misc_feature complement(2684..>3960) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010723259.1:formate dehydrogenase-N subunit alpha locus_tag LOCUS_32850 sequence251 source 1..3927 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(161..298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32860 note possible pseudo, internal stop codon CDS complement(302..1171) product N-acetylmuramoyl-L-alanine amidase AmiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102886.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 gene amiA CDS 1385..1810 product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405996.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS 1797..2246 product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350539.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS 2307..2882 product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838944.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS 2978..3877 product porphyrinogen peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350538.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene yfeX sequence252 source 1..3924 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(201..1658) product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336293.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 gene yjeM CDS complement(1922..2899) product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004771.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene epmA sequence253 source 1..3911 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1216..>3911) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001197875.1:multidrug efflux RND transporter permease subunit MdtB locus_tag LOCUS_32940 sequence254 source 1..3902 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1301..2740 product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029634.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 gene norV CDS 2737..3870 product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064752.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 gene norW sequence255 source 1..3888 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 131..1897 product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642196.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 gene ftsI CDS 1884..3371 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775093.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 gene murE sequence256 source 1..3883 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(265..963) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977128.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(987..1664) product lipoprotein YdjY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939212.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 gene ydjY CDS complement(1669..2379) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300395.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS complement(2546..3364) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673918.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 gene xthA sequence257 source 1..3845 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1063..1944 product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285661.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 gene rnm CDS 1941..2561 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295575.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 sequence258 source 1..3826 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(237..1901) product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287154.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 gene glnS misc_feature complement(2104..>3826) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001023093.1:PTS N-acetyl glucosamine transporter subunit IIABC locus_tag LOCUS_33060 sequence259 source 1..3821 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(722..2119) product two-component system sensor histidine kinase ZraS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211892.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 gene zraS CDS 2226..2354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS 2357..2782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(2784..3419) product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084037.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS complement(3492..3764) product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044513.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 gene hupA sequence260 source 1..3798 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 53..1003 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053399.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 gene galK CDS 997..2037 product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931389.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene galM CDS 2239..2991 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295305.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 gene gpmA misc_feature complement(3149..>3798) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001109183.1:3-deoxy-7-phosphoheptulonate synthase AroG locus_tag LOCUS_33150 sequence261 source 1..3780 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 562..864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(836..1276) product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106835.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS complement(1303..1905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(1871..2146) product phage N-6-adenine-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066913.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(2637..3005) product protein YdfO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128175.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene yfdO CDS 3149..3316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS 3363..3725 product protein YfdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135673.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 gene yfdP sequence262 source 1..3704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..545 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000476011.1:tRNA 5-hydroxyuridine modification protein YegQ locus_tag LOCUS_33230 CDS complement(1505..1837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130399.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS 2228..3127 product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807348.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 gene yegS CDS complement(3209..3655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33260 sequence263 source 1..3687 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 214..1092 product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459182.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 gene xdhB CDS 1089..1568 product xanthine dehydrogenase iron sulfur-binding subunit XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016605.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 gene xdhC CDS complement(1608..3386) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417791.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 sequence264 source 1..3593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 612..1040 product universal stress protein UspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122416.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 gene uspC CDS complement(1047..2471) product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295646.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 gene otsA CDS complement(2446..3057) product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295645.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 gene otsB assembly_gap 3191..3255 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence265 source 1..3584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(31..795) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298497.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 gene deoC assembly_gap 699..718 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1053..2603 product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143253.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 2734..3438 product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088415.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 sequence266 source 1..3528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(857..1192) product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254738.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 gene mazF CDS complement(1192..1440) product type II toxin-antitoxin system antitoxin MazE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581937.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 gene mazE CDS complement(1518..3509) product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226815.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 sequence267 source 1..3523 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(342..1268) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795630.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 gene motB CDS complement(1265..2152) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906340.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 gene motA CDS complement(2279..2857) product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291603.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 gene flhC CDS complement(2860..3210) product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295647.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 gene flhD sequence268 source 1..3479 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 460..2658 product kojibiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198036.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 gene ycjT CDS 2655..3314 product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775794.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 gene pgmB sequence269 source 1..3445 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 412..1254 product ISAs1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420862.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 assembly_gap 699..715 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1402..1911 product YbgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053305.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS 1908..3326 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207142.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 gene phrB sequence270 source 1..3442 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 365..403 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 466..1377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33480 note possible pseudo, frameshifted CDS complement(1536..3191) product arylsulfatase AslA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395863.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 gene aslA sequence271 source 1..3432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2..247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS complement(225..2135) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098613.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 gene tkt assembly_gap 273..397 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2413..3171 product metalloprotease LoiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326497.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 gene loiP sequence272 source 1..3408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS complement(494..1534) product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199295.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS complement(1642..1860) product lipoprotein YgdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758655.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 gene ygdR CDS complement(1998..2711) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895624.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 misc_feature complement(2780..>3408) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000082201.1:DNA mismatch repair endonuclease MutH locus_tag LOCUS_33570 sequence273 source 1..3367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 345..1598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33580 note possible pseudo, frameshifted assembly_gap 1517..1537 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1989..2100 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2168..2458 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181706.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 gene ilvN CDS 2534..3124 product transcriptional regulator UhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633668.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 gene uhpA sequence274 source 1..3364 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 523..657 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(885..1421) product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168299.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 gene ssb1 CDS 1675..3249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33620 note possible pseudo, internal stop codon sequence275 source 1..3345 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(309..1649) product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295701.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 gene fadL CDS 2021..2305 product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296261.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 sequence276 source 1..3336 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2933 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000177906.1:beta-galactosidase locus_tag LOCUS_33650 sequence277 source 1..3287 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1576..1749) product periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731833.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS complement(1994..2524) product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954775.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 gene cybB sequence278 source 1..3276 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(81..593) product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907622.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 gene mobB CDS complement(590..1174) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052181.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene mobA CDS 1244..1513 product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295263.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS 1590..2576 product stress response kinase SrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065497.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene srkA CDS 2593..3219 product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725337.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 gene dsbA sequence279 source 1..3236 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000246534.1:class 1b ribonucleoside-diphosphate reductase subunit alpha locus_tag LOCUS_33730 CDS 910..1869 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777969.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 gene nrdF sequence280 source 1..3226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..606 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001321419.1:A/G-specific adenine glycosylase locus_tag LOCUS_33750 CDS 634..909 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091700.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS 971..2053 product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760323.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 gene mltC CDS 2255..2956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33780 sequence281 source 1..3210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(395..1054) product transcriptional regulator YeiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310375.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 gene yeiL CDS 1223..2164 product ribosylpyrimidine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415429.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 gene rihB sequence282 source 1..3174 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(829..1749) product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936043.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene gsiC misc_feature complement(1767..>3174) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000090140.1:glutathione ABC transporter substrate-binding protein GsiB locus_tag LOCUS_33820 sequence283 source 1..3159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(222..1346) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216257.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 misc_feature complement(1346..>3159) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000149156.1:ribosome-associated ATPase/putative transporter RbbA locus_tag LOCUS_33840 sequence284 source 1..3155 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2570..2905 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300891.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 sequence285 source 1..3057 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(41..1345) product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671574.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene gsk CDS 1497..2456 product acetyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801813.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 gene aes misc_feature complement(2453..>3057) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001250103.1:ferrochelatase locus_tag LOCUS_33880 sequence286 source 1..3053 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 37..195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS 235..897 product DUF2057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847791.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS 984..1451 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275684.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 gene mgsA CDS complement(1483..3051) product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295354.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 gene helD sequence287 source 1..3025 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 294..512 product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966807.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene hemP CDS complement(516..1952) product protein adenylyltransferase SelO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175703.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 gene selO CDS 2081..2308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33950 sequence288 source 1..2963 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 351..1316 product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043654.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene fcl CDS 1316..1798 product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393539.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene gmm sequence289 source 1..2939 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(144..410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33980 note possible pseudo, frameshifted CDS complement(598..1590) product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216525.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 gene proX CDS complement(1648..2712) product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774978.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 gene proW CDS complement(2705..2833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34010 sequence290 source 1..2926 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 927..1835 product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219309.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene mak assembly_gap 1936..2044 estimated_length known gap_type within scaffold linkage_evidence paired-ends misc_feature complement(2086..>2926) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001326926.1:MFS transporter AraJ locus_tag LOCUS_34030 sequence291 source 1..2910 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence292 source 1..2783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1165..2334) product signal transduction histidine-protein kinase/phosphatase UhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295243.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 gene uhpB assembly_gap 2337..2446 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence293 source 1..2769 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(264..683) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801125.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 gene nusB CDS complement(703..1173) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021161.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 gene ribE CDS complement(1262..2365) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150457.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 gene ribD sequence294 source 1..2766 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..787 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000422182.1:microcin J25 efflux ABC transporter YojI locus_tag LOCUS_34080 CDS 1005..2651 product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758077.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 gene mqo sequence295 source 1..2746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(29..445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34100 note possible pseudo, frameshifted assembly_gap 465..528 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(918..1979) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393448.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 misc_feature complement(2045..>2746) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001276670.1:ABC transporter permease locus_tag LOCUS_34120 sequence296 source 1..2724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 106..1170 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137657.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 gene hemE CDS 1180..1851 product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362388.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 gene nfi CDS 1894..2484 product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940106.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 sequence297 source 1..2706 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(696..1268) product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300431.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 gene kdpC CDS complement(1277..2560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34170 note possible pseudo, internal stop codon sequence298 source 1..2685 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 95..1450 product L-xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196054.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 gene lyxK CDS 1447..2109 product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089481.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 gene ulaD sequence299 source 1..2663 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(356..1546) product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032666220.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 tRNA complement(1807..1891) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 sequence300 source 1..2636 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1399..2364) product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513781.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 gene iaaA sequence301 source 1..2614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(49..1251) product nucleoside permease NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376337.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 gene nupC sequence302 source 1..2604 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(122..868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34230 note possible pseudo, frameshifted CDS 1037..1759 product mannosyl-D-glycerate transport/metabolism system transcriptional repressor MngR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509902.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 gene mngR misc_feature complement(1863..>2604) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000025458.1:succinate--CoA ligase subunit alpha locus_tag LOCUS_34250 sequence303 source 1..2554 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(297..1190) product UTP--glucose-1-phosphate uridylyltransferase GalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183060.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene galF misc_feature complement(1365..>2554) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001116026.1:colanic acid biosynthesis protein WcaM locus_tag LOCUS_34270