>Feature sequence001 1728 784 gene locus_tag LOCUS_00010 gene rbsK 1728 784 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354235.1 protein_id gnl|my_center|LOCUS_00010 2729 1839 gene locus_tag LOCUS_00020 gene rbsB 2729 1839 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056271.1 protein_id gnl|my_center|LOCUS_00020 3719 2754 gene locus_tag LOCUS_00030 gene rbsC 3719 2754 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211858.1 protein_id gnl|my_center|LOCUS_00030 5229 3724 gene locus_tag LOCUS_00040 gene rbsA 5229 3724 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387770.1 protein_id gnl|my_center|LOCUS_00040 5656 5237 gene locus_tag LOCUS_00050 gene rbsD 5656 5237 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301979.1 protein_id gnl|my_center|LOCUS_00050 7691 5823 gene locus_tag LOCUS_00060 gene kup 7691 5823 CDS product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102319.1 protein_id gnl|my_center|LOCUS_00060 7914 9410 gene locus_tag LOCUS_00070 gene ravA 7914 9410 CDS product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299914.1 protein_id gnl|my_center|LOCUS_00070 9404 10855 gene locus_tag LOCUS_00080 gene viaA 9404 10855 CDS product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956642.1 protein_id gnl|my_center|LOCUS_00080 11528 10860 gene locus_tag LOCUS_00090 11528 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00090 11847 11545 gene locus_tag LOCUS_00100 11847 11545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00100 11999 12457 gene locus_tag LOCUS_00110 gene asnC 11999 12457 CDS product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432970.1 protein_id gnl|my_center|LOCUS_00110 12547 12990 gene locus_tag LOCUS_00120 gene mioC 12547 12990 CDS product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763724.1 protein_id gnl|my_center|LOCUS_00120 13369 15258 gene locus_tag LOCUS_00130 gene mnmG 13369 15258 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499788.1 protein_id gnl|my_center|LOCUS_00130 15322 15945 gene locus_tag LOCUS_00140 gene rsmG 15322 15945 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932839.1 protein_id gnl|my_center|LOCUS_00140 16550 16942 gene locus_tag LOCUS_00150 gene atpI 16550 16942 CDS product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116695.1 protein_id gnl|my_center|LOCUS_00150 16951 17766 gene locus_tag LOCUS_00160 gene atpB 16951 17766 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135625.1 protein_id gnl|my_center|LOCUS_00160 17813 18052 gene locus_tag LOCUS_00170 gene atpE 17813 18052 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 protein_id gnl|my_center|LOCUS_00170 18114 18584 gene locus_tag LOCUS_00180 gene atpF 18114 18584 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052217.1 protein_id gnl|my_center|LOCUS_00180 18599 19132 gene locus_tag LOCUS_00190 gene atpH 18599 19132 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288587.1 protein_id gnl|my_center|LOCUS_00190 19145 20686 gene locus_tag LOCUS_00200 gene atpA 19145 20686 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176745.1 protein_id gnl|my_center|LOCUS_00200 20737 21600 gene locus_tag LOCUS_00210 gene atpG 20737 21600 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896498.1 protein_id gnl|my_center|LOCUS_00210 21627 23009 gene locus_tag LOCUS_00220 gene atpD 21627 23009 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190506.1 protein_id gnl|my_center|LOCUS_00220 23030 23449 gene locus_tag LOCUS_00230 23030 23449 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251965.1 protein_id gnl|my_center|LOCUS_00230 23802 25172 gene locus_tag LOCUS_00240 gene glmU 23802 25172 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933736.1 protein_id gnl|my_center|LOCUS_00240 25334 27163 gene locus_tag LOCUS_00250 gene glmS 25334 27163 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334099.1 protein_id gnl|my_center|LOCUS_00250 27477 28517 gene locus_tag LOCUS_00260 gene pstS 27477 28517 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867146.1 protein_id gnl|my_center|LOCUS_00260 28604 29563 gene locus_tag LOCUS_00270 gene pstC 28604 29563 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741620.1 protein_id gnl|my_center|LOCUS_00270 29563 30453 gene locus_tag LOCUS_00280 gene pstA 29563 30453 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251998.1 protein_id gnl|my_center|LOCUS_00280 30636 31409 gene locus_tag LOCUS_00290 gene pstB 30636 31409 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063125.1 protein_id gnl|my_center|LOCUS_00290 31424 32149 gene locus_tag LOCUS_00300 gene phoU 31424 32149 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377786.1 protein_id gnl|my_center|LOCUS_00300 32435 33271 gene locus_tag LOCUS_00310 gene bglG 32435 33271 CDS product transcriptional antiterminator BglG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295251.1 protein_id gnl|my_center|LOCUS_00310 33405 35282 gene locus_tag LOCUS_00320 gene bglF 33405 35282 CDS product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137296.1 protein_id gnl|my_center|LOCUS_00320 35301 36713 gene locus_tag LOCUS_00330 gene bglB 35301 36713 CDS product 6-phospho-beta-glucosidase BglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643228.1 protein_id gnl|my_center|LOCUS_00330 36782 38398 gene locus_tag LOCUS_00340 gene bglH 36782 38398 CDS product carbohydrate-specific porin BglH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489881.1 protein_id gnl|my_center|LOCUS_00340 38425 39594 gene locus_tag LOCUS_00350 38425 39594 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336377.1 protein_id gnl|my_center|LOCUS_00350 39609 40331 gene locus_tag LOCUS_00360 39609 40331 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766900.1 protein_id gnl|my_center|LOCUS_00360 40980 40393 gene locus_tag LOCUS_00370 gene cbrC 40980 40393 CDS product PF03691 family colicin E2 tolerance protein CbrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193072.1 protein_id gnl|my_center|LOCUS_00370 41496 41029 gene locus_tag LOCUS_00380 41496 41029 CDS product protein CbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116777.1 protein_id gnl|my_center|LOCUS_00380 42228 41563 gene locus_tag LOCUS_00390 gene yieH 42228 41563 CDS product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086486.1 protein_id gnl|my_center|LOCUS_00390 42393 43730 gene locus_tag LOCUS_00400 gene adeP 42393 43730 CDS product adenine permease AdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019348.1 protein_id gnl|my_center|LOCUS_00400 44350 43784 gene locus_tag LOCUS_00410 gene yieF 44350 43784 CDS product class I chromate reductase YieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291268.1 protein_id gnl|my_center|LOCUS_00410 45121 44372 gene locus_tag LOCUS_00420 45121 44372 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296581.1 protein_id gnl|my_center|LOCUS_00420 46246 45278 gene locus_tag LOCUS_00430 gene yidZ 46246 45278 CDS product HTH-type transcriptional regulator YidZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311238.1 protein_id gnl|my_center|LOCUS_00430 47387 46212 gene locus_tag LOCUS_00440 gene mdtL 47387 46212 CDS product multidrug efflux MFS transporter MdtL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085982.1 protein_id gnl|my_center|LOCUS_00440 48766 47519 gene locus_tag LOCUS_00450 gene tnaB 48766 47519 CDS product low affinity tryptophan permease TnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131925.1 protein_id gnl|my_center|LOCUS_00450 50272 48857 gene locus_tag LOCUS_00460 gene tnaA 50272 48857 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295247.1 protein_id gnl|my_center|LOCUS_00460 52174 50810 gene locus_tag LOCUS_00470 gene mnmE 52174 50810 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282346.1 protein_id gnl|my_center|LOCUS_00470 53926 52280 gene locus_tag LOCUS_00480 gene yidC 53926 52280 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378250.1 protein_id gnl|my_center|LOCUS_00480 54476 54150 gene locus_tag LOCUS_00490 gene rnpA 54476 54150 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239730.1 protein_id gnl|my_center|LOCUS_00490 54666 54526 gene locus_tag LOCUS_00500 gene rpmH 54666 54526 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831330.1 protein_id gnl|my_center|LOCUS_00500 55342 56676 gene locus_tag LOCUS_00510 gene dnaA 55342 56676 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059111.1 protein_id gnl|my_center|LOCUS_00510 56681 57781 gene locus_tag LOCUS_00520 gene dnaN 56681 57781 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673464.1 protein_id gnl|my_center|LOCUS_00520 57781 58854 gene locus_tag LOCUS_00530 gene recF 57781 58854 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060112.1 protein_id gnl|my_center|LOCUS_00530 58883 60007 gene locus_tag LOCUS_00540 58883 60007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00540 59949 59957 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 60004 61248 gene locus_tag LOCUS_00550 60004 61248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00550 61441 61839 gene locus_tag LOCUS_00560 61441 61839 CDS product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522208.1 protein_id gnl|my_center|LOCUS_00560 61954 62766 gene locus_tag LOCUS_00570 gene yidA 61954 62766 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985549.1 protein_id gnl|my_center|LOCUS_00570 63468 62812 gene locus_tag LOCUS_00580 gene yidX 63468 62812 CDS product protein YidX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772934.1 protein_id gnl|my_center|LOCUS_00580 63746 64435 gene locus_tag LOCUS_00590 gene dgoR 63746 64435 CDS product D-galactonate utilization transcriptional regulator DgoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174305.1 protein_id gnl|my_center|LOCUS_00590 64432 65310 gene locus_tag LOCUS_00600 gene dgoK 64432 65310 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127091.1 protein_id gnl|my_center|LOCUS_00600 65294 65911 gene locus_tag LOCUS_00610 gene dgoA 65294 65911 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198722.1 protein_id gnl|my_center|LOCUS_00610 65908 67056 gene locus_tag LOCUS_00620 gene dgoD 65908 67056 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705001.1 protein_id gnl|my_center|LOCUS_00620 67176 68468 gene locus_tag LOCUS_00630 67176 68468 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354284.1 protein_id gnl|my_center|LOCUS_00630 69529 68465 gene locus_tag LOCUS_00640 gene cbrA 69529 68465 CDS product colicin M resistance lipid reductase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340434.1 protein_id gnl|my_center|LOCUS_00640 69630 70844 gene locus_tag LOCUS_00650 69630 70844 CDS product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723257.1 protein_id gnl|my_center|LOCUS_00650 71106 70846 gene locus_tag LOCUS_00660 71106 70846 CDS product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313407.1 protein_id gnl|my_center|LOCUS_00660 71484 71897 gene locus_tag LOCUS_00670 gene ibpA 71484 71897 CDS product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243437.1 protein_id gnl|my_center|LOCUS_00670 72009 72437 gene locus_tag LOCUS_00680 gene ibpB 72009 72437 CDS product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243431.1 protein_id gnl|my_center|LOCUS_00680 72633 74294 gene locus_tag LOCUS_00690 72633 74294 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279752.1 protein_id gnl|my_center|LOCUS_00690 75007 74291 gene locus_tag LOCUS_00700 75007 74291 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300779.1 protein_id gnl|my_center|LOCUS_00700 75303 76409 gene locus_tag LOCUS_00710 75303 76409 CDS product alpha-glucoside-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952140.1 protein_id gnl|my_center|LOCUS_00710 76434 76919 gene locus_tag LOCUS_00720 76434 76919 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492410.1 protein_id gnl|my_center|LOCUS_00720 76919 77557 gene locus_tag LOCUS_00730 76919 77557 CDS product inactive 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311230.1 protein_id gnl|my_center|LOCUS_00730 77557 77733 gene locus_tag LOCUS_00740 77557 77733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 78623 77730 gene locus_tag LOCUS_00750 78623 77730 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013540.1 protein_id gnl|my_center|LOCUS_00750 78790 80505 gene locus_tag LOCUS_00760 78790 80505 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087145.1 protein_id gnl|my_center|LOCUS_00760 80502 81995 gene locus_tag LOCUS_00770 80502 81995 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828527.1 protein_id gnl|my_center|LOCUS_00770 82491 82042 gene locus_tag LOCUS_00780 gene yidI 82491 82042 CDS product protein YidI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511289.1 protein_id gnl|my_center|LOCUS_00780 82599 82946 gene locus_tag LOCUS_00790 82599 82946 CDS product YidH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703959.1 protein_id gnl|my_center|LOCUS_00790 82936 83298 gene locus_tag LOCUS_00800 82936 83298 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113432.1 protein_id gnl|my_center|LOCUS_00800 83295 83792 gene locus_tag LOCUS_00810 83295 83792 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148061.1 protein_id gnl|my_center|LOCUS_00810 84960 83800 gene locus_tag LOCUS_00820 gene emrD 84960 83800 CDS product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306726.1 protein_id gnl|my_center|LOCUS_00820 >Feature sequence002 200 1792 gene locus_tag LOCUS_00830 gene malX 200 1792 CDS product PTS maltose transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125583.1 protein_id gnl|my_center|LOCUS_00830 1802 2974 gene locus_tag LOCUS_00840 gene malY 1802 2974 CDS product bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459379.1 protein_id gnl|my_center|LOCUS_00840 3078 4079 gene locus_tag LOCUS_00850 gene add 3078 4079 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567490.1 protein_id gnl|my_center|LOCUS_00850 5153 4113 gene locus_tag LOCUS_00860 5153 4113 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282550.1 protein_id gnl|my_center|LOCUS_00860 5404 5619 gene locus_tag LOCUS_00870 gene ydgT 5404 5619 CDS product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217950.1 protein_id gnl|my_center|LOCUS_00870 5705 6145 gene locus_tag LOCUS_00880 5705 6145 CDS product DUF2569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310854.1 protein_id gnl|my_center|LOCUS_00880 6222 6803 gene locus_tag LOCUS_00890 gene rsxA 6222 6803 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133193.1 protein_id gnl|my_center|LOCUS_00890 6803 7381 gene locus_tag LOCUS_00900 gene rsxB 6803 7381 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991805.1 protein_id gnl|my_center|LOCUS_00900 7374 9476 gene locus_tag LOCUS_00910 gene rsxC 7374 9476 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915778.1 protein_id gnl|my_center|LOCUS_00910 9131 9215 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9477 10535 gene locus_tag LOCUS_00920 gene rsxD 9477 10535 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231927.1 protein_id gnl|my_center|LOCUS_00920 10539 11159 gene locus_tag LOCUS_00930 gene rsxG 10539 11159 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920784.1 protein_id gnl|my_center|LOCUS_00930 11163 11858 gene locus_tag LOCUS_00940 gene rsxE 11163 11858 CDS product electron transport complex subunit RsxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289652.1 protein_id gnl|my_center|LOCUS_00940 11858 12493 gene locus_tag LOCUS_00950 gene nth 11858 12493 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030339.1 protein_id gnl|my_center|LOCUS_00950 13104 14606 gene locus_tag LOCUS_00960 gene dtpA 13104 14606 CDS product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100932.1 protein_id gnl|my_center|LOCUS_00960 14712 15317 gene locus_tag LOCUS_00970 gene gstA 14712 15317 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765749.1 protein_id gnl|my_center|LOCUS_00970 16224 15361 gene locus_tag LOCUS_00980 gene pdxY 16224 15361 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307229.1 protein_id gnl|my_center|LOCUS_00980 17557 16283 gene locus_tag LOCUS_00990 gene tyrS 17557 16283 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295400.1 protein_id gnl|my_center|LOCUS_00990 18342 17686 gene locus_tag LOCUS_01000 gene pdxH 18342 17686 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282319.1 protein_id gnl|my_center|LOCUS_01000 18730 18401 gene locus_tag LOCUS_01010 gene mliC 18730 18401 CDS product C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178044.1 protein_id gnl|my_center|LOCUS_01010 19937 18828 gene locus_tag LOCUS_01020 gene anmK 19937 18828 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835039.1 protein_id gnl|my_center|LOCUS_01020 20211 20678 gene locus_tag LOCUS_01030 gene slyB 20211 20678 CDS product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597196.1 protein_id gnl|my_center|LOCUS_01030 21159 20725 gene locus_tag LOCUS_01040 gene slyA 21159 20725 CDS product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296943.1 protein_id gnl|my_center|LOCUS_01040 21360 21596 gene locus_tag LOCUS_01050 21360 21596 CDS product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670998.1 protein_id gnl|my_center|LOCUS_01050 21599 22456 gene locus_tag LOCUS_01060 21599 22456 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300356.1 protein_id gnl|my_center|LOCUS_01060 22456 24468 gene locus_tag LOCUS_01070 22456 24468 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994333.1 protein_id gnl|my_center|LOCUS_01070 24990 24469 gene locus_tag LOCUS_01080 gene sodC 24990 24469 CDS product superoxide dismutase [Cu-Zn] SodC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296937.1 protein_id gnl|my_center|LOCUS_01080 25967 25071 gene locus_tag LOCUS_01090 25967 25071 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250656.1 protein_id gnl|my_center|LOCUS_01090 26358 26957 gene locus_tag LOCUS_01100 gene nemR 26358 26957 CDS product DNA-binding transcriptional regulator NemR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032936.1 protein_id gnl|my_center|LOCUS_01100 26994 28091 gene locus_tag LOCUS_01110 gene nemA 26994 28091 CDS product N-ethylmaleimide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093589.1 protein_id gnl|my_center|LOCUS_01110 28172 28579 gene locus_tag LOCUS_01120 gene gloA 28172 28579 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237796.1 protein_id gnl|my_center|LOCUS_01120 28682 29329 gene locus_tag LOCUS_01130 gene rnt 28682 29329 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282283.1 protein_id gnl|my_center|LOCUS_01130 29422 34038 gene locus_tag LOCUS_01140 29422 34038 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310858.1 protein_id gnl|my_center|LOCUS_01140 34436 34089 gene locus_tag LOCUS_01150 gene grxD 34436 34089 CDS product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108172.1 protein_id gnl|my_center|LOCUS_01150 34670 34518 gene locus_tag LOCUS_01160 34670 34518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 34770 35585 gene locus_tag LOCUS_01170 gene mepH 34770 35585 CDS product peptidoglycan DD-endopeptidase MepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101193.1 protein_id gnl|my_center|LOCUS_01170 35713 36294 gene locus_tag LOCUS_01180 gene sodB 35713 36294 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007283.1 protein_id gnl|my_center|LOCUS_01180 37625 36456 gene locus_tag LOCUS_01190 37625 36456 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701040.1 protein_id gnl|my_center|LOCUS_01190 38179 39204 gene locus_tag LOCUS_01200 gene purR 38179 39204 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190982.1 protein_id gnl|my_center|LOCUS_01200 40133 39201 gene locus_tag LOCUS_01210 gene punR 40133 39201 CDS product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269501.1 protein_id gnl|my_center|LOCUS_01210 40246 41457 gene locus_tag LOCUS_01220 gene punC 40246 41457 CDS product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182347.1 protein_id gnl|my_center|LOCUS_01220 41748 42896 gene locus_tag LOCUS_01230 gene cfa 41748 42896 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098896.1 protein_id gnl|my_center|LOCUS_01230 43577 42936 gene locus_tag LOCUS_01240 gene ribE 43577 42936 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493947.1 protein_id gnl|my_center|LOCUS_01240 43792 45165 gene locus_tag LOCUS_01250 gene mdtK 43792 45165 CDS product multidrug efflux MATE transporter MdtK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174940.1 protein_id gnl|my_center|LOCUS_01250 46462 45206 gene locus_tag LOCUS_01260 46462 45206 CDS product AIDA repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534271.1 protein_id gnl|my_center|LOCUS_01260 46770 46846 gene locus_tag LOCUS_t00010 46770 46846 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 46851 46927 gene locus_tag LOCUS_t00020 46851 46927 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 47035 47340 gene locus_tag LOCUS_01270 47035 47340 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212657.1 protein_id gnl|my_center|LOCUS_01270 47466 49070 gene locus_tag LOCUS_01280 47466 49070 CDS product FAD-NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716950.1 protein_id gnl|my_center|LOCUS_01280 49846 49082 gene locus_tag LOCUS_01290 gene ydhT 49846 49082 CDS product protein YdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587525.1 protein_id gnl|my_center|LOCUS_01290 50683 49898 gene locus_tag LOCUS_01300 50683 49898 CDS product thiosulfate reductase cytochrome B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069979.1 protein_id gnl|my_center|LOCUS_01300 51234 50680 gene locus_tag LOCUS_01310 51234 50680 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310861.1 protein_id gnl|my_center|LOCUS_01310 52050 51412 gene locus_tag LOCUS_01320 52050 51412 CDS product YdhW family putative oxidoreductase system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517579.1 protein_id gnl|my_center|LOCUS_01320 54165 52063 gene locus_tag LOCUS_01330 54165 52063 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273527.1 protein_id gnl|my_center|LOCUS_01330 54812 54186 gene locus_tag LOCUS_01340 54812 54186 CDS product ferredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070230.1 protein_id gnl|my_center|LOCUS_01340 55476 55267 gene locus_tag LOCUS_01350 gene fumD 55476 55267 CDS product fumarate hydratase FumD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528342.1 protein_id gnl|my_center|LOCUS_01350 56033 57445 gene locus_tag LOCUS_01360 gene pykF 56033 57445 CDS product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295403.1 protein_id gnl|my_center|LOCUS_01360 57756 57992 gene locus_tag LOCUS_01370 gene lpp 57756 57992 CDS product murein lipoprotein Lpp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648420.1 protein_id gnl|my_center|LOCUS_01370 59060 58056 gene locus_tag LOCUS_01380 gene ldtE 59060 58056 CDS product L,D-transpeptidase LdtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817105.1 protein_id gnl|my_center|LOCUS_01380 59625 59209 gene locus_tag LOCUS_01390 gene sufE 59625 59209 CDS product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196530.1 protein_id gnl|my_center|LOCUS_01390 60858 59638 gene locus_tag LOCUS_01400 gene sufS 60858 59638 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577988.1 protein_id gnl|my_center|LOCUS_01400 62126 60855 gene locus_tag LOCUS_01410 gene sufD 62126 60855 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907979.1 protein_id gnl|my_center|LOCUS_01410 62847 62101 gene locus_tag LOCUS_01420 gene sufC 62847 62101 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948863.1 protein_id gnl|my_center|LOCUS_01420 64344 62857 gene locus_tag LOCUS_01430 gene sufB 64344 62857 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089364.1 protein_id gnl|my_center|LOCUS_01430 64721 64353 gene locus_tag LOCUS_01440 gene sufA 64721 64353 CDS product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367160.1 protein_id gnl|my_center|LOCUS_01440 65457 65269 gene locus_tag LOCUS_01450 65457 65269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 65967 65557 gene locus_tag LOCUS_01460 gene menI 65967 65557 CDS product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637982.1 protein_id gnl|my_center|LOCUS_01460 69020 65964 gene locus_tag LOCUS_01470 69020 65964 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613008.1 protein_id gnl|my_center|LOCUS_01470 69409 70521 gene locus_tag LOCUS_01480 gene ydiK 69409 70521 CDS product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248636.1 protein_id gnl|my_center|LOCUS_01480 70950 71306 gene locus_tag LOCUS_01490 70950 71306 CDS product YdiL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310864.1 protein_id gnl|my_center|LOCUS_01490 71406 72620 gene locus_tag LOCUS_01500 71406 72620 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795537.1 protein_id gnl|my_center|LOCUS_01500 72847 74112 gene locus_tag LOCUS_01510 72847 74112 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081197.1 protein_id gnl|my_center|LOCUS_01510 74124 74990 gene locus_tag LOCUS_01520 gene ydiB 74124 74990 CDS product quinate/shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383469.1 protein_id gnl|my_center|LOCUS_01520 75021 75779 gene locus_tag LOCUS_01530 gene aroD 75021 75779 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860201.1 protein_id gnl|my_center|LOCUS_01530 75922 77517 gene locus_tag LOCUS_01540 75922 77517 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805700.1 protein_id gnl|my_center|LOCUS_01540 77531 78682 gene locus_tag LOCUS_01550 77531 78682 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347850.1 protein_id gnl|my_center|LOCUS_01550 >Feature sequence003 1170 127 gene locus_tag LOCUS_01560 gene selD 1170 127 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295485.1 protein_id gnl|my_center|LOCUS_01560 1838 1287 gene locus_tag LOCUS_01570 1838 1287 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339283.1 protein_id gnl|my_center|LOCUS_01570 1999 3855 gene locus_tag LOCUS_01580 gene sppA 1999 3855 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259810.1 protein_id gnl|my_center|LOCUS_01580 4022 5038 gene locus_tag LOCUS_01590 gene ansA 4022 5038 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170162.1 protein_id gnl|my_center|LOCUS_01590 5049 5690 gene locus_tag LOCUS_01600 5049 5690 CDS product bifunctional pyrazinamidase/nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135066.1 protein_id gnl|my_center|LOCUS_01600 7141 5783 gene locus_tag LOCUS_01610 7141 5783 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438807.1 protein_id gnl|my_center|LOCUS_01610 8016 7258 gene locus_tag LOCUS_01620 8016 7258 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719096.1 protein_id gnl|my_center|LOCUS_01620 9133 8153 gene locus_tag LOCUS_01630 gene ydjG 9133 8153 CDS product NADH-dependent methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723710.1 protein_id gnl|my_center|LOCUS_01630 10090 9143 gene locus_tag LOCUS_01640 10090 9143 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369231.1 protein_id gnl|my_center|LOCUS_01640 10931 10095 gene locus_tag LOCUS_01650 10931 10095 CDS product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878893.1 protein_id gnl|my_center|LOCUS_01650 11929 10952 gene locus_tag LOCUS_01660 11929 10952 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798110.1 protein_id gnl|my_center|LOCUS_01660 13391 12012 gene locus_tag LOCUS_01670 13391 12012 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435292.1 protein_id gnl|my_center|LOCUS_01670 14494 13418 gene locus_tag LOCUS_01680 14494 13418 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645221.1 protein_id gnl|my_center|LOCUS_01680 15136 14864 gene locus_tag LOCUS_01690 15136 14864 CDS product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300415.1 protein_id gnl|my_center|LOCUS_01690 15591 15178 gene locus_tag LOCUS_01700 gene msrB 15591 15178 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284618.1 protein_id gnl|my_center|LOCUS_01700 15933 16928 gene locus_tag LOCUS_01710 gene gapA 15933 16928 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153502.1 protein_id gnl|my_center|LOCUS_01710 17012 17896 gene locus_tag LOCUS_01720 17012 17896 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335909.1 protein_id gnl|my_center|LOCUS_01720 18798 17944 gene locus_tag LOCUS_01730 gene yeaE 18798 17944 CDS product methylglyoxal reductase YeaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186371.1 protein_id gnl|my_center|LOCUS_01730 19634 18888 gene locus_tag LOCUS_01740 gene mipA 19634 18888 CDS product scaffolding protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163771.1 protein_id gnl|my_center|LOCUS_01740 20070 22004 gene locus_tag LOCUS_01750 gene yeaG 20070 22004 CDS product protein kinase YeaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019882.1 protein_id gnl|my_center|LOCUS_01750 22117 23400 gene locus_tag LOCUS_01760 22117 23400 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219687.1 protein_id gnl|my_center|LOCUS_01760 23679 25022 gene locus_tag LOCUS_01770 23679 25022 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616411.1 protein_id gnl|my_center|LOCUS_01770 25203 26693 gene locus_tag LOCUS_01780 gene dgcJ 25203 26693 CDS product diguanylate cyclase DgcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766132.1 protein_id gnl|my_center|LOCUS_01780 26736 27239 gene locus_tag LOCUS_01790 gene yeaK 26736 27239 CDS product mischarged aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138043.1 protein_id gnl|my_center|LOCUS_01790 27514 27960 gene locus_tag LOCUS_01800 27514 27960 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460707.1 protein_id gnl|my_center|LOCUS_01800 28351 27917 gene locus_tag LOCUS_01810 28351 27917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 28835 30016 gene locus_tag LOCUS_01820 gene nimT 28835 30016 CDS product 2-nitroimidazole transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128491.1 protein_id gnl|my_center|LOCUS_01820 30071 30418 gene locus_tag LOCUS_01830 30071 30418 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326526.1 protein_id gnl|my_center|LOCUS_01830 30694 30440 gene locus_tag LOCUS_01840 gene yoaF 30694 30440 CDS product DUF333 domain-containing lipoprotein YoaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691930.1 protein_id gnl|my_center|LOCUS_01840 30877 31902 gene locus_tag LOCUS_01850 gene dgcP 30877 31902 CDS product diguanylate cyclase DgcP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310896.1 protein_id gnl|my_center|LOCUS_01850 32417 32169 gene locus_tag LOCUS_01860 32417 32169 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512153.1 protein_id gnl|my_center|LOCUS_01860 32747 32565 gene locus_tag LOCUS_01870 32747 32565 CDS product DUF1869 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513737.1 protein_id gnl|my_center|LOCUS_01870 33110 32751 gene locus_tag LOCUS_01880 gene yeaR 33110 32751 CDS product DUF1971 domain-containing protein YeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939317.1 protein_id gnl|my_center|LOCUS_01880 33921 33283 gene locus_tag LOCUS_01890 gene leuE 33921 33283 CDS product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457206.1 protein_id gnl|my_center|LOCUS_01890 34971 34048 gene locus_tag LOCUS_01900 gene dmlR 34971 34048 CDS product DNA-binding transcriptional regulator DmlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061575.1 protein_id gnl|my_center|LOCUS_01900 35074 36159 gene locus_tag LOCUS_01910 gene dmlA 35074 36159 CDS product multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978494.1 protein_id gnl|my_center|LOCUS_01910 36365 37795 gene locus_tag LOCUS_01920 36365 37795 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301380.1 protein_id gnl|my_center|LOCUS_01920 37827 38951 gene locus_tag LOCUS_01930 gene yeaW 37827 38951 CDS product carnitine monooxygenase subunit YeaW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067822.1 protein_id gnl|my_center|LOCUS_01930 39007 39972 gene locus_tag LOCUS_01940 gene yeaX 39007 39972 CDS product carnitine monooxygenase subunit YeaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287026.1 protein_id gnl|my_center|LOCUS_01940 41153 40026 gene locus_tag LOCUS_01950 gene rnd 41153 40026 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109156.1 protein_id gnl|my_center|LOCUS_01950 42974 41223 gene locus_tag LOCUS_01960 gene fadD 42974 41223 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954305.1 protein_id gnl|my_center|LOCUS_01960 43694 43113 gene locus_tag LOCUS_01970 gene yeaY 43694 43113 CDS product Slp family lipoprotein YeaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290576.1 protein_id gnl|my_center|LOCUS_01970 44429 43734 gene locus_tag LOCUS_01980 gene tsaB 44429 43734 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220966.1 protein_id gnl|my_center|LOCUS_01980 46397 44487 gene locus_tag LOCUS_01990 46397 44487 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128841.1 protein_id gnl|my_center|LOCUS_01990 46526 46873 gene locus_tag LOCUS_02000 46526 46873 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310311.1 protein_id gnl|my_center|LOCUS_02000 47235 47594 gene locus_tag LOCUS_02010 47235 47594 CDS product DUF1889 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307845.1 protein_id gnl|my_center|LOCUS_02010 47893 47714 gene locus_tag LOCUS_02020 47893 47714 CDS product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457334.1 protein_id gnl|my_center|LOCUS_02020 47967 49328 gene locus_tag LOCUS_02030 gene pabB 47967 49328 CDS product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854958.1 protein_id gnl|my_center|LOCUS_02030 49332 49910 gene locus_tag LOCUS_02040 49332 49910 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456715.1 protein_id gnl|my_center|LOCUS_02040 50094 51458 gene locus_tag LOCUS_02050 gene sdaA 50094 51458 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624298.1 protein_id gnl|my_center|LOCUS_02050 51589 53187 gene locus_tag LOCUS_02060 51589 53187 CDS product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295494.1 protein_id gnl|my_center|LOCUS_02060 54747 53191 gene locus_tag LOCUS_02070 gene yoaE 54747 53191 CDS product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394983.1 protein_id gnl|my_center|LOCUS_02070 55210 56181 gene locus_tag LOCUS_02080 gene manX 55210 56181 CDS product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150543.1 protein_id gnl|my_center|LOCUS_02080 56244 57044 gene locus_tag LOCUS_02090 gene manY 56244 57044 CDS product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406926.1 protein_id gnl|my_center|LOCUS_02090 57057 57908 gene locus_tag LOCUS_02100 gene manZ 57057 57908 CDS product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228655.1 protein_id gnl|my_center|LOCUS_02100 57963 58421 gene locus_tag LOCUS_02110 57963 58421 CDS product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156255.1 protein_id gnl|my_center|LOCUS_02110 58850 59416 gene locus_tag LOCUS_02120 gene mntP 58850 59416 CDS product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296134.1 protein_id gnl|my_center|LOCUS_02120 59778 59413 gene locus_tag LOCUS_02130 59778 59413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 59864 60037 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 60696 60487 gene locus_tag LOCUS_02140 gene cspE 60696 60487 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062678.1 protein_id gnl|my_center|LOCUS_02140 61809 61522 gene locus_tag LOCUS_02150 61809 61522 CDS product YebO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006866.1 protein_id gnl|my_center|LOCUS_02150 62186 62425 gene locus_tag LOCUS_02160 62186 62425 CDS product YobH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211011.1 protein_id gnl|my_center|LOCUS_02160 63360 62569 gene locus_tag LOCUS_02170 gene kdgR 63360 62569 CDS product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262203.1 protein_id gnl|my_center|LOCUS_02170 63537 64910 gene locus_tag LOCUS_02180 63537 64910 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127216.1 protein_id gnl|my_center|LOCUS_02180 65795 64956 gene locus_tag LOCUS_02190 gene htpX 65795 64956 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984520.1 protein_id gnl|my_center|LOCUS_02190 68077 66029 gene locus_tag LOCUS_02200 gene prc 68077 66029 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055791.1 protein_id gnl|my_center|LOCUS_02200 68795 68097 gene locus_tag LOCUS_02210 gene proQ 68795 68097 CDS product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431381.1 protein_id gnl|my_center|LOCUS_02210 69389 68892 gene locus_tag LOCUS_02220 gene msrC 69389 68892 CDS product L-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043877.1 protein_id gnl|my_center|LOCUS_02220 69564 70802 gene locus_tag LOCUS_02230 gene yebS 69564 70802 CDS product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207282.1 protein_id gnl|my_center|LOCUS_02230 71430 71445 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence004 469 1986 gene locus_tag LOCUS_02240 gene purF 469 1986 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334220.1 protein_id gnl|my_center|LOCUS_02240 2081 2650 gene locus_tag LOCUS_02250 gene ubiX 2081 2650 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825700.1 protein_id gnl|my_center|LOCUS_02250 2916 3698 gene locus_tag LOCUS_02260 gene argT 2916 3698 CDS product lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748271.1 protein_id gnl|my_center|LOCUS_02260 3919 4701 gene locus_tag LOCUS_02270 gene hisJ 3919 4701 CDS product histidine ABC transporter substrate-binding protein HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737621.1 protein_id gnl|my_center|LOCUS_02270 4791 5477 gene locus_tag LOCUS_02280 gene hisQ 4791 5477 CDS product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965522.1 protein_id gnl|my_center|LOCUS_02280 5474 6190 gene locus_tag LOCUS_02290 5474 6190 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569958.1 protein_id gnl|my_center|LOCUS_02290 6198 6971 gene locus_tag LOCUS_02300 gene hisP 6198 6971 CDS product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293613.1 protein_id gnl|my_center|LOCUS_02300 7168 8058 gene locus_tag LOCUS_02310 gene rpnB 7168 8058 CDS product recombination-promoting nuclease RpnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156149.1 protein_id gnl|my_center|LOCUS_02310 8999 8106 gene locus_tag LOCUS_02320 8999 8106 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028341.1 protein_id gnl|my_center|LOCUS_02320 9382 9020 gene locus_tag LOCUS_02330 gene folX 9382 9020 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068457.1 protein_id gnl|my_center|LOCUS_02330 10086 9439 gene locus_tag LOCUS_02340 gene yfcG 10086 9439 CDS product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566471.1 protein_id gnl|my_center|LOCUS_02340 10222 10866 gene locus_tag LOCUS_02350 gene yfcF 10222 10866 CDS product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042442.1 protein_id gnl|my_center|LOCUS_02350 10922 11473 gene locus_tag LOCUS_02360 gene yfcE 10922 11473 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977007.1 protein_id gnl|my_center|LOCUS_02360 11531 12073 gene locus_tag LOCUS_02370 gene yfcD 11531 12073 CDS product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437935.1 protein_id gnl|my_center|LOCUS_02370 13584 12106 gene locus_tag LOCUS_02380 gene yfcC 13584 12106 CDS product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274493.1 protein_id gnl|my_center|LOCUS_02380 13529 13693 gene locus_tag LOCUS_02390 13529 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 15960 13816 gene locus_tag LOCUS_02400 gene pta 15960 13816 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086722.1 protein_id gnl|my_center|LOCUS_02400 17237 16035 gene locus_tag LOCUS_02410 gene ackA 17237 16035 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095707.1 protein_id gnl|my_center|LOCUS_02410 17575 18030 gene locus_tag LOCUS_02420 gene yfbV 17575 18030 CDS product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106627.1 protein_id gnl|my_center|LOCUS_02420 18113 18607 gene locus_tag LOCUS_02430 18113 18607 CDS product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426124.1 protein_id gnl|my_center|LOCUS_02430 18618 19268 gene locus_tag LOCUS_02440 gene hxpA 18618 19268 CDS product hexitol phosphatase HxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203392.1 protein_id gnl|my_center|LOCUS_02440 19355 21187 gene locus_tag LOCUS_02450 19355 21187 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012899.1 protein_id gnl|my_center|LOCUS_02450 21845 21246 gene locus_tag LOCUS_02460 gene yfbR 21845 21246 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813859.1 protein_id gnl|my_center|LOCUS_02460 23146 21929 gene locus_tag LOCUS_02470 gene alaA 23146 21929 CDS product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074527.1 protein_id gnl|my_center|LOCUS_02470 24066 25004 gene locus_tag LOCUS_02480 gene lrhA 24066 25004 CDS product transcriptional regulator LrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622280.1 protein_id gnl|my_center|LOCUS_02480 25635 26078 gene locus_tag LOCUS_02490 gene nuoA 25635 26078 CDS product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062997.1 protein_id gnl|my_center|LOCUS_02490 26094 26756 gene locus_tag LOCUS_02500 gene nuoB 26094 26756 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386733.1 protein_id gnl|my_center|LOCUS_02500 26850 28652 gene locus_tag LOCUS_02510 gene nuoC 26850 28652 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247878.1 protein_id gnl|my_center|LOCUS_02510 28655 29155 gene locus_tag LOCUS_02520 gene nuoE 28655 29155 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545042.1 protein_id gnl|my_center|LOCUS_02520 29152 30489 gene locus_tag LOCUS_02530 gene nuoF 29152 30489 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789500.1 protein_id gnl|my_center|LOCUS_02530 30542 33268 gene locus_tag LOCUS_02540 gene nuoG 30542 33268 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190939.1 protein_id gnl|my_center|LOCUS_02540 33265 34242 gene locus_tag LOCUS_02550 gene nuoH 33265 34242 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118512.1 protein_id gnl|my_center|LOCUS_02550 34257 34799 gene locus_tag LOCUS_02560 gene nuoI 34257 34799 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172749.1 protein_id gnl|my_center|LOCUS_02560 34811 35365 gene locus_tag LOCUS_02570 gene nuoJ 34811 35365 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393511.1 protein_id gnl|my_center|LOCUS_02570 35362 35664 gene locus_tag LOCUS_02580 gene nuoK 35362 35664 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612644.1 protein_id gnl|my_center|LOCUS_02580 35661 37502 gene locus_tag LOCUS_02590 gene nuoL 35661 37502 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056643.1 protein_id gnl|my_center|LOCUS_02590 37666 39195 gene locus_tag LOCUS_02600 gene nuoM 37666 39195 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926441.1 protein_id gnl|my_center|LOCUS_02600 39202 40659 gene locus_tag LOCUS_02610 gene nuoN 39202 40659 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156701.1 protein_id gnl|my_center|LOCUS_02610 41591 40743 gene locus_tag LOCUS_02620 gene yfbP 41591 40743 CDS product tetratricopeptide repeat protein YfbP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767280.1 protein_id gnl|my_center|LOCUS_02620 42126 41650 gene locus_tag LOCUS_02630 gene yfbO 42126 41650 CDS product protein YfbO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188051.1 protein_id gnl|my_center|LOCUS_02630 42281 42997 gene locus_tag LOCUS_02640 gene yfbN 42281 42997 CDS product protein YfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455114.1 protein_id gnl|my_center|LOCUS_02640 43773 43270 gene locus_tag LOCUS_02650 43773 43270 CDS product YfbM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525360.1 protein_id gnl|my_center|LOCUS_02650 44694 43876 gene locus_tag LOCUS_02660 44694 43876 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719999.1 protein_id gnl|my_center|LOCUS_02660 44985 46712 gene locus_tag LOCUS_02670 44985 46712 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244806.1 protein_id gnl|my_center|LOCUS_02670 47991 46783 gene locus_tag LOCUS_02680 gene elaD 47991 46783 CDS product deubiquitinase ElaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393504.1 protein_id gnl|my_center|LOCUS_02680 >Feature sequence005 533 1330 gene locus_tag LOCUS_02690 gene fhuC 533 1330 CDS product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158931.1 protein_id gnl|my_center|LOCUS_02690 1330 2220 gene locus_tag LOCUS_02700 gene fhuD 1330 2220 CDS product Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310529.1 protein_id gnl|my_center|LOCUS_02700 2217 4199 gene locus_tag LOCUS_02710 gene fhuB 2217 4199 CDS product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044072.1 protein_id gnl|my_center|LOCUS_02710 5637 4357 gene locus_tag LOCUS_02720 gene hemL 5637 4357 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045315.1 protein_id gnl|my_center|LOCUS_02720 5972 7123 gene locus_tag LOCUS_02730 gene clcA 5972 7123 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845394.1 protein_id gnl|my_center|LOCUS_02730 7205 7549 gene locus_tag LOCUS_02740 gene erpA 7205 7549 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295564.1 protein_id gnl|my_center|LOCUS_02740 8219 7596 gene locus_tag LOCUS_02750 8219 7596 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964221.1 protein_id gnl|my_center|LOCUS_02750 9057 8257 gene locus_tag LOCUS_02760 gene btuF 9057 8257 CDS product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129927.1 protein_id gnl|my_center|LOCUS_02760 9748 9050 gene locus_tag LOCUS_02770 gene mtnN 9748 9050 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689844.1 protein_id gnl|my_center|LOCUS_02770 9832 11349 gene locus_tag LOCUS_02780 gene dgt 9832 11349 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057073.1 protein_id gnl|my_center|LOCUS_02780 11479 12903 gene locus_tag LOCUS_02790 gene degP 11479 12903 CDS product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753946.1 protein_id gnl|my_center|LOCUS_02790 13058 14215 gene locus_tag LOCUS_02800 gene cdaR 13058 14215 CDS product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929443.1 protein_id gnl|my_center|LOCUS_02800 14690 14304 gene locus_tag LOCUS_02810 14690 14304 CDS product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272188.1 protein_id gnl|my_center|LOCUS_02810 15595 14852 gene locus_tag LOCUS_02820 gene yaeI 15595 14852 CDS product phosphodiesterase YaeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625631.1 protein_id gnl|my_center|LOCUS_02820 16542 15718 gene locus_tag LOCUS_02830 gene dapD 16542 15718 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186650.1 protein_id gnl|my_center|LOCUS_02830 19245 16573 gene locus_tag LOCUS_02840 gene glnD 19245 16573 CDS product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094586.1 protein_id gnl|my_center|LOCUS_02840 20101 19307 gene locus_tag LOCUS_02850 gene map 20101 19307 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018194.1 protein_id gnl|my_center|LOCUS_02850 20469 21194 gene locus_tag LOCUS_02860 gene rpsB 20469 21194 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246882.1 protein_id gnl|my_center|LOCUS_02860 21452 22303 gene locus_tag LOCUS_02870 gene tsf 21452 22303 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818114.1 protein_id gnl|my_center|LOCUS_02870 22450 23175 gene locus_tag LOCUS_02880 gene pyrH 22450 23175 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224573.1 protein_id gnl|my_center|LOCUS_02880 23467 24024 gene locus_tag LOCUS_02890 gene frr 23467 24024 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622418.1 protein_id gnl|my_center|LOCUS_02890 24116 25312 gene locus_tag LOCUS_02900 gene ispC 24116 25312 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811923.1 protein_id gnl|my_center|LOCUS_02900 25570 26259 gene locus_tag LOCUS_02910 gene ispU 25570 26259 CDS product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295562.1 protein_id gnl|my_center|LOCUS_02910 26380 27129 gene locus_tag LOCUS_02920 gene cdsA 26380 27129 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922446.1 protein_id gnl|my_center|LOCUS_02920 27141 28493 gene locus_tag LOCUS_02930 gene rseP 27141 28493 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295561.1 protein_id gnl|my_center|LOCUS_02930 28523 30955 gene locus_tag LOCUS_02940 gene bamA 28523 30955 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240896.1 protein_id gnl|my_center|LOCUS_02940 31077 31562 gene locus_tag LOCUS_02950 gene skp 31077 31562 CDS product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758956.1 protein_id gnl|my_center|LOCUS_02950 31566 32591 gene locus_tag LOCUS_02960 gene lpxD 31566 32591 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139279.1 protein_id gnl|my_center|LOCUS_02960 32696 33151 gene locus_tag LOCUS_02970 gene fabZ 32696 33151 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210739.1 protein_id gnl|my_center|LOCUS_02970 33155 33943 gene locus_tag LOCUS_02980 gene lpxA 33155 33943 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565966.1 protein_id gnl|my_center|LOCUS_02980 33943 35091 gene locus_tag LOCUS_02990 gene lpxB 33943 35091 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139654.1 protein_id gnl|my_center|LOCUS_02990 35088 35684 gene locus_tag LOCUS_03000 gene rnhB 35088 35684 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569430.1 protein_id gnl|my_center|LOCUS_03000 35721 39203 gene locus_tag LOCUS_03010 gene dnaE 35721 39203 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294757.1 protein_id gnl|my_center|LOCUS_03010 39216 40175 gene locus_tag LOCUS_03020 gene accA 39216 40175 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055741.1 protein_id gnl|my_center|LOCUS_03020 40274 42289 gene locus_tag LOCUS_03030 gene ldcC 40274 42289 CDS product lysine decarboxylase LdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020973.1 protein_id gnl|my_center|LOCUS_03030 42472 42861 gene locus_tag LOCUS_03040 42472 42861 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901099.1 protein_id gnl|my_center|LOCUS_03040 42926 44224 gene locus_tag LOCUS_03050 gene tilS 42926 44224 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176549.1 protein_id gnl|my_center|LOCUS_03050 >Feature sequence006 341 997 gene locus_tag LOCUS_03060 gene yobB 341 997 CDS product carbon-nitrogen hydrolase family protein YobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011658.1 protein_id gnl|my_center|LOCUS_03060 1021 1683 gene locus_tag LOCUS_03070 gene exoX 1021 1683 CDS product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944256.1 protein_id gnl|my_center|LOCUS_03070 3740 1680 gene locus_tag LOCUS_03080 gene ptrB 3740 1680 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936927.1 protein_id gnl|my_center|LOCUS_03080 4608 3949 gene locus_tag LOCUS_03090 4608 3949 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024757.1 protein_id gnl|my_center|LOCUS_03090 5291 4935 gene locus_tag LOCUS_03100 gene yebF 5291 4935 CDS product protein YebF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350516.1 protein_id gnl|my_center|LOCUS_03100 5648 5358 gene locus_tag LOCUS_03110 gene yebG 5648 5358 CDS product DNA damage-inducible protein YebG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257738.1 protein_id gnl|my_center|LOCUS_03110 5782 6960 gene locus_tag LOCUS_03120 gene purT 5782 6960 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173484.1 protein_id gnl|my_center|LOCUS_03120 7657 7016 gene locus_tag LOCUS_03130 gene kdgA 7657 7016 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800512.1 protein_id gnl|my_center|LOCUS_03130 9505 7694 gene locus_tag LOCUS_03140 gene edd 9505 7694 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069467.1 protein_id gnl|my_center|LOCUS_03140 11215 9740 gene locus_tag LOCUS_03150 gene zwf 11215 9740 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301727.1 protein_id gnl|my_center|LOCUS_03150 11530 11381 gene locus_tag LOCUS_03160 11530 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155622.1 protein_id gnl|my_center|LOCUS_03160 11553 12422 gene locus_tag LOCUS_03170 gene hexR 11553 12422 CDS product DNA-binding transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056706.1 protein_id gnl|my_center|LOCUS_03170 12550 13992 gene locus_tag LOCUS_03180 gene pyk 12550 13992 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091148.1 protein_id gnl|my_center|LOCUS_03180 15094 14123 gene locus_tag LOCUS_03190 gene lpxM 15094 14123 CDS product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448381.1 protein_id gnl|my_center|LOCUS_03190 16536 15214 gene locus_tag LOCUS_03200 gene mepM 16536 15214 CDS product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001184045.1 protein_id gnl|my_center|LOCUS_03200 17610 16552 gene locus_tag LOCUS_03210 gene znuA 17610 16552 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069410.1 protein_id gnl|my_center|LOCUS_03210 17563 18318 gene locus_tag LOCUS_03220 gene znuC 17563 18318 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202996.1 protein_id gnl|my_center|LOCUS_03220 18315 19100 gene locus_tag LOCUS_03230 gene znuB 18315 19100 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571480.1 protein_id gnl|my_center|LOCUS_03230 19176 19787 gene locus_tag LOCUS_03240 gene lacA 19176 19787 CDS product galactoside O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335915.1 protein_id gnl|my_center|LOCUS_03240 21044 19890 gene locus_tag LOCUS_03250 gene cynX 21044 19890 CDS product cyanate transporter CynX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927953.1 protein_id gnl|my_center|LOCUS_03250 22504 21077 gene locus_tag LOCUS_03260 22504 21077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 22904 22572 gene locus_tag LOCUS_03270 22904 22572 CDS product head decoration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201478.1 protein_id gnl|my_center|LOCUS_03270 24257 22914 gene locus_tag LOCUS_03280 24257 22914 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123254.1 protein_id gnl|my_center|LOCUS_03280 25812 24238 gene locus_tag LOCUS_03290 25812 24238 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001316944.1 protein_id gnl|my_center|LOCUS_03290 26033 25827 gene locus_tag LOCUS_03300 26033 25827 CDS product gpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198149.1 protein_id gnl|my_center|LOCUS_03300 27955 26033 gene locus_tag LOCUS_03310 27955 26033 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027292.1 protein_id gnl|my_center|LOCUS_03310 28247 27930 gene locus_tag LOCUS_03320 28247 27930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 28170 29081 gene locus_tag LOCUS_03330 28170 29081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 29725 29135 gene locus_tag LOCUS_03340 gene yajL 29725 29135 CDS product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276305.1 protein_id gnl|my_center|LOCUS_03340 29867 29688 gene locus_tag LOCUS_03350 29867 29688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03350 30606 29893 gene locus_tag LOCUS_03360 gene panE 30606 29893 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705865.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03360 30774 31265 gene locus_tag LOCUS_03370 gene yajQ 30774 31265 CDS product nucleotide binding protein YajQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138904.1 protein_id gnl|my_center|LOCUS_03370 32757 31393 gene locus_tag LOCUS_03380 32757 31393 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000963.1 protein_id gnl|my_center|LOCUS_03380 33796 32906 gene locus_tag LOCUS_03390 gene cyoE 33796 32906 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971336.1 protein_id gnl|my_center|LOCUS_03390 34137 33808 gene locus_tag LOCUS_03400 34137 33808 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019869.1 protein_id gnl|my_center|LOCUS_03400 34751 34137 gene locus_tag LOCUS_03410 34751 34137 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179819.1 protein_id gnl|my_center|LOCUS_03410 36732 34741 gene locus_tag LOCUS_03420 gene cyoB 36732 34741 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467180.1 protein_id gnl|my_center|LOCUS_03420 37641 36754 gene locus_tag LOCUS_03430 gene cyoA 37641 36754 CDS product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239436.1 protein_id gnl|my_center|LOCUS_03430 39636 38161 gene locus_tag LOCUS_03440 gene ampG 39636 38161 CDS product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098429.1 protein_id gnl|my_center|LOCUS_03440 40258 39680 gene locus_tag LOCUS_03450 40258 39680 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295326.1 protein_id gnl|my_center|LOCUS_03450 40563 40880 gene locus_tag LOCUS_03460 gene bolA 40563 40880 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973448.1 protein_id gnl|my_center|LOCUS_03460 41224 42522 gene locus_tag LOCUS_03470 gene tig 41224 42522 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198384.1 protein_id gnl|my_center|LOCUS_03470 42768 43391 gene locus_tag LOCUS_03480 gene clpP 42768 43391 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122253.1 protein_id gnl|my_center|LOCUS_03480 >Feature sequence007 2223 1324 gene locus_tag LOCUS_03490 gene lysO 2223 1324 CDS product L-lysine exporter LysO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491142.1 protein_id gnl|my_center|LOCUS_03490 3422 2718 gene locus_tag LOCUS_03500 gene aqpZ 3422 2718 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298299.1 protein_id gnl|my_center|LOCUS_03500 3839 5497 gene locus_tag LOCUS_03510 3839 5497 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599802.1 protein_id gnl|my_center|LOCUS_03510 6486 5494 gene locus_tag LOCUS_03520 6486 5494 CDS product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241033.1 protein_id gnl|my_center|LOCUS_03520 6619 7716 gene locus_tag LOCUS_03530 gene macA 6619 7716 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746442.1 protein_id gnl|my_center|LOCUS_03530 7713 9659 gene locus_tag LOCUS_03540 gene macB 7713 9659 CDS product macrolide ABC transporter ATP-binding protein/permease MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188144.1 protein_id gnl|my_center|LOCUS_03540 9956 9732 gene locus_tag LOCUS_03550 gene cspD 9956 9732 CDS product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410785.1 protein_id gnl|my_center|LOCUS_03550 10279 10599 gene locus_tag LOCUS_03560 gene clpS 10279 10599 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520781.1 protein_id gnl|my_center|LOCUS_03560 10630 12906 gene locus_tag LOCUS_03570 gene clpA 10630 12906 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934041.1 protein_id gnl|my_center|LOCUS_03570 13337 13250 gene locus_tag LOCUS_t00030 13337 13250 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13809 13591 gene locus_tag LOCUS_03580 gene infA 13809 13591 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 protein_id gnl|my_center|LOCUS_03580 14798 14094 gene locus_tag LOCUS_03590 gene aat 14798 14094 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241678.1 protein_id gnl|my_center|LOCUS_03590 16561 14840 gene locus_tag LOCUS_03600 gene cydC 16561 14840 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202177.1 protein_id gnl|my_center|LOCUS_03600 18328 16562 gene locus_tag LOCUS_03610 gene cydD 18328 16562 CDS product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043598.1 protein_id gnl|my_center|LOCUS_03610 19416 18451 gene locus_tag LOCUS_03620 gene trxB 19416 18451 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537418.1 protein_id gnl|my_center|LOCUS_03620 19961 20455 gene locus_tag LOCUS_03630 gene lrp 19961 20455 CDS product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228473.1 protein_id gnl|my_center|LOCUS_03630 20590 24462 gene locus_tag LOCUS_03640 20590 24462 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097320.1 protein_id gnl|my_center|LOCUS_03640 24618 25232 gene locus_tag LOCUS_03650 gene lolA 24618 25232 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976047.1 protein_id gnl|my_center|LOCUS_03650 25243 26586 gene locus_tag LOCUS_03660 gene rarA 25243 26586 CDS product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067755.1 protein_id gnl|my_center|LOCUS_03660 26677 27969 gene locus_tag LOCUS_03670 gene serS 26677 27969 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886683.1 protein_id gnl|my_center|LOCUS_03670 28208 30652 gene locus_tag LOCUS_03680 gene dmsA 28208 30652 CDS product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850303.1 protein_id gnl|my_center|LOCUS_03680 30663 31280 gene locus_tag LOCUS_03690 gene dmsB 30663 31280 CDS product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213098.1 protein_id gnl|my_center|LOCUS_03690 31282 32145 gene locus_tag LOCUS_03700 gene dmsC 31282 32145 CDS product dimethyl sulfoxide reductase anchor subunit DmsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534637.1 protein_id gnl|my_center|LOCUS_03700 32806 32180 gene locus_tag LOCUS_03710 gene ycaC 32806 32180 CDS product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165879.1 protein_id gnl|my_center|LOCUS_03710 33120 34268 gene locus_tag LOCUS_03720 33120 34268 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109259.1 protein_id gnl|my_center|LOCUS_03720 34478 35908 gene locus_tag LOCUS_03730 34478 35908 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918506.1 protein_id gnl|my_center|LOCUS_03730 36817 35909 gene locus_tag LOCUS_03740 36817 35909 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242684.1 protein_id gnl|my_center|LOCUS_03740 36917 37507 gene locus_tag LOCUS_03750 36917 37507 CDS product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190363.1 protein_id gnl|my_center|LOCUS_03750 38329 37589 gene locus_tag LOCUS_03760 gene pflA 38329 37589 CDS product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111043.1 protein_id gnl|my_center|LOCUS_03760 40803 38521 gene locus_tag LOCUS_03770 gene pflB 40803 38521 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292822.1 protein_id gnl|my_center|LOCUS_03770 41520 40858 gene locus_tag LOCUS_03780 gene focA 41520 40858 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642546.1 protein_id gnl|my_center|LOCUS_03780 41524 41556 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence008 1887 127 gene locus_tag LOCUS_03790 gene ycaO 1887 127 CDS product 30S ribosomal protein S12 methylthiotransferase accessory factor YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295344.1 protein_id gnl|my_center|LOCUS_03790 2017 2709 gene locus_tag LOCUS_03800 2017 2709 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642849.1 protein_id gnl|my_center|LOCUS_03800 2908 3996 gene locus_tag LOCUS_03810 gene serC 2908 3996 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057138.1 protein_id gnl|my_center|LOCUS_03810 4067 5350 gene locus_tag LOCUS_03820 gene aroA 4067 5350 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445231.1 protein_id gnl|my_center|LOCUS_03820 5519 6283 gene locus_tag LOCUS_03830 gene ycaL 5519 6283 CDS product metallopeptidase YcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350496.1 protein_id gnl|my_center|LOCUS_03830 6456 7139 gene locus_tag LOCUS_03840 gene cmk 6456 7139 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125016.1 protein_id gnl|my_center|LOCUS_03840 7250 8923 gene locus_tag LOCUS_03850 gene rpsA 7250 8923 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140327.1 protein_id gnl|my_center|LOCUS_03850 9083 9367 gene locus_tag LOCUS_03860 gene ihfB 9083 9367 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167336.1 protein_id gnl|my_center|LOCUS_03860 9575 10726 gene locus_tag LOCUS_03870 9575 10726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03870 11031 11840 gene locus_tag LOCUS_03880 11031 11840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 11877 13625 gene locus_tag LOCUS_03890 gene msbA 11877 13625 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551270.1 protein_id gnl|my_center|LOCUS_03890 13622 14608 gene locus_tag LOCUS_03900 gene lpxK 13622 14608 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570539.1 protein_id gnl|my_center|LOCUS_03900 14645 15877 gene locus_tag LOCUS_03910 14645 15877 CDS product winged helix DNA-binding protein YcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056538.1 protein_id gnl|my_center|LOCUS_03910 15929 16111 gene locus_tag LOCUS_03920 gene ycaR 15929 16111 CDS product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350058.1 protein_id gnl|my_center|LOCUS_03920 16108 16854 gene locus_tag LOCUS_03930 gene kdsB 16108 16854 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011603.1 protein_id gnl|my_center|LOCUS_03930 17008 17901 gene locus_tag LOCUS_03940 17008 17901 CDS product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436922.1 protein_id gnl|my_center|LOCUS_03940 18657 17878 gene locus_tag LOCUS_03950 gene elyC 18657 17878 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899600.1 protein_id gnl|my_center|LOCUS_03950 18793 19578 gene locus_tag LOCUS_03960 gene cmoM 18793 19578 CDS product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298300.1 protein_id gnl|my_center|LOCUS_03960 19575 20897 gene locus_tag LOCUS_03970 gene mukF 19575 20897 CDS product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288850.1 protein_id gnl|my_center|LOCUS_03970 20905 21582 gene locus_tag LOCUS_03980 gene mukE 20905 21582 CDS product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295347.1 protein_id gnl|my_center|LOCUS_03980 21582 26009 gene locus_tag LOCUS_03990 gene mukB 21582 26009 CDS product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572698.1 protein_id gnl|my_center|LOCUS_03990 26270 28117 gene locus_tag LOCUS_04000 gene ldtD 26270 28117 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925969.1 protein_id gnl|my_center|LOCUS_04000 28298 28846 gene locus_tag LOCUS_04010 28298 28846 CDS product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295932.1 protein_id gnl|my_center|LOCUS_04010 28873 29520 gene locus_tag LOCUS_04020 gene gloC 28873 29520 CDS product hydroxyacylglutathione hydrolase GloC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109486.1 protein_id gnl|my_center|LOCUS_04020 30932 29742 gene locus_tag LOCUS_04030 gene aspC 30932 29742 CDS product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462687.1 protein_id gnl|my_center|LOCUS_04030 30919 31101 gene locus_tag LOCUS_04040 30919 31101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196607.1 protein_id gnl|my_center|LOCUS_04040 32205 31117 gene locus_tag LOCUS_04050 gene ompF 32205 31117 CDS product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977920.1 protein_id gnl|my_center|LOCUS_04050 34208 32808 gene locus_tag LOCUS_04060 gene asnS 34208 32808 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117881.1 protein_id gnl|my_center|LOCUS_04060 35084 34377 gene locus_tag LOCUS_04070 35084 34377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 35530 35099 gene locus_tag LOCUS_04080 35530 35099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 35114 35118 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35748 38360 gene locus_tag LOCUS_04090 gene pepN 35748 38360 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193841.1 protein_id gnl|my_center|LOCUS_04090 39170 38403 gene locus_tag LOCUS_04100 gene ssuB 39170 38403 CDS product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090506.1 protein_id gnl|my_center|LOCUS_04100 39958 39167 gene locus_tag LOCUS_04110 gene ssuC 39958 39167 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235203.1 protein_id gnl|my_center|LOCUS_04110 40523 39969 gene locus_tag LOCUS_04120 40523 39969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 >Feature sequence009 389 2407 gene locus_tag LOCUS_04130 gene fadH 389 2407 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121433.1 protein_id gnl|my_center|LOCUS_04130 2868 2452 gene locus_tag LOCUS_04140 gene higA 2868 2452 CDS product type II toxin-antitoxin system antitoxin HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560266.1 protein_id gnl|my_center|LOCUS_04140 3179 2865 gene locus_tag LOCUS_04150 gene higB 3179 2865 CDS product type II toxin-antitoxin system toxin HigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550189.1 protein_id gnl|my_center|LOCUS_04150 4599 3463 gene locus_tag LOCUS_04160 gene rlmG 4599 3463 CDS product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018695.1 protein_id gnl|my_center|LOCUS_04160 4684 5187 gene locus_tag LOCUS_04170 4684 5187 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333820.1 protein_id gnl|my_center|LOCUS_04170 5264 5956 gene locus_tag LOCUS_04180 5264 5956 CDS product vancomycin high temperature exclusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942548.1 protein_id gnl|my_center|LOCUS_04180 6035 7021 gene locus_tag LOCUS_04190 6035 7021 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617698.1 protein_id gnl|my_center|LOCUS_04190 7304 8269 gene locus_tag LOCUS_04200 gene alx 7304 8269 CDS product TerC family membrane protein Alx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098806.1 protein_id gnl|my_center|LOCUS_04200 8668 9912 gene locus_tag LOCUS_04210 gene sstT 8668 9912 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211655.1 protein_id gnl|my_center|LOCUS_04210 10468 9917 gene locus_tag LOCUS_04220 10468 9917 CDS product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128135.1 protein_id gnl|my_center|LOCUS_04220 12038 10551 gene locus_tag LOCUS_04230 gene uxaA 12038 10551 CDS product altronate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199390.1 protein_id gnl|my_center|LOCUS_04230 13465 12053 gene locus_tag LOCUS_04240 gene uxaC 13465 12053 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187442.1 protein_id gnl|my_center|LOCUS_04240 13948 15246 gene locus_tag LOCUS_04250 gene exuT 13948 15246 CDS product hexuronate transporter ExuT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226465.1 protein_id gnl|my_center|LOCUS_04250 15376 16152 gene locus_tag LOCUS_04260 gene exuR 15376 16152 CDS product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406488.1 protein_id gnl|my_center|LOCUS_04260 16497 17159 gene locus_tag LOCUS_04270 gene yqjA 16497 17159 CDS product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422149.1 protein_id gnl|my_center|LOCUS_04270 17163 17546 gene locus_tag LOCUS_04280 gene mzrA 17163 17546 CDS product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166760.1 protein_id gnl|my_center|LOCUS_04280 17693 18061 gene locus_tag LOCUS_04290 gene yqjC 17693 18061 CDS product DUF1090 family protein YqjC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295543.1 protein_id gnl|my_center|LOCUS_04290 18099 18404 gene locus_tag LOCUS_04300 18099 18404 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031415.1 protein_id gnl|my_center|LOCUS_04300 18407 18811 gene locus_tag LOCUS_04310 18407 18811 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785722.1 protein_id gnl|my_center|LOCUS_04310 18801 19100 gene locus_tag LOCUS_04320 18801 19100 CDS product YqjK-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096091.1 protein_id gnl|my_center|LOCUS_04320 19196 19678 gene locus_tag LOCUS_04330 19196 19678 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603618.1 protein_id gnl|my_center|LOCUS_04330 19748 20734 gene locus_tag LOCUS_04340 gene yqjG 19748 20734 CDS product glutathionyl-hydroquinone reductase YqjG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531213.1 protein_id gnl|my_center|LOCUS_04340 21028 21393 gene locus_tag LOCUS_04350 21028 21393 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384145.1 protein_id gnl|my_center|LOCUS_04350 21635 21991 gene locus_tag LOCUS_04360 21635 21991 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198807.1 protein_id gnl|my_center|LOCUS_04360 22938 22042 gene locus_tag LOCUS_04370 gene yhaJ 22938 22042 CDS product DNA-binding transcriptional regulator YhaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041009.1 protein_id gnl|my_center|LOCUS_04370 23043 23744 gene locus_tag LOCUS_04380 23043 23744 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633576.1 protein_id gnl|my_center|LOCUS_04380 23767 23931 gene locus_tag LOCUS_04390 gene yhaL 23767 23931 CDS product protein YhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001345966.1 protein_id gnl|my_center|LOCUS_04390 25375 24065 gene locus_tag LOCUS_04400 gene cyuA 25375 24065 CDS product cysteine desulfidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460499.1 protein_id gnl|my_center|LOCUS_04400 26734 25403 gene locus_tag LOCUS_04410 26734 25403 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401598.1 protein_id gnl|my_center|LOCUS_04410 28373 27009 gene locus_tag LOCUS_04420 gene tdcG 28373 27009 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622126.1 protein_id gnl|my_center|LOCUS_04420 28834 28445 gene locus_tag LOCUS_04430 28834 28445 CDS product enamine/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719990.1 protein_id gnl|my_center|LOCUS_04430 31142 28848 gene locus_tag LOCUS_04440 gene tdcE 31142 28848 CDS product 2-ketobutyrate formate-lyase/pyruvate formate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861734.1 protein_id gnl|my_center|LOCUS_04440 32384 31176 gene locus_tag LOCUS_04450 gene tdcD 32384 31176 CDS product propionate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295545.1 protein_id gnl|my_center|LOCUS_04450 33741 32410 gene locus_tag LOCUS_04460 gene tdcC 33741 32410 CDS product threonine/serine transporter TdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107723.1 protein_id gnl|my_center|LOCUS_04460 34752 33763 gene locus_tag LOCUS_04470 gene tdcB 34752 33763 CDS product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548347.1 protein_id gnl|my_center|LOCUS_04470 35789 34851 gene locus_tag LOCUS_04480 gene tdcA 35789 34851 CDS product transcriptional regulator TdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104211.1 protein_id gnl|my_center|LOCUS_04480 36578 37117 gene locus_tag LOCUS_04490 gene yhaB 36578 37117 CDS product protein YhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675733.1 protein_id gnl|my_center|LOCUS_04490 37139 38326 gene locus_tag LOCUS_04500 37139 38326 CDS product YhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484600.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence010 27 102 gene locus_tag LOCUS_t00040 27 102 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 144 254 gene locus_tag LOCUS_r00010 144 254 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1246 488 gene locus_tag LOCUS_04510 1246 488 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078349.1 protein_id gnl|my_center|LOCUS_04510 2357 1254 gene locus_tag LOCUS_04520 2357 1254 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300681.1 protein_id gnl|my_center|LOCUS_04520 3566 2367 gene locus_tag LOCUS_04530 3566 2367 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019655.1 protein_id gnl|my_center|LOCUS_04530 4533 3616 gene locus_tag LOCUS_04540 4533 3616 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738579.1 protein_id gnl|my_center|LOCUS_04540 5292 5071 gene locus_tag LOCUS_04550 5292 5071 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825639.1 protein_id gnl|my_center|LOCUS_04550 8424 5545 gene locus_tag LOCUS_04560 gene acrF 8424 5545 CDS product multidrug efflux RND transporter permease subunit AcrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273238.1 protein_id gnl|my_center|LOCUS_04560 8647 8429 gene locus_tag LOCUS_04570 8647 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04570 9816 8659 gene locus_tag LOCUS_04580 gene acrE 9816 8659 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160334.1 protein_id gnl|my_center|LOCUS_04580 10215 10877 gene locus_tag LOCUS_04590 gene acrS 10215 10877 CDS product multidrug efflux transporter transcriptional repressor AcrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129518.1 protein_id gnl|my_center|LOCUS_04590 12027 11143 gene locus_tag LOCUS_04600 gene yhdJ 12027 11143 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258895.1 protein_id gnl|my_center|LOCUS_04600 12409 12113 gene locus_tag LOCUS_04610 gene fis 12409 12113 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 protein_id gnl|my_center|LOCUS_04610 13307 12435 gene locus_tag LOCUS_04620 gene dusB 13307 12435 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219652.1 protein_id gnl|my_center|LOCUS_04620 14610 13729 gene locus_tag LOCUS_04630 gene prmA 14610 13729 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145827.1 protein_id gnl|my_center|LOCUS_04630 16073 14622 gene locus_tag LOCUS_04640 gene panF 16073 14622 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175728.1 protein_id gnl|my_center|LOCUS_04640 16305 16063 gene locus_tag LOCUS_04650 16305 16063 CDS product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381173.1 protein_id gnl|my_center|LOCUS_04650 17763 16414 gene locus_tag LOCUS_04660 gene accC 17763 16414 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884639.1 protein_id gnl|my_center|LOCUS_04660 18244 17774 gene locus_tag LOCUS_04670 gene accB 18244 17774 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354622.1 protein_id gnl|my_center|LOCUS_04670 18405 18217 gene locus_tag LOCUS_04680 18405 18217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 20196 19222 gene locus_tag LOCUS_04690 20196 19222 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148481.1 protein_id gnl|my_center|LOCUS_04690 20348 22288 gene locus_tag LOCUS_04700 gene csrD 20348 22288 CDS product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241469.1 protein_id gnl|my_center|LOCUS_04700 22593 23636 gene locus_tag LOCUS_04710 gene mreB 22593 23636 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913396.1 protein_id gnl|my_center|LOCUS_04710 23702 24805 gene locus_tag LOCUS_04720 gene mreC 23702 24805 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802511.1 protein_id gnl|my_center|LOCUS_04720 24805 25293 gene locus_tag LOCUS_04730 gene mreD 24805 25293 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179409.1 protein_id gnl|my_center|LOCUS_04730 25302 25895 gene locus_tag LOCUS_04740 gene yhdE 25302 25895 CDS product nucleoside triphosphate pyrophosphatase YhdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203105.1 protein_id gnl|my_center|LOCUS_04740 25885 27354 gene locus_tag LOCUS_04750 gene rng 25885 27354 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123197.1 protein_id gnl|my_center|LOCUS_04750 27422 31222 gene locus_tag LOCUS_04760 gene yhdP 27422 31222 CDS product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253618.1 protein_id gnl|my_center|LOCUS_04760 31652 33097 gene locus_tag LOCUS_04770 gene tldD 31652 33097 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055909.1 protein_id gnl|my_center|LOCUS_04770 33163 33235 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33734 33297 gene locus_tag LOCUS_04780 33734 33297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04780 34228 33674 gene locus_tag LOCUS_04790 34228 33674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04790 34411 34614 gene locus_tag LOCUS_04800 34411 34614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 34622 35554 gene locus_tag LOCUS_04810 gene aaeA 34622 35554 CDS product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854021.1 protein_id gnl|my_center|LOCUS_04810 35560 37527 gene locus_tag LOCUS_04820 gene aaeB 35560 37527 CDS product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510962.1 protein_id gnl|my_center|LOCUS_04820 37619 37927 gene locus_tag LOCUS_04830 37619 37927 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029013.1 protein_id gnl|my_center|LOCUS_04830 38297 37983 gene locus_tag LOCUS_04840 gene yhcN 38297 37983 CDS product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509740.1 protein_id gnl|my_center|LOCUS_04840 >Feature sequence011 <1 608 gene locus_tag LOCUS_04850 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000212470.1:transcriptional regulator EbgR 792 3884 gene locus_tag LOCUS_04860 gene ebgA 792 3884 CDS product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082856.1 protein_id gnl|my_center|LOCUS_04860 3881 4330 gene locus_tag LOCUS_04870 3881 4330 CDS product beta-galactosidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219954.1 protein_id gnl|my_center|LOCUS_04870 4393 5826 gene locus_tag LOCUS_04880 4393 5826 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285432.1 protein_id gnl|my_center|LOCUS_04880 5960 7030 gene locus_tag LOCUS_04890 gene ygjJ 5960 7030 CDS product protein YgjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767652.1 protein_id gnl|my_center|LOCUS_04890 7047 9398 gene locus_tag LOCUS_04900 gene ygjK 7047 9398 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695487.1 protein_id gnl|my_center|LOCUS_04900 9849 9523 gene locus_tag LOCUS_04910 gene ypeC 9849 9523 CDS product DUF2502 domain-containing protein YpeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490072.1 protein_id gnl|my_center|LOCUS_04910 11220 9964 gene locus_tag LOCUS_04920 11220 9964 CDS product ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903148.1 protein_id gnl|my_center|LOCUS_04920 11424 12389 gene locus_tag LOCUS_04930 gene glk 11424 12389 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170346.1 protein_id gnl|my_center|LOCUS_04930 12608 12934 gene locus_tag LOCUS_04940 12608 12934 CDS product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038456.1 protein_id gnl|my_center|LOCUS_04940 12956 14203 gene locus_tag LOCUS_04950 12956 14203 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985359.1 protein_id gnl|my_center|LOCUS_04950 14218 15303 gene locus_tag LOCUS_04960 gene ypdF 14218 15303 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173288.1 protein_id gnl|my_center|LOCUS_04960 15303 16340 gene locus_tag LOCUS_04970 gene ypdE 15303 16340 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366028.1 protein_id gnl|my_center|LOCUS_04970 16365 18860 gene locus_tag LOCUS_04980 gene ptsP 16365 18860 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955906.1 protein_id gnl|my_center|LOCUS_04980 19720 18863 gene locus_tag LOCUS_04990 19720 18863 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646835.1 protein_id gnl|my_center|LOCUS_04990 20467 19733 gene locus_tag LOCUS_05000 gene ypdB 20467 19733 CDS product two-component system response regulator YpdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295458.1 protein_id gnl|my_center|LOCUS_05000 22161 20482 gene locus_tag LOCUS_05010 gene ypdA 22161 20482 CDS product two-component system sensor histidine kinase YpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544359.1 protein_id gnl|my_center|LOCUS_05010 22555 23793 gene locus_tag LOCUS_05020 gene alaC 22555 23793 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785931.1 protein_id gnl|my_center|LOCUS_05020 25205 24285 gene locus_tag LOCUS_05030 gene lpxP 25205 24285 CDS product kdo(2)-lipid IV(A) palmitoleoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484404.1 protein_id gnl|my_center|LOCUS_05030 25558 25800 gene locus_tag LOCUS_05040 25558 25800 CDS product YfdY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609275.1 protein_id gnl|my_center|LOCUS_05040 26152 25877 gene locus_tag LOCUS_05050 gene ypdI 26152 25877 CDS product colanic acid biosynthesis lipoprotein YpdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867631.1 protein_id gnl|my_center|LOCUS_05050 26448 27083 gene locus_tag LOCUS_05060 26448 27083 CDS product YfdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825600.1 protein_id gnl|my_center|LOCUS_05060 27668 28846 gene locus_tag LOCUS_05070 gene frc 27668 28846 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106759.1 protein_id gnl|my_center|LOCUS_05070 28930 30594 gene locus_tag LOCUS_05080 gene oxc 28930 30594 CDS product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283490.1 protein_id gnl|my_center|LOCUS_05080 30664 31608 gene locus_tag LOCUS_05090 gene yfdV 30664 31608 CDS product transporter YfdV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955028.1 protein_id gnl|my_center|LOCUS_05090 31682 32827 gene locus_tag LOCUS_05100 gene yfdE 31682 32827 CDS product CoA:oxalate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296867.1 protein_id gnl|my_center|LOCUS_05100 36476 32883 gene locus_tag LOCUS_05110 gene evgS 36476 32883 CDS product acid-sensing system histidine kinase EvgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326970.1 protein_id gnl|my_center|LOCUS_05110 37095 36481 gene locus_tag LOCUS_05120 gene evgA 37095 36481 CDS product acid-sensing system DNA-binding response regulator EvgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991370.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence012 629 384 gene locus_tag LOCUS_05130 gene dinI 629 384 CDS product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217754.1 protein_id gnl|my_center|LOCUS_05130 1623 703 gene locus_tag LOCUS_05140 gene pyrC 1623 703 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126534.1 protein_id gnl|my_center|LOCUS_05140 2415 1855 gene locus_tag LOCUS_05150 2415 1855 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295443.1 protein_id gnl|my_center|LOCUS_05150 3196 2549 gene locus_tag LOCUS_05160 gene grxB 3196 2549 CDS product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780912.1 protein_id gnl|my_center|LOCUS_05160 4468 3260 gene locus_tag LOCUS_05170 gene mdtH 4468 3260 CDS product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092206.1 protein_id gnl|my_center|LOCUS_05170 4704 5288 gene locus_tag LOCUS_05180 gene rimJ 4704 5288 CDS product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468186.1 protein_id gnl|my_center|LOCUS_05180 5299 5946 gene locus_tag LOCUS_05190 5299 5946 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877107.1 protein_id gnl|my_center|LOCUS_05190 5948 6871 gene locus_tag LOCUS_05200 5948 6871 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736158.1 protein_id gnl|my_center|LOCUS_05200 6981 8516 gene locus_tag LOCUS_05210 gene murJ 6981 8516 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050683.1 protein_id gnl|my_center|LOCUS_05210 8972 8556 gene locus_tag LOCUS_05220 gene flgN 8972 8556 CDS product flagella biosynthesis chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197363.1 protein_id gnl|my_center|LOCUS_05220 9270 8977 gene locus_tag LOCUS_05230 gene flgM 9270 8977 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020880.1 protein_id gnl|my_center|LOCUS_05230 10005 9346 gene locus_tag LOCUS_05240 gene flgA 10005 9346 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905458.1 protein_id gnl|my_center|LOCUS_05240 10160 10576 gene locus_tag LOCUS_05250 gene flgB 10160 10576 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884702.1 protein_id gnl|my_center|LOCUS_05250 10580 10984 gene locus_tag LOCUS_05260 gene flgC 10580 10984 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196460.1 protein_id gnl|my_center|LOCUS_05260 10996 11691 gene locus_tag LOCUS_05270 gene flgD 10996 11691 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020486.1 protein_id gnl|my_center|LOCUS_05270 11716 12924 gene locus_tag LOCUS_05280 gene flgE 11716 12924 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885873.1 protein_id gnl|my_center|LOCUS_05280 12944 13699 gene locus_tag LOCUS_05290 gene flgF 12944 13699 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349316.1 protein_id gnl|my_center|LOCUS_05290 13871 14653 gene locus_tag LOCUS_05300 gene flgG 13871 14653 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625837.1 protein_id gnl|my_center|LOCUS_05300 14706 15404 gene locus_tag LOCUS_05310 gene flgH 14706 15404 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295442.1 protein_id gnl|my_center|LOCUS_05310 15416 16513 gene locus_tag LOCUS_05320 gene flgI 15416 16513 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589326.1 protein_id gnl|my_center|LOCUS_05320 16513 17454 gene locus_tag LOCUS_05330 gene flgJ 16513 17454 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295441.1 protein_id gnl|my_center|LOCUS_05330 17520 19163 gene locus_tag LOCUS_05340 gene flgK 17520 19163 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096479.1 protein_id gnl|my_center|LOCUS_05340 19175 20128 gene locus_tag LOCUS_05350 gene flgL 19175 20128 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212782.1 protein_id gnl|my_center|LOCUS_05350 23509 20324 gene locus_tag LOCUS_05360 gene rne 23509 20324 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827360.1 protein_id gnl|my_center|LOCUS_05360 24082 25041 gene locus_tag LOCUS_05370 gene rluC 24082 25041 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846343.1 protein_id gnl|my_center|LOCUS_05370 25776 25153 gene locus_tag LOCUS_05380 gene yceF 25776 25153 CDS product 7-methyl-GTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974786.1 protein_id gnl|my_center|LOCUS_05380 25936 26457 gene locus_tag LOCUS_05390 gene yceD 25936 26457 CDS product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174481.1 protein_id gnl|my_center|LOCUS_05390 26509 26682 gene locus_tag LOCUS_05400 gene rpmF 26509 26682 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290727.1 protein_id gnl|my_center|LOCUS_05400 26763 27833 gene locus_tag LOCUS_05410 gene plsX 26763 27833 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197597.1 protein_id gnl|my_center|LOCUS_05410 27901 28854 gene locus_tag LOCUS_05420 gene fabH 27901 28854 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288132.1 protein_id gnl|my_center|LOCUS_05420 28870 29799 gene locus_tag LOCUS_05430 gene fabD 28870 29799 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191372.1 protein_id gnl|my_center|LOCUS_05430 29812 30546 gene locus_tag LOCUS_05440 gene fabG 29812 30546 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008535.1 protein_id gnl|my_center|LOCUS_05440 30757 30993 gene locus_tag LOCUS_05450 gene acpP 30757 30993 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103754.1 protein_id gnl|my_center|LOCUS_05450 31081 32322 gene locus_tag LOCUS_05460 gene fabF 31081 32322 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044679.1 protein_id gnl|my_center|LOCUS_05460 32442 33251 gene locus_tag LOCUS_05470 gene pabC 32442 33251 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478681.1 protein_id gnl|my_center|LOCUS_05470 33254 34276 gene locus_tag LOCUS_05480 gene yceG 33254 34276 CDS product cell division protein YceG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756827.1 protein_id gnl|my_center|LOCUS_05480 34266 34907 gene locus_tag LOCUS_05490 gene tmk 34266 34907 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257000.1 protein_id gnl|my_center|LOCUS_05490 34904 35908 gene locus_tag LOCUS_05500 gene holB 34904 35908 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267956.1 protein_id gnl|my_center|LOCUS_05500 35919 36716 gene locus_tag LOCUS_05510 35919 36716 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480245.1 protein_id gnl|my_center|LOCUS_05510 >Feature sequence013 3148 2456 gene locus_tag LOCUS_05520 gene fimC 3148 2456 CDS product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988364.1 protein_id gnl|my_center|LOCUS_05520 3910 3368 gene locus_tag LOCUS_05530 gene fimA 3910 3368 CDS product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776555.1 protein_id gnl|my_center|LOCUS_05530 4381 5247 gene locus_tag LOCUS_05540 gene folD 4381 5247 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729160.1 protein_id gnl|my_center|LOCUS_05540 5249 5461 gene locus_tag LOCUS_05550 gene ybcJ 5249 5461 CDS product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310620.1 protein_id gnl|my_center|LOCUS_05550 5569 6090 gene locus_tag LOCUS_05560 5569 6090 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143542.1 protein_id gnl|my_center|LOCUS_05560 7511 6126 gene locus_tag LOCUS_05570 gene cysS 7511 6126 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912385.1 protein_id gnl|my_center|LOCUS_05570 7685 8179 gene locus_tag LOCUS_05580 gene ppiB 7685 8179 CDS product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255997.1 protein_id gnl|my_center|LOCUS_05580 8182 8904 gene locus_tag LOCUS_05590 gene lpxH 8182 8904 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212247.1 protein_id gnl|my_center|LOCUS_05590 9022 9531 gene locus_tag LOCUS_05600 gene purE 9022 9531 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295318.1 protein_id gnl|my_center|LOCUS_05600 9528 10595 gene locus_tag LOCUS_05610 gene purK 9528 10595 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815571.1 protein_id gnl|my_center|LOCUS_05610 11683 10790 gene locus_tag LOCUS_05620 11683 10790 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855379.1 protein_id gnl|my_center|LOCUS_05620 12495 11680 gene locus_tag LOCUS_05630 12495 11680 CDS product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152519.1 protein_id gnl|my_center|LOCUS_05630 13765 12506 gene locus_tag LOCUS_05640 13765 12506 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495367.1 protein_id gnl|my_center|LOCUS_05640 15442 13775 gene locus_tag LOCUS_05650 15442 13775 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580829.1 protein_id gnl|my_center|LOCUS_05650 15759 16808 gene locus_tag LOCUS_05660 gene allD 15759 16808 CDS product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703900.1 protein_id gnl|my_center|LOCUS_05660 16830 18065 gene locus_tag LOCUS_05670 gene allC 16830 18065 CDS product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310618.1 protein_id gnl|my_center|LOCUS_05670 18076 18861 gene locus_tag LOCUS_05680 gene allE 18076 18861 CDS product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540997.1 protein_id gnl|my_center|LOCUS_05680 20234 19089 gene locus_tag LOCUS_05690 gene glxK 20234 19089 CDS product glycerate 3-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333621.1 protein_id gnl|my_center|LOCUS_05690 20822 20256 gene locus_tag LOCUS_05700 20822 20256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05700 21557 20838 gene locus_tag LOCUS_05710 21557 20838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05710 22975 21614 gene locus_tag LOCUS_05720 gene allB 22975 21614 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006900.1 protein_id gnl|my_center|LOCUS_05720 24489 23035 gene locus_tag LOCUS_05730 24489 23035 CDS product putative allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401100.1 protein_id gnl|my_center|LOCUS_05730 25536 24658 gene locus_tag LOCUS_05740 gene glxR 25536 24658 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765839.1 protein_id gnl|my_center|LOCUS_05740 26412 25636 gene locus_tag LOCUS_05750 gene hyi 26412 25636 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943544.1 protein_id gnl|my_center|LOCUS_05750 28206 26425 gene locus_tag LOCUS_05760 gene gcl 28206 26425 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096881.1 protein_id gnl|my_center|LOCUS_05760 29066 28296 gene locus_tag LOCUS_05770 gene allR 29066 28296 CDS product HTH-type transcriptional repressor AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141275.1 protein_id gnl|my_center|LOCUS_05770 29671 29189 gene locus_tag LOCUS_05780 gene allA 29671 29189 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776377.1 protein_id gnl|my_center|LOCUS_05780 29901 30827 gene locus_tag LOCUS_05790 gene allS 29901 30827 CDS product HTH-type transcriptional activator AllS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460145.1 protein_id gnl|my_center|LOCUS_05790 30896 31990 gene locus_tag LOCUS_05800 gene mnmH 30896 31990 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157938.1 protein_id gnl|my_center|LOCUS_05800 32106 32477 gene locus_tag LOCUS_05810 32106 32477 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903287.1 protein_id gnl|my_center|LOCUS_05810 33189 32992 gene locus_tag LOCUS_05820 33189 32992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05820 33452 33222 gene locus_tag LOCUS_05830 33452 33222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001320180.1 protein_id gnl|my_center|LOCUS_05830 34173 33463 gene locus_tag LOCUS_05840 34173 33463 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300714.1 protein_id gnl|my_center|LOCUS_05840 34541 34173 gene locus_tag LOCUS_05850 34541 34173 CDS product YbbC/YhhH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877768.1 protein_id gnl|my_center|LOCUS_05850 35162 34581 gene locus_tag LOCUS_05860 35162 34581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 >Feature sequence014 1661 264 gene locus_tag LOCUS_05870 gene ccp 1661 264 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784827.1 protein_id gnl|my_center|LOCUS_05870 2065 3714 gene locus_tag LOCUS_05880 2065 3714 CDS product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934216.1 protein_id gnl|my_center|LOCUS_05880 4367 3765 gene locus_tag LOCUS_05890 4367 3765 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167676.1 protein_id gnl|my_center|LOCUS_05890 4905 5786 gene locus_tag LOCUS_05900 4905 5786 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357790.1 protein_id gnl|my_center|LOCUS_05900 5835 6848 gene locus_tag LOCUS_05910 gene yhjD 5835 6848 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191237.1 protein_id gnl|my_center|LOCUS_05910 7259 8581 gene locus_tag LOCUS_05920 7259 8581 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149003.1 protein_id gnl|my_center|LOCUS_05920 8613 8648 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10790 8730 gene locus_tag LOCUS_05930 10790 8730 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296794.1 protein_id gnl|my_center|LOCUS_05930 11495 10860 gene locus_tag LOCUS_05940 gene pdeH 11495 10860 CDS product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295219.1 protein_id gnl|my_center|LOCUS_05940 11859 12788 gene locus_tag LOCUS_05950 gene kdgK 11859 12788 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037562.1 protein_id gnl|my_center|LOCUS_05950 14380 12884 gene locus_tag LOCUS_05960 14380 12884 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163141.1 protein_id gnl|my_center|LOCUS_05960 15887 14601 gene locus_tag LOCUS_05970 gene dctA 15887 14601 CDS product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858214.1 protein_id gnl|my_center|LOCUS_05970 18019 16070 gene locus_tag LOCUS_05980 gene hmsP 18019 16070 CDS product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266293.1 protein_id gnl|my_center|LOCUS_05980 21613 18140 gene locus_tag LOCUS_05990 gene bcsC 21613 18140 CDS product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225124.1 protein_id gnl|my_center|LOCUS_05990 22701 21595 gene locus_tag LOCUS_06000 gene bcsZ 22701 21595 CDS product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311203.1 protein_id gnl|my_center|LOCUS_06000 25047 22708 gene locus_tag LOCUS_06010 gene bcsB 25047 22708 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001407405.1 protein_id gnl|my_center|LOCUS_06010 27676 25058 gene locus_tag LOCUS_06020 gene bcsA 27676 25058 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025892.1 protein_id gnl|my_center|LOCUS_06020 28401 27673 gene locus_tag LOCUS_06030 gene bcsQ 28401 27673 CDS product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279528.1 protein_id gnl|my_center|LOCUS_06030 28625 28437 gene locus_tag LOCUS_06040 gene bcsR 28625 28437 CDS product cellulose biosynthesis protein BcsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063318.1 protein_id gnl|my_center|LOCUS_06040 28910 30469 gene locus_tag LOCUS_06050 gene bcsE 28910 30469 CDS product cellulose biosynthesis c-di-GMP-binding protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204931.1 protein_id gnl|my_center|LOCUS_06050 30466 30657 gene locus_tag LOCUS_06060 gene bcsF 30466 30657 CDS product cellulose biosynthesis protein BcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988308.1 protein_id gnl|my_center|LOCUS_06060 30654 32333 gene locus_tag LOCUS_06070 gene bcsG 30654 32333 CDS product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191622.1 protein_id gnl|my_center|LOCUS_06070 32695 32420 gene locus_tag LOCUS_06080 32695 32420 CDS product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254108.1 protein_id gnl|my_center|LOCUS_06080 33003 34274 gene locus_tag LOCUS_06090 33003 34274 CDS product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295225.1 protein_id gnl|my_center|LOCUS_06090 35308 34304 gene locus_tag LOCUS_06100 gene dppF 35308 34304 CDS product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107012.1 protein_id gnl|my_center|LOCUS_06100 >Feature sequence015 739 338 gene locus_tag LOCUS_06110 gene nikR 739 338 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190062.1 protein_id gnl|my_center|LOCUS_06110 1551 745 gene locus_tag LOCUS_06120 gene nikE 1551 745 CDS product nickel import ATP-binding protein NikE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173631.1 protein_id gnl|my_center|LOCUS_06120 2312 1548 gene locus_tag LOCUS_06130 gene nikD 2312 1548 CDS product nickel import ATP-binding protein NikD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136229.1 protein_id gnl|my_center|LOCUS_06130 3145 2312 gene locus_tag LOCUS_06140 gene nikC 3145 2312 CDS product nickel ABC transporter permease subunit NikC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008963.1 protein_id gnl|my_center|LOCUS_06140 4086 3142 gene locus_tag LOCUS_06150 gene nikB 4086 3142 CDS product nickel ABC transporter permease subunit NikB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947068.1 protein_id gnl|my_center|LOCUS_06150 5660 4086 gene locus_tag LOCUS_06160 gene nikA 5660 4086 CDS product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953361.1 protein_id gnl|my_center|LOCUS_06160 6358 5771 gene locus_tag LOCUS_06170 gene acpT 6358 5771 CDS product 4'-phosphopantetheinyl transferase AcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285774.1 protein_id gnl|my_center|LOCUS_06170 7462 6413 gene locus_tag LOCUS_06180 7462 6413 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300885.1 protein_id gnl|my_center|LOCUS_06180 7561 8811 gene locus_tag LOCUS_06190 7561 8811 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240225.1 protein_id gnl|my_center|LOCUS_06190 9372 8815 gene locus_tag LOCUS_06200 gene dcrB 9372 8815 CDS product phage sensitivity protein DcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245295.1 protein_id gnl|my_center|LOCUS_06200 10110 9445 gene locus_tag LOCUS_06210 10110 9445 CDS product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100469.1 protein_id gnl|my_center|LOCUS_06210 10331 10576 gene locus_tag LOCUS_06220 gene tusA 10331 10576 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130621.1 protein_id gnl|my_center|LOCUS_06220 12876 10678 gene locus_tag LOCUS_06230 gene zntA 12876 10678 CDS product Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106551.1 protein_id gnl|my_center|LOCUS_06230 13576 12950 gene locus_tag LOCUS_06240 13576 12950 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964718.1 protein_id gnl|my_center|LOCUS_06240 13717 14076 gene locus_tag LOCUS_06250 13717 14076 CDS product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042895.1 protein_id gnl|my_center|LOCUS_06250 14348 14079 gene locus_tag LOCUS_06260 14348 14079 CDS product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311191.1 protein_id gnl|my_center|LOCUS_06260 14934 14338 gene locus_tag LOCUS_06270 gene rsmD 14934 14338 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743193.1 protein_id gnl|my_center|LOCUS_06270 15084 16577 gene locus_tag LOCUS_06280 gene ftsY 15084 16577 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040654.1 protein_id gnl|my_center|LOCUS_06280 16580 17248 gene locus_tag LOCUS_06290 gene ftsE 16580 17248 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617723.1 protein_id gnl|my_center|LOCUS_06290 17241 18299 gene locus_tag LOCUS_06300 gene ftsX 17241 18299 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042003.1 protein_id gnl|my_center|LOCUS_06300 18544 19398 gene locus_tag LOCUS_06310 gene rpoH 18544 19398 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130217.1 protein_id gnl|my_center|LOCUS_06310 19669 20772 gene locus_tag LOCUS_06320 gene livJ 19669 20772 CDS product branched chain amino acid ABC transporter substrate-binding protein LivJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021996.1 protein_id gnl|my_center|LOCUS_06320 21343 20960 gene locus_tag LOCUS_06330 gene panM 21343 20960 CDS product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778768.1 protein_id gnl|my_center|LOCUS_06330 21713 22876 gene locus_tag LOCUS_06340 gene livK 21713 22876 CDS product high-affinity branched-chain amino acid ABC transporter substrate-binding protein LivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827696.1 protein_id gnl|my_center|LOCUS_06340 22924 23850 gene locus_tag LOCUS_06350 gene livH 22924 23850 CDS product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295111.1 protein_id gnl|my_center|LOCUS_06350 23847 25124 gene locus_tag LOCUS_06360 gene livM 23847 25124 CDS product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803813.1 protein_id gnl|my_center|LOCUS_06360 25121 25888 gene locus_tag LOCUS_06370 gene livG 25121 25888 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082101.1 protein_id gnl|my_center|LOCUS_06370 25890 26603 gene locus_tag LOCUS_06380 gene livF 25890 26603 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416891.1 protein_id gnl|my_center|LOCUS_06380 27002 28318 gene locus_tag LOCUS_06390 gene ugpB 27002 28318 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803190.1 protein_id gnl|my_center|LOCUS_06390 28416 29303 gene locus_tag LOCUS_06400 gene ugpA 28416 29303 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099289.1 protein_id gnl|my_center|LOCUS_06400 29300 30145 gene locus_tag LOCUS_06410 gene ugpE 29300 30145 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572177.1 protein_id gnl|my_center|LOCUS_06410 30147 31217 gene locus_tag LOCUS_06420 gene ugpC 30147 31217 CDS product sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907792.1 protein_id gnl|my_center|LOCUS_06420 31214 31957 gene locus_tag LOCUS_06430 gene ugpQ 31214 31957 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073623.1 protein_id gnl|my_center|LOCUS_06430 32384 31944 gene locus_tag LOCUS_06440 32384 31944 CDS product DUF2756 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825996.1 protein_id gnl|my_center|LOCUS_06440 32504 34246 gene locus_tag LOCUS_06450 gene ggt 32504 34246 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595082.1 protein_id gnl|my_center|LOCUS_06450 34568 34284 gene locus_tag LOCUS_06460 34568 34284 CDS product YrhB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634159.1 protein_id gnl|my_center|LOCUS_06460 34923 34768 gene locus_tag LOCUS_06470 34923 34768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 >Feature sequence016 472 562 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1095 613 gene locus_tag LOCUS_06480 1095 613 CDS product RadC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001407480.1 protein_id gnl|my_center|LOCUS_06480 1562 1104 gene locus_tag LOCUS_06490 1562 1104 CDS product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211841.1 protein_id gnl|my_center|LOCUS_06490 3575 2460 gene locus_tag LOCUS_06500 3575 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 3631 3879 gene locus_tag LOCUS_06510 3631 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 4445 4645 gene locus_tag LOCUS_06520 4445 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06520 4721 5314 gene locus_tag LOCUS_06530 4721 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06530 5327 5641 gene locus_tag LOCUS_06540 5327 5641 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065803.1 protein_id gnl|my_center|LOCUS_06540 6333 5866 gene locus_tag LOCUS_06550 gene yfjT 6333 5866 CDS product protein YfjT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702495.1 protein_id gnl|my_center|LOCUS_06550 6800 6357 gene locus_tag LOCUS_06560 gene yfjS 6800 6357 CDS product lipoprotein YfjS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824222.1 protein_id gnl|my_center|LOCUS_06560 7036 6800 gene locus_tag LOCUS_06570 gene ypjK 7036 6800 CDS product protein YpjK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144029.1 protein_id gnl|my_center|LOCUS_06570 7778 7077 gene locus_tag LOCUS_06580 7778 7077 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189409.1 protein_id gnl|my_center|LOCUS_06580 8816 7995 gene locus_tag LOCUS_06590 8816 7995 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197391.1 protein_id gnl|my_center|LOCUS_06590 9771 8908 gene locus_tag LOCUS_06600 9771 8908 CDS product GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787597.1 protein_id gnl|my_center|LOCUS_06600 10497 10126 gene locus_tag LOCUS_06610 gene rnlB 10497 10126 CDS product type II toxin-antitoxin system antitoxin RnlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461704.1 protein_id gnl|my_center|LOCUS_06610 11563 10490 gene locus_tag LOCUS_06620 gene rnlA 11563 10490 CDS product type II toxin-antitoxin system toxin mRNA endoribonuclease RnlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155570.1 protein_id gnl|my_center|LOCUS_06620 11705 11968 gene locus_tag LOCUS_06630 11705 11968 CDS product DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502050.1 protein_id gnl|my_center|LOCUS_06630 12328 13944 gene locus_tag LOCUS_06640 gene abpA 12328 13944 CDS product anti-bacteriophage protein AbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445380.1 protein_id gnl|my_center|LOCUS_06640 13941 16130 gene locus_tag LOCUS_06650 13941 16130 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136402.1 protein_id gnl|my_center|LOCUS_06650 16934 16308 gene locus_tag LOCUS_06660 16934 16308 CDS product inovirus Gp2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220524.1 protein_id gnl|my_center|LOCUS_06660 16907 17134 gene locus_tag LOCUS_06670 16907 17134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 18496 17087 gene locus_tag LOCUS_06680 18496 17087 CDS product YfjI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481742.1 protein_id gnl|my_center|LOCUS_06680 18837 18625 gene locus_tag LOCUS_06690 gene alpA 18837 18625 CDS product DNA-binding transcriptional activator AlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065343.1 protein_id gnl|my_center|LOCUS_06690 18881 19837 gene locus_tag LOCUS_06700 gene yfjH 18881 19837 CDS product protein YfjH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510827.1 protein_id gnl|my_center|LOCUS_06700 21322 20081 gene locus_tag LOCUS_06710 21322 20081 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101723.1 protein_id gnl|my_center|LOCUS_06710 21888 21526 gene locus_tag LOCUS_tm00010 21888 21526 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 22585 22103 gene locus_tag LOCUS_06720 gene smpB 22585 22103 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162574.1 protein_id gnl|my_center|LOCUS_06720 22717 23193 gene locus_tag LOCUS_06730 gene ratA 22717 23193 CDS product type II toxin-antitoxin system toxin RatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600189.1 protein_id gnl|my_center|LOCUS_06730 23183 23473 gene locus_tag LOCUS_06740 23183 23473 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117838.1 protein_id gnl|my_center|LOCUS_06740 23876 23535 gene locus_tag LOCUS_06750 gene bamE 23876 23535 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203437.1 protein_id gnl|my_center|LOCUS_06750 25686 24025 gene locus_tag LOCUS_06760 gene recN 25686 24025 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880910.1 protein_id gnl|my_center|LOCUS_06760 26650 25772 gene locus_tag LOCUS_06770 gene nadK 26650 25772 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059169.1 protein_id gnl|my_center|LOCUS_06770 26773 27366 gene locus_tag LOCUS_06780 gene grpE 26773 27366 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393454.1 protein_id gnl|my_center|LOCUS_06780 28683 27421 gene locus_tag LOCUS_06790 28683 27421 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723175.1 protein_id gnl|my_center|LOCUS_06790 29423 28728 gene locus_tag LOCUS_06800 29423 28728 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001338897.1 protein_id gnl|my_center|LOCUS_06800 29337 29573 gene locus_tag LOCUS_06810 29337 29573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 29686 31047 gene locus_tag LOCUS_06820 gene ffh 29686 31047 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460035.1 protein_id gnl|my_center|LOCUS_06820 31296 31544 gene locus_tag LOCUS_06830 gene rpsP 31296 31544 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256450.1 protein_id gnl|my_center|LOCUS_06830 31563 32111 gene locus_tag LOCUS_06840 gene rimM 31563 32111 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043335.1 protein_id gnl|my_center|LOCUS_06840 32142 32909 gene locus_tag LOCUS_06850 gene trmD 32142 32909 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264777.1 protein_id gnl|my_center|LOCUS_06850 32951 33298 gene locus_tag LOCUS_06860 gene rplS 32951 33298 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065253.1 protein_id gnl|my_center|LOCUS_06860 33856 33374 gene locus_tag LOCUS_06870 33856 33374 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589847.1 protein_id gnl|my_center|LOCUS_06870 <34763 33872 gene locus_tag LOCUS_06880 <34763 33872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000969032.1:diguanylate cyclase DgcN >Feature sequence017 382 999 gene locus_tag LOCUS_06890 382 999 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647891.1 protein_id gnl|my_center|LOCUS_06890 1931 1026 gene locus_tag LOCUS_06900 gene yijE 1931 1026 CDS product cystine transporter YijE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271242.1 protein_id gnl|my_center|LOCUS_06900 4204 2024 gene locus_tag LOCUS_06910 gene katG 4204 2024 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295695.1 protein_id gnl|my_center|LOCUS_06910 5423 4533 gene locus_tag LOCUS_06920 gene metF 5423 4533 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007523.1 protein_id gnl|my_center|LOCUS_06920 8204 5772 gene locus_tag LOCUS_06930 gene metL 8204 5772 CDS product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110772.1 protein_id gnl|my_center|LOCUS_06930 9367 8207 gene locus_tag LOCUS_06940 gene metB 9367 8207 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295694.1 protein_id gnl|my_center|LOCUS_06940 9644 9961 gene locus_tag LOCUS_06950 gene metJ 9644 9961 CDS product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852812.1 protein_id gnl|my_center|LOCUS_06950 10045 10083 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10148 10756 gene locus_tag LOCUS_06960 10148 10756 CDS product YiiX family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797353.1 protein_id gnl|my_center|LOCUS_06960 11029 10817 gene locus_tag LOCUS_06970 gene rpmE 11029 10817 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710769.1 protein_id gnl|my_center|LOCUS_06970 11232 13430 gene locus_tag LOCUS_06980 gene priA 11232 13430 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301269.1 protein_id gnl|my_center|LOCUS_06980 13586 14611 gene locus_tag LOCUS_06990 gene cytR 13586 14611 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644904.1 protein_id gnl|my_center|LOCUS_06990 14808 15662 gene locus_tag LOCUS_07000 gene ftsN 14808 15662 CDS product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068828.1 protein_id gnl|my_center|LOCUS_07000 15755 16285 gene locus_tag LOCUS_07010 gene hslV 15755 16285 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208242.1 protein_id gnl|my_center|LOCUS_07010 16295 17626 gene locus_tag LOCUS_07020 gene hslU 16295 17626 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293341.1 protein_id gnl|my_center|LOCUS_07020 17693 18619 gene locus_tag LOCUS_07030 gene menA 17693 18619 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139496.1 protein_id gnl|my_center|LOCUS_07030 18712 19197 gene locus_tag LOCUS_07040 gene rraA 18712 19197 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872908.1 protein_id gnl|my_center|LOCUS_07040 19521 19282 gene locus_tag LOCUS_07050 gene zapB 19521 19282 CDS product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295521.1 protein_id gnl|my_center|LOCUS_07050 19952 20797 gene locus_tag LOCUS_07060 gene glpF 19952 20797 CDS product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084268.1 protein_id gnl|my_center|LOCUS_07060 20799 22328 gene locus_tag LOCUS_07070 gene glpK 20799 22328 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136788.1 protein_id gnl|my_center|LOCUS_07070 22334 23473 gene locus_tag LOCUS_07080 gene glpX 22334 23473 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250644.1 protein_id gnl|my_center|LOCUS_07080 23570 24316 gene locus_tag LOCUS_07090 gene fpr 23570 24316 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796332.1 protein_id gnl|my_center|LOCUS_07090 24749 24321 gene locus_tag LOCUS_07100 gene uspD 24749 24321 CDS product universal stress protein UspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323556.1 protein_id gnl|my_center|LOCUS_07100 25075 24776 gene locus_tag LOCUS_07110 25075 24776 CDS product DUF406 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655989.1 protein_id gnl|my_center|LOCUS_07110 25727 25287 gene locus_tag LOCUS_07120 25727 25287 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155257.1 protein_id gnl|my_center|LOCUS_07120 25828 26427 gene locus_tag LOCUS_07130 25828 26427 CDS product YiiQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802216.1 protein_id gnl|my_center|LOCUS_07130 26535 27302 gene locus_tag LOCUS_07140 gene tpiA 26535 27302 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216325.1 protein_id gnl|my_center|LOCUS_07140 28112 27357 gene locus_tag LOCUS_07150 gene cdh 28112 27357 CDS product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326656.1 protein_id gnl|my_center|LOCUS_07150 29156 28167 gene locus_tag LOCUS_07160 gene sbp 29156 28167 CDS product sulfate/thiosulfate ABC transporter substrate-binding protein Sbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045689.1 protein_id gnl|my_center|LOCUS_07160 30438 29476 gene locus_tag LOCUS_07170 gene pfkA 30438 29476 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591795.1 protein_id gnl|my_center|LOCUS_07170 31521 30619 gene locus_tag LOCUS_07180 gene fieF 31521 30619 CDS product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076742.1 protein_id gnl|my_center|LOCUS_07180 32170 31670 gene locus_tag LOCUS_07190 gene cpxP 32170 31670 CDS product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223800.1 protein_id gnl|my_center|LOCUS_07190 32320 33018 gene locus_tag LOCUS_07200 gene cpxR 32320 33018 CDS product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033722.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence018 584 123 gene locus_tag LOCUS_07210 gene pyrI 584 123 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148581.1 protein_id gnl|my_center|LOCUS_07210 1532 597 gene locus_tag LOCUS_07220 gene pyrB 1532 597 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013046.1 protein_id gnl|my_center|LOCUS_07220 2346 1951 gene locus_tag LOCUS_07230 2346 1951 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230281.1 protein_id gnl|my_center|LOCUS_07230 3190 2477 gene locus_tag LOCUS_07240 gene bdcA 3190 2477 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500727.1 protein_id gnl|my_center|LOCUS_07240 3261 3854 gene locus_tag LOCUS_07250 3261 3854 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256658.1 protein_id gnl|my_center|LOCUS_07250 3999 4451 gene locus_tag LOCUS_07260 gene tabA 3999 4451 CDS product toxin-antitoxin biofilm protein TabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583469.1 protein_id gnl|my_center|LOCUS_07260 4574 6388 gene locus_tag LOCUS_07270 gene yjgL 4574 6388 CDS product protein YjgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036434.1 protein_id gnl|my_center|LOCUS_07270 7448 6444 gene locus_tag LOCUS_07280 gene argF 7448 6444 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012931.1 protein_id gnl|my_center|LOCUS_07280 7610 8026 gene locus_tag LOCUS_07290 gene rraB 7610 8026 CDS product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002952.1 protein_id gnl|my_center|LOCUS_07290 8674 8171 gene locus_tag LOCUS_07300 8674 8171 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059402.1 protein_id gnl|my_center|LOCUS_07300 8840 10063 gene locus_tag LOCUS_07310 8840 10063 CDS product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079634.1 protein_id gnl|my_center|LOCUS_07310 10409 10119 gene locus_tag LOCUS_07320 10409 10119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 11656 10406 gene locus_tag LOCUS_07330 gene wzxE 11656 10406 CDS product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050265.1 protein_id gnl|my_center|LOCUS_07330 12788 11658 gene locus_tag LOCUS_07340 gene rffA 12788 11658 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612043.1 protein_id gnl|my_center|LOCUS_07340 13467 12793 gene locus_tag LOCUS_07350 gene rffC 13467 12793 CDS product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145183.1 protein_id gnl|my_center|LOCUS_07350 13609 13445 gene locus_tag LOCUS_07360 13609 13445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07360 14326 13715 gene locus_tag LOCUS_07370 14326 13715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07370 15412 14345 gene locus_tag LOCUS_07380 gene rffG 15412 14345 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226601.1 protein_id gnl|my_center|LOCUS_07380 16674 15412 gene locus_tag LOCUS_07390 gene wecC 16674 15412 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006621.1 protein_id gnl|my_center|LOCUS_07390 17801 16671 gene locus_tag LOCUS_07400 gene wecB 17801 16671 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340422.1 protein_id gnl|my_center|LOCUS_07400 18903 17857 gene locus_tag LOCUS_07410 gene wzzE 18903 17857 CDS product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295256.1 protein_id gnl|my_center|LOCUS_07410 20018 18915 gene locus_tag LOCUS_07420 gene wecA 20018 18915 CDS product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050960.1 protein_id gnl|my_center|LOCUS_07420 20248 20030 gene locus_tag LOCUS_07430 20248 20030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127070.1 protein_id gnl|my_center|LOCUS_07430 21517 20258 gene locus_tag LOCUS_07440 gene rho 21517 20258 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054527.1 protein_id gnl|my_center|LOCUS_07440 22173 21844 gene locus_tag LOCUS_07450 gene trxA 22173 21844 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305383.1 protein_id gnl|my_center|LOCUS_07450 22304 23569 gene locus_tag LOCUS_07460 gene rhlB 22304 23569 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047499.1 protein_id gnl|my_center|LOCUS_07460 23705 25189 gene locus_tag LOCUS_07470 gene gppA 23705 25189 CDS product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295254.1 protein_id gnl|my_center|LOCUS_07470 27257 25236 gene locus_tag LOCUS_07480 gene rep 27257 25236 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238899.1 protein_id gnl|my_center|LOCUS_07480 27474 27692 gene locus_tag LOCUS_07490 27474 27692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07490 28121 28402 gene locus_tag LOCUS_07500 gene ppiC 28121 28402 CDS product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140251.1 protein_id gnl|my_center|LOCUS_07500 29964 28489 gene locus_tag LOCUS_07510 gene ilvC 29964 28489 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024939.1 protein_id gnl|my_center|LOCUS_07510 30114 31007 gene locus_tag LOCUS_07520 gene ilvY 30114 31007 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365791.1 protein_id gnl|my_center|LOCUS_07520 32603 31059 gene locus_tag LOCUS_07530 gene ilvA 32603 31059 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785596.1 protein_id gnl|my_center|LOCUS_07530 <33569 32606 gene locus_tag LOCUS_07540 <33569 32606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001127399.1:dihydroxy-acid dehydratase >Feature sequence019 291 1634 gene locus_tag LOCUS_07550 291 1634 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013789.1 protein_id gnl|my_center|LOCUS_07550 1859 3514 gene locus_tag LOCUS_07560 gene opgD 1859 3514 CDS product glucan biosynthesis protein OpgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375961.1 protein_id gnl|my_center|LOCUS_07560 3654 3878 gene locus_tag LOCUS_07570 3654 3878 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296778.1 protein_id gnl|my_center|LOCUS_07570 3941 4480 gene locus_tag LOCUS_07580 gene rimL 3941 4480 CDS product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140873.1 protein_id gnl|my_center|LOCUS_07580 5452 4472 gene locus_tag LOCUS_07590 gene ydcK 5452 4472 CDS product YdcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234042.1 protein_id gnl|my_center|LOCUS_07590 5576 6568 gene locus_tag LOCUS_07600 gene tehA 5576 6568 CDS product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301046.1 protein_id gnl|my_center|LOCUS_07600 6565 7158 gene locus_tag LOCUS_07610 gene tehB 6565 7158 CDS product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586732.1 protein_id gnl|my_center|LOCUS_07610 7460 8128 gene locus_tag LOCUS_07620 7460 8128 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261013.1 protein_id gnl|my_center|LOCUS_07620 8720 9868 gene locus_tag LOCUS_07630 8720 9868 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251043.1 protein_id gnl|my_center|LOCUS_07630 11083 9908 gene locus_tag LOCUS_07640 gene ydcO 11083 9908 CDS product BenE family transporter YdcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236265.1 protein_id gnl|my_center|LOCUS_07640 11175 11711 gene locus_tag LOCUS_07650 gene sutR 11175 11711 CDS product DNA-binding transcriptional regulator SutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429155.1 protein_id gnl|my_center|LOCUS_07650 11784 13745 gene locus_tag LOCUS_07660 gene rlhA 11784 13745 CDS product 23S rRNA 5-hydroxycytidine C2501 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303492.1 protein_id gnl|my_center|LOCUS_07660 14007 13837 gene locus_tag LOCUS_07670 14007 13837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 14490 14927 gene locus_tag LOCUS_07680 gene hicB 14490 14927 CDS product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209405.1 protein_id gnl|my_center|LOCUS_07680 15006 16412 gene locus_tag LOCUS_07690 15006 16412 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760626.1 protein_id gnl|my_center|LOCUS_07690 16657 17802 gene locus_tag LOCUS_07700 16657 17802 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047424.1 protein_id gnl|my_center|LOCUS_07700 17832 18833 gene locus_tag LOCUS_07710 17832 18833 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220396.1 protein_id gnl|my_center|LOCUS_07710 18834 19775 gene locus_tag LOCUS_07720 18834 19775 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251304.1 protein_id gnl|my_center|LOCUS_07720 19765 20559 gene locus_tag LOCUS_07730 19765 20559 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555471.1 protein_id gnl|my_center|LOCUS_07730 20581 22005 gene locus_tag LOCUS_07740 gene patD 20581 22005 CDS product aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163872.1 protein_id gnl|my_center|LOCUS_07740 22317 22565 gene locus_tag LOCUS_07750 22317 22565 CDS product GhoT/OrtT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732115.1 protein_id gnl|my_center|LOCUS_07750 22651 22884 gene locus_tag LOCUS_07760 gene ydcY 22651 22884 CDS product DUF2526 family protein YdcY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018633.1 protein_id gnl|my_center|LOCUS_07760 23334 22885 gene locus_tag LOCUS_07770 23334 22885 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076535.1 protein_id gnl|my_center|LOCUS_07770 23849 23331 gene locus_tag LOCUS_07780 gene mddA 23849 23331 CDS product L-methionine sulfoximine/L-methionine sulfone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310799.1 protein_id gnl|my_center|LOCUS_07780 24030 25067 gene locus_tag LOCUS_07790 gene curA 24030 25067 CDS product NADPH-dependent curcumin/dihydrocurcumin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531462.1 protein_id gnl|my_center|LOCUS_07790 25265 25930 gene locus_tag LOCUS_07800 gene mcbR 25265 25930 CDS product colanic acid/biofilm transcriptional regulator McbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300742.1 protein_id gnl|my_center|LOCUS_07800 27984 25966 gene locus_tag LOCUS_07810 gene pqqU 27984 25966 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689363.1 protein_id gnl|my_center|LOCUS_07810 28310 29371 gene locus_tag LOCUS_07820 28310 29371 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550695.1 protein_id gnl|my_center|LOCUS_07820 30983 29484 gene locus_tag LOCUS_07830 gene ansP 30983 29484 CDS product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300590.1 protein_id gnl|my_center|LOCUS_07830 31250 31867 gene locus_tag LOCUS_07840 31250 31867 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598857.1 protein_id gnl|my_center|LOCUS_07840 >Feature sequence020 52 1893 gene locus_tag LOCUS_07850 gene ftsH 52 1893 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107467.1 protein_id gnl|my_center|LOCUS_07850 1983 2831 gene locus_tag LOCUS_07860 gene folP 1983 2831 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311155.1 protein_id gnl|my_center|LOCUS_07860 2824 4161 gene locus_tag LOCUS_07870 gene glmM 2824 4161 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071134.1 protein_id gnl|my_center|LOCUS_07870 4389 4721 gene locus_tag LOCUS_07880 gene secG 4389 4721 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295556.1 protein_id gnl|my_center|LOCUS_07880 4736 4822 gene locus_tag LOCUS_t00050 4736 4822 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5389 6906 gene locus_tag LOCUS_07890 5389 6906 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333576.1 protein_id gnl|my_center|LOCUS_07890 8257 6914 gene locus_tag LOCUS_07900 gene argG 8257 6914 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207680.1 protein_id gnl|my_center|LOCUS_07900 8605 8681 gene locus_tag LOCUS_t00060 8605 8681 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8918 9340 gene locus_tag LOCUS_07910 gene rimP 8918 9340 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296446.1 protein_id gnl|my_center|LOCUS_07910 9368 10855 gene locus_tag LOCUS_07920 gene nusA 9368 10855 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031057.1 protein_id gnl|my_center|LOCUS_07920 10880 13552 gene locus_tag LOCUS_07930 gene infB 10880 13552 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133044.1 protein_id gnl|my_center|LOCUS_07930 13716 14117 gene locus_tag LOCUS_07940 gene rbfA 13716 14117 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040205.1 protein_id gnl|my_center|LOCUS_07940 14117 15061 gene locus_tag LOCUS_07950 gene truB 14117 15061 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089698.1 protein_id gnl|my_center|LOCUS_07950 15210 15479 gene locus_tag LOCUS_07960 gene rpsO 15210 15479 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059466.1 protein_id gnl|my_center|LOCUS_07960 15726 17861 gene locus_tag LOCUS_07970 gene pnp 15726 17861 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295554.1 protein_id gnl|my_center|LOCUS_07970 17970 18854 gene locus_tag LOCUS_07980 gene nlpI 17970 18854 CDS product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802080.1 protein_id gnl|my_center|LOCUS_07980 19034 20920 gene locus_tag LOCUS_07990 gene deaD 19034 20920 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301504.1 protein_id gnl|my_center|LOCUS_07990 21074 22318 gene locus_tag LOCUS_08000 gene mtr 21074 22318 CDS product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224351.1 protein_id gnl|my_center|LOCUS_08000 23443 22436 gene locus_tag LOCUS_08010 23443 22436 CDS product luciferase-like monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130380.1 protein_id gnl|my_center|LOCUS_08010 24402 23524 gene locus_tag LOCUS_08020 24402 23524 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301318.1 protein_id gnl|my_center|LOCUS_08020 25406 24411 gene locus_tag LOCUS_08030 25406 24411 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311152.1 protein_id gnl|my_center|LOCUS_08030 25615 26139 gene locus_tag LOCUS_08040 25615 26139 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295552.1 protein_id gnl|my_center|LOCUS_08040 26133 26636 gene locus_tag LOCUS_08050 26133 26636 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908554.1 protein_id gnl|my_center|LOCUS_08050 26925 26623 gene locus_tag LOCUS_08060 gene yhbQ 26925 26623 CDS product DNA damage response exodeoxyribonuclease YhbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189333.1 protein_id gnl|my_center|LOCUS_08060 26976 27419 gene locus_tag LOCUS_08070 26976 27419 CDS product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449030.1 protein_id gnl|my_center|LOCUS_08070 27917 27399 gene locus_tag LOCUS_08080 gene yhbO 27917 27399 CDS product protein/nucleic acid deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037608.1 protein_id gnl|my_center|LOCUS_08080 28045 28680 gene locus_tag LOCUS_08090 28045 28680 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300423.1 protein_id gnl|my_center|LOCUS_08090 28753 29793 gene locus_tag LOCUS_08100 28753 29793 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147574.1 protein_id gnl|my_center|LOCUS_08100 30482 29907 gene locus_tag LOCUS_08110 gene dolP 30482 29907 CDS product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646033.1 protein_id gnl|my_center|LOCUS_08110 31082 30492 gene locus_tag LOCUS_08120 gene diaA 31082 30492 CDS product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158034.1 protein_id gnl|my_center|LOCUS_08120 31497 31102 gene locus_tag LOCUS_08130 31497 31102 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246830.1 protein_id gnl|my_center|LOCUS_08130 <33000 31455 gene locus_tag LOCUS_08140 <33000 31455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000249104.1:penicillin-binding protein activator LpoA >Feature sequence021 <1 1089 gene locus_tag LOCUS_08150 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000195274.1:DNA topoisomerase IV subunit B 1451 1137 gene locus_tag LOCUS_08160 1451 1137 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958598.1 protein_id gnl|my_center|LOCUS_08160 2063 1482 gene locus_tag LOCUS_08170 gene mdaB 2063 1482 CDS product NADPH:quinone oxidoreductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065430.1 protein_id gnl|my_center|LOCUS_08170 2382 2714 gene locus_tag LOCUS_08180 2382 2714 CDS product DUF2645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917684.1 protein_id gnl|my_center|LOCUS_08180 4109 2760 gene locus_tag LOCUS_08190 gene qseC 4109 2760 CDS product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673402.1 protein_id gnl|my_center|LOCUS_08190 4765 4106 gene locus_tag LOCUS_08200 gene qseB 4765 4106 CDS product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221495.1 protein_id gnl|my_center|LOCUS_08200 4917 5309 gene locus_tag LOCUS_08210 gene ygiW 4917 5309 CDS product OB fold stress tolerance protein YgiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712658.1 protein_id gnl|my_center|LOCUS_08210 5362 5844 gene locus_tag LOCUS_08220 5362 5844 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183505.1 protein_id gnl|my_center|LOCUS_08220 6049 6345 gene locus_tag LOCUS_08230 gene mqsR 6049 6345 CDS product type II toxin-antitoxin system toxin MqsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415584.1 protein_id gnl|my_center|LOCUS_08230 6347 6742 gene locus_tag LOCUS_08240 gene mqsA 6347 6742 CDS product type II toxin-antitoxin system antitoxin MqsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650107.1 protein_id gnl|my_center|LOCUS_08240 6875 8482 gene locus_tag LOCUS_08250 6875 8482 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295629.1 protein_id gnl|my_center|LOCUS_08250 8620 10878 gene locus_tag LOCUS_08260 gene parC 8620 10878 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281881.1 protein_id gnl|my_center|LOCUS_08260 11112 11849 gene locus_tag LOCUS_08270 gene plsC 11112 11849 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965722.1 protein_id gnl|my_center|LOCUS_08270 11924 13336 gene locus_tag LOCUS_08280 gene ftsP 11924 13336 CDS product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059388.1 protein_id gnl|my_center|LOCUS_08280 13447 15666 gene locus_tag LOCUS_08290 13447 15666 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095187.1 protein_id gnl|my_center|LOCUS_08290 15966 15709 gene locus_tag LOCUS_08300 gene yqhH 15966 15709 CDS product lipoprotein YqhH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848528.1 protein_id gnl|my_center|LOCUS_08300 16943 16017 gene locus_tag LOCUS_08310 16943 16017 CDS product YbjP/YqhG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691619.1 protein_id gnl|my_center|LOCUS_08310 17970 17143 gene locus_tag LOCUS_08320 gene dkgA 17970 17143 CDS product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013149.1 protein_id gnl|my_center|LOCUS_08320 19238 18075 gene locus_tag LOCUS_08330 gene yqhD 19238 18075 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058802.1 protein_id gnl|my_center|LOCUS_08330 19432 20331 gene locus_tag LOCUS_08340 gene yqhC 19432 20331 CDS product DNA-binding transcriptional regulator YqhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350547.1 protein_id gnl|my_center|LOCUS_08340 21030 20371 gene locus_tag LOCUS_08350 gene yghB 21030 20371 CDS product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268419.1 protein_id gnl|my_center|LOCUS_08350 22357 21170 gene locus_tag LOCUS_08360 gene metC 22357 21170 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301079.1 protein_id gnl|my_center|LOCUS_08360 22609 23343 gene locus_tag LOCUS_08370 gene exbB 22609 23343 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527844.1 protein_id gnl|my_center|LOCUS_08370 23350 23775 gene locus_tag LOCUS_08380 gene exbD 23350 23775 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240712.1 protein_id gnl|my_center|LOCUS_08380 24819 23935 gene locus_tag LOCUS_08390 gene yghA 24819 23935 CDS product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018760.1 protein_id gnl|my_center|LOCUS_08390 25010 25504 gene locus_tag LOCUS_08400 25010 25504 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439331.1 protein_id gnl|my_center|LOCUS_08400 26584 25544 gene locus_tag LOCUS_08410 gene gpr 26584 25544 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262172.1 protein_id gnl|my_center|LOCUS_08410 26741 26884 gene locus_tag LOCUS_08420 26741 26884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08420 26862 27215 gene locus_tag LOCUS_08430 26862 27215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08430 27215 27625 gene locus_tag LOCUS_08440 27215 27625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08440 27744 28031 gene locus_tag LOCUS_08450 gene yghW 27744 28031 CDS product DUF2623 family protein YghW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059136.1 protein_id gnl|my_center|LOCUS_08450 28220 29338 gene locus_tag LOCUS_08460 gene hybO 28220 29338 CDS product hydrogenase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145410.1 protein_id gnl|my_center|LOCUS_08460 29341 30327 gene locus_tag LOCUS_08470 gene hybA 29341 30327 CDS product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081870.1 protein_id gnl|my_center|LOCUS_08470 30317 31495 gene locus_tag LOCUS_08480 gene hybB 30317 31495 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017703.1 protein_id gnl|my_center|LOCUS_08480 31629 31705 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence022 2050 422 gene locus_tag LOCUS_08490 gene glpA 2050 422 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857257.1 protein_id gnl|my_center|LOCUS_08490 2323 3681 gene locus_tag LOCUS_08500 gene glpT 2323 3681 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948731.1 protein_id gnl|my_center|LOCUS_08500 3686 4762 gene locus_tag LOCUS_08510 gene glpQ 3686 4762 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779105.1 protein_id gnl|my_center|LOCUS_08510 5010 4804 gene locus_tag LOCUS_08520 5010 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009396.1 protein_id gnl|my_center|LOCUS_08520 5225 5875 gene locus_tag LOCUS_08530 gene inaA 5225 5875 CDS product lipopolysaccharide kinase InaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301050.1 protein_id gnl|my_center|LOCUS_08530 6183 5929 gene locus_tag LOCUS_08540 gene yfaE 6183 5929 CDS product ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135040.1 protein_id gnl|my_center|LOCUS_08540 7352 6183 gene locus_tag LOCUS_08550 gene nrdB 7352 6183 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299501.1 protein_id gnl|my_center|LOCUS_08550 7403 7436 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9761 7476 gene locus_tag LOCUS_08560 gene nrdA 9761 7476 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075164.1 protein_id gnl|my_center|LOCUS_08560 10745 14209 gene locus_tag LOCUS_08570 gene yfaL 10745 14209 CDS product AIDA-I family autotransporter adhesin YfaL/EhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220077.1 protein_id gnl|my_center|LOCUS_08570 15059 14337 gene locus_tag LOCUS_08580 15059 14337 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990765.1 protein_id gnl|my_center|LOCUS_08580 15206 17833 gene locus_tag LOCUS_08590 gene gyrA 15206 17833 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281242.1 protein_id gnl|my_center|LOCUS_08590 17982 19670 gene locus_tag LOCUS_08600 17982 19670 CDS product DUF2138 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012305.1 protein_id gnl|my_center|LOCUS_08600 19667 20290 gene locus_tag LOCUS_08610 19667 20290 CDS product DUF1175 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295211.1 protein_id gnl|my_center|LOCUS_08610 20434 24327 gene locus_tag LOCUS_08620 20434 24327 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001442934.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08620 24343 24828 gene locus_tag LOCUS_08630 24343 24828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08630 24829 26478 gene locus_tag LOCUS_08640 24829 26478 CDS product YfaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104549.1 protein_id gnl|my_center|LOCUS_08640 26483 27259 gene locus_tag LOCUS_08650 26483 27259 CDS product YfaP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225852.1 protein_id gnl|my_center|LOCUS_08650 28517 27333 gene locus_tag LOCUS_08660 gene atoB 28517 27333 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786547.1 protein_id gnl|my_center|LOCUS_08660 29870 28548 gene locus_tag LOCUS_08670 29870 28548 CDS product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580275.1 protein_id gnl|my_center|LOCUS_08670 30517 29867 gene locus_tag LOCUS_08680 gene atoA 30517 29867 CDS product acetate CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339065.1 protein_id gnl|my_center|LOCUS_08680 31179 30517 gene locus_tag LOCUS_08690 gene atoD 31179 30517 CDS product acetate CoA-transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850540.1 protein_id gnl|my_center|LOCUS_08690 <32607 31375 gene locus_tag LOCUS_08700 <32607 31375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000125282.1:acetoacetate metabolism transcriptional regulator AtoC >Feature sequence023 325 615 gene locus_tag LOCUS_08710 325 615 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768384.1 protein_id gnl|my_center|LOCUS_08710 675 1595 gene locus_tag LOCUS_08720 675 1595 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001407592.1 protein_id gnl|my_center|LOCUS_08720 1643 1969 gene locus_tag LOCUS_08730 1643 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08730 2293 3681 gene locus_tag LOCUS_08740 gene narU 2293 3681 CDS product nitrate/nitrite transporter NarU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207901.1 protein_id gnl|my_center|LOCUS_08740 3763 7506 gene locus_tag LOCUS_08750 3763 7506 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032939.1 protein_id gnl|my_center|LOCUS_08750 7503 9041 gene locus_tag LOCUS_08760 gene narH 7503 9041 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702650.1 protein_id gnl|my_center|LOCUS_08760 9038 9748 gene locus_tag LOCUS_08770 gene narJ 9038 9748 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571681.1 protein_id gnl|my_center|LOCUS_08770 9748 10425 gene locus_tag LOCUS_08780 gene narI 9748 10425 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160108.1 protein_id gnl|my_center|LOCUS_08780 11227 11143 gene locus_tag LOCUS_t00070 11227 11143 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 11456 11544 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12565 11723 gene locus_tag LOCUS_08790 gene purU 12565 11723 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555857.1 protein_id gnl|my_center|LOCUS_08790 13073 12615 gene locus_tag LOCUS_08800 13073 12615 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307143.1 protein_id gnl|my_center|LOCUS_08800 13147 14091 gene locus_tag LOCUS_08810 gene rssA 13147 14091 CDS product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190792.1 protein_id gnl|my_center|LOCUS_08810 14183 15196 gene locus_tag LOCUS_08820 gene rssB 14183 15196 CDS product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193447.1 protein_id gnl|my_center|LOCUS_08820 15398 16306 gene locus_tag LOCUS_08830 gene galU 15398 16306 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718995.1 protein_id gnl|my_center|LOCUS_08830 16863 16450 gene locus_tag LOCUS_08840 gene hns 16863 16450 CDS product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287378.1 protein_id gnl|my_center|LOCUS_08840 17468 18085 gene locus_tag LOCUS_08850 gene tdk 17468 18085 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068077.1 protein_id gnl|my_center|LOCUS_08850 18957 18367 gene locus_tag LOCUS_08860 18957 18367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08860 19139 18909 gene locus_tag LOCUS_08870 19139 18909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08870 19263 19078 gene locus_tag LOCUS_08880 19263 19078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08880 22062 19387 gene locus_tag LOCUS_08890 gene adhE 22062 19387 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301653.1 protein_id gnl|my_center|LOCUS_08890 22539 23186 gene locus_tag LOCUS_08900 gene ychE 22539 23186 CDS product NAAT family transporter YchE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616554.1 protein_id gnl|my_center|LOCUS_08900 23640 23344 gene locus_tag LOCUS_08910 23640 23344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211509.1 protein_id gnl|my_center|LOCUS_08910 23924 25555 gene locus_tag LOCUS_08920 gene oppA 23924 25555 CDS product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295623.1 protein_id gnl|my_center|LOCUS_08920 25641 26561 gene locus_tag LOCUS_08930 gene oppB 25641 26561 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911112.1 protein_id gnl|my_center|LOCUS_08930 26576 27484 gene locus_tag LOCUS_08940 gene oppC 26576 27484 CDS product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979661.1 protein_id gnl|my_center|LOCUS_08940 27496 28509 gene locus_tag LOCUS_08950 gene oppD 27496 28509 CDS product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110948.1 protein_id gnl|my_center|LOCUS_08950 28506 29510 gene locus_tag LOCUS_08960 gene oppF 28506 29510 CDS product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994905.1 protein_id gnl|my_center|LOCUS_08960 29892 29563 gene locus_tag LOCUS_08970 29892 29563 CDS product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366959.1 protein_id gnl|my_center|LOCUS_08970 31387 29927 gene locus_tag LOCUS_08980 gene cls 31387 29927 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214516.1 protein_id gnl|my_center|LOCUS_08980 32294 31758 gene locus_tag LOCUS_08990 32294 31758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence024 312 971 gene locus_tag LOCUS_09000 312 971 CDS product YjfK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012550.1 protein_id gnl|my_center|LOCUS_09000 989 1387 gene locus_tag LOCUS_09010 989 1387 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547760.1 protein_id gnl|my_center|LOCUS_09010 1397 2035 gene locus_tag LOCUS_09020 1397 2035 CDS product DUF1190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101658.1 protein_id gnl|my_center|LOCUS_09020 2038 3201 gene locus_tag LOCUS_09030 2038 3201 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943959.1 protein_id gnl|my_center|LOCUS_09030 3285 4910 gene locus_tag LOCUS_09040 3285 4910 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350567.1 protein_id gnl|my_center|LOCUS_09040 5302 5027 gene locus_tag LOCUS_09050 gene yjfN 5302 5027 CDS product DUF1471 family protease activator YjfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811566.1 protein_id gnl|my_center|LOCUS_09050 5720 5451 gene locus_tag LOCUS_09060 5720 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 5962 6711 gene locus_tag LOCUS_09070 gene yjfP 5962 6711 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569707.1 protein_id gnl|my_center|LOCUS_09070 7463 6708 gene locus_tag LOCUS_09080 gene ulaR 7463 6708 CDS product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133631.1 protein_id gnl|my_center|LOCUS_09080 8641 7571 gene locus_tag LOCUS_09090 gene ulaG 8641 7571 CDS product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295191.1 protein_id gnl|my_center|LOCUS_09090 8990 10387 gene locus_tag LOCUS_09100 gene ulaA 8990 10387 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350568.1 protein_id gnl|my_center|LOCUS_09100 10403 10708 gene locus_tag LOCUS_09110 gene ulaB 10403 10708 CDS product PTS ascorbate transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218362.1 protein_id gnl|my_center|LOCUS_09110 10718 11182 gene locus_tag LOCUS_09120 gene ulaC 10718 11182 CDS product PTS ascorbate transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776517.1 protein_id gnl|my_center|LOCUS_09120 11196 11846 gene locus_tag LOCUS_09130 gene ulaD 11196 11846 CDS product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056749.1 protein_id gnl|my_center|LOCUS_09130 11856 12710 gene locus_tag LOCUS_09140 gene ulaE 11856 12710 CDS product L-ribulose-5-phosphate 3-epimerase UlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949502.1 protein_id gnl|my_center|LOCUS_09140 12710 13396 gene locus_tag LOCUS_09150 gene ulaF 12710 13396 CDS product L-ribulose-5-phosphate 4-epimerase UlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170847.1 protein_id gnl|my_center|LOCUS_09150 13801 13526 gene locus_tag LOCUS_09160 13801 13526 CDS product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324306.1 protein_id gnl|my_center|LOCUS_09160 14128 14523 gene locus_tag LOCUS_09170 gene rpsF 14128 14523 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216676.1 protein_id gnl|my_center|LOCUS_09170 14530 14844 gene locus_tag LOCUS_09180 gene priB 14530 14844 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315977.1 protein_id gnl|my_center|LOCUS_09180 14849 15076 gene locus_tag LOCUS_09190 gene rpsR 14849 15076 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 protein_id gnl|my_center|LOCUS_09190 15118 15567 gene locus_tag LOCUS_09200 gene rplI 15118 15567 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196062.1 protein_id gnl|my_center|LOCUS_09200 16432 15638 gene locus_tag LOCUS_09210 16432 15638 CDS product DUF2686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174714.1 protein_id gnl|my_center|LOCUS_09210 16779 17105 gene locus_tag LOCUS_09220 16779 17105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 17727 17089 gene locus_tag LOCUS_09230 gene ytfB 17727 17089 CDS product cell division protein YtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119478.1 protein_id gnl|my_center|LOCUS_09230 17945 18565 gene locus_tag LOCUS_09240 gene fklB 17945 18565 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311330.1 protein_id gnl|my_center|LOCUS_09240 18874 20286 gene locus_tag LOCUS_09250 gene cycA 18874 20286 CDS product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228371.1 protein_id gnl|my_center|LOCUS_09250 20993 20331 gene locus_tag LOCUS_09260 gene ytfE 20993 20331 CDS product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331456.1 protein_id gnl|my_center|LOCUS_09260 22066 21101 gene locus_tag LOCUS_09270 22066 21101 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350569.1 protein_id gnl|my_center|LOCUS_09270 23034 22174 gene locus_tag LOCUS_09280 gene qorB 23034 22174 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560561.1 protein_id gnl|my_center|LOCUS_09280 23033 23503 gene locus_tag LOCUS_09290 23033 23503 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307543.1 protein_id gnl|my_center|LOCUS_09290 25575 23632 gene locus_tag LOCUS_09300 gene cpdB 25575 23632 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589431.1 protein_id gnl|my_center|LOCUS_09300 25765 26505 gene locus_tag LOCUS_09310 gene cysQ 25765 26505 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886919.1 protein_id gnl|my_center|LOCUS_09310 26717 27655 gene locus_tag LOCUS_09320 gene ytfI 26717 27655 CDS product protein YtfI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937655.1 protein_id gnl|my_center|LOCUS_09320 28272 27718 gene locus_tag LOCUS_09330 28272 27718 CDS product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175279.1 protein_id gnl|my_center|LOCUS_09330 28597 28803 gene locus_tag LOCUS_09340 28597 28803 CDS product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689228.1 protein_id gnl|my_center|LOCUS_09340 30225 28882 gene locus_tag LOCUS_09350 30225 28882 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935036.1 protein_id gnl|my_center|LOCUS_09350 31186 30548 gene locus_tag LOCUS_09360 gene msrA 31186 30548 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295196.1 protein_id gnl|my_center|LOCUS_09360 31243 31422 gene locus_tag LOCUS_09370 31243 31422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence025 349 497 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 939 1655 gene locus_tag LOCUS_09380 gene nanC 939 1655 CDS product N-acetylneuraminic acid outer membrane channel NanC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295734.1 protein_id gnl|my_center|LOCUS_09380 1675 2781 gene locus_tag LOCUS_09390 gene nanM 1675 2781 CDS product N-acetylneuraminate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309184.1 protein_id gnl|my_center|LOCUS_09390 2819 3826 gene locus_tag LOCUS_09400 2819 3826 CDS product 9-O-acetyl-N-acetylneuraminic acid deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991438.1 protein_id gnl|my_center|LOCUS_09400 5425 4409 gene locus_tag LOCUS_09410 5425 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09410 5601 5392 gene locus_tag LOCUS_09420 5601 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09420 6387 6644 gene locus_tag LOCUS_09430 6387 6644 CDS product YjhX family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054376.1 protein_id gnl|my_center|LOCUS_09430 6656 7201 gene locus_tag LOCUS_09440 6656 7201 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309181.1 protein_id gnl|my_center|LOCUS_09440 7257 8003 gene locus_tag LOCUS_09450 7257 8003 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354251.1 protein_id gnl|my_center|LOCUS_09450 8789 9910 gene locus_tag LOCUS_09460 8789 9910 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010829.1 protein_id gnl|my_center|LOCUS_09460 9907 10185 gene locus_tag LOCUS_09470 gene sgcB 9907 10185 CDS product PTS sugar transporter subunit IIB SgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722973.1 protein_id gnl|my_center|LOCUS_09470 10197 11510 gene locus_tag LOCUS_09480 gene sgcC 10197 11510 CDS product PTS sugar transporter subunit IIC SgcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460843.1 protein_id gnl|my_center|LOCUS_09480 11523 12329 gene locus_tag LOCUS_09490 gene sgcQ 11523 12329 CDS product BtpA family protein SgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118626.1 protein_id gnl|my_center|LOCUS_09490 12460 12891 gene locus_tag LOCUS_09500 gene sgcA 12460 12891 CDS product SgcA family PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606406.1 protein_id gnl|my_center|LOCUS_09500 12903 13535 gene locus_tag LOCUS_09510 12903 13535 CDS product ribulose-phosphate 3 epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600622.1 protein_id gnl|my_center|LOCUS_09510 13552 14334 gene locus_tag LOCUS_09520 13552 14334 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082780.1 protein_id gnl|my_center|LOCUS_09520 14637 15425 gene locus_tag LOCUS_09530 14637 15425 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251798.1 protein_id gnl|my_center|LOCUS_09530 15430 16335 gene locus_tag LOCUS_09540 15430 16335 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714563.1 protein_id gnl|my_center|LOCUS_09540 16346 18313 gene locus_tag LOCUS_09550 gene yjhG 16346 18313 CDS product xylonate dehydratase YjhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116326.1 protein_id gnl|my_center|LOCUS_09550 18420 19769 gene locus_tag LOCUS_09560 18420 19769 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128363.1 protein_id gnl|my_center|LOCUS_09560 20224 21102 gene locus_tag LOCUS_09570 20224 21102 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373366.1 protein_id gnl|my_center|LOCUS_09570 21425 21216 gene locus_tag LOCUS_09580 21425 21216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09580 21611 21426 gene locus_tag LOCUS_09590 21611 21426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 21862 21638 gene locus_tag LOCUS_09600 21862 21638 CDS product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303900.1 protein_id gnl|my_center|LOCUS_09600 22205 22726 gene locus_tag LOCUS_09610 gene fecI 22205 22726 CDS product RNA polymerase sigma factor FecI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283626.1 protein_id gnl|my_center|LOCUS_09610 22723 23676 gene locus_tag LOCUS_09620 gene fecR 22723 23676 CDS product fec operon regulator FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068910.1 protein_id gnl|my_center|LOCUS_09620 23763 26087 gene locus_tag LOCUS_09630 gene fecA 23763 26087 CDS product Fe(3+) dicitrate transport protein FecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188283.1 protein_id gnl|my_center|LOCUS_09630 26132 27034 gene locus_tag LOCUS_09640 gene fecB 26132 27034 CDS product Fe(3+) dicitrate ABC transporter substrate-binding protein FecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879155.1 protein_id gnl|my_center|LOCUS_09640 27031 28029 gene locus_tag LOCUS_09650 gene fecC 27031 28029 CDS product iron-dicitrate ABC transporter permease FecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125187.1 protein_id gnl|my_center|LOCUS_09650 28026 28982 gene locus_tag LOCUS_09660 gene fecD 28026 28982 CDS product Fe(3+) dicitrate ABC transporter permease subunit FecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684852.1 protein_id gnl|my_center|LOCUS_09660 28983 29750 gene locus_tag LOCUS_09670 gene fecE 28983 29750 CDS product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175457.1 protein_id gnl|my_center|LOCUS_09670 30564 30307 gene locus_tag LOCUS_09680 30564 30307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 30889 30647 gene locus_tag LOCUS_09690 30889 30647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09690 31323 30886 gene locus_tag LOCUS_09700 31323 30886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09700 >Feature sequence026 494 1564 gene locus_tag LOCUS_09710 gene dadX 494 1564 CDS product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197881.1 protein_id gnl|my_center|LOCUS_09710 3686 1950 gene locus_tag LOCUS_09720 3686 1950 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340194.1 protein_id gnl|my_center|LOCUS_09720 4695 3781 gene locus_tag LOCUS_09730 gene ldcA 4695 3781 CDS product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051560.1 protein_id gnl|my_center|LOCUS_09730 4668 4856 gene locus_tag LOCUS_09740 4668 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 4795 5406 gene locus_tag LOCUS_09750 gene emtA 4795 5406 CDS product membrane-bound lytic murein transglycosylase EmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301104.1 protein_id gnl|my_center|LOCUS_09750 6142 5408 gene locus_tag LOCUS_09760 6142 5408 CDS product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020169.1 protein_id gnl|my_center|LOCUS_09760 6343 6597 gene locus_tag LOCUS_09770 6343 6597 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310727.1 protein_id gnl|my_center|LOCUS_09770 6775 7215 gene locus_tag LOCUS_09780 gene ycgY 6775 7215 CDS product protein YcgY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615067.1 protein_id gnl|my_center|LOCUS_09780 8991 7294 gene locus_tag LOCUS_09790 gene treA 8991 7294 CDS product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841714.1 protein_id gnl|my_center|LOCUS_09790 10729 9311 gene locus_tag LOCUS_09800 gene dhaM 10729 9311 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301101.1 protein_id gnl|my_center|LOCUS_09800 11372 10740 gene locus_tag LOCUS_09810 gene dhaL 11372 10740 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059411.1 protein_id gnl|my_center|LOCUS_09810 12453 11383 gene locus_tag LOCUS_09820 gene dhaK 12453 11383 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733715.1 protein_id gnl|my_center|LOCUS_09820 12759 14600 gene locus_tag LOCUS_09830 gene dhaR 12759 14600 CDS product dihydroxyacetone kinase operon transcriptional regulator DhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350505.1 protein_id gnl|my_center|LOCUS_09830 17567 14700 gene locus_tag LOCUS_09840 17567 14700 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001334788.1 protein_id gnl|my_center|LOCUS_09840 19427 18336 gene locus_tag LOCUS_09850 gene ychF 19427 18336 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505866.1 protein_id gnl|my_center|LOCUS_09850 20128 19544 gene locus_tag LOCUS_09860 gene pth 20128 19544 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152933.1 protein_id gnl|my_center|LOCUS_09860 20406 20684 gene locus_tag LOCUS_09870 gene ychH 20406 20684 CDS product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823885.1 protein_id gnl|my_center|LOCUS_09870 22418 20739 gene locus_tag LOCUS_09880 gene dauA 22418 20739 CDS product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033352.1 protein_id gnl|my_center|LOCUS_09880 23556 22543 gene locus_tag LOCUS_09890 gene prs 23556 22543 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119392.1 protein_id gnl|my_center|LOCUS_09890 24492 23641 gene locus_tag LOCUS_09900 gene ispE 24492 23641 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260332.1 protein_id gnl|my_center|LOCUS_09900 25115 24492 gene locus_tag LOCUS_09910 gene lolB 25115 24492 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130692.1 protein_id gnl|my_center|LOCUS_09910 25329 26585 gene locus_tag LOCUS_09920 gene hemA 25329 26585 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299679.1 protein_id gnl|my_center|LOCUS_09920 26627 27709 gene locus_tag LOCUS_09930 gene prfA 26627 27709 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804726.1 protein_id gnl|my_center|LOCUS_09930 27709 28542 gene locus_tag LOCUS_09940 gene prmC 27709 28542 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456467.1 protein_id gnl|my_center|LOCUS_09940 28539 28931 gene locus_tag LOCUS_09950 gene sirB2 28539 28931 CDS product invasion regulator SirB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200374.1 protein_id gnl|my_center|LOCUS_09950 28935 29744 gene locus_tag LOCUS_09960 gene sirB1 28935 29744 CDS product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257044.1 protein_id gnl|my_center|LOCUS_09960 29780 30634 gene locus_tag LOCUS_09970 gene kdsA 29780 30634 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811065.1 protein_id gnl|my_center|LOCUS_09970 30917 30783 gene locus_tag LOCUS_09980 30917 30783 CDS product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517635.1 protein_id gnl|my_center|LOCUS_09980 31452 31318 gene locus_tag LOCUS_09990 31452 31318 CDS product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517635.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence027 1272 88 gene locus_tag LOCUS_10000 gene csiE 1272 88 CDS product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982994.1 protein_id gnl|my_center|LOCUS_10000 2413 1559 gene locus_tag LOCUS_10010 2413 1559 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297705.1 protein_id gnl|my_center|LOCUS_10010 3361 2558 gene locus_tag LOCUS_10020 gene suhB 3361 2558 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553451.1 protein_id gnl|my_center|LOCUS_10020 3480 4220 gene locus_tag LOCUS_10030 gene trmJ 3480 4220 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940019.1 protein_id gnl|my_center|LOCUS_10030 4319 4364 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4647 5135 gene locus_tag LOCUS_10040 gene iscR 4647 5135 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241357.1 protein_id gnl|my_center|LOCUS_10040 5247 6461 gene locus_tag LOCUS_10050 gene iscS 5247 6461 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295373.1 protein_id gnl|my_center|LOCUS_10050 6489 6716 gene locus_tag LOCUS_10060 6489 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10060 6717 6875 gene locus_tag LOCUS_10070 6717 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10070 6892 7215 gene locus_tag LOCUS_10080 gene iscA 6892 7215 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028953.1 protein_id gnl|my_center|LOCUS_10080 7311 7826 gene locus_tag LOCUS_10090 gene hscB 7311 7826 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384413.1 protein_id gnl|my_center|LOCUS_10090 7843 9693 gene locus_tag LOCUS_10100 gene hscA 7843 9693 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196613.1 protein_id gnl|my_center|LOCUS_10100 9695 10030 gene locus_tag LOCUS_10110 gene fdx 9695 10030 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124469.1 protein_id gnl|my_center|LOCUS_10110 10042 10242 gene locus_tag LOCUS_10120 gene iscX 10042 10242 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523616.1 protein_id gnl|my_center|LOCUS_10120 10420 11703 gene locus_tag LOCUS_10130 gene pepB 10420 11703 CDS product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133592.1 protein_id gnl|my_center|LOCUS_10130 11845 12621 gene locus_tag LOCUS_10140 gene sseB 11845 12621 CDS product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295479.1 protein_id gnl|my_center|LOCUS_10140 14284 13439 gene locus_tag LOCUS_10150 gene sseA 14284 13439 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108626.1 protein_id gnl|my_center|LOCUS_10150 14491 19452 gene locus_tag LOCUS_10160 gene yfhM 14491 19452 CDS product alpha2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736312.1 protein_id gnl|my_center|LOCUS_10160 19588 21765 gene locus_tag LOCUS_10170 gene pbpC 19588 21765 CDS product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137675.1 protein_id gnl|my_center|LOCUS_10170 21914 22345 gene locus_tag LOCUS_10180 gene ndk 21914 22345 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963837.1 protein_id gnl|my_center|LOCUS_10180 22495 23649 gene locus_tag LOCUS_10190 22495 23649 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003317.1 protein_id gnl|my_center|LOCUS_10190 23934 24947 gene locus_tag LOCUS_10200 gene rodZ 23934 24947 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090866.1 protein_id gnl|my_center|LOCUS_10200 24974 26092 gene locus_tag LOCUS_10210 gene ispG 24974 26092 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551807.1 protein_id gnl|my_center|LOCUS_10210 26203 27477 gene locus_tag LOCUS_10220 gene hisS 26203 27477 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107167.1 protein_id gnl|my_center|LOCUS_10220 27495 28115 gene locus_tag LOCUS_10230 gene yfgM 27495 28115 CDS product ancillary SecYEG translocon subunit YfgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409205.1 protein_id gnl|my_center|LOCUS_10230 28126 29304 gene locus_tag LOCUS_10240 gene bamB 28126 29304 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177052.1 protein_id gnl|my_center|LOCUS_10240 29422 30894 gene locus_tag LOCUS_10250 gene der 29422 30894 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249410.1 protein_id gnl|my_center|LOCUS_10250 30964 31179 gene locus_tag LOCUS_10260 30964 31179 CDS product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301158.1 protein_id gnl|my_center|LOCUS_10260 <31710 31176 gene locus_tag LOCUS_10270 <31710 31176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000937912.1:exodeoxyribonuclease VII large subunit >Feature sequence028 2160 226 gene locus_tag LOCUS_10280 gene rnb 2160 226 CDS product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484984.1 protein_id gnl|my_center|LOCUS_10280 3355 2228 gene locus_tag LOCUS_10290 3355 2228 CDS product CMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335988.1 protein_id gnl|my_center|LOCUS_10290 4287 3499 gene locus_tag LOCUS_10300 gene fabI 4287 3499 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506490.1 protein_id gnl|my_center|LOCUS_10300 4882 4655 gene locus_tag LOCUS_10310 4882 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 4811 4975 gene locus_tag LOCUS_10320 4811 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 5882 5076 gene locus_tag LOCUS_10330 gene sapF 5882 5076 CDS product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573407.1 protein_id gnl|my_center|LOCUS_10330 6876 5884 gene locus_tag LOCUS_10340 gene sapD 6876 5884 CDS product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128858.1 protein_id gnl|my_center|LOCUS_10340 7766 6876 gene locus_tag LOCUS_10350 gene sapC 7766 6876 CDS product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146163.1 protein_id gnl|my_center|LOCUS_10350 8718 7753 gene locus_tag LOCUS_10360 gene sapB 8718 7753 CDS product putrescine ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583277.1 protein_id gnl|my_center|LOCUS_10360 10316 8715 gene locus_tag LOCUS_10370 gene sapA 10316 8715 CDS product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250216.1 protein_id gnl|my_center|LOCUS_10370 10916 10671 gene locus_tag LOCUS_10380 10916 10671 CDS product YmjA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015110.1 protein_id gnl|my_center|LOCUS_10380 12435 11050 gene locus_tag LOCUS_10390 gene puuP 12435 11050 CDS product putrescine/proton symporter PuuP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996856.1 protein_id gnl|my_center|LOCUS_10390 14156 12738 gene locus_tag LOCUS_10400 gene puuA 14156 12738 CDS product glutamate-putrescine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296746.1 protein_id gnl|my_center|LOCUS_10400 14380 15132 gene locus_tag LOCUS_10410 gene puuD 14380 15132 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300506.1 protein_id gnl|my_center|LOCUS_10410 15159 15716 gene locus_tag LOCUS_10420 gene puuR 15159 15716 CDS product HTH-type transcriptional regulator PuuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278727.1 protein_id gnl|my_center|LOCUS_10420 15991 17478 gene locus_tag LOCUS_10430 gene puuC 15991 17478 CDS product aldehyde dehydrogenase PuuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009090.1 protein_id gnl|my_center|LOCUS_10430 17480 18760 gene locus_tag LOCUS_10440 gene puuB 17480 18760 CDS product gamma-glutamylputrescine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134870.1 protein_id gnl|my_center|LOCUS_10440 18798 20063 gene locus_tag LOCUS_10450 gene puuE 18798 20063 CDS product 4-aminobutyrate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069229.1 protein_id gnl|my_center|LOCUS_10450 21160 20183 gene locus_tag LOCUS_10460 gene pspF 21160 20183 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301108.1 protein_id gnl|my_center|LOCUS_10460 21327 21995 gene locus_tag LOCUS_10470 gene pspA 21327 21995 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511025.1 protein_id gnl|my_center|LOCUS_10470 22049 22273 gene locus_tag LOCUS_10480 gene pspB 22049 22273 CDS product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274963.1 protein_id gnl|my_center|LOCUS_10480 22273 22632 gene locus_tag LOCUS_10490 gene pspC 22273 22632 CDS product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907387.1 protein_id gnl|my_center|LOCUS_10490 22641 22862 gene locus_tag LOCUS_10500 gene pspD 22641 22862 CDS product phage shock protein PspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295585.1 protein_id gnl|my_center|LOCUS_10500 22937 23251 gene locus_tag LOCUS_10510 gene pspE 22937 23251 CDS product thiosulfate sulfurtransferase PspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473109.1 protein_id gnl|my_center|LOCUS_10510 23464 25143 gene locus_tag LOCUS_10520 gene ycjM 23464 25143 CDS product glucosylglycerate phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810499.1 protein_id gnl|my_center|LOCUS_10520 25157 26449 gene locus_tag LOCUS_10530 25157 26449 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597466.1 protein_id gnl|my_center|LOCUS_10530 26470 27351 gene locus_tag LOCUS_10540 26470 27351 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080790.1 protein_id gnl|my_center|LOCUS_10540 27338 28180 gene locus_tag LOCUS_10550 27338 28180 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224659.1 protein_id gnl|my_center|LOCUS_10550 28211 29263 gene locus_tag LOCUS_10560 28211 29263 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737347.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence029 <1 1095 gene locus_tag LOCUS_10570 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000081983.1:succinylornithine/acetylornithine transaminase 1092 2168 gene locus_tag LOCUS_10580 gene astA 1092 2168 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989419.1 protein_id gnl|my_center|LOCUS_10580 2061 2070 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2152 3630 gene locus_tag LOCUS_10590 gene astD 2152 3630 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177206.1 protein_id gnl|my_center|LOCUS_10590 3627 4970 gene locus_tag LOCUS_10600 gene astB 3627 4970 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994973.1 protein_id gnl|my_center|LOCUS_10600 4963 5931 gene locus_tag LOCUS_10610 gene astE 4963 5931 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368506.1 protein_id gnl|my_center|LOCUS_10610 6261 6746 gene locus_tag LOCUS_10620 gene spy 6261 6746 CDS product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228984.1 protein_id gnl|my_center|LOCUS_10620 6949 7524 gene locus_tag LOCUS_10630 gene ves 6949 7524 CDS product environmental stress-induced protein Ves inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300480.1 protein_id gnl|my_center|LOCUS_10630 8371 7484 gene locus_tag LOCUS_10640 gene cho 8371 7484 CDS product excinuclease Cho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252397.1 protein_id gnl|my_center|LOCUS_10640 9428 8601 gene locus_tag LOCUS_10650 gene nadE 9428 8601 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175026.1 protein_id gnl|my_center|LOCUS_10650 9630 9968 gene locus_tag LOCUS_10660 gene osmE 9630 9968 CDS product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039044.1 protein_id gnl|my_center|LOCUS_10660 10267 10587 gene locus_tag LOCUS_10670 gene chbB 10267 10587 CDS product PTS N,N'-diacetylchitobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412169.1 protein_id gnl|my_center|LOCUS_10670 10672 12030 gene locus_tag LOCUS_10680 gene chbC 10672 12030 CDS product PTS N,N'-diacetylchitobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073041.1 protein_id gnl|my_center|LOCUS_10680 12081 12431 gene locus_tag LOCUS_10690 gene chbA 12081 12431 CDS product PTS N,N'-diacetylchitobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968919.1 protein_id gnl|my_center|LOCUS_10690 12442 13281 gene locus_tag LOCUS_10700 gene chbR 12442 13281 CDS product transcriptional regulator ChbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983647.1 protein_id gnl|my_center|LOCUS_10700 13386 14738 gene locus_tag LOCUS_10710 gene celF 13386 14738 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078765.1 protein_id gnl|my_center|LOCUS_10710 14751 15500 gene locus_tag LOCUS_10720 gene chbG 14751 15500 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440471.1 protein_id gnl|my_center|LOCUS_10720 18052 15791 gene locus_tag LOCUS_10730 gene katE 18052 15791 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077872.1 protein_id gnl|my_center|LOCUS_10730 18343 18498 gene locus_tag LOCUS_10740 18343 18498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 18787 19590 gene locus_tag LOCUS_10750 gene ydjO 18787 19590 CDS product protein YdjO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310874.1 protein_id gnl|my_center|LOCUS_10750 20985 19594 gene locus_tag LOCUS_10760 gene tcyP 20985 19594 CDS product cystine/sulfocysteine:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010696.1 protein_id gnl|my_center|LOCUS_10760 21708 21118 gene locus_tag LOCUS_10770 21708 21118 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297653.1 protein_id gnl|my_center|LOCUS_10770 22539 21871 gene locus_tag LOCUS_10780 gene hxpB 22539 21871 CDS product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106833.1 protein_id gnl|my_center|LOCUS_10780 22686 23222 gene locus_tag LOCUS_10790 22686 23222 CDS product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222163.1 protein_id gnl|my_center|LOCUS_10790 24123 23263 gene locus_tag LOCUS_10800 24123 23263 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267650.1 protein_id gnl|my_center|LOCUS_10800 24519 24229 gene locus_tag LOCUS_10810 gene ghoS 24519 24229 CDS product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146159.1 protein_id gnl|my_center|LOCUS_10810 25549 24620 gene locus_tag LOCUS_10820 gene pfkB 25549 24620 CDS product 6-phosphofructokinase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251727.1 protein_id gnl|my_center|LOCUS_10820 25884 26594 gene locus_tag LOCUS_10830 25884 26594 CDS product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771391.1 protein_id gnl|my_center|LOCUS_10830 27732 26926 gene locus_tag LOCUS_10840 27732 26926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence030 1833 1006 gene locus_tag LOCUS_10850 1833 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10850 1247 1253 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2911 1844 gene locus_tag LOCUS_10860 2911 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10860 3784 4938 gene locus_tag LOCUS_10870 gene metK 3784 4938 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062128.1 protein_id gnl|my_center|LOCUS_10870 5362 6756 gene locus_tag LOCUS_10880 gene galP 5362 6756 CDS product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112301.1 protein_id gnl|my_center|LOCUS_10880 6875 7330 gene locus_tag LOCUS_10890 6875 7330 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300769.1 protein_id gnl|my_center|LOCUS_10890 7425 8132 gene locus_tag LOCUS_10900 gene endA 7425 8132 CDS product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286500.1 protein_id gnl|my_center|LOCUS_10900 8212 8943 gene locus_tag LOCUS_10910 gene rsmE 8212 8943 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222509.1 protein_id gnl|my_center|LOCUS_10910 8956 9906 gene locus_tag LOCUS_10920 gene gshB 8956 9906 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593273.1 protein_id gnl|my_center|LOCUS_10920 10015 10578 gene locus_tag LOCUS_10930 10015 10578 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053178.1 protein_id gnl|my_center|LOCUS_10930 10578 10994 gene locus_tag LOCUS_10940 gene ruvX 10578 10994 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017106.1 protein_id gnl|my_center|LOCUS_10940 12059 11178 gene locus_tag LOCUS_10950 12059 11178 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326494.1 protein_id gnl|my_center|LOCUS_10950 12176 12880 gene locus_tag LOCUS_10960 gene yggS 12176 12880 CDS product pyridoxal phosphate homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997795.1 protein_id gnl|my_center|LOCUS_10960 12898 13464 gene locus_tag LOCUS_10970 gene yggT 12898 13464 CDS product osmotic shock tolerance protein YggT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094831.1 protein_id gnl|my_center|LOCUS_10970 13461 13751 gene locus_tag LOCUS_10980 gene yggU 13461 13751 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994920.1 protein_id gnl|my_center|LOCUS_10980 13759 14352 gene locus_tag LOCUS_10990 gene rdgB 13759 14352 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174777.1 protein_id gnl|my_center|LOCUS_10990 14345 15481 gene locus_tag LOCUS_11000 gene hemW 14345 15481 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239943.1 protein_id gnl|my_center|LOCUS_11000 17093 15612 gene locus_tag LOCUS_11010 gene dtpD 17093 15612 CDS product dipeptide permease DtpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032689.1 protein_id gnl|my_center|LOCUS_11010 17364 18107 gene locus_tag LOCUS_11020 gene ybgI 17364 18107 CDS product radiation resistance protein YbgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798871.1 protein_id gnl|my_center|LOCUS_11020 18130 18786 gene locus_tag LOCUS_11030 gene pxpB 18130 18786 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188343.1 protein_id gnl|my_center|LOCUS_11030 18780 19712 gene locus_tag LOCUS_11040 gene pxpC 18780 19712 CDS product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912724.1 protein_id gnl|my_center|LOCUS_11040 19702 20436 gene locus_tag LOCUS_11050 gene pxpA 19702 20436 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687112.1 protein_id gnl|my_center|LOCUS_11050 20472 21263 gene locus_tag LOCUS_11060 gene nei 20472 21263 CDS product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113989.1 protein_id gnl|my_center|LOCUS_11060 22306 21260 gene locus_tag LOCUS_11070 22306 21260 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336221.1 protein_id gnl|my_center|LOCUS_11070 23519 22458 gene locus_tag LOCUS_11080 23519 22458 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272410.1 protein_id gnl|my_center|LOCUS_11080 24244 23516 gene locus_tag LOCUS_11090 24244 23516 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142799.1 protein_id gnl|my_center|LOCUS_11090 26715 24259 gene locus_tag LOCUS_11100 26715 24259 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350492.1 protein_id gnl|my_center|LOCUS_11100 27332 26766 gene locus_tag LOCUS_11110 27332 26766 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472412.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence031 270 2867 gene locus_tag LOCUS_11120 gene acnB 270 2867 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307570.1 protein_id gnl|my_center|LOCUS_11120 3043 3405 gene locus_tag LOCUS_11130 gene yacL 3043 3405 CDS product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384306.1 protein_id gnl|my_center|LOCUS_11130 4237 3443 gene locus_tag LOCUS_11140 gene speD 4237 3443 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734287.1 protein_id gnl|my_center|LOCUS_11140 5119 4253 gene locus_tag LOCUS_11150 gene speE 5119 4253 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818411.1 protein_id gnl|my_center|LOCUS_11150 5572 5225 gene locus_tag LOCUS_11160 5572 5225 CDS product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295568.1 protein_id gnl|my_center|LOCUS_11160 5738 7288 gene locus_tag LOCUS_11170 gene cueO 5738 7288 CDS product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189647.1 protein_id gnl|my_center|LOCUS_11170 9880 7490 gene locus_tag LOCUS_11180 gene gcd 9880 7490 CDS product quinoprotein glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306211.1 protein_id gnl|my_center|LOCUS_11180 10086 10622 gene locus_tag LOCUS_11190 gene hpt 10086 10622 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683335.1 protein_id gnl|my_center|LOCUS_11190 11325 10663 gene locus_tag LOCUS_11200 gene can 11325 10663 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651599.1 protein_id gnl|my_center|LOCUS_11200 11434 12360 gene locus_tag LOCUS_11210 11434 12360 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150637.1 protein_id gnl|my_center|LOCUS_11210 12357 13127 gene locus_tag LOCUS_11220 12357 13127 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972203.1 protein_id gnl|my_center|LOCUS_11220 13232 13672 gene locus_tag LOCUS_11230 13232 13672 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901987.1 protein_id gnl|my_center|LOCUS_11230 13736 14965 gene locus_tag LOCUS_11240 13736 14965 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277917.1 protein_id gnl|my_center|LOCUS_11240 15349 14969 gene locus_tag LOCUS_11250 gene panD 15349 14969 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621515.1 protein_id gnl|my_center|LOCUS_11250 15623 16525 gene locus_tag LOCUS_11260 gene rpnC 15623 16525 CDS product recombination-promoting nuclease RpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339954.1 protein_id gnl|my_center|LOCUS_11260 17450 16599 gene locus_tag LOCUS_11270 gene panC 17450 16599 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905383.1 protein_id gnl|my_center|LOCUS_11270 18256 17462 gene locus_tag LOCUS_11280 gene panB 18256 17462 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805497.1 protein_id gnl|my_center|LOCUS_11280 19608 18370 gene locus_tag LOCUS_11290 gene yadC 19608 18370 CDS product fimbrial tip-adhesin YadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848455.1 protein_id gnl|my_center|LOCUS_11290 20254 19658 gene locus_tag LOCUS_11300 20254 19658 CDS product fimbrial-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553749.1 protein_id gnl|my_center|LOCUS_11300 20886 20281 gene locus_tag LOCUS_11310 gene yadL 20886 20281 CDS product fimbrial-like protein YadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310526.1 protein_id gnl|my_center|LOCUS_11310 21431 20898 gene locus_tag LOCUS_11320 21431 20898 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598300.1 protein_id gnl|my_center|LOCUS_11320 24081 21484 gene locus_tag LOCUS_11330 gene htrE 24081 21484 CDS product Yad fimbria usher protein HtrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151605.1 protein_id gnl|my_center|LOCUS_11330 24856 24116 gene locus_tag LOCUS_11340 24856 24116 CDS product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465928.1 protein_id gnl|my_center|LOCUS_11340 25538 24954 gene locus_tag LOCUS_11350 25538 24954 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038438.1 protein_id gnl|my_center|LOCUS_11350 26387 25908 gene locus_tag LOCUS_11360 gene folK 26387 25908 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215139.1 protein_id gnl|my_center|LOCUS_11360 27232 26384 gene locus_tag LOCUS_11370 27232 26384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11370 >Feature sequence032 965 153 gene locus_tag LOCUS_11380 gene ydgH 965 153 CDS product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769303.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11380 1489 3021 gene locus_tag LOCUS_11390 gene pntA 1489 3021 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300486.1 protein_id gnl|my_center|LOCUS_11390 3032 4420 gene locus_tag LOCUS_11400 gene pntB 3032 4420 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014036.1 protein_id gnl|my_center|LOCUS_11400 5479 4445 gene locus_tag LOCUS_11410 gene tqsA 5479 4445 CDS product AI-2 transporter TqsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118241.1 protein_id gnl|my_center|LOCUS_11410 5891 6256 gene locus_tag LOCUS_11420 gene mdtJ 5891 6256 CDS product multidrug/spermidine efflux SMR transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276149.1 protein_id gnl|my_center|LOCUS_11420 6243 6572 gene locus_tag LOCUS_11430 gene mdtI 6243 6572 CDS product multidrug/spermidine efflux SMR transporter subunit MdtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046661.1 protein_id gnl|my_center|LOCUS_11430 7432 6611 gene locus_tag LOCUS_11440 7432 6611 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260865.1 protein_id gnl|my_center|LOCUS_11440 8043 7708 gene locus_tag LOCUS_11450 gene asr 8043 7708 CDS product acid resistance repetitive basic protein Asr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743951.1 protein_id gnl|my_center|LOCUS_11450 9693 8440 gene locus_tag LOCUS_11460 9693 8440 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091840.1 protein_id gnl|my_center|LOCUS_11460 9800 10693 gene locus_tag LOCUS_11470 9800 10693 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019525.1 protein_id gnl|my_center|LOCUS_11470 10828 12048 gene locus_tag LOCUS_11480 gene mlc 10828 12048 CDS product DNA-binding transcriptional repressor Mlc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225262.1 protein_id gnl|my_center|LOCUS_11480 12173 12868 gene locus_tag LOCUS_11490 gene bioD 12173 12868 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919231.1 protein_id gnl|my_center|LOCUS_11490 14077 12821 gene locus_tag LOCUS_11500 gene clcB 14077 12821 CDS product voltage-gated ClC-type chloride channel ClcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350514.1 protein_id gnl|my_center|LOCUS_11500 14886 14272 gene locus_tag LOCUS_11510 gene dmsD 14886 14272 CDS product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148710.1 protein_id gnl|my_center|LOCUS_11510 15783 14929 gene locus_tag LOCUS_11520 15783 14929 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526503.1 protein_id gnl|my_center|LOCUS_11520 16402 15785 gene locus_tag LOCUS_11530 gene dmsB 16402 15785 CDS product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213028.1 protein_id gnl|my_center|LOCUS_11530 18839 16413 gene locus_tag LOCUS_11540 18839 16413 CDS product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340362.1 protein_id gnl|my_center|LOCUS_11540 21323 18897 gene locus_tag LOCUS_11550 21323 18897 CDS product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041675.1 protein_id gnl|my_center|LOCUS_11550 21827 21522 gene locus_tag LOCUS_11560 21827 21522 CDS product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300836.1 protein_id gnl|my_center|LOCUS_11560 21899 22645 gene locus_tag LOCUS_11570 21899 22645 CDS product YnfC family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571976.1 protein_id gnl|my_center|LOCUS_11570 23208 22648 gene locus_tag LOCUS_11580 gene speG 23208 22648 CDS product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138581.1 protein_id gnl|my_center|LOCUS_11580 23584 23243 gene locus_tag LOCUS_11590 23584 23243 CDS product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705211.1 protein_id gnl|my_center|LOCUS_11590 23719 24045 gene locus_tag LOCUS_11600 23719 24045 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598292.1 protein_id gnl|my_center|LOCUS_11600 24082 24270 gene locus_tag LOCUS_11610 24082 24270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 24251 25465 gene locus_tag LOCUS_11620 gene rspA 24251 25465 CDS product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295394.1 protein_id gnl|my_center|LOCUS_11620 25477 26496 gene locus_tag LOCUS_11630 25477 26496 CDS product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836066.1 protein_id gnl|my_center|LOCUS_11630 <27559 26684 gene locus_tag LOCUS_11640 <27559 26684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000877001.1:site-specific integrase >Feature sequence033 1840 329 gene locus_tag LOCUS_11650 1840 329 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493470.1 protein_id gnl|my_center|LOCUS_11650 2846 1863 gene locus_tag LOCUS_11660 2846 1863 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142427.1 protein_id gnl|my_center|LOCUS_11660 6224 2943 gene locus_tag LOCUS_11670 6224 2943 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333903.1 protein_id gnl|my_center|LOCUS_11670 6336 7535 gene locus_tag LOCUS_11680 6336 7535 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200769.1 protein_id gnl|my_center|LOCUS_11680 7649 7737 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9040 7787 gene locus_tag LOCUS_11690 gene glyA 9040 7787 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919159.1 protein_id gnl|my_center|LOCUS_11690 9368 10558 gene locus_tag LOCUS_11700 gene hmpA 9368 10558 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883122.1 protein_id gnl|my_center|LOCUS_11700 10941 10603 gene locus_tag LOCUS_11710 gene glnB 10941 10603 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914032.1 protein_id gnl|my_center|LOCUS_11710 12336 11002 gene locus_tag LOCUS_11720 gene glrR 12336 11002 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295369.1 protein_id gnl|my_center|LOCUS_11720 12973 12326 gene locus_tag LOCUS_11730 gene qseG 12973 12326 CDS product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215861.1 protein_id gnl|my_center|LOCUS_11730 12973 13137 gene locus_tag LOCUS_11740 12973 13137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 14586 13204 gene locus_tag LOCUS_11750 gene qseE 14586 13204 CDS product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311037.1 protein_id gnl|my_center|LOCUS_11750 17981 15189 gene locus_tag LOCUS_11760 17981 15189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11760 19076 18129 gene locus_tag LOCUS_11770 19076 18129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11770 19334 20890 gene locus_tag LOCUS_11780 gene mltF 19334 20890 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734212.1 protein_id gnl|my_center|LOCUS_11780 21390 20887 gene locus_tag LOCUS_11790 gene tadA 21390 20887 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297409.1 protein_id gnl|my_center|LOCUS_11790 22083 21448 gene locus_tag LOCUS_11800 gene yfhb 22083 21448 CDS product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190655.1 protein_id gnl|my_center|LOCUS_11800 22220 23140 gene locus_tag LOCUS_11810 22220 23140 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455839.1 protein_id gnl|my_center|LOCUS_11810 23271 23456 gene locus_tag LOCUS_11820 23271 23456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 24531 24151 gene locus_tag LOCUS_11830 gene acpS 24531 24151 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986023.1 protein_id gnl|my_center|LOCUS_11830 25262 24531 gene locus_tag LOCUS_11840 gene pdxJ 25262 24531 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297412.1 protein_id gnl|my_center|LOCUS_11840 26002 25274 gene locus_tag LOCUS_11850 gene recO 26002 25274 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399404.1 protein_id gnl|my_center|LOCUS_11850 <26878 26014 gene locus_tag LOCUS_11860 <26878 26014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000020749.1:GTPase Era >Feature sequence034 142 399 gene locus_tag LOCUS_11870 142 399 CDS product DUF2534 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605090.1 protein_id gnl|my_center|LOCUS_11870 1399 449 gene locus_tag LOCUS_11880 gene uspE 1399 449 CDS product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262123.1 protein_id gnl|my_center|LOCUS_11880 2303 1551 gene locus_tag LOCUS_11890 gene fnr 2303 1551 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611911.1 protein_id gnl|my_center|LOCUS_11890 3013 2498 gene locus_tag LOCUS_11900 gene ogt 3013 2498 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945011.1 protein_id gnl|my_center|LOCUS_11900 4430 3024 gene locus_tag LOCUS_11910 gene abgT 4430 3024 CDS product p-aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062973.1 protein_id gnl|my_center|LOCUS_11910 6032 4587 gene locus_tag LOCUS_11920 gene abgB 6032 4587 CDS product p-aminobenzoyl-glutamate hydrolase subunit AbgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156451.1 protein_id gnl|my_center|LOCUS_11920 7342 6032 gene locus_tag LOCUS_11930 gene abgA 7342 6032 CDS product p-aminobenzoyl-glutamate hydrolase subunit AbgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444929.1 protein_id gnl|my_center|LOCUS_11930 7518 8426 gene locus_tag LOCUS_11940 7518 8426 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885458.1 protein_id gnl|my_center|LOCUS_11940 8756 9319 gene locus_tag LOCUS_11950 gene smrA 8756 9319 CDS product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046829.1 protein_id gnl|my_center|LOCUS_11950 10572 9340 gene locus_tag LOCUS_11960 gene dgcM 10572 9340 CDS product diguanylate cyclase DgcM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628058.1 protein_id gnl|my_center|LOCUS_11960 10827 11810 gene locus_tag LOCUS_11970 gene zntB 10827 11810 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387388.1 protein_id gnl|my_center|LOCUS_11970 12288 13661 gene locus_tag LOCUS_11980 gene dbpA 12288 13661 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123737.1 protein_id gnl|my_center|LOCUS_11980 14725 13790 gene locus_tag LOCUS_11990 gene ttcA 14725 13790 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157406.1 protein_id gnl|my_center|LOCUS_11990 15541 14777 gene locus_tag LOCUS_12000 15541 14777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 16229 16014 gene locus_tag LOCUS_12010 gene xisR 16229 16014 CDS product excisionase XisR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079604.1 protein_id gnl|my_center|LOCUS_12010 16517 16308 gene locus_tag LOCUS_12020 gene rcbA 16517 16308 CDS product double-strand break reduction protein RcbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276809.1 protein_id gnl|my_center|LOCUS_12020 16743 16510 gene locus_tag LOCUS_12030 gene ralR 16743 16510 CDS product type I toxin-antitoxin system endodeoxyribonuclease toxin RalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317028.1 protein_id gnl|my_center|LOCUS_12030 17570 16761 gene locus_tag LOCUS_12040 gene recT 17570 16761 CDS product recombination protein RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166319.1 protein_id gnl|my_center|LOCUS_12040 20163 17563 gene locus_tag LOCUS_12050 gene recE 20163 17563 CDS product exodeoxyribonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105143.1 protein_id gnl|my_center|LOCUS_12050 20540 20265 gene locus_tag LOCUS_12060 20540 20265 CDS product protein RacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632297.1 protein_id gnl|my_center|LOCUS_12060 20791 20615 gene locus_tag LOCUS_12070 20791 20615 CDS product YdaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001352098.1 protein_id gnl|my_center|LOCUS_12070 21006 20785 gene locus_tag LOCUS_12080 gene kilR 21006 20785 CDS product killing protein KilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560225.1 protein_id gnl|my_center|LOCUS_12080 21325 21936 gene locus_tag LOCUS_12090 21325 21936 CDS product superinfection exclusion B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001312793.1 protein_id gnl|my_center|LOCUS_12090 22088 21933 gene locus_tag LOCUS_12100 22088 21933 CDS product YdaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169151.1 protein_id gnl|my_center|LOCUS_12100 22233 22099 gene locus_tag LOCUS_12110 22233 22099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 23018 22542 gene locus_tag LOCUS_12120 gene racR 23018 22542 CDS product DNA-binding transcriptional repressor RacR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948459.1 protein_id gnl|my_center|LOCUS_12120 23142 23438 gene locus_tag LOCUS_12130 gene ydaS 23142 23438 CDS product toxin YdaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712069.1 protein_id gnl|my_center|LOCUS_12130 23461 23883 gene locus_tag LOCUS_12140 23461 23883 CDS product toxin YdaT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000693797.1 protein_id gnl|my_center|LOCUS_12140 23896 24753 gene locus_tag LOCUS_12150 23896 24753 CDS product YdaU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899748.1 protein_id gnl|my_center|LOCUS_12150 24760 25506 gene locus_tag LOCUS_12160 24760 25506 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788970.1 protein_id gnl|my_center|LOCUS_12160 25529 26089 gene locus_tag LOCUS_12170 25529 26089 CDS product DUF1627 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450663.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence035 1636 584 gene locus_tag LOCUS_12180 gene rsgA 1636 584 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041964.1 protein_id gnl|my_center|LOCUS_12180 1731 2276 gene locus_tag LOCUS_12190 gene orn 1731 2276 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295188.1 protein_id gnl|my_center|LOCUS_12190 2487 2562 gene locus_tag LOCUS_t00080 2487 2562 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2599 2674 gene locus_tag LOCUS_t00090 2599 2674 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2710 2785 gene locus_tag LOCUS_t00100 2710 2785 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4194 3055 gene locus_tag LOCUS_12200 gene queG 4194 3055 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294219.1 protein_id gnl|my_center|LOCUS_12200 4208 5740 gene locus_tag LOCUS_12210 gene nnr 4208 5740 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295189.1 protein_id gnl|my_center|LOCUS_12210 5712 6173 gene locus_tag LOCUS_12220 gene tsaE 5712 6173 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981977.1 protein_id gnl|my_center|LOCUS_12220 6192 7529 gene locus_tag LOCUS_12230 gene amiB 6192 7529 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990333.1 protein_id gnl|my_center|LOCUS_12230 7539 8294 gene locus_tag LOCUS_12240 7539 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 8307 8618 gene locus_tag LOCUS_12250 8307 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 9015 10088 gene locus_tag LOCUS_12260 9015 10088 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810253.1 protein_id gnl|my_center|LOCUS_12260 10153 13662 gene locus_tag LOCUS_12270 gene mfd 10153 13662 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115094.1 protein_id gnl|my_center|LOCUS_12270 13809 14768 gene locus_tag LOCUS_12280 gene ldtC 13809 14768 CDS product L,D-transpeptidase LdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300895.1 protein_id gnl|my_center|LOCUS_12280 15107 14850 gene locus_tag LOCUS_12290 gene bhsA 15107 14850 CDS product multiple stress resistance protein BhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800153.1 protein_id gnl|my_center|LOCUS_12290 15348 15980 gene locus_tag LOCUS_12300 gene comR 15348 15980 CDS product TetR family copper-responsive transcriptional repressor ComR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336528.1 protein_id gnl|my_center|LOCUS_12300 16581 16042 gene locus_tag LOCUS_12310 16581 16042 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043459.1 protein_id gnl|my_center|LOCUS_12310 18095 16791 gene locus_tag LOCUS_12320 gene ndh 18095 16791 CDS product NADH-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211045.1 protein_id gnl|my_center|LOCUS_12320 19037 18495 gene locus_tag LOCUS_12330 gene ycfP 19037 18495 CDS product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587933.1 protein_id gnl|my_center|LOCUS_12330 20085 19060 gene locus_tag LOCUS_12340 gene nagZ 20085 19060 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529320.1 protein_id gnl|my_center|LOCUS_12340 20920 20096 gene locus_tag LOCUS_12350 gene thiK 20920 20096 CDS product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116592.1 protein_id gnl|my_center|LOCUS_12350 21545 20901 gene locus_tag LOCUS_12360 gene lpoB 21545 20901 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164439.1 protein_id gnl|my_center|LOCUS_12360 21909 21556 gene locus_tag LOCUS_12370 21909 21556 CDS product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225295.1 protein_id gnl|my_center|LOCUS_12370 22295 21936 gene locus_tag LOCUS_12380 gene hinT 22295 21936 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807125.1 protein_id gnl|my_center|LOCUS_12380 22629 24818 gene locus_tag LOCUS_12390 gene fhuE 22629 24818 CDS product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953441.1 protein_id gnl|my_center|LOCUS_12390 <26274 24878 gene locus_tag LOCUS_12400 <26274 24878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000475719.1:PTS glucose transporter subunit IIBC >Feature sequence036 797 2419 gene locus_tag LOCUS_12410 gene pckA 797 2419 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265681.1 protein_id gnl|my_center|LOCUS_12410 3838 2495 gene locus_tag LOCUS_12420 gene envZ 3838 2495 CDS product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253696.1 protein_id gnl|my_center|LOCUS_12420 4563 3844 gene locus_tag LOCUS_12430 gene ompR 4563 3844 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 protein_id gnl|my_center|LOCUS_12430 4791 5267 gene locus_tag LOCUS_12440 gene greB 4791 5267 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856737.1 protein_id gnl|my_center|LOCUS_12440 5364 7685 gene locus_tag LOCUS_12450 5364 7685 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980727.1 protein_id gnl|my_center|LOCUS_12450 8142 8369 gene locus_tag LOCUS_12460 gene feoA 8142 8369 CDS product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200455.1 protein_id gnl|my_center|LOCUS_12460 8386 10707 gene locus_tag LOCUS_12470 gene feoB 8386 10707 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737039.1 protein_id gnl|my_center|LOCUS_12470 10707 10943 gene locus_tag LOCUS_12480 gene feoC 10707 10943 CDS product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157586.1 protein_id gnl|my_center|LOCUS_12480 11146 12024 gene locus_tag LOCUS_12490 gene rpnA 11146 12024 CDS product recombination-promoting nuclease RpnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039062.1 protein_id gnl|my_center|LOCUS_12490 12823 12053 gene locus_tag LOCUS_12500 gene bioH 12823 12053 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060070.1 protein_id gnl|my_center|LOCUS_12500 12897 13544 gene locus_tag LOCUS_12510 gene gntX 12897 13544 CDS product DNA utilization protein GntX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333371.1 protein_id gnl|my_center|LOCUS_12510 13603 14178 gene locus_tag LOCUS_12520 gene nfuA 13603 14178 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619389.1 protein_id gnl|my_center|LOCUS_12520 14538 15854 gene locus_tag LOCUS_12530 gene gntT 14538 15854 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131758.1 protein_id gnl|my_center|LOCUS_12530 18049 15965 gene locus_tag LOCUS_12540 gene malQ 18049 15965 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444342.1 protein_id gnl|my_center|LOCUS_12540 20452 18059 gene locus_tag LOCUS_12550 gene malP 20452 18059 CDS product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081909.1 protein_id gnl|my_center|LOCUS_12550 21064 23769 gene locus_tag LOCUS_12560 gene malT 21064 23769 CDS product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906961.1 protein_id gnl|my_center|LOCUS_12560 24828 23812 gene locus_tag LOCUS_12570 gene rtcA 24828 23812 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335950.1 protein_id gnl|my_center|LOCUS_12570 <26055 24832 gene locus_tag LOCUS_12580 <26055 24832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001105504.1:RNA-splicing ligase RtcB >Feature sequence037 <1 2345 gene locus_tag LOCUS_12590 <1 2345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000286312.1:fimbrial biogenesis usher protein 2336 3406 gene locus_tag LOCUS_12600 2336 3406 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165668.1 protein_id gnl|my_center|LOCUS_12600 3508 3960 gene locus_tag LOCUS_12610 3508 3960 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730630.1 protein_id gnl|my_center|LOCUS_12610 3968 4483 gene locus_tag LOCUS_12620 3968 4483 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919497.1 protein_id gnl|my_center|LOCUS_12620 4506 5186 gene locus_tag LOCUS_12630 4506 5186 CDS product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307699.1 protein_id gnl|my_center|LOCUS_12630 5297 6307 gene locus_tag LOCUS_12640 gene pyrD 5297 6307 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295352.1 protein_id gnl|my_center|LOCUS_12640 6481 7023 gene locus_tag LOCUS_12650 gene zapC 6481 7023 CDS product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295353.1 protein_id gnl|my_center|LOCUS_12650 8129 7020 gene locus_tag LOCUS_12660 gene ycbX 8129 7020 CDS product 6-N-hydroxylaminopurine resistance protein YcbX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212426.1 protein_id gnl|my_center|LOCUS_12660 8373 10481 gene locus_tag LOCUS_12670 gene rlmKL 8373 10481 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086539.1 protein_id gnl|my_center|LOCUS_12670 10493 12400 gene locus_tag LOCUS_12680 10493 12400 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053099.1 protein_id gnl|my_center|LOCUS_12680 12530 13783 gene locus_tag LOCUS_12690 gene pqiA 12530 13783 CDS product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333176.1 protein_id gnl|my_center|LOCUS_12690 13788 15428 gene locus_tag LOCUS_12700 gene pqiB 13788 15428 CDS product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445533.1 protein_id gnl|my_center|LOCUS_12700 15425 15988 gene locus_tag LOCUS_12710 gene pqiC 15425 15988 CDS product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759120.1 protein_id gnl|my_center|LOCUS_12710 16244 16411 gene locus_tag LOCUS_12720 gene rmf 16244 16411 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828648.1 protein_id gnl|my_center|LOCUS_12720 17107 16481 gene locus_tag LOCUS_12730 gene fabA 17107 16481 CDS product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018747.1 protein_id gnl|my_center|LOCUS_12730 18828 17068 gene locus_tag LOCUS_12740 18828 17068 CDS product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156518.1 protein_id gnl|my_center|LOCUS_12740 19014 19466 gene locus_tag LOCUS_12750 gene matP 19014 19466 CDS product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877161.1 protein_id gnl|my_center|LOCUS_12750 20582 19542 gene locus_tag LOCUS_12760 gene ompA 20582 19542 CDS product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750416.1 protein_id gnl|my_center|LOCUS_12760 20737 20955 gene locus_tag LOCUS_12770 20737 20955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 21454 20939 gene locus_tag LOCUS_12780 gene sulA 21454 20939 CDS product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288710.1 protein_id gnl|my_center|LOCUS_12780 21667 22296 gene locus_tag LOCUS_12790 gene sxy 21667 22296 CDS product CRP-S regulon transcriptional coactivator Sxy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839153.1 protein_id gnl|my_center|LOCUS_12790 24421 22259 gene locus_tag LOCUS_12800 gene yccS 24421 22259 CDS product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875023.1 protein_id gnl|my_center|LOCUS_12800 24877 24431 gene locus_tag LOCUS_12810 24877 24431 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261236.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence038 181 1611 gene locus_tag LOCUS_12820 181 1611 CDS product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333507.1 protein_id gnl|my_center|LOCUS_12820 2395 1652 gene locus_tag LOCUS_12830 2395 1652 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311257.1 protein_id gnl|my_center|LOCUS_12830 2430 2648 gene locus_tag LOCUS_12840 2430 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 2948 5734 gene locus_tag LOCUS_12850 gene polA 2948 5734 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250006.1 protein_id gnl|my_center|LOCUS_12850 6747 6115 gene locus_tag LOCUS_12860 gene yihA 6747 6115 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183349.1 protein_id gnl|my_center|LOCUS_12860 7329 7838 gene locus_tag LOCUS_12870 gene yihI 7329 7838 CDS product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295266.1 protein_id gnl|my_center|LOCUS_12870 8027 9400 gene locus_tag LOCUS_12880 gene hemN 8027 9400 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116090.1 protein_id gnl|my_center|LOCUS_12880 11269 9851 gene locus_tag LOCUS_12890 gene glnG 11269 9851 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188777.1 protein_id gnl|my_center|LOCUS_12890 12321 11272 gene locus_tag LOCUS_12900 gene glnL 12321 11272 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190577.1 protein_id gnl|my_center|LOCUS_12900 14016 12607 gene locus_tag LOCUS_12910 gene glnA 14016 12607 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271717.1 protein_id gnl|my_center|LOCUS_12910 14389 16212 gene locus_tag LOCUS_12920 gene typA 14389 16212 CDS product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570668.1 protein_id gnl|my_center|LOCUS_12920 16429 17139 gene locus_tag LOCUS_12930 16429 17139 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829798.1 protein_id gnl|my_center|LOCUS_12930 17252 18127 gene locus_tag LOCUS_12940 17252 18127 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256396.1 protein_id gnl|my_center|LOCUS_12940 18229 19494 gene locus_tag LOCUS_12950 18229 19494 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956313.1 protein_id gnl|my_center|LOCUS_12950 20277 19585 gene locus_tag LOCUS_12960 gene ompL 20277 19585 CDS product porin OmpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723465.1 protein_id gnl|my_center|LOCUS_12960 21748 20345 gene locus_tag LOCUS_12970 21748 20345 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295267.1 protein_id gnl|my_center|LOCUS_12970 23176 21791 gene locus_tag LOCUS_12980 23176 21791 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018380.1 protein_id gnl|my_center|LOCUS_12980 25258 23222 gene locus_tag LOCUS_12990 gene yihQ 25258 23222 CDS product sulfoquinovosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380843.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence039 2341 272 gene locus_tag LOCUS_13000 gene glyS 2341 272 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291772.1 protein_id gnl|my_center|LOCUS_13000 3262 2351 gene locus_tag LOCUS_13010 gene glyQ 3262 2351 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168544.1 protein_id gnl|my_center|LOCUS_13010 3656 3357 gene locus_tag LOCUS_13020 3656 3357 CDS product YsaB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980107.1 protein_id gnl|my_center|LOCUS_13020 3831 4826 gene locus_tag LOCUS_13030 gene wecH 3831 4826 CDS product O-acetyltransferase WecH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182650.1 protein_id gnl|my_center|LOCUS_13030 5305 4868 gene locus_tag LOCUS_13040 gene yiaA 5305 4868 CDS product inner membrane protein YiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296808.1 protein_id gnl|my_center|LOCUS_13040 5692 5351 gene locus_tag LOCUS_13050 gene yiaB 5692 5351 CDS product inner membrane protein YiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295228.1 protein_id gnl|my_center|LOCUS_13050 7315 5861 gene locus_tag LOCUS_13060 gene xylB 7315 5861 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275334.1 protein_id gnl|my_center|LOCUS_13060 8709 7387 gene locus_tag LOCUS_13070 gene xylA 8709 7387 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149591.1 protein_id gnl|my_center|LOCUS_13070 9075 10067 gene locus_tag LOCUS_13080 gene xylF 9075 10067 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694881.1 protein_id gnl|my_center|LOCUS_13080 10145 11686 gene locus_tag LOCUS_13090 gene xylG 10145 11686 CDS product D-xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146473.1 protein_id gnl|my_center|LOCUS_13090 11664 12845 gene locus_tag LOCUS_13100 gene xylH 11664 12845 CDS product xylose ABC transporter permease XylH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045978.1 protein_id gnl|my_center|LOCUS_13100 12923 13765 gene locus_tag LOCUS_13110 12923 13765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13110 13789 14097 gene locus_tag LOCUS_13120 13789 14097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13120 14865 14293 gene locus_tag LOCUS_13130 14865 14293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 15437 17467 gene locus_tag LOCUS_13140 gene malS 15437 17467 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761225.1 protein_id gnl|my_center|LOCUS_13140 17645 18898 gene locus_tag LOCUS_13150 gene avtA 17645 18898 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144363.1 protein_id gnl|my_center|LOCUS_13150 19522 19049 gene locus_tag LOCUS_13160 19522 19049 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300918.1 protein_id gnl|my_center|LOCUS_13160 20472 19624 gene locus_tag LOCUS_13170 gene yiaJ 20472 19624 CDS product IclR family transcriptional regulator YiaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514240.1 protein_id gnl|my_center|LOCUS_13170 20673 21671 gene locus_tag LOCUS_13180 gene yiaK 20673 21671 CDS product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869037.1 protein_id gnl|my_center|LOCUS_13180 21683 22150 gene locus_tag LOCUS_13190 21683 22150 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576079.1 protein_id gnl|my_center|LOCUS_13190 22268 22741 gene locus_tag LOCUS_13200 gene yiaM 22268 22741 CDS product 2,3-diketo-L-gulonate TRAP transporter small permease YiaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721664.1 protein_id gnl|my_center|LOCUS_13200 23286 23484 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23679 24182 gene locus_tag LOCUS_13210 23679 24182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 24195 25181 gene locus_tag LOCUS_13220 gene yiaO 24195 25181 CDS product 2,3-diketo-L-gulonate transporter substrate-binding protein YiaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776887.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence040 <1 788 gene locus_tag LOCUS_13230 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001295313.1:isochorismate synthase EntC 798 2408 gene locus_tag LOCUS_13240 gene entE 798 2408 CDS product (2,3-dihydroxybenzoyl)adenylate synthase EntE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026812.1 protein_id gnl|my_center|LOCUS_13240 2422 3279 gene locus_tag LOCUS_13250 gene entB 2422 3279 CDS product enterobactin biosynthesis bifunctional isochorismatase/aryl carrier protein EntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007138.1 protein_id gnl|my_center|LOCUS_13250 3279 4025 gene locus_tag LOCUS_13260 gene entA 3279 4025 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase EntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347651.1 protein_id gnl|my_center|LOCUS_13260 4028 4441 gene locus_tag LOCUS_13270 gene entH 4028 4441 CDS product proofreading thioesterase EntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637953.1 protein_id gnl|my_center|LOCUS_13270 4622 6727 gene locus_tag LOCUS_13280 gene cstA 4622 6727 CDS product pyruvate/proton symporter CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043156.1 protein_id gnl|my_center|LOCUS_13280 6859 6883 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6934 7131 gene locus_tag LOCUS_13290 6934 7131 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460431.1 protein_id gnl|my_center|LOCUS_13290 8229 7141 gene locus_tag LOCUS_13300 gene hcxA 8229 7141 CDS product hydroxycarboxylate dehydrogenase HcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120441.1 protein_id gnl|my_center|LOCUS_13300 8338 9498 gene locus_tag LOCUS_13310 gene ybdL 8338 9498 CDS product methionine-oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183907.1 protein_id gnl|my_center|LOCUS_13310 10128 9499 gene locus_tag LOCUS_13320 10128 9499 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502945.1 protein_id gnl|my_center|LOCUS_13320 11321 10101 gene locus_tag LOCUS_13330 11321 10101 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029814.1 protein_id gnl|my_center|LOCUS_13330 12370 11468 gene locus_tag LOCUS_13340 12370 11468 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002474.1 protein_id gnl|my_center|LOCUS_13340 13325 12579 gene locus_tag LOCUS_13350 gene dsbG 13325 12579 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913829.1 protein_id gnl|my_center|LOCUS_13350 13697 14260 gene locus_tag LOCUS_13360 gene ahpC 13697 14260 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052796.1 protein_id gnl|my_center|LOCUS_13360 14505 16070 gene locus_tag LOCUS_13370 gene ahpF 14505 16070 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887629.1 protein_id gnl|my_center|LOCUS_13370 16619 16191 gene locus_tag LOCUS_13380 gene uspG 16619 16191 CDS product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278509.1 protein_id gnl|my_center|LOCUS_13380 16840 18078 gene locus_tag LOCUS_13390 16840 18078 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646173.1 protein_id gnl|my_center|LOCUS_13390 18719 18309 gene locus_tag LOCUS_13400 gene rnk 18719 18309 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089731.1 protein_id gnl|my_center|LOCUS_13400 19755 18949 gene locus_tag LOCUS_13410 gene rna 19755 18949 CDS product ribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643397.1 protein_id gnl|my_center|LOCUS_13410 21332 19869 gene locus_tag LOCUS_13420 gene citT 21332 19869 CDS product citrate/succinate antiporter CitT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050323.1 protein_id gnl|my_center|LOCUS_13420 22261 21383 gene locus_tag LOCUS_13430 gene citG 22261 21383 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062457.1 protein_id gnl|my_center|LOCUS_13430 22787 22236 gene locus_tag LOCUS_13440 gene citX 22787 22236 CDS product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550422.1 protein_id gnl|my_center|LOCUS_13440 23228 22791 gene locus_tag LOCUS_13450 23228 22791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13450 24292 23216 gene locus_tag LOCUS_13460 24292 23216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13460 25211 24303 gene locus_tag LOCUS_13470 gene citE 25211 24303 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622357.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence041 <1 2284 gene locus_tag LOCUS_13480 <1 2284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000900941.1:YdbH family protein 2281 2466 gene locus_tag LOCUS_13490 2281 2466 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698145.1 protein_id gnl|my_center|LOCUS_13490 2531 2800 gene locus_tag LOCUS_13500 2531 2800 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300734.1 protein_id gnl|my_center|LOCUS_13500 3877 2972 gene locus_tag LOCUS_13510 gene feaR 3877 2972 CDS product transcriptional regulator FeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067514.1 protein_id gnl|my_center|LOCUS_13510 4113 5612 gene locus_tag LOCUS_13520 gene feaB 4113 5612 CDS product phenylacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138615.1 protein_id gnl|my_center|LOCUS_13520 7943 5670 gene locus_tag LOCUS_13530 gene tynA 7943 5670 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535469.1 protein_id gnl|my_center|LOCUS_13530 10236 8191 gene locus_tag LOCUS_13540 gene paaZ 10236 8191 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186469.1 protein_id gnl|my_center|LOCUS_13540 10521 11450 gene locus_tag LOCUS_13550 gene paaA 10521 11450 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191077.1 protein_id gnl|my_center|LOCUS_13550 11462 11749 gene locus_tag LOCUS_13560 gene paaB 11462 11749 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073393.1 protein_id gnl|my_center|LOCUS_13560 11758 12504 gene locus_tag LOCUS_13570 gene paaC 11758 12504 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072837.1 protein_id gnl|my_center|LOCUS_13570 12519 13016 gene locus_tag LOCUS_13580 gene paaD 12519 13016 CDS product phenylacetate degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189201.1 protein_id gnl|my_center|LOCUS_13580 13024 14094 gene locus_tag LOCUS_13590 gene paaK 13024 14094 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206388.1 protein_id gnl|my_center|LOCUS_13590 14091 14858 gene locus_tag LOCUS_13600 14091 14858 CDS product 2,3-dehydroadipyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292353.1 protein_id gnl|my_center|LOCUS_13600 14858 15646 gene locus_tag LOCUS_13610 gene paaG 14858 15646 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969784.1 protein_id gnl|my_center|LOCUS_13610 15693 17075 gene locus_tag LOCUS_13620 gene paaC 15693 17075 CDS product 3-hydroxyacyl-CoA dehydrogenase PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973360.1 protein_id gnl|my_center|LOCUS_13620 17065 17487 gene locus_tag LOCUS_13630 gene paaI 17065 17487 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018413.1 protein_id gnl|my_center|LOCUS_13630 17487 18692 gene locus_tag LOCUS_13640 gene paaJ 17487 18692 CDS product bifunctional 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206197.1 protein_id gnl|my_center|LOCUS_13640 18719 20032 gene locus_tag LOCUS_13650 gene paaF 18719 20032 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632280.1 protein_id gnl|my_center|LOCUS_13650 20133 21083 gene locus_tag LOCUS_13660 gene paaX 20133 21083 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039887.1 protein_id gnl|my_center|LOCUS_13660 21065 21655 gene locus_tag LOCUS_13670 gene paaY 21065 21655 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123464.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence042 788 1144 gene locus_tag LOCUS_13680 788 1144 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258236.1 protein_id gnl|my_center|LOCUS_13680 1148 2275 gene locus_tag LOCUS_13690 gene dapE 1148 2275 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277801.1 protein_id gnl|my_center|LOCUS_13690 2303 2503 gene locus_tag LOCUS_13700 2303 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 3311 2613 gene locus_tag LOCUS_13710 gene ypfH 3311 2613 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679799.1 protein_id gnl|my_center|LOCUS_13710 5373 3385 gene locus_tag LOCUS_13720 gene tmcA 5373 3385 CDS product tRNA cytosine(34) acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829360.1 protein_id gnl|my_center|LOCUS_13720 5735 5388 gene locus_tag LOCUS_13730 5735 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13730 6265 5720 gene locus_tag LOCUS_13740 6265 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13740 5793 5832 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7146 6433 gene locus_tag LOCUS_13750 gene purC 7146 6433 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295467.1 protein_id gnl|my_center|LOCUS_13750 8393 7359 gene locus_tag LOCUS_13760 gene bamC 8393 7359 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297320.1 protein_id gnl|my_center|LOCUS_13760 9288 8410 gene locus_tag LOCUS_13770 gene dapA 9288 8410 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311023.1 protein_id gnl|my_center|LOCUS_13770 9434 10006 gene locus_tag LOCUS_13780 9434 10006 CDS product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176187.1 protein_id gnl|my_center|LOCUS_13780 10006 10476 gene locus_tag LOCUS_13790 gene bcp 10006 10476 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068682.1 protein_id gnl|my_center|LOCUS_13790 10729 11346 gene locus_tag LOCUS_13800 gene hyfA 10729 11346 CDS product hydrogenase 4 subunit HyfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336048.1 protein_id gnl|my_center|LOCUS_13800 11346 13364 gene locus_tag LOCUS_13810 gene hyfB 11346 13364 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339455.1 protein_id gnl|my_center|LOCUS_13810 13375 14322 gene locus_tag LOCUS_13820 gene hyfC 13375 14322 CDS product hydrogenase 4 subunit HyfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311024.1 protein_id gnl|my_center|LOCUS_13820 14339 15778 gene locus_tag LOCUS_13830 gene hyfD 14339 15778 CDS product hydrogenase 4 subunit HyfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429104.1 protein_id gnl|my_center|LOCUS_13830 15790 16440 gene locus_tag LOCUS_13840 gene hyfE 15790 16440 CDS product hydrogenase 4 membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147991.1 protein_id gnl|my_center|LOCUS_13840 16445 18025 gene locus_tag LOCUS_13850 gene hyfF 16445 18025 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122577.1 protein_id gnl|my_center|LOCUS_13850 18015 19682 gene locus_tag LOCUS_13860 gene hyfG 18015 19682 CDS product hydrogenase 4 catalytic subunit HyfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102321.1 protein_id gnl|my_center|LOCUS_13860 19692 20111 gene locus_tag LOCUS_13870 19692 20111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13870 20095 20103 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20629 20827 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20843 21106 gene locus_tag LOCUS_13880 20843 21106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 21099 21512 gene locus_tag LOCUS_13890 gene hyfJ 21099 21512 CDS product hydrogenase 4 assembly chaperone HyfJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326580.1 protein_id gnl|my_center|LOCUS_13890 21542 23542 gene locus_tag LOCUS_13900 gene hyfR 21542 23542 CDS product DNA-binding transcriptional regulator HyfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251544.1 protein_id gnl|my_center|LOCUS_13900 21547 21596 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence043 1383 835 gene locus_tag LOCUS_13910 1383 835 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621065.1 protein_id gnl|my_center|LOCUS_13910 2012 1683 gene locus_tag LOCUS_13920 gene zapA 2012 1683 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276008.1 protein_id gnl|my_center|LOCUS_13920 2180 2758 gene locus_tag LOCUS_13930 gene ygfB 2180 2758 CDS product UPF0149 family protein YgfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295378.1 protein_id gnl|my_center|LOCUS_13930 2784 4109 gene locus_tag LOCUS_13940 gene pepP 2784 4109 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290136.1 protein_id gnl|my_center|LOCUS_13940 4106 5284 gene locus_tag LOCUS_13950 gene ubiH 4106 5284 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111195.1 protein_id gnl|my_center|LOCUS_13950 5307 6509 gene locus_tag LOCUS_13960 gene ubiI 5307 6509 CDS product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192229.1 protein_id gnl|my_center|LOCUS_13960 6957 8051 gene locus_tag LOCUS_13970 gene gcvT 6957 8051 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068701.1 protein_id gnl|my_center|LOCUS_13970 8075 8464 gene locus_tag LOCUS_13980 gene gcvH 8075 8464 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295377.1 protein_id gnl|my_center|LOCUS_13980 8583 11456 gene locus_tag LOCUS_13990 gene gcvP 8583 11456 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195062.1 protein_id gnl|my_center|LOCUS_13990 11554 11633 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11882 12544 gene locus_tag LOCUS_14000 11882 12544 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951964.1 protein_id gnl|my_center|LOCUS_14000 14034 12601 gene locus_tag LOCUS_14010 gene bglA 14034 12601 CDS product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295376.1 protein_id gnl|my_center|LOCUS_14010 14079 14390 gene locus_tag LOCUS_14020 gene yqfB 14079 14390 CDS product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182957.1 protein_id gnl|my_center|LOCUS_14020 14554 15213 gene locus_tag LOCUS_14030 14554 15213 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250274.1 protein_id gnl|my_center|LOCUS_14030 16389 15409 gene locus_tag LOCUS_14040 gene ygfZ 16389 15409 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886062.1 protein_id gnl|my_center|LOCUS_14040 16632 16898 gene locus_tag LOCUS_14050 gene sdhE 16632 16898 CDS product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354046.1 protein_id gnl|my_center|LOCUS_14050 16879 17286 gene locus_tag LOCUS_14060 16879 17286 CDS product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244777.1 protein_id gnl|my_center|LOCUS_14060 17847 17326 gene locus_tag LOCUS_14070 gene fldB 17847 17326 CDS product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055874.1 protein_id gnl|my_center|LOCUS_14070 17959 18855 gene locus_tag LOCUS_14080 gene xerD 17959 18855 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806638.1 protein_id gnl|my_center|LOCUS_14080 18880 19590 gene locus_tag LOCUS_14090 gene dsbC 18880 19590 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715214.1 protein_id gnl|my_center|LOCUS_14090 19596 21329 gene locus_tag LOCUS_14100 gene recJ 19596 21329 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813200.1 protein_id gnl|my_center|LOCUS_14100 21637 22518 gene locus_tag LOCUS_14110 gene prfB 21637 22518 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723217.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14110 >Feature sequence044 1299 277 gene locus_tag LOCUS_14120 gene lsrB 1299 277 CDS product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172465.1 protein_id gnl|my_center|LOCUS_14120 2303 1311 gene locus_tag LOCUS_14130 gene lsrD 2303 1311 CDS product autoinducer 2 ABC transporter permease LsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222721.1 protein_id gnl|my_center|LOCUS_14130 3331 2303 gene locus_tag LOCUS_14140 gene lsrC 3331 2303 CDS product autoinducer 2 ABC transporter permease LsrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911184.1 protein_id gnl|my_center|LOCUS_14140 4860 3325 gene locus_tag LOCUS_14150 gene lsrA 4860 3325 CDS product autoinducer 2 ABC transporter ATP-binding protein LsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194860.1 protein_id gnl|my_center|LOCUS_14150 5109 6062 gene locus_tag LOCUS_14160 gene lsrR 5109 6062 CDS product transcriptional regulator LsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154342.1 protein_id gnl|my_center|LOCUS_14160 6141 7733 gene locus_tag LOCUS_14170 gene lsrK 6141 7733 CDS product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113108.1 protein_id gnl|my_center|LOCUS_14170 8402 12241 gene locus_tag LOCUS_14180 8402 12241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14180 12285 13685 gene locus_tag LOCUS_14190 12285 13685 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083595.1 protein_id gnl|my_center|LOCUS_14190 13890 14174 gene locus_tag LOCUS_14200 gene hipB 13890 14174 CDS product type II toxin-antitoxin system antitoxin HipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301023.1 protein_id gnl|my_center|LOCUS_14200 14174 15496 gene locus_tag LOCUS_14210 gene hipA 14174 15496 CDS product type II toxin-antitoxin system serine/threonine protein kinase toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125439.1 protein_id gnl|my_center|LOCUS_14210 15814 15993 gene locus_tag LOCUS_14220 15814 15993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 16349 17071 gene locus_tag LOCUS_14230 16349 17071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 17084 17587 gene locus_tag LOCUS_14240 17084 17587 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825452.1 protein_id gnl|my_center|LOCUS_14240 17646 18560 gene locus_tag LOCUS_14250 17646 18560 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520676.1 protein_id gnl|my_center|LOCUS_14250 18894 21173 gene locus_tag LOCUS_14260 gene ydeP 18894 21173 CDS product acid resistance putative oxidoreductase YdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726691.1 protein_id gnl|my_center|LOCUS_14260 21421 21618 gene locus_tag LOCUS_14270 gene safA 21421 21618 CDS product two-component system connector SafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543384.1 protein_id gnl|my_center|LOCUS_14270 21693 22454 gene locus_tag LOCUS_14280 gene ydeO 21693 22454 CDS product acid stress response transcriptional regulator YdeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060495.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence045 844 26 gene locus_tag LOCUS_14290 gene glsB 844 26 CDS product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257409.1 protein_id gnl|my_center|LOCUS_14290 2296 908 gene locus_tag LOCUS_14300 gene sad 2296 908 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156615.1 protein_id gnl|my_center|LOCUS_14300 2397 3278 gene locus_tag LOCUS_14310 2397 3278 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366501.1 protein_id gnl|my_center|LOCUS_14310 3356 4471 gene locus_tag LOCUS_14320 gene yneK 3356 4471 CDS product putative protein YneK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258599.1 protein_id gnl|my_center|LOCUS_14320 4621 5811 gene locus_tag LOCUS_14330 gene ydeA 4621 5811 CDS product L-arabinose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210785.1 protein_id gnl|my_center|LOCUS_14330 6501 5836 gene locus_tag LOCUS_14340 gene marC 6501 5836 CDS product NAAT family transporter MarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885033.1 protein_id gnl|my_center|LOCUS_14340 6713 7147 gene locus_tag LOCUS_14350 gene marR 6713 7147 CDS product multiple antibiotic resistance transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843414.1 protein_id gnl|my_center|LOCUS_14350 7167 7550 gene locus_tag LOCUS_14360 gene marA 7167 7550 CDS product MDR efflux pump AcrAB transcriptional activator MarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091199.1 protein_id gnl|my_center|LOCUS_14360 7582 7800 gene locus_tag LOCUS_14370 gene marB 7582 7800 CDS product multiple antibiotic resistance protein MarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803657.1 protein_id gnl|my_center|LOCUS_14370 8730 7831 gene locus_tag LOCUS_14380 gene eamA 8730 7831 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087187.1 protein_id gnl|my_center|LOCUS_14380 9012 10112 gene locus_tag LOCUS_14390 gene ydeE 9012 10112 CDS product efflux MFS transporter YdeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054204.1 protein_id gnl|my_center|LOCUS_14390 11443 10553 gene locus_tag LOCUS_14400 gene dgcZ 11443 10553 CDS product diguanylate cyclase DgcZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592814.1 protein_id gnl|my_center|LOCUS_14400 12090 11698 gene locus_tag LOCUS_14410 gene ydeI 12090 11698 CDS product YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671737.1 protein_id gnl|my_center|LOCUS_14410 12366 12884 gene locus_tag LOCUS_14420 12366 12884 CDS product 2-oxo-tetronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024746.1 protein_id gnl|my_center|LOCUS_14420 14973 12928 gene locus_tag LOCUS_14430 gene dcp 14973 12928 CDS product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210373.1 protein_id gnl|my_center|LOCUS_14430 15110 15856 gene locus_tag LOCUS_14440 gene ydfG 15110 15856 CDS product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636571.1 protein_id gnl|my_center|LOCUS_14440 15945 16631 gene locus_tag LOCUS_14450 gene rspR 15945 16631 CDS product DNA-binding transcriptional regulator rspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215549.1 protein_id gnl|my_center|LOCUS_14450 16808 17011 gene locus_tag LOCUS_14460 gene ydfZ 16808 17011 CDS product putative selenium delivery protein YdfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214712.1 protein_id gnl|my_center|LOCUS_14460 18506 17046 gene locus_tag LOCUS_14470 18506 17046 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527743.1 protein_id gnl|my_center|LOCUS_14470 19878 18595 gene locus_tag LOCUS_14480 19878 18595 CDS product MHS family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347482.1 protein_id gnl|my_center|LOCUS_14480 20665 20898 gene locus_tag LOCUS_14490 gene ydfK 20665 20898 CDS product cold shock protein YdfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836768.1 protein_id gnl|my_center|LOCUS_14490 21215 21805 gene locus_tag LOCUS_14500 21215 21805 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078177.1 protein_id gnl|my_center|LOCUS_14500 22478 21903 gene locus_tag LOCUS_14510 22478 21903 CDS product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885611.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence046 1395 1320 gene locus_tag LOCUS_t00110 1395 1320 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1510 1435 gene locus_tag LOCUS_t00120 1510 1435 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1746 2090 gene locus_tag LOCUS_14520 1746 2090 CDS product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472021.1 protein_id gnl|my_center|LOCUS_14520 2113 2484 gene locus_tag LOCUS_14530 2113 2484 CDS product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826503.1 protein_id gnl|my_center|LOCUS_14530 3951 2536 gene locus_tag LOCUS_14540 gene gltX 3951 2536 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695655.1 protein_id gnl|my_center|LOCUS_14540 4210 4285 gene locus_tag LOCUS_t00130 4210 4285 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4330 4405 gene locus_tag LOCUS_t00140 4330 4405 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4452 4527 gene locus_tag LOCUS_t00150 4452 4527 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4532 4607 gene locus_tag LOCUS_t00160 4532 4607 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5756 4872 gene locus_tag LOCUS_14550 gene xapR 5756 4872 CDS product DNA-binding transcriptional regulator XapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442949.1 protein_id gnl|my_center|LOCUS_14550 5955 5797 gene locus_tag LOCUS_14560 5955 5797 CDS product DUF1427 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651752.1 protein_id gnl|my_center|LOCUS_14560 7264 6008 gene locus_tag LOCUS_14570 gene xapB 7264 6008 CDS product xanthosine/proton symporter XapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020402.1 protein_id gnl|my_center|LOCUS_14570 8157 7324 gene locus_tag LOCUS_14580 gene xapA 8157 7324 CDS product xanthosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084573.1 protein_id gnl|my_center|LOCUS_14580 8406 9170 gene locus_tag LOCUS_14590 8406 9170 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716421.1 protein_id gnl|my_center|LOCUS_14590 10135 9209 gene locus_tag LOCUS_14600 10135 9209 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109794.1 protein_id gnl|my_center|LOCUS_14600 10225 11223 gene locus_tag LOCUS_14610 10225 11223 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765610.1 protein_id gnl|my_center|LOCUS_14610 11438 11220 gene locus_tag LOCUS_14620 11438 11220 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410201.1 protein_id gnl|my_center|LOCUS_14620 12705 11440 gene locus_tag LOCUS_14630 12705 11440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14630 13427 12684 gene locus_tag LOCUS_14640 13427 12684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14640 13932 13498 gene locus_tag LOCUS_14650 13932 13498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 14023 14349 gene locus_tag LOCUS_14660 14023 14349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 14714 15475 gene locus_tag LOCUS_14670 gene cysZ 14714 15475 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254839.1 protein_id gnl|my_center|LOCUS_14670 15660 16631 gene locus_tag LOCUS_14680 gene cysK 15660 16631 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034402.1 protein_id gnl|my_center|LOCUS_14680 17015 17272 gene locus_tag LOCUS_14690 gene ptsH 17015 17272 CDS product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 protein_id gnl|my_center|LOCUS_14690 17317 19044 gene locus_tag LOCUS_14700 gene ptsI 17317 19044 CDS product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623140.1 protein_id gnl|my_center|LOCUS_14700 19085 19594 gene locus_tag LOCUS_14710 gene crr 19085 19594 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522247.1 protein_id gnl|my_center|LOCUS_14710 20488 19637 gene locus_tag LOCUS_14720 gene pdxK 20488 19637 CDS product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096674.1 protein_id gnl|my_center|LOCUS_14720 20593 20967 gene locus_tag LOCUS_14730 20593 20967 CDS product YfeK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719962.1 protein_id gnl|my_center|LOCUS_14730 21000 21734 gene locus_tag LOCUS_14740 21000 21734 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745534.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence047 190 603 gene locus_tag LOCUS_14750 190 603 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301418.1 protein_id gnl|my_center|LOCUS_14750 965 648 gene locus_tag LOCUS_14760 gene hspQ 965 648 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295356.1 protein_id gnl|my_center|LOCUS_14760 2213 1023 gene locus_tag LOCUS_14770 gene rlmI 2213 1023 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116297.1 protein_id gnl|my_center|LOCUS_14770 2308 2586 gene locus_tag LOCUS_14780 gene yccX 2308 2586 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048252.1 protein_id gnl|my_center|LOCUS_14780 2912 2583 gene locus_tag LOCUS_14790 gene tusE 2912 2583 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904442.1 protein_id gnl|my_center|LOCUS_14790 3662 3003 gene locus_tag LOCUS_14800 gene yccA 3662 3003 CDS product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375136.1 protein_id gnl|my_center|LOCUS_14800 3956 3869 gene locus_tag LOCUS_t00170 3956 3869 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4383 5501 gene locus_tag LOCUS_14810 gene hyaA 4383 5501 CDS product hydrogenase 1 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058323.1 protein_id gnl|my_center|LOCUS_14810 5498 7291 gene locus_tag LOCUS_14820 gene hyaB 5498 7291 CDS product Ni/Fe-hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107384.1 protein_id gnl|my_center|LOCUS_14820 7310 8017 gene locus_tag LOCUS_14830 gene hyaC 7310 8017 CDS product Ni/Fe-hydrogenase b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186424.1 protein_id gnl|my_center|LOCUS_14830 8014 8601 gene locus_tag LOCUS_14840 8014 8601 CDS product hydrogenase 1 maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003671.1 protein_id gnl|my_center|LOCUS_14840 8598 8996 gene locus_tag LOCUS_14850 gene hyaE 8598 8996 CDS product hydrogenase-1 operon protein HyaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063978.1 protein_id gnl|my_center|LOCUS_14850 8993 9850 gene locus_tag LOCUS_14860 8993 9850 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004899.1 protein_id gnl|my_center|LOCUS_14860 9984 11528 gene locus_tag LOCUS_14870 gene appC 9984 11528 CDS product cytochrome bd-II oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263582.1 protein_id gnl|my_center|LOCUS_14870 11540 12676 gene locus_tag LOCUS_14880 gene appB 11540 12676 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460803.1 protein_id gnl|my_center|LOCUS_14880 12861 14159 gene locus_tag LOCUS_14890 gene appA 12861 14159 CDS product bifunctional acid phosphatase/4-phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300464.1 protein_id gnl|my_center|LOCUS_14890 16439 14274 gene locus_tag LOCUS_14900 gene etk 16439 14274 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208650.1 protein_id gnl|my_center|LOCUS_14900 16920 16474 gene locus_tag LOCUS_14910 gene etp 16920 16474 CDS product protein-tyrosine-phosphatase Etp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057871.1 protein_id gnl|my_center|LOCUS_14910 18047 16908 gene locus_tag LOCUS_14920 18047 16908 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295357.1 protein_id gnl|my_center|LOCUS_14920 20189 18093 gene locus_tag LOCUS_14930 20189 18093 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742328.1 protein_id gnl|my_center|LOCUS_14930 20935 20189 gene locus_tag LOCUS_14940 20935 20189 CDS product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038079.1 protein_id gnl|my_center|LOCUS_14940 21576 20932 gene locus_tag LOCUS_14950 gene gfcB 21576 20932 CDS product lipoprotein GfcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247610.1 protein_id gnl|my_center|LOCUS_14950 21988 21683 gene locus_tag LOCUS_14960 21988 21683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032438.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence048 399 1934 gene locus_tag LOCUS_14970 gene gadC 399 1934 CDS product acid resistance gamma-aminobutyrate antiporter GadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246019.1 protein_id gnl|my_center|LOCUS_14970 2275 2099 gene locus_tag LOCUS_14980 2275 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 2230 3384 gene locus_tag LOCUS_14990 2230 3384 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350395.1 protein_id gnl|my_center|LOCUS_14990 3748 5130 gene locus_tag LOCUS_15000 gene dosC 3748 5130 CDS product diguanylate cyclase DosC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426292.1 protein_id gnl|my_center|LOCUS_15000 5155 7554 gene locus_tag LOCUS_15010 gene dosP 5155 7554 CDS product oxygen-sensing cyclic-di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360132.1 protein_id gnl|my_center|LOCUS_15010 7812 8393 gene locus_tag LOCUS_15020 gene ddpX 7812 8393 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285833.1 protein_id gnl|my_center|LOCUS_15020 8503 9957 gene locus_tag LOCUS_15030 8503 9957 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830550.1 protein_id gnl|my_center|LOCUS_15030 9959 10981 gene locus_tag LOCUS_15040 9959 10981 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145123.1 protein_id gnl|my_center|LOCUS_15040 10978 11874 gene locus_tag LOCUS_15050 10978 11874 CDS product D,D-dipeptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979626.1 protein_id gnl|my_center|LOCUS_15050 11871 12857 gene locus_tag LOCUS_15060 11871 12857 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193547.1 protein_id gnl|my_center|LOCUS_15060 12850 13776 gene locus_tag LOCUS_15070 12850 13776 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285536.1 protein_id gnl|my_center|LOCUS_15070 14263 13832 gene locus_tag LOCUS_15080 gene osmC 14263 13832 CDS product peroxiredoxin OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152305.1 protein_id gnl|my_center|LOCUS_15080 14263 14466 gene locus_tag LOCUS_15090 14263 14466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 14608 14823 gene locus_tag LOCUS_15100 gene bdm 14608 14823 CDS product biofilm-dependent modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495771.1 protein_id gnl|my_center|LOCUS_15100 14925 15062 gene locus_tag LOCUS_15110 gene sra 14925 15062 CDS product stationary-phase-induced ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841554.1 protein_id gnl|my_center|LOCUS_15110 15219 16916 gene locus_tag LOCUS_15120 gene maeA 15219 16916 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433476.1 protein_id gnl|my_center|LOCUS_15120 17050 18060 gene locus_tag LOCUS_15130 gene adhP 17050 18060 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642433.1 protein_id gnl|my_center|LOCUS_15130 18206 18490 gene locus_tag LOCUS_15140 18206 18490 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781370.1 protein_id gnl|my_center|LOCUS_15140 19550 18897 gene locus_tag LOCUS_15150 gene fdnI 19550 18897 CDS product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045648.1 protein_id gnl|my_center|LOCUS_15150 20427 19510 gene locus_tag LOCUS_15160 gene fdnH 20427 19510 CDS product formate dehydrogenase N subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240582.1 protein_id gnl|my_center|LOCUS_15160 <21713 20440 gene locus_tag LOCUS_15170 <21713 20440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010723100.1:formate dehydrogenase-N subunit alpha >Feature sequence049 285 1145 gene locus_tag LOCUS_15180 gene rsmI 285 1145 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809262.1 protein_id gnl|my_center|LOCUS_15180 2279 1188 gene locus_tag LOCUS_15190 2279 1188 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816992.1 protein_id gnl|my_center|LOCUS_15190 4731 2290 gene locus_tag LOCUS_15200 4731 2290 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355538.1 protein_id gnl|my_center|LOCUS_15200 5434 4835 gene locus_tag LOCUS_15210 5434 4835 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044775.1 protein_id gnl|my_center|LOCUS_15210 6194 5610 gene locus_tag LOCUS_15220 6194 5610 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045432.1 protein_id gnl|my_center|LOCUS_15220 7296 6595 gene locus_tag LOCUS_15230 7296 6595 CDS product galactosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311150.1 protein_id gnl|my_center|LOCUS_15230 8142 7351 gene locus_tag LOCUS_15240 gene agaD 8142 7351 CDS product PTS galactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534347.1 protein_id gnl|my_center|LOCUS_15240 8935 8132 gene locus_tag LOCUS_15250 gene agaC 8935 8132 CDS product PTS galactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544489.1 protein_id gnl|my_center|LOCUS_15250 9450 8974 gene locus_tag LOCUS_15260 gene agaB 9450 8974 CDS product PTS galactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203711.1 protein_id gnl|my_center|LOCUS_15260 10477 9617 gene locus_tag LOCUS_15270 gene kbaY 10477 9617 CDS product tagatose-bisphosphate aldolase subunit KbaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022766.1 protein_id gnl|my_center|LOCUS_15270 11644 10490 gene locus_tag LOCUS_15280 11644 10490 CDS product AgaS family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114869.1 protein_id gnl|my_center|LOCUS_15280 12498 11995 gene locus_tag LOCUS_15290 12498 11995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 12919 12518 gene locus_tag LOCUS_15300 12919 12518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 13403 12930 gene locus_tag LOCUS_15310 gene agaV 13403 12930 CDS product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336162.1 protein_id gnl|my_center|LOCUS_15310 14706 13426 gene locus_tag LOCUS_15320 gene kbaZ 14706 13426 CDS product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681920.1 protein_id gnl|my_center|LOCUS_15320 14955 15764 gene locus_tag LOCUS_15330 gene agaR 14955 15764 CDS product aga operon transcriptional regulator AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072187.1 protein_id gnl|my_center|LOCUS_15330 16283 15819 gene locus_tag LOCUS_15340 gene yhaV 16283 15819 CDS product type II toxin-antitoxin system ribonuclease toxin YhaV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347273.1 protein_id gnl|my_center|LOCUS_15340 16618 16283 gene locus_tag LOCUS_15350 gene prlF 16618 16283 CDS product type II toxin-antitoxin system antitoxin PrlF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307405.1 protein_id gnl|my_center|LOCUS_15350 18338 16767 gene locus_tag LOCUS_15360 gene garD 18338 16767 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273753.1 protein_id gnl|my_center|LOCUS_15360 18713 20047 gene locus_tag LOCUS_15370 gene garP 18713 20047 CDS product galactarate/glucarate/glycerate transporter GarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599636.1 protein_id gnl|my_center|LOCUS_15370 20063 20833 gene locus_tag LOCUS_15380 gene garL 20063 20833 CDS product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058209.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence050 1813 1388 gene locus_tag LOCUS_15390 gene arsC 1813 1388 CDS product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065769.1 protein_id gnl|my_center|LOCUS_15390 3115 1826 gene locus_tag LOCUS_15400 gene arsB 3115 1826 CDS product arsenite/antimonite:H(+) antiporter ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922639.1 protein_id gnl|my_center|LOCUS_15400 3522 3169 gene locus_tag LOCUS_15410 gene arsR 3522 3169 CDS product As(III)-sensing metalloregulatory transcriptional repressor ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008957.1 protein_id gnl|my_center|LOCUS_15410 4234 4061 gene locus_tag LOCUS_15420 4234 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004976829.1 protein_id gnl|my_center|LOCUS_15420 4196 4345 gene locus_tag LOCUS_15430 4196 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 5751 4399 gene locus_tag LOCUS_15440 gene gorA 5751 4399 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160816.1 protein_id gnl|my_center|LOCUS_15440 6665 5823 gene locus_tag LOCUS_15450 gene rlmJ 6665 5823 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300574.1 protein_id gnl|my_center|LOCUS_15450 6868 8910 gene locus_tag LOCUS_15460 gene prlC 6868 8910 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298719.1 protein_id gnl|my_center|LOCUS_15460 8918 9670 gene locus_tag LOCUS_15470 gene rsmJ 8918 9670 CDS product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686620.1 protein_id gnl|my_center|LOCUS_15470 11188 9719 gene locus_tag LOCUS_15480 gene dtpB 11188 9719 CDS product dipeptide/tripeptide permease DtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098652.1 protein_id gnl|my_center|LOCUS_15480 11143 11322 gene locus_tag LOCUS_15490 11143 11322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 11939 11505 gene locus_tag LOCUS_15500 gene uspA 11939 11505 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323571.1 protein_id gnl|my_center|LOCUS_15500 12330 12665 gene locus_tag LOCUS_15510 gene uspB 12330 12665 CDS product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626187.1 protein_id gnl|my_center|LOCUS_15510 14344 12845 gene locus_tag LOCUS_15520 gene pitA 14344 12845 CDS product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902780.1 protein_id gnl|my_center|LOCUS_15520 14576 15778 gene locus_tag LOCUS_15530 14576 15778 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439170.1 protein_id gnl|my_center|LOCUS_15530 17145 16093 gene locus_tag LOCUS_15540 17145 16093 CDS product DUF2776 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028905.1 protein_id gnl|my_center|LOCUS_15540 17528 18766 gene locus_tag LOCUS_15550 17528 18766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15550 18763 19134 gene locus_tag LOCUS_15560 18763 19134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15560 19396 21018 gene locus_tag LOCUS_15570 19396 21018 CDS product YhiJ/YhiL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393583.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence051 1953 1294 gene locus_tag LOCUS_15580 gene rpiA 1953 1294 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189743.1 protein_id gnl|my_center|LOCUS_15580 2239 2009 gene locus_tag LOCUS_15590 2239 2009 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545308.1 protein_id gnl|my_center|LOCUS_15590 2381 3274 gene locus_tag LOCUS_15600 gene argP 2381 3274 CDS product DNA-binding transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828351.1 protein_id gnl|my_center|LOCUS_15600 3478 5622 gene locus_tag LOCUS_15610 gene scpA 3478 5622 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073223.1 protein_id gnl|my_center|LOCUS_15610 5615 6610 gene locus_tag LOCUS_15620 gene meaB 5615 6610 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606525.1 protein_id gnl|my_center|LOCUS_15620 6621 7406 gene locus_tag LOCUS_15630 gene scpB 6621 7406 CDS product methylmalonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122080.1 protein_id gnl|my_center|LOCUS_15630 7430 8908 gene locus_tag LOCUS_15640 gene scpC 7430 8908 CDS product propionyl-CoA:succinate CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449965.1 protein_id gnl|my_center|LOCUS_15640 9801 8905 gene locus_tag LOCUS_15650 9801 8905 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350807.1 protein_id gnl|my_center|LOCUS_15650 10708 9968 gene locus_tag LOCUS_15660 10708 9968 CDS product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669834.1 protein_id gnl|my_center|LOCUS_15660 11436 10801 gene locus_tag LOCUS_15670 gene argO 11436 10801 CDS product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493352.1 protein_id gnl|my_center|LOCUS_15670 12435 11575 gene locus_tag LOCUS_15680 gene mscS 12435 11575 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389818.1 protein_id gnl|my_center|LOCUS_15680 12647 12701 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13853 12774 gene locus_tag LOCUS_15690 gene fbaA 13853 12774 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034372.1 protein_id gnl|my_center|LOCUS_15690 15231 14068 gene locus_tag LOCUS_15700 gene pgk 15231 14068 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111269.1 protein_id gnl|my_center|LOCUS_15700 16300 15281 gene locus_tag LOCUS_15710 gene epd 16300 15281 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218480.1 protein_id gnl|my_center|LOCUS_15710 17298 16585 gene locus_tag LOCUS_15720 17298 16585 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687705.1 protein_id gnl|my_center|LOCUS_15720 17804 17295 gene locus_tag LOCUS_15730 gene fumE 17804 17295 CDS product fumarase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224147.1 protein_id gnl|my_center|LOCUS_15730 18791 17826 gene locus_tag LOCUS_15740 gene glpX 18791 17826 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987283.1 protein_id gnl|my_center|LOCUS_15740 20065 18788 gene locus_tag LOCUS_15750 20065 18788 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853247.1 protein_id gnl|my_center|LOCUS_15750 <20986 20080 gene locus_tag LOCUS_15760 <20986 20080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000428788.1:PTS mannitol transporter subunit IICB >Feature sequence052 1662 2093 gene locus_tag LOCUS_15770 1662 2093 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156181.1 protein_id gnl|my_center|LOCUS_15770 2235 2486 gene locus_tag LOCUS_15780 gene grxC 2235 2486 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024392.1 protein_id gnl|my_center|LOCUS_15780 2549 3016 gene locus_tag LOCUS_15790 gene secB 2549 3016 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003377.1 protein_id gnl|my_center|LOCUS_15790 3016 4035 gene locus_tag LOCUS_15800 gene gpsA 3016 4035 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076194.1 protein_id gnl|my_center|LOCUS_15800 4115 4936 gene locus_tag LOCUS_15810 gene cysE 4115 4936 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277561.1 protein_id gnl|my_center|LOCUS_15810 5462 4989 gene locus_tag LOCUS_15820 gene trmL 5462 4989 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932347.1 protein_id gnl|my_center|LOCUS_15820 6850 5660 gene locus_tag LOCUS_15830 gene lldD 6850 5660 CDS product quinone-dependent L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586962.1 protein_id gnl|my_center|LOCUS_15830 7623 6847 gene locus_tag LOCUS_15840 gene lldR 7623 6847 CDS product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636500.1 protein_id gnl|my_center|LOCUS_15840 9278 7623 gene locus_tag LOCUS_15850 gene lldP 9278 7623 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295233.1 protein_id gnl|my_center|LOCUS_15850 10012 9650 gene locus_tag LOCUS_15860 10012 9650 CDS product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665680.1 protein_id gnl|my_center|LOCUS_15860 10297 10506 gene locus_tag LOCUS_15870 gene yibT 10297 10506 CDS product protein YibT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517100.1 protein_id gnl|my_center|LOCUS_15870 11105 10518 gene locus_tag LOCUS_15880 gene mtlR 11105 10518 CDS product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228269.1 protein_id gnl|my_center|LOCUS_15880 12253 11105 gene locus_tag LOCUS_15890 gene mtlD 12253 11105 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645439.1 protein_id gnl|my_center|LOCUS_15890 14396 12483 gene locus_tag LOCUS_15900 gene mtlA 14396 12483 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093247.1 protein_id gnl|my_center|LOCUS_15900 14933 15295 gene locus_tag LOCUS_15910 14933 15295 CDS product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479624.1 protein_id gnl|my_center|LOCUS_15910 15298 16434 gene locus_tag LOCUS_15920 15298 16434 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364939.1 protein_id gnl|my_center|LOCUS_15920 17332 16997 gene locus_tag LOCUS_15930 17332 16997 CDS product Imm57 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326561.1 protein_id gnl|my_center|LOCUS_15930 17714 17421 gene locus_tag LOCUS_15940 17714 17421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 18410 18039 gene locus_tag LOCUS_15950 18410 18039 CDS product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642478.1 protein_id gnl|my_center|LOCUS_15950 19450 18755 gene locus_tag LOCUS_15960 19450 18755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15960 20340 19498 gene locus_tag LOCUS_15970 20340 19498 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072850.1 protein_id gnl|my_center|LOCUS_15970 <20867 20361 gene locus_tag LOCUS_15980 <20867 20361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000015300.1:RHS element protein RhsA >Feature sequence053 1057 398 gene locus_tag LOCUS_15990 gene glnP 1057 398 CDS product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159065.1 protein_id gnl|my_center|LOCUS_15990 1942 1196 gene locus_tag LOCUS_16000 gene glnH 1942 1196 CDS product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843866.1 protein_id gnl|my_center|LOCUS_16000 2849 2346 gene locus_tag LOCUS_16010 gene dps 2849 2346 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100800.1 protein_id gnl|my_center|LOCUS_16010 4035 3148 gene locus_tag LOCUS_16020 gene rhtA 4035 3148 CDS product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295297.1 protein_id gnl|my_center|LOCUS_16020 4388 4903 gene locus_tag LOCUS_16030 gene ompX 4388 4903 CDS product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295296.1 protein_id gnl|my_center|LOCUS_16030 6535 4952 gene locus_tag LOCUS_16040 gene opgE 6535 4952 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054678.1 protein_id gnl|my_center|LOCUS_16040 6935 6807 gene locus_tag LOCUS_16050 gene mntS 6935 6807 CDS product manganase accumulation protein MntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001761.1 protein_id gnl|my_center|LOCUS_16050 7121 7588 gene locus_tag LOCUS_16060 gene mntR 7121 7588 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091016.1 protein_id gnl|my_center|LOCUS_16060 7585 8703 gene locus_tag LOCUS_16070 7585 8703 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056457.1 protein_id gnl|my_center|LOCUS_16070 9682 8762 gene locus_tag LOCUS_16080 gene ldtB 9682 8762 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056384.1 protein_id gnl|my_center|LOCUS_16080 9901 11493 gene locus_tag LOCUS_16090 9901 11493 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961458.1 protein_id gnl|my_center|LOCUS_16090 12999 11734 gene locus_tag LOCUS_16100 12999 11734 CDS product DUF1479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168797.1 protein_id gnl|my_center|LOCUS_16100 13966 13151 gene locus_tag LOCUS_16110 gene ybiV 13966 13151 CDS product sugar-phosphatase YbiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114272.1 protein_id gnl|my_center|LOCUS_16110 16544 14112 gene locus_tag LOCUS_16120 16544 14112 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209309.1 protein_id gnl|my_center|LOCUS_16120 17449 16550 gene locus_tag LOCUS_16130 17449 16550 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295295.1 protein_id gnl|my_center|LOCUS_16130 17580 18242 gene locus_tag LOCUS_16140 gene fsa 17580 18242 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336208.1 protein_id gnl|my_center|LOCUS_16140 19067 18318 gene locus_tag LOCUS_16150 gene moeB 19067 18318 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829217.1 protein_id gnl|my_center|LOCUS_16150 20302 19067 gene locus_tag LOCUS_16160 gene moeA 20302 19067 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397340.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence054 436 2190 gene locus_tag LOCUS_16170 436 2190 CDS product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784470.1 protein_id gnl|my_center|LOCUS_16170 3718 2261 gene locus_tag LOCUS_16180 gene lpdA 3718 2261 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102483.1 protein_id gnl|my_center|LOCUS_16180 5902 4010 gene locus_tag LOCUS_16190 gene aceF 5902 4010 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963564.1 protein_id gnl|my_center|LOCUS_16190 8580 5917 gene locus_tag LOCUS_16200 gene aceE 8580 5917 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003820.1 protein_id gnl|my_center|LOCUS_16200 9505 8741 gene locus_tag LOCUS_16210 gene pdhR 9505 8741 CDS product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331776.1 protein_id gnl|my_center|LOCUS_16210 10046 11419 gene locus_tag LOCUS_16220 gene aroP 10046 11419 CDS product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969915.1 protein_id gnl|my_center|LOCUS_16220 12316 11462 gene locus_tag LOCUS_16230 gene ampE 12316 11462 CDS product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172005.1 protein_id gnl|my_center|LOCUS_16230 12864 12313 gene locus_tag LOCUS_16240 gene ampD 12864 12313 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923721.1 protein_id gnl|my_center|LOCUS_16240 12952 13845 gene locus_tag LOCUS_16250 gene nadC 12952 13845 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135174.1 protein_id gnl|my_center|LOCUS_16250 14048 14488 gene locus_tag LOCUS_16260 gene ppdD 14048 14488 CDS product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360904.1 protein_id gnl|my_center|LOCUS_16260 14498 15883 gene locus_tag LOCUS_16270 gene gspE 14498 15883 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025145.1 protein_id gnl|my_center|LOCUS_16270 15873 17075 gene locus_tag LOCUS_16280 gene hofC 15873 17075 CDS product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157266.1 protein_id gnl|my_center|LOCUS_16280 18153 17110 gene locus_tag LOCUS_16290 gene guaC 18153 17110 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217338.1 protein_id gnl|my_center|LOCUS_16290 18378 18998 gene locus_tag LOCUS_16300 gene coaE 18378 18998 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269520.1 protein_id gnl|my_center|LOCUS_16300 18998 19741 gene locus_tag LOCUS_16310 gene zapD 18998 19741 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194734.1 protein_id gnl|my_center|LOCUS_16310 19751 19948 gene locus_tag LOCUS_16320 gene yacG 19751 19948 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005042.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence055 276 1667 gene locus_tag LOCUS_16330 gene uhpT 276 1667 CDS product hexose-6-phosphate:phosphate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879194.1 protein_id gnl|my_center|LOCUS_16330 3479 1713 gene locus_tag LOCUS_16340 gene adeD 3479 1713 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065718.1 protein_id gnl|my_center|LOCUS_16340 3654 4988 gene locus_tag LOCUS_16350 gene adeQ 3654 4988 CDS product adenine permease AdeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001403836.1 protein_id gnl|my_center|LOCUS_16350 5041 5493 gene locus_tag LOCUS_16360 5041 5493 CDS product DUF1198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295241.1 protein_id gnl|my_center|LOCUS_16360 5704 6894 gene locus_tag LOCUS_16370 gene nepI 5704 6894 CDS product purine ribonucleoside efflux pump NepI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288549.1 protein_id gnl|my_center|LOCUS_16370 7228 6935 gene locus_tag LOCUS_16380 gene yicS 7228 6935 CDS product protein YicS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805509.1 protein_id gnl|my_center|LOCUS_16380 7450 8268 gene locus_tag LOCUS_16390 gene nlpA 7450 8268 CDS product lipoprotein NlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779426.1 protein_id gnl|my_center|LOCUS_16390 9195 8272 gene locus_tag LOCUS_16400 9195 8272 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535961.1 protein_id gnl|my_center|LOCUS_16400 10490 9306 gene locus_tag LOCUS_16410 10490 9306 CDS product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172878.1 protein_id gnl|my_center|LOCUS_16410 11221 11127 gene locus_tag LOCUS_t00180 11221 11127 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 11514 12896 gene locus_tag LOCUS_16420 11514 12896 CDS product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834439.1 protein_id gnl|my_center|LOCUS_16420 12906 15224 gene locus_tag LOCUS_16430 gene yicI 12906 15224 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702898.1 protein_id gnl|my_center|LOCUS_16430 16986 15277 gene locus_tag LOCUS_16440 16986 15277 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300954.1 protein_id gnl|my_center|LOCUS_16440 18498 17107 gene locus_tag LOCUS_16450 gene xanP 18498 17107 CDS product xanthine/proton symporter XanP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295238.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence056 3024 1351 gene locus_tag LOCUS_16460 gene mdtO 3024 1351 CDS product multidrug efflux transporter permease subunit MdtO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275207.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16460 4437 3406 gene locus_tag LOCUS_16470 gene mdtN 4437 3406 CDS product multidrug efflux transporter periplasmic adaptor subunit MdtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446378.1 protein_id gnl|my_center|LOCUS_16470 4731 4456 gene locus_tag LOCUS_16480 4731 4456 CDS product YtcA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295389.1 protein_id gnl|my_center|LOCUS_16480 6925 4940 gene locus_tag LOCUS_16490 gene yjcS 6925 4940 CDS product alkyl sulfatase YjcS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066019.1 protein_id gnl|my_center|LOCUS_16490 8127 7198 gene locus_tag LOCUS_16500 gene alsK 8127 7198 CDS product allose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171687.1 protein_id gnl|my_center|LOCUS_16500 8806 8111 gene locus_tag LOCUS_16510 gene alsE 8806 8111 CDS product D-allulose-6-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311314.1 protein_id gnl|my_center|LOCUS_16510 9797 8817 gene locus_tag LOCUS_16520 gene alsC 9797 8817 CDS product D-allose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000507106.1 protein_id gnl|my_center|LOCUS_16520 11308 9776 gene locus_tag LOCUS_16530 gene alsA 11308 9776 CDS product D-allose ABC transporter ATP-binding protein AlsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235257.1 protein_id gnl|my_center|LOCUS_16530 12370 11435 gene locus_tag LOCUS_16540 gene alsB 12370 11435 CDS product D-allose transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046187.1 protein_id gnl|my_center|LOCUS_16540 13319 12429 gene locus_tag LOCUS_16550 gene alsR 13319 12429 CDS product als operon DNA-binding transcriptional repressor AlsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083216.1 protein_id gnl|my_center|LOCUS_16550 13678 14127 gene locus_tag LOCUS_16560 gene rpiB 13678 14127 CDS product bifunctional allose-6-phosphate isomerase/ribose-5-phosphate isomerase RpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716794.1 protein_id gnl|my_center|LOCUS_16560 14196 14525 gene locus_tag LOCUS_16570 14196 14525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 15430 14672 gene locus_tag LOCUS_16580 gene phnP 15430 14672 CDS product phosphonate metabolism protein PhnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059908.1 protein_id gnl|my_center|LOCUS_16580 15866 15432 gene locus_tag LOCUS_16590 gene phnO 15866 15432 CDS product aminoalkylphosphonate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110490.1 protein_id gnl|my_center|LOCUS_16590 16410 15853 gene locus_tag LOCUS_16600 gene phnN 16410 15853 CDS product ribose 1,5-bisphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971886.1 protein_id gnl|my_center|LOCUS_16600 17546 16410 gene locus_tag LOCUS_16610 gene phnM 17546 16410 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586325.1 protein_id gnl|my_center|LOCUS_16610 18223 17543 gene locus_tag LOCUS_16620 gene phnL 18223 17543 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611405.1 protein_id gnl|my_center|LOCUS_16620 19092 18334 gene locus_tag LOCUS_16630 gene phnK 19092 18334 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075514.1 protein_id gnl|my_center|LOCUS_16630 <19687 19089 gene locus_tag LOCUS_16640 <19687 19089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000002303.1:alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ >Feature sequence057 202 1071 gene locus_tag LOCUS_16650 202 1071 CDS product YjeJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008040.1 protein_id gnl|my_center|LOCUS_16650 1627 1274 gene locus_tag LOCUS_16660 1627 1274 CDS product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558209.1 protein_id gnl|my_center|LOCUS_16660 3411 1765 gene locus_tag LOCUS_16670 gene groL 3411 1765 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729117.1 protein_id gnl|my_center|LOCUS_16670 3748 3455 gene locus_tag LOCUS_16680 3748 3455 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026276.1 protein_id gnl|my_center|LOCUS_16680 4024 4827 gene locus_tag LOCUS_16690 4024 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16690 4840 5280 gene locus_tag LOCUS_16700 4840 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16700 5772 5296 gene locus_tag LOCUS_16710 gene fxsA 5772 5296 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267448.1 protein_id gnl|my_center|LOCUS_16710 6109 7545 gene locus_tag LOCUS_16720 gene aspA 6109 7545 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069437.1 protein_id gnl|my_center|LOCUS_16720 7663 8964 gene locus_tag LOCUS_16730 gene dcuA 7663 8964 CDS product anaerobic C4-dicarboxylate transporter DcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961959.1 protein_id gnl|my_center|LOCUS_16730 9080 9418 gene locus_tag LOCUS_16740 gene cutA 9080 9418 CDS product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883400.1 protein_id gnl|my_center|LOCUS_16740 9394 11091 gene locus_tag LOCUS_16750 gene dsbD 9394 11091 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068922.1 protein_id gnl|my_center|LOCUS_16750 11128 11703 gene locus_tag LOCUS_16760 11128 11703 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188520.1 protein_id gnl|my_center|LOCUS_16760 11810 11885 gene locus_tag LOCUS_t00190 11810 11885 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 12502 14040 gene locus_tag LOCUS_16770 gene cadC 12502 14040 CDS product lysine decarboxylation/transport transcriptional activator CadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187173.1 protein_id gnl|my_center|LOCUS_16770 14405 15739 gene locus_tag LOCUS_16780 gene cadB 14405 15739 CDS product cadaverine/lysine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092909.1 protein_id gnl|my_center|LOCUS_16780 15819 17966 gene locus_tag LOCUS_16790 gene cadA 15819 17966 CDS product lysine decarboxylase CadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295383.1 protein_id gnl|my_center|LOCUS_16790 18025 19482 gene locus_tag LOCUS_16800 gene dtpC 18025 19482 CDS product dipeptide/tripeptide permease DtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856829.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence058 2134 1334 gene locus_tag LOCUS_16810 gene ydcF 2134 1334 CDS product DUF218 domain-containing protein YdcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027942.1 protein_id gnl|my_center|LOCUS_16810 4304 2406 gene locus_tag LOCUS_16820 4304 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16820 6325 4304 gene locus_tag LOCUS_16830 6325 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16830 6526 7131 gene locus_tag LOCUS_16840 gene azoR 6526 7131 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048950.1 protein_id gnl|my_center|LOCUS_16840 8453 7185 gene locus_tag LOCUS_16850 8453 7185 CDS product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001375099.1 protein_id gnl|my_center|LOCUS_16850 10077 8491 gene locus_tag LOCUS_16860 10077 8491 CDS product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431845.1 protein_id gnl|my_center|LOCUS_16860 11160 10264 gene locus_tag LOCUS_16870 11160 10264 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890941.1 protein_id gnl|my_center|LOCUS_16870 11627 11160 gene locus_tag LOCUS_16880 11627 11160 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177515.1 protein_id gnl|my_center|LOCUS_16880 14242 11936 gene locus_tag LOCUS_16890 14242 11936 CDS product DUF2773 domain-containing bactofilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910026.1 protein_id gnl|my_center|LOCUS_16890 15165 14305 gene locus_tag LOCUS_16900 gene pdxI 15165 14305 CDS product pyridoxine 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097801.1 protein_id gnl|my_center|LOCUS_16900 18696 15373 gene locus_tag LOCUS_16910 18696 15373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence059 322 1050 gene locus_tag LOCUS_16920 gene mtgA 322 1050 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047091.1 protein_id gnl|my_center|LOCUS_16920 1679 1047 gene locus_tag LOCUS_16930 gene yrbL 1679 1047 CDS product PhoP regulatory network protein YrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620405.1 protein_id gnl|my_center|LOCUS_16930 2165 1893 gene locus_tag LOCUS_16940 gene npr 2165 1893 CDS product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216791.1 protein_id gnl|my_center|LOCUS_16940 3016 2162 gene locus_tag LOCUS_16950 gene rapZ 3016 2162 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243741.1 protein_id gnl|my_center|LOCUS_16950 3553 3062 gene locus_tag LOCUS_16960 gene ptsN 3553 3062 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183676.1 protein_id gnl|my_center|LOCUS_16960 3958 3671 gene locus_tag LOCUS_16970 gene hpf 3958 3671 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176599.1 protein_id gnl|my_center|LOCUS_16970 5414 3981 gene locus_tag LOCUS_16980 gene rpoN 5414 3981 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809057.1 protein_id gnl|my_center|LOCUS_16980 6187 5462 gene locus_tag LOCUS_16990 gene lptB 6187 5462 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224099.1 protein_id gnl|my_center|LOCUS_16990 6751 6194 gene locus_tag LOCUS_17000 gene lptA 6751 6194 CDS product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669785.1 protein_id gnl|my_center|LOCUS_17000 7295 6720 gene locus_tag LOCUS_17010 gene lptC 7295 6720 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030537.1 protein_id gnl|my_center|LOCUS_17010 7858 7292 gene locus_tag LOCUS_17020 gene kdsC 7858 7292 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030005.1 protein_id gnl|my_center|LOCUS_17020 8865 7879 gene locus_tag LOCUS_17030 gene kdsD 8865 7879 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295557.1 protein_id gnl|my_center|LOCUS_17030 9856 8879 gene locus_tag LOCUS_17040 9856 8879 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922901.1 protein_id gnl|my_center|LOCUS_17040 10066 10875 gene locus_tag LOCUS_17050 gene mlaF 10066 10875 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438245.1 protein_id gnl|my_center|LOCUS_17050 10883 11665 gene locus_tag LOCUS_17060 gene mlaE 10883 11665 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925795.1 protein_id gnl|my_center|LOCUS_17060 11670 12221 gene locus_tag LOCUS_17070 gene mlaD 11670 12221 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296448.1 protein_id gnl|my_center|LOCUS_17070 12240 12875 gene locus_tag LOCUS_17080 gene mlaC 12240 12875 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476487.1 protein_id gnl|my_center|LOCUS_17080 12875 13168 gene locus_tag LOCUS_17090 gene mlaB 12875 13168 CDS product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004488.1 protein_id gnl|my_center|LOCUS_17090 13313 13582 gene locus_tag LOCUS_17100 gene ibaG 13313 13582 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568740.1 protein_id gnl|my_center|LOCUS_17100 13637 14896 gene locus_tag LOCUS_17110 gene murA 13637 14896 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357259.1 protein_id gnl|my_center|LOCUS_17110 15222 14944 gene locus_tag LOCUS_17120 gene sfsB 15222 14944 CDS product DNA-binding transcriptional regulator SfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445413.1 protein_id gnl|my_center|LOCUS_17120 16421 15450 gene locus_tag LOCUS_17130 gene ispB 16421 15450 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047336.1 protein_id gnl|my_center|LOCUS_17130 16680 16991 gene locus_tag LOCUS_17140 gene rplU 16680 16991 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271401.1 protein_id gnl|my_center|LOCUS_17140 17012 17269 gene locus_tag LOCUS_17150 gene rpmA 17012 17269 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940595.1 protein_id gnl|my_center|LOCUS_17150 17396 18361 gene locus_tag LOCUS_17160 17396 18361 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813037.1 protein_id gnl|my_center|LOCUS_17160 >Feature sequence060 750 280 gene locus_tag LOCUS_17170 gene argR 750 280 CDS product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257846.1 protein_id gnl|my_center|LOCUS_17170 1185 2123 gene locus_tag LOCUS_17180 gene mdh 1185 2123 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295272.1 protein_id gnl|my_center|LOCUS_17180 3253 2186 gene locus_tag LOCUS_17190 gene degS 3253 2186 CDS product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497723.1 protein_id gnl|my_center|LOCUS_17190 4710 3343 gene locus_tag LOCUS_17200 gene degQ 4710 3343 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295271.1 protein_id gnl|my_center|LOCUS_17200 5268 4864 gene locus_tag LOCUS_17210 gene zapG 5268 4864 CDS product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295270.1 protein_id gnl|my_center|LOCUS_17210 5612 6583 gene locus_tag LOCUS_17220 gene zapE 5612 6583 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192332.1 protein_id gnl|my_center|LOCUS_17220 6802 7230 gene locus_tag LOCUS_17230 gene rplM 6802 7230 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 protein_id gnl|my_center|LOCUS_17230 7246 7638 gene locus_tag LOCUS_17240 gene rpsI 7246 7638 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 protein_id gnl|my_center|LOCUS_17240 8033 8671 gene locus_tag LOCUS_17250 gene sspA 8033 8671 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257293.1 protein_id gnl|my_center|LOCUS_17250 8677 9174 gene locus_tag LOCUS_17260 gene sspB 8677 9174 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366129.1 protein_id gnl|my_center|LOCUS_17260 10584 9217 gene locus_tag LOCUS_17270 gene dcuC 10584 9217 CDS product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467018.1 protein_id gnl|my_center|LOCUS_17270 10973 11755 gene locus_tag LOCUS_17280 gene nanR 10973 11755 CDS product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523845.1 protein_id gnl|my_center|LOCUS_17280 11877 12770 gene locus_tag LOCUS_17290 gene nanA 11877 12770 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224714.1 protein_id gnl|my_center|LOCUS_17290 12879 14369 gene locus_tag LOCUS_17300 gene nanT 12879 14369 CDS product sialic acid transporter NanT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108454.1 protein_id gnl|my_center|LOCUS_17300 14417 15106 gene locus_tag LOCUS_17310 14417 15106 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054239.1 protein_id gnl|my_center|LOCUS_17310 15103 15978 gene locus_tag LOCUS_17320 gene nanK 15103 15978 CDS product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209011.1 protein_id gnl|my_center|LOCUS_17320 15975 16439 gene locus_tag LOCUS_17330 gene nanQ 15975 16439 CDS product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979882.1 protein_id gnl|my_center|LOCUS_17330 17047 16499 gene locus_tag LOCUS_17340 17047 16499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 18527 17811 gene locus_tag LOCUS_17350 18527 17811 CDS product DUF1120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067008.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence061 141 371 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 415 1149 gene locus_tag LOCUS_17360 gene cysH 415 1149 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039850.1 protein_id gnl|my_center|LOCUS_17360 1508 4174 gene locus_tag LOCUS_17370 gene cas3 1508 4174 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433152.1 protein_id gnl|my_center|LOCUS_17370 4589 6097 gene locus_tag LOCUS_17380 gene casA 4589 6097 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050401.1 protein_id gnl|my_center|LOCUS_17380 6090 6572 gene locus_tag LOCUS_17390 gene casB 6090 6572 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752800.1 protein_id gnl|my_center|LOCUS_17390 6585 7676 gene locus_tag LOCUS_17400 gene cas7e 6585 7676 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064450.1 protein_id gnl|my_center|LOCUS_17400 8955 9872 gene locus_tag LOCUS_17410 gene cas1e 8955 9872 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220066.1 protein_id gnl|my_center|LOCUS_17410 9874 10158 gene locus_tag LOCUS_17420 gene cas2e 9874 10158 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001381369.1 protein_id gnl|my_center|LOCUS_17420 10264 10965 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gagttccccgcgccagcggggataaaccg 12085 11048 gene locus_tag LOCUS_17430 gene iap 12085 11048 CDS product alkaline phosphatase isozyme conversion aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490428.1 protein_id gnl|my_center|LOCUS_17430 12337 13245 gene locus_tag LOCUS_17440 gene cysD 12337 13245 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372108.1 protein_id gnl|my_center|LOCUS_17440 13247 14674 gene locus_tag LOCUS_17450 gene cysN 13247 14674 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090361.1 protein_id gnl|my_center|LOCUS_17450 14674 15279 gene locus_tag LOCUS_17460 gene cysC 14674 15279 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173673.1 protein_id gnl|my_center|LOCUS_17460 15329 15652 gene locus_tag LOCUS_17470 15329 15652 CDS product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246104.1 protein_id gnl|my_center|LOCUS_17470 15637 15858 gene locus_tag LOCUS_17480 15637 15858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 15846 16157 gene locus_tag LOCUS_17490 gene ftsB 15846 16157 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517476.1 protein_id gnl|my_center|LOCUS_17490 16176 16886 gene locus_tag LOCUS_17500 gene ispD 16176 16886 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246138.1 protein_id gnl|my_center|LOCUS_17500 16886 17365 gene locus_tag LOCUS_17510 gene ispF 16886 17365 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219242.1 protein_id gnl|my_center|LOCUS_17510 17362 18411 gene locus_tag LOCUS_17520 gene truD 17362 18411 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568943.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence062 1869 907 gene locus_tag LOCUS_17530 gene ybiB 1869 907 CDS product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386551.1 protein_id gnl|my_center|LOCUS_17530 4047 1897 gene locus_tag LOCUS_17540 gene dinG 4047 1897 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340191.1 protein_id gnl|my_center|LOCUS_17540 4200 4649 gene locus_tag LOCUS_17550 gene ybiA 4200 4649 CDS product N-glycosidase YbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145126.1 protein_id gnl|my_center|LOCUS_17550 5756 4881 gene locus_tag LOCUS_17560 5756 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17560 6261 5671 gene locus_tag LOCUS_17570 6261 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17570 5764 5780 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6490 7161 gene locus_tag LOCUS_17580 gene cecR 6490 7161 CDS product DNA-binding transcriptional regulator CecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340357.1 protein_id gnl|my_center|LOCUS_17580 7161 8159 gene locus_tag LOCUS_17590 gene hlyD 7161 8159 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976409.1 protein_id gnl|my_center|LOCUS_17590 8152 9888 gene locus_tag LOCUS_17600 8152 9888 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996107.1 protein_id gnl|my_center|LOCUS_17600 9881 11014 gene locus_tag LOCUS_17610 9881 11014 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070131.1 protein_id gnl|my_center|LOCUS_17610 11039 12169 gene locus_tag LOCUS_17620 11039 12169 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469031.1 protein_id gnl|my_center|LOCUS_17620 11069 11103 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12541 12131 gene locus_tag LOCUS_17630 12541 12131 CDS product YbhQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871982.1 protein_id gnl|my_center|LOCUS_17630 12674 13435 gene locus_tag LOCUS_17640 12674 13435 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113348.1 protein_id gnl|my_center|LOCUS_17640 13432 14673 gene locus_tag LOCUS_17650 gene clsB 13432 14673 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650337.1 protein_id gnl|my_center|LOCUS_17650 14673 15629 gene locus_tag LOCUS_17660 14673 15629 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045450.1 protein_id gnl|my_center|LOCUS_17660 16103 16162 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17349 16624 gene locus_tag LOCUS_17670 17349 16624 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373624.1 protein_id gnl|my_center|LOCUS_17670 17938 17486 gene locus_tag LOCUS_17680 gene moaE 17938 17486 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852296.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence063 50 850 gene locus_tag LOCUS_17690 gene tcyJ 50 850 CDS product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317901.1 protein_id gnl|my_center|LOCUS_17690 955 1941 gene locus_tag LOCUS_17700 gene dcyD 955 1941 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128215.1 protein_id gnl|my_center|LOCUS_17700 1956 2624 gene locus_tag LOCUS_17710 gene tcyL 1956 2624 CDS product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158220.1 protein_id gnl|my_center|LOCUS_17710 2621 3373 gene locus_tag LOCUS_17720 gene yecC 2621 3373 CDS product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272991.1 protein_id gnl|my_center|LOCUS_17720 3603 4325 gene locus_tag LOCUS_17730 gene sdiA 3603 4325 CDS product transcriptional regulator SdiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152715.1 protein_id gnl|my_center|LOCUS_17730 4617 4393 gene locus_tag LOCUS_17740 gene yecF 4617 4393 CDS product DUF2594 family protein YecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106474.1 protein_id gnl|my_center|LOCUS_17740 5076 5732 gene locus_tag LOCUS_17750 gene uvrY 5076 5732 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611335.1 protein_id gnl|my_center|LOCUS_17750 5795 7561 gene locus_tag LOCUS_17760 gene uvrC 5795 7561 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283421.1 protein_id gnl|my_center|LOCUS_17760 7618 8166 gene locus_tag LOCUS_17770 gene pgsA 7618 8166 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160187.1 protein_id gnl|my_center|LOCUS_17770 8318 8393 gene locus_tag LOCUS_t00200 8318 8393 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8448 8521 gene locus_tag LOCUS_t00210 8448 8521 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 8534 8620 gene locus_tag LOCUS_t00220 8534 8620 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8816 9481 gene locus_tag LOCUS_17780 gene yecA 8816 9481 CDS product UPF0149 family protein YecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847902.1 protein_id gnl|my_center|LOCUS_17780 10754 9543 gene locus_tag LOCUS_17790 gene tyrP 10754 9543 CDS product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797560.1 protein_id gnl|my_center|LOCUS_17790 10945 11184 gene locus_tag LOCUS_17800 10945 11184 CDS product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377225.1 protein_id gnl|my_center|LOCUS_17800 11719 11222 gene locus_tag LOCUS_17810 gene ftnA 11719 11222 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917208.1 protein_id gnl|my_center|LOCUS_17810 12677 12928 gene locus_tag LOCUS_17820 gene yecJ 12677 12928 CDS product DUF2766 family protein YecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082127.1 protein_id gnl|my_center|LOCUS_17820 13510 13007 gene locus_tag LOCUS_17830 13510 13007 CDS product non-heme ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179469.1 protein_id gnl|my_center|LOCUS_17830 14307 15296 gene locus_tag LOCUS_17840 gene araF 14307 15296 CDS product arabinose ABC transporter substrate-binding protein AraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548675.1 protein_id gnl|my_center|LOCUS_17840 15366 16880 gene locus_tag LOCUS_17850 gene araG 15366 16880 CDS product arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187819.1 protein_id gnl|my_center|LOCUS_17850 16895 17881 gene locus_tag LOCUS_17860 gene araH 16895 17881 CDS product arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100205.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence064 1560 730 gene locus_tag LOCUS_17870 gene frlC 1560 730 CDS product fructoselysine 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847837.1 protein_id gnl|my_center|LOCUS_17870 2632 1610 gene locus_tag LOCUS_17880 gene frlB 2632 1610 CDS product fructoselysine 6-phosphate deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295163.1 protein_id gnl|my_center|LOCUS_17880 4041 2653 gene locus_tag LOCUS_17890 gene frlA 4041 2653 CDS product fructoselysine/psicoselysine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535505.1 protein_id gnl|my_center|LOCUS_17890 4452 4285 gene locus_tag LOCUS_17900 4452 4285 CDS product YhfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031834.1 protein_id gnl|my_center|LOCUS_17900 6072 4699 gene locus_tag LOCUS_17910 gene cysG 6072 4699 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349855.1 protein_id gnl|my_center|LOCUS_17910 6897 6091 gene locus_tag LOCUS_17920 gene nirC 6897 6091 CDS product nitrite transporter NirC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493556.1 protein_id gnl|my_center|LOCUS_17920 7349 7023 gene locus_tag LOCUS_17930 gene nirD 7349 7023 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084764.1 protein_id gnl|my_center|LOCUS_17930 9889 7346 gene locus_tag LOCUS_17940 gene nirB 9889 7346 CDS product NADPH-nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049208.1 protein_id gnl|my_center|LOCUS_17940 11332 10151 gene locus_tag LOCUS_17950 gene tsgA 11332 10151 CDS product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185247.1 protein_id gnl|my_center|LOCUS_17950 11603 12175 gene locus_tag LOCUS_17960 gene ppiA 11603 12175 CDS product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477225.1 protein_id gnl|my_center|LOCUS_17960 12280 12447 gene locus_tag LOCUS_17970 12280 12447 CDS product YhfG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736862.1 protein_id gnl|my_center|LOCUS_17970 12437 13039 gene locus_tag LOCUS_17980 12437 13039 CDS product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280641.1 protein_id gnl|my_center|LOCUS_17980 13071 13634 gene locus_tag LOCUS_17990 gene pabA 13071 13634 CDS product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601847.1 protein_id gnl|my_center|LOCUS_17990 13720 14940 gene locus_tag LOCUS_18000 gene argD 13720 14940 CDS product bifunctional acetylornithine/succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963792.1 protein_id gnl|my_center|LOCUS_18000 17010 15007 gene locus_tag LOCUS_18010 17010 15007 CDS product YccS/YhfK family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484349.1 protein_id gnl|my_center|LOCUS_18010 17780 17148 gene locus_tag LOCUS_18020 gene crp 17780 17148 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242755.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence065 1850 3499 gene locus_tag LOCUS_18030 gene pgi 1850 3499 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789986.1 protein_id gnl|my_center|LOCUS_18030 3530 3608 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4075 4317 gene locus_tag LOCUS_18040 4075 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 4431 5069 gene locus_tag LOCUS_18050 4431 5069 CDS product YjbF family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295278.1 protein_id gnl|my_center|LOCUS_18050 5066 5803 gene locus_tag LOCUS_18060 5066 5803 CDS product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595558.1 protein_id gnl|my_center|LOCUS_18060 5803 7899 gene locus_tag LOCUS_18070 5803 7899 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745776.1 protein_id gnl|my_center|LOCUS_18070 8494 8904 gene locus_tag LOCUS_18080 gene psiE 8494 8904 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202902.1 protein_id gnl|my_center|LOCUS_18080 10423 8948 gene locus_tag LOCUS_18090 gene xylE 10423 8948 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097274.1 protein_id gnl|my_center|LOCUS_18090 11685 10795 gene locus_tag LOCUS_18100 gene malG 11685 10795 CDS product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252058.1 protein_id gnl|my_center|LOCUS_18100 13244 11700 gene locus_tag LOCUS_18110 gene malF 13244 11700 CDS product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297290.1 protein_id gnl|my_center|LOCUS_18110 14588 13398 gene locus_tag LOCUS_18120 gene malE 14588 13398 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695387.1 protein_id gnl|my_center|LOCUS_18120 14953 16068 gene locus_tag LOCUS_18130 gene malK 14953 16068 CDS product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179165.1 protein_id gnl|my_center|LOCUS_18130 16140 17480 gene locus_tag LOCUS_18140 gene lamB 16140 17480 CDS product maltoporin LamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973663.1 protein_id gnl|my_center|LOCUS_18140 17606 17643 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence066 1850 948 gene locus_tag LOCUS_18150 gene dppC 1850 948 CDS product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084677.1 protein_id gnl|my_center|LOCUS_18150 2879 1860 gene locus_tag LOCUS_18160 gene dppB 2879 1860 CDS product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938855.1 protein_id gnl|my_center|LOCUS_18160 4794 3187 gene locus_tag LOCUS_18170 gene dppA 4794 3187 CDS product dipeptide ABC transporter substrate-binding protein DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222883.1 protein_id gnl|my_center|LOCUS_18170 5613 5537 gene locus_tag LOCUS_t00230 5613 5537 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7354 5705 gene locus_tag LOCUS_18180 gene eptB 7354 5705 CDS product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269197.1 protein_id gnl|my_center|LOCUS_18180 8928 7720 gene locus_tag LOCUS_18190 8928 7720 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189019.1 protein_id gnl|my_center|LOCUS_18190 9855 9157 gene locus_tag LOCUS_18200 9855 9157 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299523.1 protein_id gnl|my_center|LOCUS_18200 10013 10576 gene locus_tag LOCUS_18210 gene tag 10013 10576 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438957.1 protein_id gnl|my_center|LOCUS_18210 10573 11013 gene locus_tag LOCUS_18220 10573 11013 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617473.1 protein_id gnl|my_center|LOCUS_18220 13261 10982 gene locus_tag LOCUS_18230 gene bisC 13261 10982 CDS product biotin sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013950.1 protein_id gnl|my_center|LOCUS_18230 13468 14127 gene locus_tag LOCUS_18240 13468 14127 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747625.1 protein_id gnl|my_center|LOCUS_18240 14231 15205 gene locus_tag LOCUS_18250 gene ghrB 14231 15205 CDS product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805038.1 protein_id gnl|my_center|LOCUS_18250 15965 15255 gene locus_tag LOCUS_18260 15965 15255 CDS product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602794.1 protein_id gnl|my_center|LOCUS_18260 16399 16689 gene locus_tag LOCUS_18270 16399 16689 CDS product HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455798.1 protein_id gnl|my_center|LOCUS_18270 16970 17182 gene locus_tag LOCUS_18280 gene cspA 16970 17182 CDS product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014594.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence067 59 499 gene locus_tag LOCUS_18290 gene hofO 59 499 CDS product DNA utilization protein HofO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055759.1 protein_id gnl|my_center|LOCUS_18290 489 893 gene locus_tag LOCUS_18300 gene hofP 489 893 CDS product DNA utilization protein HofP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264141.1 protein_id gnl|my_center|LOCUS_18300 805 2043 gene locus_tag LOCUS_18310 gene hofQ 805 2043 CDS product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815987.1 protein_id gnl|my_center|LOCUS_18310 2444 2965 gene locus_tag LOCUS_18320 2444 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 3022 4110 gene locus_tag LOCUS_18330 gene aroB 3022 4110 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439848.1 protein_id gnl|my_center|LOCUS_18330 4202 5488 gene locus_tag LOCUS_18340 gene damX 4202 5488 CDS product cell division protein DamX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343215.1 protein_id gnl|my_center|LOCUS_18340 5715 6431 gene locus_tag LOCUS_18350 gene dam 5715 6431 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742143.1 protein_id gnl|my_center|LOCUS_18350 6449 7126 gene locus_tag LOCUS_18360 gene rpe 6449 7126 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816280.1 protein_id gnl|my_center|LOCUS_18360 7119 7877 gene locus_tag LOCUS_18370 gene gph 7119 7877 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031729.1 protein_id gnl|my_center|LOCUS_18370 7870 8874 gene locus_tag LOCUS_18380 gene trpS 7870 8874 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165552.1 protein_id gnl|my_center|LOCUS_18380 8914 8949 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9124 10029 gene locus_tag LOCUS_18390 gene yhfZ 9124 10029 CDS product GntR family transcriptional regulator YhfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254790.1 protein_id gnl|my_center|LOCUS_18390 10046 10408 gene locus_tag LOCUS_18400 10046 10408 CDS product PRD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295165.1 protein_id gnl|my_center|LOCUS_18400 10492 11655 gene locus_tag LOCUS_18410 10492 11655 CDS product YhfX family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497334.1 protein_id gnl|my_center|LOCUS_18410 11655 12881 gene locus_tag LOCUS_18420 11655 12881 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090644.1 protein_id gnl|my_center|LOCUS_18420 12878 13756 gene locus_tag LOCUS_18430 12878 13756 CDS product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007010.1 protein_id gnl|my_center|LOCUS_18430 13767 14120 gene locus_tag LOCUS_18440 13767 14120 CDS product DUF2620 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719728.1 protein_id gnl|my_center|LOCUS_18440 14132 15436 gene locus_tag LOCUS_18450 14132 15436 CDS product YhfT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366857.1 protein_id gnl|my_center|LOCUS_18450 15448 16533 gene locus_tag LOCUS_18460 15448 16533 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847144.1 protein_id gnl|my_center|LOCUS_18460 16588 16613 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17431 16634 gene locus_tag LOCUS_18470 gene frlR 17431 16634 CDS product DNA-binding transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276847.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence068 852 247 gene locus_tag LOCUS_18480 gene ubiJ 852 247 CDS product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295259.1 protein_id gnl|my_center|LOCUS_18480 1621 866 gene locus_tag LOCUS_18490 gene ubiE 1621 866 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227958.1 protein_id gnl|my_center|LOCUS_18490 3143 1716 gene locus_tag LOCUS_18500 gene rmuC 3143 1716 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347714.1 protein_id gnl|my_center|LOCUS_18500 4045 3284 gene locus_tag LOCUS_18510 gene udp 4045 3284 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045177.1 protein_id gnl|my_center|LOCUS_18510 4307 5122 gene locus_tag LOCUS_18520 4307 5122 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336442.1 protein_id gnl|my_center|LOCUS_18520 7423 5162 gene locus_tag LOCUS_18530 gene metE 7423 5162 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153907.1 protein_id gnl|my_center|LOCUS_18530 7660 8613 gene locus_tag LOCUS_18540 gene metR 7660 8613 CDS product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573621.1 protein_id gnl|my_center|LOCUS_18540 9400 8501 gene locus_tag LOCUS_18550 gene bioP 9400 8501 CDS product biotin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196238.1 protein_id gnl|my_center|LOCUS_18550 10276 9476 gene locus_tag LOCUS_18560 gene yigL 10276 9476 CDS product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285362.1 protein_id gnl|my_center|LOCUS_18560 11306 10284 gene locus_tag LOCUS_18570 gene pldB 11306 10284 CDS product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487654.1 protein_id gnl|my_center|LOCUS_18570 11417 12037 gene locus_tag LOCUS_18580 gene rhtB 11417 12037 CDS product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171707.1 protein_id gnl|my_center|LOCUS_18580 12719 12099 gene locus_tag LOCUS_18590 gene rhtC 12719 12099 CDS product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928824.1 protein_id gnl|my_center|LOCUS_18590 14618 12783 gene locus_tag LOCUS_18600 gene recQ 14618 12783 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099855.1 protein_id gnl|my_center|LOCUS_18600 15614 14745 gene locus_tag LOCUS_18610 gene pldA 15614 14745 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259700.1 protein_id gnl|my_center|LOCUS_18610 15779 16246 gene locus_tag LOCUS_18620 gene yigI 15779 16246 CDS product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277142.1 protein_id gnl|my_center|LOCUS_18620 16298 17188 gene locus_tag LOCUS_18630 gene rarD 16298 17188 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339104.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence069 33 449 gene locus_tag LOCUS_18640 33 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1028 513 gene locus_tag LOCUS_18650 gene luxS 1028 513 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130211.1 protein_id gnl|my_center|LOCUS_18650 2734 1178 gene locus_tag LOCUS_18660 gene gshA 2734 1178 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611804.1 protein_id gnl|my_center|LOCUS_18660 3235 2807 gene locus_tag LOCUS_18670 3235 2807 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287454.1 protein_id gnl|my_center|LOCUS_18670 3798 3232 gene locus_tag LOCUS_18680 gene yqaB 3798 3232 CDS product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273290.1 protein_id gnl|my_center|LOCUS_18680 4155 4079 gene locus_tag LOCUS_t00240 4155 4079 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4430 4354 gene locus_tag LOCUS_t00250 4430 4354 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4569 4493 gene locus_tag LOCUS_t00260 4569 4493 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4753 4824 gene locus_tag LOCUS_t00270 4753 4824 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4844 4768 gene locus_tag LOCUS_t00280 4844 4768 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4940 4848 gene locus_tag LOCUS_t00290 4940 4848 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5441 5256 gene locus_tag LOCUS_18690 gene csrA 5441 5256 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 protein_id gnl|my_center|LOCUS_18690 8306 5676 gene locus_tag LOCUS_18700 gene alaS 8306 5676 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047184.1 protein_id gnl|my_center|LOCUS_18700 8934 8434 gene locus_tag LOCUS_18710 gene recX 8934 8434 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140508.1 protein_id gnl|my_center|LOCUS_18710 10064 9003 gene locus_tag LOCUS_18720 gene recA 10064 9003 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963143.1 protein_id gnl|my_center|LOCUS_18720 10641 10144 gene locus_tag LOCUS_18730 gene pncC 10641 10144 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 protein_id gnl|my_center|LOCUS_18730 11871 10786 gene locus_tag LOCUS_18740 gene mltB 11871 10786 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295177.1 protein_id gnl|my_center|LOCUS_18740 12127 12690 gene locus_tag LOCUS_18750 gene srlA 12127 12690 CDS product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573321.1 protein_id gnl|my_center|LOCUS_18750 12687 13646 gene locus_tag LOCUS_18760 gene srlE 12687 13646 CDS product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148878.1 protein_id gnl|my_center|LOCUS_18760 13657 14028 gene locus_tag LOCUS_18770 gene srlB 13657 14028 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216194.1 protein_id gnl|my_center|LOCUS_18770 14032 14811 gene locus_tag LOCUS_18780 gene srlD 14032 14811 CDS product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077358.1 protein_id gnl|my_center|LOCUS_18780 14916 15275 gene locus_tag LOCUS_18790 gene gutM 14916 15275 CDS product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252908.1 protein_id gnl|my_center|LOCUS_18790 15342 16115 gene locus_tag LOCUS_18800 gene srlR 15342 16115 CDS product glucitol operon DNA-binding transcriptional repressor SrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804550.1 protein_id gnl|my_center|LOCUS_18800 16108 17073 gene locus_tag LOCUS_18810 gene gutQ 16108 17073 CDS product arabinose-5-phosphate isomerase GutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287420.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence070 246 1124 gene locus_tag LOCUS_18820 246 1124 CDS product YjcZ-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169188.1 protein_id gnl|my_center|LOCUS_18820 1388 2890 gene locus_tag LOCUS_18830 gene proP 1388 2890 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298520.1 protein_id gnl|my_center|LOCUS_18830 4167 3067 gene locus_tag LOCUS_18840 gene pmrB 4167 3067 CDS product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300761.1 protein_id gnl|my_center|LOCUS_18840 4836 4168 gene locus_tag LOCUS_18850 gene basR 4836 4168 CDS product two-component system response regulator BasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697926.1 protein_id gnl|my_center|LOCUS_18850 6446 4833 gene locus_tag LOCUS_18860 gene eptA 6446 4833 CDS product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919792.1 protein_id gnl|my_center|LOCUS_18860 7917 6580 gene locus_tag LOCUS_18870 gene adiC 7917 6580 CDS product arginine/agmatine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093154.1 protein_id gnl|my_center|LOCUS_18870 8815 8054 gene locus_tag LOCUS_18880 gene adiY 8815 8054 CDS product DNA-binding transcriptional activator AdiY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217060.1 protein_id gnl|my_center|LOCUS_18880 11410 9140 gene locus_tag LOCUS_18890 gene adiA 11410 9140 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001381593.1 protein_id gnl|my_center|LOCUS_18890 11788 11606 gene locus_tag LOCUS_18900 11788 11606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18900 12514 11804 gene locus_tag LOCUS_18910 gene melR 12514 11804 CDS product transcriptional regulator MelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090758.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18910 12797 14152 gene locus_tag LOCUS_18920 gene melA 12797 14152 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986601.1 protein_id gnl|my_center|LOCUS_18920 14267 15676 gene locus_tag LOCUS_18930 gene melB 14267 15676 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028111.1 protein_id gnl|my_center|LOCUS_18930 16444 15815 gene locus_tag LOCUS_18940 16444 15815 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198773.1 protein_id gnl|my_center|LOCUS_18940 <17306 16566 gene locus_tag LOCUS_18950 <17306 16566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000066681.1:class I fumarate hydratase >Feature sequence071 590 1879 gene locus_tag LOCUS_18960 gene sdaC 590 1879 CDS product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450476.1 protein_id gnl|my_center|LOCUS_18960 1937 3304 gene locus_tag LOCUS_18970 gene sdaB 1937 3304 CDS product L-serine ammonia-lyase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626422.1 protein_id gnl|my_center|LOCUS_18970 3416 4171 gene locus_tag LOCUS_18980 gene xni 3416 4171 CDS product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268232.1 protein_id gnl|my_center|LOCUS_18980 5374 4226 gene locus_tag LOCUS_18990 gene fucO 5374 4226 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013588.1 protein_id gnl|my_center|LOCUS_18990 6049 5402 gene locus_tag LOCUS_19000 gene fucA 6049 5402 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440781.1 protein_id gnl|my_center|LOCUS_19000 6596 7912 gene locus_tag LOCUS_19010 gene fucP 6596 7912 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528603.1 protein_id gnl|my_center|LOCUS_19010 7945 9720 gene locus_tag LOCUS_19020 gene fucI 7945 9720 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724153.1 protein_id gnl|my_center|LOCUS_19020 9829 11247 gene locus_tag LOCUS_19030 gene fucK 9829 11247 CDS product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808376.1 protein_id gnl|my_center|LOCUS_19030 11249 11671 gene locus_tag LOCUS_19040 gene fucU 11249 11671 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920840.1 protein_id gnl|my_center|LOCUS_19040 11729 12460 gene locus_tag LOCUS_19050 gene fucR 11729 12460 CDS product L-fucose operon activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642344.1 protein_id gnl|my_center|LOCUS_19050 13604 12504 gene locus_tag LOCUS_19060 gene rlmM 13604 12504 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045520.1 protein_id gnl|my_center|LOCUS_19060 13992 13597 gene locus_tag LOCUS_19070 13992 13597 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203905.1 protein_id gnl|my_center|LOCUS_19070 14928 14011 gene locus_tag LOCUS_19080 gene gcvA 14928 14011 CDS product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044401.1 protein_id gnl|my_center|LOCUS_19080 15498 15271 gene locus_tag LOCUS_19090 15498 15271 CDS product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750398.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence072 350 1627 gene locus_tag LOCUS_19100 gene waaA 350 1627 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891564.1 protein_id gnl|my_center|LOCUS_19100 1635 2114 gene locus_tag LOCUS_19110 gene coaD 1635 2114 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171866.1 protein_id gnl|my_center|LOCUS_19110 2962 2153 gene locus_tag LOCUS_19120 gene mutM 2962 2153 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114543.1 protein_id gnl|my_center|LOCUS_19120 3227 3060 gene locus_tag LOCUS_19130 gene rpmG 3227 3060 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051798.1 protein_id gnl|my_center|LOCUS_19130 3484 3248 gene locus_tag LOCUS_19140 gene rpmB 3484 3248 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091955.1 protein_id gnl|my_center|LOCUS_19140 4369 3701 gene locus_tag LOCUS_19150 gene radC 4369 3701 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350561.1 protein_id gnl|my_center|LOCUS_19150 4541 5761 gene locus_tag LOCUS_19160 gene coaBC 4541 5761 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050139.1 protein_id gnl|my_center|LOCUS_19160 5739 6197 gene locus_tag LOCUS_19170 gene dut 5739 6197 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976073.1 protein_id gnl|my_center|LOCUS_19170 6304 6900 gene locus_tag LOCUS_19180 gene slmA 6304 6900 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311223.1 protein_id gnl|my_center|LOCUS_19180 7578 6937 gene locus_tag LOCUS_19190 gene pyrE 7578 6937 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806177.1 protein_id gnl|my_center|LOCUS_19190 8360 7644 gene locus_tag LOCUS_19200 gene rph 8360 7644 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247093.1 protein_id gnl|my_center|LOCUS_19200 8487 9350 gene locus_tag LOCUS_19210 8487 9350 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621340.1 protein_id gnl|my_center|LOCUS_19210 9571 10395 gene locus_tag LOCUS_19220 gene dinD 9571 10395 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350563.1 protein_id gnl|my_center|LOCUS_19220 10685 11302 gene locus_tag LOCUS_19230 10685 11302 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924289.1 protein_id gnl|my_center|LOCUS_19230 12981 11299 gene locus_tag LOCUS_19240 gene ligB 12981 11299 CDS product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870036.1 protein_id gnl|my_center|LOCUS_19240 13239 13862 gene locus_tag LOCUS_19250 gene gmk 13239 13862 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295237.1 protein_id gnl|my_center|LOCUS_19250 13917 14192 gene locus_tag LOCUS_19260 gene rpoZ 13917 14192 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 protein_id gnl|my_center|LOCUS_19260 14211 16325 gene locus_tag LOCUS_19270 gene spoT 14211 16325 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280488.1 protein_id gnl|my_center|LOCUS_19270 >Feature sequence073 3 1010 gene locus_tag LOCUS_19280 gene clpX 3 1010 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130305.1 protein_id gnl|my_center|LOCUS_19280 1198 3552 gene locus_tag LOCUS_19290 gene lon 1198 3552 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295325.1 protein_id gnl|my_center|LOCUS_19290 3761 4033 gene locus_tag LOCUS_19300 gene hupB 3761 4033 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043542.1 protein_id gnl|my_center|LOCUS_19300 4225 6096 gene locus_tag LOCUS_19310 gene ppiD 4225 6096 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969372.1 protein_id gnl|my_center|LOCUS_19310 6247 6618 gene locus_tag LOCUS_19320 6247 6618 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680312.1 protein_id gnl|my_center|LOCUS_19320 6712 7110 gene locus_tag LOCUS_19330 gene fadM 6712 7110 CDS product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194534.1 protein_id gnl|my_center|LOCUS_19330 7857 7162 gene locus_tag LOCUS_19340 gene queC 7857 7162 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817220.1 protein_id gnl|my_center|LOCUS_19340 9385 7922 gene locus_tag LOCUS_19350 9385 7922 CDS product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238234.1 protein_id gnl|my_center|LOCUS_19350 9715 10533 gene locus_tag LOCUS_19360 gene cof 9715 10533 CDS product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336137.1 protein_id gnl|my_center|LOCUS_19360 10686 11144 gene locus_tag LOCUS_19370 gene decR 10686 11144 CDS product DNA-binding transcriptional regulator DecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884589.1 protein_id gnl|my_center|LOCUS_19370 11174 12946 gene locus_tag LOCUS_19380 11174 12946 CDS product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235649.1 protein_id gnl|my_center|LOCUS_19380 12939 14720 gene locus_tag LOCUS_19390 12939 14720 CDS product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256201.1 protein_id gnl|my_center|LOCUS_19390 14901 15239 gene locus_tag LOCUS_19400 gene glnK 14901 15239 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780338.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence074 63 404 gene locus_tag LOCUS_19410 gene ykfI 63 404 CDS product type IV toxin-antitoxin system toxin YkfI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854672.1 protein_id gnl|my_center|LOCUS_19410 861 786 gene locus_tag LOCUS_t00300 861 786 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2229 976 gene locus_tag LOCUS_19420 gene proA 2229 976 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893278.1 protein_id gnl|my_center|LOCUS_19420 3344 2241 gene locus_tag LOCUS_19430 gene proB 3344 2241 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285288.1 protein_id gnl|my_center|LOCUS_19430 3632 4687 gene locus_tag LOCUS_19440 gene phoE 3632 4687 CDS product phosphoporin PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749863.1 protein_id gnl|my_center|LOCUS_19440 5127 4726 gene locus_tag LOCUS_19450 gene crl 5127 4726 CDS product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174689.1 protein_id gnl|my_center|LOCUS_19450 6429 5185 gene locus_tag LOCUS_19460 gene frsA 6429 5185 CDS product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189532.1 protein_id gnl|my_center|LOCUS_19460 6979 6521 gene locus_tag LOCUS_19470 gene gpt 6979 6521 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291990.1 protein_id gnl|my_center|LOCUS_19470 7240 8697 gene locus_tag LOCUS_19480 gene pepD 7240 8697 CDS product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292994.1 protein_id gnl|my_center|LOCUS_19480 9254 8754 gene locus_tag LOCUS_19490 gene prfH 9254 8754 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602135.1 protein_id gnl|my_center|LOCUS_19490 9489 9223 gene locus_tag LOCUS_19500 9489 9223 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295202.1 protein_id gnl|my_center|LOCUS_19500 10169 9795 gene locus_tag LOCUS_19510 10169 9795 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059892.1 protein_id gnl|my_center|LOCUS_19510 10655 10257 gene locus_tag LOCUS_19520 gene yafO 10655 10257 CDS product type II toxin-antitoxin system mRNA interferase toxin YafO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263489.1 protein_id gnl|my_center|LOCUS_19520 10951 10658 gene locus_tag LOCUS_19530 gene yafN 10951 10658 CDS product type I toxin-antitoxin system antitoxin YafN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554758.1 protein_id gnl|my_center|LOCUS_19530 12058 11003 gene locus_tag LOCUS_19540 gene dinB 12058 11003 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226164.1 protein_id gnl|my_center|LOCUS_19540 12899 12129 gene locus_tag LOCUS_19550 gene lafU 12899 12129 CDS product putative lateral flagellar export/assembly protein LafU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207556.1 protein_id gnl|my_center|LOCUS_19550 12859 14598 gene locus_tag LOCUS_19560 12859 14598 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301901.1 protein_id gnl|my_center|LOCUS_19560 14636 14833 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15466 15495 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16134 15508 gene locus_tag LOCUS_19570 16134 15508 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056849.1 protein_id gnl|my_center|LOCUS_19570 16172 16339 gene locus_tag LOCUS_19580 16172 16339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence075 1977 781 gene locus_tag LOCUS_19590 gene hemY 1977 781 CDS product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921791.1 protein_id gnl|my_center|LOCUS_19590 3161 1980 gene locus_tag LOCUS_19600 gene hemX 3161 1980 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138997.1 protein_id gnl|my_center|LOCUS_19600 3923 3183 gene locus_tag LOCUS_19610 gene hemD 3923 3183 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026046.1 protein_id gnl|my_center|LOCUS_19610 4882 3920 gene locus_tag LOCUS_19620 gene hemC 4882 3920 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606154.1 protein_id gnl|my_center|LOCUS_19620 5248 7794 gene locus_tag LOCUS_19630 gene cyaA 5248 7794 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281668.1 protein_id gnl|my_center|LOCUS_19630 8154 7834 gene locus_tag LOCUS_19640 gene cyaY 8154 7834 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999947.1 protein_id gnl|my_center|LOCUS_19640 8617 8820 gene locus_tag LOCUS_19650 8617 8820 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799889.1 protein_id gnl|my_center|LOCUS_19650 8857 9681 gene locus_tag LOCUS_19660 gene dapF 8857 9681 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160654.1 protein_id gnl|my_center|LOCUS_19660 9678 10145 gene locus_tag LOCUS_19670 9678 10145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19670 10194 10385 gene locus_tag LOCUS_19680 10194 10385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19680 10382 11278 gene locus_tag LOCUS_19690 gene xerC 10382 11278 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130691.1 protein_id gnl|my_center|LOCUS_19690 11278 11994 gene locus_tag LOCUS_19700 gene yigB 11278 11994 CDS product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213584.1 protein_id gnl|my_center|LOCUS_19700 12078 14240 gene locus_tag LOCUS_19710 gene uvrD 12078 14240 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383406.1 protein_id gnl|my_center|LOCUS_19710 15151 14387 gene locus_tag LOCUS_19720 15151 14387 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951133.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence076 1456 557 gene locus_tag LOCUS_19730 gene hisG 1456 557 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131782.1 protein_id gnl|my_center|LOCUS_19730 1935 2186 gene locus_tag LOCUS_19740 gene yefM 1935 2186 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259255.1 protein_id gnl|my_center|LOCUS_19740 2183 2437 gene locus_tag LOCUS_19750 gene yoeB 2183 2437 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_19750 2520 3344 gene locus_tag LOCUS_19760 2520 3344 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754737.1 protein_id gnl|my_center|LOCUS_19760 3369 4319 gene locus_tag LOCUS_19770 3369 4319 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803351.1 protein_id gnl|my_center|LOCUS_19770 4586 5944 gene locus_tag LOCUS_19780 gene plaP 4586 5944 CDS product putrescine/proton symporter PlaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019197.1 protein_id gnl|my_center|LOCUS_19780 6123 7181 gene locus_tag LOCUS_19790 gene tsuA 6123 7181 CDS product thiosulfate utilization transporter TsuA/YeeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492339.1 protein_id gnl|my_center|LOCUS_19790 7195 7422 gene locus_tag LOCUS_19800 7195 7422 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234896.1 protein_id gnl|my_center|LOCUS_19800 8892 7465 gene locus_tag LOCUS_19810 gene sbcB 8892 7465 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980589.1 protein_id gnl|my_center|LOCUS_19810 9224 10267 gene locus_tag LOCUS_19820 gene dacD 9224 10267 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830156.1 protein_id gnl|my_center|LOCUS_19820 10386 10859 gene locus_tag LOCUS_19830 gene sbmC 10386 10859 CDS product DNA gyrase inhibitor SbmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105415.1 protein_id gnl|my_center|LOCUS_19830 11057 12115 gene locus_tag LOCUS_19840 11057 12115 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200891.1 protein_id gnl|my_center|LOCUS_19840 12287 12616 gene locus_tag LOCUS_19850 12287 12616 CDS product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450409.1 protein_id gnl|my_center|LOCUS_19850 13708 13514 gene locus_tag LOCUS_19860 13708 13514 CDS product DUF5983 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988600.1 protein_id gnl|my_center|LOCUS_19860 14079 13705 gene locus_tag LOCUS_19870 gene cbtA 14079 13705 CDS product type IV toxin-antitoxin system cytoskeleton-binding toxin CbtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854814.1 protein_id gnl|my_center|LOCUS_19870 14536 14168 gene locus_tag LOCUS_19880 gene cbeA 14536 14168 CDS product type IV toxin-antitoxin system cytoskeleton bundling-enhancing antitoxin CbeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285584.1 protein_id gnl|my_center|LOCUS_19880 14831 14610 gene locus_tag LOCUS_19890 14831 14610 CDS product DUF987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692323.1 protein_id gnl|my_center|LOCUS_19890 15340 14894 gene locus_tag LOCUS_19900 15340 14894 CDS product RadC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187523.1 protein_id gnl|my_center|LOCUS_19900 <16293 15337 gene locus_tag LOCUS_19910 <16293 15337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001350525.1:protein YeeR >Feature sequence077 2888 609 gene locus_tag LOCUS_19920 2888 609 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294387.1 protein_id gnl|my_center|LOCUS_19920 3987 2899 gene locus_tag LOCUS_19930 3987 2899 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350535.1 protein_id gnl|my_center|LOCUS_19930 4611 4294 gene locus_tag LOCUS_19940 gene yehK 4611 4294 CDS product protein YehK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636925.1 protein_id gnl|my_center|LOCUS_19940 8304 4672 gene locus_tag LOCUS_19950 gene yehI 8304 4672 CDS product DUF4132 domain-containing protein YehI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356817.1 protein_id gnl|my_center|LOCUS_19950 9255 8314 gene locus_tag LOCUS_19960 9255 8314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19960 11155 9218 gene locus_tag LOCUS_19970 11155 9218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19970 12091 11267 gene locus_tag LOCUS_19980 12091 11267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19980 14274 12232 gene locus_tag LOCUS_19990 gene metG 14274 12232 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350533.1 protein_id gnl|my_center|LOCUS_19990 14397 15506 gene locus_tag LOCUS_20000 gene apbC 14397 15506 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005448.1 protein_id gnl|my_center|LOCUS_20000 15769 16050 gene locus_tag LOCUS_20010 15769 16050 CDS product YehE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324851.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence078 3146 810 gene locus_tag LOCUS_20020 gene arcB 3146 810 CDS product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809774.1 protein_id gnl|my_center|LOCUS_20020 4204 3242 gene locus_tag LOCUS_20030 4204 3242 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299745.1 protein_id gnl|my_center|LOCUS_20030 4738 9306 gene locus_tag LOCUS_20040 gene gltB 4738 9306 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213702.1 protein_id gnl|my_center|LOCUS_20040 9319 10737 gene locus_tag LOCUS_20050 gene gltD 9319 10737 CDS product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081674.1 protein_id gnl|my_center|LOCUS_20050 11297 12061 gene locus_tag LOCUS_20060 11297 12061 CDS product DUF1120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465371.1 protein_id gnl|my_center|LOCUS_20060 12233 12907 gene locus_tag LOCUS_20070 12233 12907 CDS product fimbria/pilus chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311157.1 protein_id gnl|my_center|LOCUS_20070 12928 15309 gene locus_tag LOCUS_20080 12928 15309 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914994.1 protein_id gnl|my_center|LOCUS_20080 >Feature sequence079 1201 98 gene locus_tag LOCUS_20090 gene gldA 1201 98 CDS product bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374004.1 protein_id gnl|my_center|LOCUS_20090 1874 1212 gene locus_tag LOCUS_20100 gene fsa 1874 1212 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424840.1 protein_id gnl|my_center|LOCUS_20100 4387 1886 gene locus_tag LOCUS_20110 gene ptsP 4387 1886 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174077.1 protein_id gnl|my_center|LOCUS_20110 4696 5775 gene locus_tag LOCUS_20120 4696 5775 CDS product PTS fructose transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004446.1 protein_id gnl|my_center|LOCUS_20120 5790 6110 gene locus_tag LOCUS_20130 5790 6110 CDS product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161265.1 protein_id gnl|my_center|LOCUS_20130 6161 8458 gene locus_tag LOCUS_20140 6161 8458 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184811.1 protein_id gnl|my_center|LOCUS_20140 8424 9302 gene locus_tag LOCUS_20150 8424 9302 CDS product [formate-C-acetyltransferase]-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204105.1 protein_id gnl|my_center|LOCUS_20150 9304 9645 gene locus_tag LOCUS_20160 9304 9645 CDS product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323846.1 protein_id gnl|my_center|LOCUS_20160 10483 9632 gene locus_tag LOCUS_20170 10483 9632 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274636.1 protein_id gnl|my_center|LOCUS_20170 12431 10698 gene locus_tag LOCUS_20180 12431 10698 CDS product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556306.1 protein_id gnl|my_center|LOCUS_20180 15264 12613 gene locus_tag LOCUS_20190 gene ppc 15264 12613 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005586.1 protein_id gnl|my_center|LOCUS_20190 >Feature sequence080 2567 144 gene locus_tag LOCUS_20200 gene plsB 2567 144 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017354.1 protein_id gnl|my_center|LOCUS_20200 2738 3106 gene locus_tag LOCUS_20210 gene dgkA 2738 3106 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002907.1 protein_id gnl|my_center|LOCUS_20210 3216 3824 gene locus_tag LOCUS_20220 gene lexA 3216 3824 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646078.1 protein_id gnl|my_center|LOCUS_20220 3897 5189 gene locus_tag LOCUS_20230 gene dinF 3897 5189 CDS product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134731.1 protein_id gnl|my_center|LOCUS_20230 5305 5514 gene locus_tag LOCUS_20240 5305 5514 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030593.1 protein_id gnl|my_center|LOCUS_20240 6071 5556 gene locus_tag LOCUS_20250 gene zur 6071 5556 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295691.1 protein_id gnl|my_center|LOCUS_20250 6389 6643 gene locus_tag LOCUS_20260 gene yjbL 6389 6643 CDS product protein YjbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912571.1 protein_id gnl|my_center|LOCUS_20260 6667 7374 gene locus_tag LOCUS_20270 6667 7374 CDS product DUF2713 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311303.1 protein_id gnl|my_center|LOCUS_20270 7833 8774 gene locus_tag LOCUS_20280 gene dusA 7833 8774 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298868.1 protein_id gnl|my_center|LOCUS_20280 8908 9150 gene locus_tag LOCUS_20290 gene pspG 8908 9150 CDS product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891404.1 protein_id gnl|my_center|LOCUS_20290 10299 9316 gene locus_tag LOCUS_20300 10299 9316 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235508.1 protein_id gnl|my_center|LOCUS_20300 10382 11797 gene locus_tag LOCUS_20310 gene dnaB 10382 11797 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918363.1 protein_id gnl|my_center|LOCUS_20310 11850 12929 gene locus_tag LOCUS_20320 gene alr 11850 12929 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147328.1 protein_id gnl|my_center|LOCUS_20320 13182 14375 gene locus_tag LOCUS_20330 gene tyrB 13182 14375 CDS product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486985.1 protein_id gnl|my_center|LOCUS_20330 14406 14611 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14903 15000 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence081 755 126 gene locus_tag LOCUS_20340 gene entD 755 126 CDS product enterobactin synthase subunit EntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001749708.1 protein_id gnl|my_center|LOCUS_20340 780 873 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3142 902 gene locus_tag LOCUS_20350 gene fepA 3142 902 CDS product siderophore enterobactin receptor FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034943.1 protein_id gnl|my_center|LOCUS_20350 3385 4587 gene locus_tag LOCUS_20360 gene fes 3385 4587 CDS product enterochelin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125843.1 protein_id gnl|my_center|LOCUS_20360 4590 4808 gene locus_tag LOCUS_20370 gene ybdZ 4590 4808 CDS product enterobactin biosynthesis protein YbdZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885798.1 protein_id gnl|my_center|LOCUS_20370 4805 8686 gene locus_tag LOCUS_20380 gene entF 4805 8686 CDS product enterobactin non-ribosomal peptide synthetase EntF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077805.1 protein_id gnl|my_center|LOCUS_20380 9031 10035 gene locus_tag LOCUS_20390 gene wzz(fepE) 9031 10035 CDS product LPS O-antigen length regulator Wzz(fepE) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096692.1 protein_id gnl|my_center|LOCUS_20390 10466 10032 gene locus_tag LOCUS_20400 10466 10032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20400 10847 10494 gene locus_tag LOCUS_20410 10847 10494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20410 11836 10844 gene locus_tag LOCUS_20420 gene fepG 11836 10844 CDS product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640988.1 protein_id gnl|my_center|LOCUS_20420 12849 11833 gene locus_tag LOCUS_20430 gene fepD 12849 11833 CDS product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453810.1 protein_id gnl|my_center|LOCUS_20430 12948 14198 gene locus_tag LOCUS_20440 gene entS 12948 14198 CDS product enterobactin transporter EntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041786.1 protein_id gnl|my_center|LOCUS_20440 15158 14202 gene locus_tag LOCUS_20450 gene fepB 15158 14202 CDS product Fe2+-enterobactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234311.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence082 395 799 gene locus_tag LOCUS_20460 395 799 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148908.1 protein_id gnl|my_center|LOCUS_20460 1723 854 gene locus_tag LOCUS_20470 1723 854 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274680.1 protein_id gnl|my_center|LOCUS_20470 1995 1777 gene locus_tag LOCUS_20480 1995 1777 CDS product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907085.1 protein_id gnl|my_center|LOCUS_20480 3011 1989 gene locus_tag LOCUS_20490 3011 1989 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057356.1 protein_id gnl|my_center|LOCUS_20490 4924 3011 gene locus_tag LOCUS_20500 4924 3011 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634798.1 protein_id gnl|my_center|LOCUS_20500 5055 5606 gene locus_tag LOCUS_20510 gene kefG 5055 5606 CDS product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987657.1 protein_id gnl|my_center|LOCUS_20510 5606 7411 gene locus_tag LOCUS_20520 gene kefB 5606 7411 CDS product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399147.1 protein_id gnl|my_center|LOCUS_20520 7421 7621 gene locus_tag LOCUS_20530 7421 7621 CDS product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007730.1 protein_id gnl|my_center|LOCUS_20530 7716 8306 gene locus_tag LOCUS_20540 gene slyD 7716 8306 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861334.1 protein_id gnl|my_center|LOCUS_20540 8573 8355 gene locus_tag LOCUS_20550 8573 8355 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153615.1 protein_id gnl|my_center|LOCUS_20550 8794 9606 gene locus_tag LOCUS_20560 gene fkpA 8794 9606 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838250.1 protein_id gnl|my_center|LOCUS_20560 9773 10495 gene locus_tag LOCUS_20570 9773 10495 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091466.1 protein_id gnl|my_center|LOCUS_20570 10495 10881 gene locus_tag LOCUS_20580 gene tusD 10495 10881 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209680.1 protein_id gnl|my_center|LOCUS_20580 10881 11240 gene locus_tag LOCUS_20590 gene tusC 10881 11240 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820714.1 protein_id gnl|my_center|LOCUS_20590 11248 11535 gene locus_tag LOCUS_20600 gene tusB 11248 11535 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903373.1 protein_id gnl|my_center|LOCUS_20600 11661 12035 gene locus_tag LOCUS_20610 gene rpsL 11661 12035 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001319024.1 protein_id gnl|my_center|LOCUS_20610 12132 12671 gene locus_tag LOCUS_20620 gene rpsG 12132 12671 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138045.1 protein_id gnl|my_center|LOCUS_20620 12699 14813 gene locus_tag LOCUS_20630 gene fusA 12699 14813 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124700.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence083 1335 3638 gene locus_tag LOCUS_20640 gene pgaA 1335 3638 CDS product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287458.1 protein_id gnl|my_center|LOCUS_20640 3647 5665 gene locus_tag LOCUS_20650 gene pgaB 3647 5665 CDS product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945561.1 protein_id gnl|my_center|LOCUS_20650 5778 6983 gene locus_tag LOCUS_20660 gene pgaC 5778 6983 CDS product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610451.1 protein_id gnl|my_center|LOCUS_20660 6985 7398 gene locus_tag LOCUS_20670 gene pgaD 6985 7398 CDS product poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061095.1 protein_id gnl|my_center|LOCUS_20670 8512 7448 gene locus_tag LOCUS_20680 gene phoH 8512 7448 CDS product phosphate starvation-inducible protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258765.1 protein_id gnl|my_center|LOCUS_20680 10128 8857 gene locus_tag LOCUS_20690 gene efeB 10128 8857 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199471.1 protein_id gnl|my_center|LOCUS_20690 11261 10134 gene locus_tag LOCUS_20700 gene efeO 11261 10134 CDS product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154398.1 protein_id gnl|my_center|LOCUS_20700 12038 11319 gene locus_tag LOCUS_20710 12038 11319 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497942.1 protein_id gnl|my_center|LOCUS_20710 14199 12691 gene locus_tag LOCUS_20720 gene putP 14199 12691 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018479.1 protein_id gnl|my_center|LOCUS_20720 14510 14358 gene locus_tag LOCUS_20730 14510 14358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 14622 14960 gene locus_tag LOCUS_20740 14622 14960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence084 1583 219 gene locus_tag LOCUS_20750 gene ppnN 1583 219 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627995.1 protein_id gnl|my_center|LOCUS_20750 2578 1730 gene locus_tag LOCUS_20760 gene queF 2578 1730 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100421.1 protein_id gnl|my_center|LOCUS_20760 2646 3191 gene locus_tag LOCUS_20770 gene syd 2646 3191 CDS product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342431.1 protein_id gnl|my_center|LOCUS_20770 3813 4142 gene locus_tag LOCUS_20780 3813 4142 CDS product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206990.1 protein_id gnl|my_center|LOCUS_20780 4142 4924 gene locus_tag LOCUS_20790 gene truC 4142 4924 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890001.1 protein_id gnl|my_center|LOCUS_20790 4942 5391 gene locus_tag LOCUS_20800 4942 5391 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807753.1 protein_id gnl|my_center|LOCUS_20800 5826 7178 gene locus_tag LOCUS_20810 gene gudP 5826 7178 CDS product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097072.1 protein_id gnl|my_center|LOCUS_20810 7180 8520 gene locus_tag LOCUS_20820 7180 8520 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235391.1 protein_id gnl|my_center|LOCUS_20820 8541 9881 gene locus_tag LOCUS_20830 gene gudD 8541 9881 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098255.1 protein_id gnl|my_center|LOCUS_20830 12869 10113 gene locus_tag LOCUS_20840 gene barA 12869 10113 CDS product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186450.1 protein_id gnl|my_center|LOCUS_20840 12926 14227 gene locus_tag LOCUS_20850 gene rlmD 12926 14227 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046812.1 protein_id gnl|my_center|LOCUS_20850 14275 14550 gene locus_tag LOCUS_20860 14275 14550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence085 230 1798 gene locus_tag LOCUS_20870 gene cydA 230 1798 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884361.1 protein_id gnl|my_center|LOCUS_20870 1814 2953 gene locus_tag LOCUS_20880 gene cydB 1814 2953 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568275.1 protein_id gnl|my_center|LOCUS_20880 3081 3374 gene locus_tag LOCUS_20890 gene ybgE 3081 3374 CDS product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034602.1 protein_id gnl|my_center|LOCUS_20890 3524 3928 gene locus_tag LOCUS_20900 gene ybgC 3524 3928 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098384.1 protein_id gnl|my_center|LOCUS_20900 3925 4617 gene locus_tag LOCUS_20910 gene tolQ 3925 4617 CDS product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131314.1 protein_id gnl|my_center|LOCUS_20910 4621 5049 gene locus_tag LOCUS_20920 gene tolR 4621 5049 CDS product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090097.1 protein_id gnl|my_center|LOCUS_20920 5114 6379 gene locus_tag LOCUS_20930 5114 6379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 6512 7804 gene locus_tag LOCUS_20940 gene tolB 6512 7804 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295307.1 protein_id gnl|my_center|LOCUS_20940 7839 8360 gene locus_tag LOCUS_20950 gene pal 7839 8360 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295306.1 protein_id gnl|my_center|LOCUS_20950 8370 9161 gene locus_tag LOCUS_20960 gene cpoB 8370 9161 CDS product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097571.1 protein_id gnl|my_center|LOCUS_20960 9326 9401 gene locus_tag LOCUS_t00310 9326 9401 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 9537 9612 gene locus_tag LOCUS_t00320 9537 9612 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9615 9690 gene locus_tag LOCUS_t00330 9615 9690 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 9840 9915 gene locus_tag LOCUS_t00340 9840 9915 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9919 9994 gene locus_tag LOCUS_t00350 9919 9994 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 10141 10216 gene locus_tag LOCUS_t00360 10141 10216 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 10349 10424 gene locus_tag LOCUS_t00370 10349 10424 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 10857 11900 gene locus_tag LOCUS_20970 gene nadA 10857 11900 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115290.1 protein_id gnl|my_center|LOCUS_20970 11938 12657 gene locus_tag LOCUS_20980 gene pnuC 11938 12657 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345410.1 protein_id gnl|my_center|LOCUS_20980 13595 12654 gene locus_tag LOCUS_20990 gene zitB 13595 12654 CDS product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951276.1 protein_id gnl|my_center|LOCUS_20990 14089 13709 gene locus_tag LOCUS_21000 14089 13709 CDS product YbgS-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784351.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence086 467 1141 gene locus_tag LOCUS_21010 467 1141 CDS product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719011.1 protein_id gnl|my_center|LOCUS_21010 1157 3637 gene locus_tag LOCUS_21020 1157 3637 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945454.1 protein_id gnl|my_center|LOCUS_21020 3653 4687 gene locus_tag LOCUS_21030 3653 4687 CDS product putative fimbrial-like adhesin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405713.1 protein_id gnl|my_center|LOCUS_21030 5107 4769 gene locus_tag LOCUS_21040 gene rcnB 5107 4769 CDS product Ni(II)/Co(II) efflux transporter accessory subunit RcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153067.1 protein_id gnl|my_center|LOCUS_21040 6150 5326 gene locus_tag LOCUS_21050 gene rcnA 6150 5326 CDS product nickel/cobalt efflux protein RcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134636.1 protein_id gnl|my_center|LOCUS_21050 6271 6543 gene locus_tag LOCUS_21060 gene rcnR 6271 6543 CDS product Ni(II)/Co(II)-binding transcriptional repressor RcnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019944.1 protein_id gnl|my_center|LOCUS_21060 6766 7554 gene locus_tag LOCUS_21070 gene thiM 6766 7554 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195564.1 protein_id gnl|my_center|LOCUS_21070 7551 8351 gene locus_tag LOCUS_21080 gene thiD 7551 8351 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822274.1 protein_id gnl|my_center|LOCUS_21080 8416 9234 gene locus_tag LOCUS_21090 8416 9234 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351783.1 protein_id gnl|my_center|LOCUS_21090 9286 10032 gene locus_tag LOCUS_21100 9286 10032 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434038.1 protein_id gnl|my_center|LOCUS_21100 10971 10006 gene locus_tag LOCUS_21110 10971 10006 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012001.1 protein_id gnl|my_center|LOCUS_21110 11972 10968 gene locus_tag LOCUS_21120 11972 10968 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846217.1 protein_id gnl|my_center|LOCUS_21120 13246 11969 gene locus_tag LOCUS_21130 13246 11969 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858484.1 protein_id gnl|my_center|LOCUS_21130 13503 14555 gene locus_tag LOCUS_21140 gene fbaB 13503 14555 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129551.1 protein_id gnl|my_center|LOCUS_21140 >Feature sequence087 334 143 gene locus_tag LOCUS_21150 334 143 CDS product YfgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076001.1 protein_id gnl|my_center|LOCUS_21150 352 504 gene locus_tag LOCUS_21160 352 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017552.1 protein_id gnl|my_center|LOCUS_21160 851 2929 gene locus_tag LOCUS_21170 gene pdeF 851 2929 CDS product cyclic-guanylate-specific phosphodiesterase PdeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772731.1 protein_id gnl|my_center|LOCUS_21170 4509 2968 gene locus_tag LOCUS_21180 gene ppx 4509 2968 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121363.1 protein_id gnl|my_center|LOCUS_21180 6586 4514 gene locus_tag LOCUS_21190 gene ppk1 6586 4514 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529576.1 protein_id gnl|my_center|LOCUS_21190 7390 6752 gene locus_tag LOCUS_21200 gene purN 7390 6752 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028612.1 protein_id gnl|my_center|LOCUS_21200 8442 7390 gene locus_tag LOCUS_21210 gene purM 8442 7390 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336050.1 protein_id gnl|my_center|LOCUS_21210 8752 9378 gene locus_tag LOCUS_21220 gene upp 8752 9378 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295473.1 protein_id gnl|my_center|LOCUS_21220 9464 10753 gene locus_tag LOCUS_21230 gene uraA 9464 10753 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198328.1 protein_id gnl|my_center|LOCUS_21230 10803 11549 gene locus_tag LOCUS_21240 10803 11549 CDS product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247065.1 protein_id gnl|my_center|LOCUS_21240 12046 11687 gene locus_tag LOCUS_21250 gene arsC 12046 11687 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166446.1 protein_id gnl|my_center|LOCUS_21250 13530 12067 gene locus_tag LOCUS_21260 gene bepA 13530 12067 CDS product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489667.1 protein_id gnl|my_center|LOCUS_21260 13743 14015 gene locus_tag LOCUS_21270 13743 14015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21270 >Feature sequence088 188 910 gene locus_tag LOCUS_21280 188 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21280 859 1263 gene locus_tag LOCUS_21290 859 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21290 883 900 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2082 1264 gene locus_tag LOCUS_21300 gene ybhA 2082 1264 CDS product bifunctional pyridoxal phosphate/fructose-1,6-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300666.1 protein_id gnl|my_center|LOCUS_21300 2237 3232 gene locus_tag LOCUS_21310 gene pgl 2237 3232 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815435.1 protein_id gnl|my_center|LOCUS_21310 4031 3273 gene locus_tag LOCUS_21320 4031 3273 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643361.1 protein_id gnl|my_center|LOCUS_21320 4515 5462 gene locus_tag LOCUS_21330 4515 5462 CDS product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723652.1 protein_id gnl|my_center|LOCUS_21330 5538 6971 gene locus_tag LOCUS_21340 5538 6971 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036475.1 protein_id gnl|my_center|LOCUS_21340 7154 9415 gene locus_tag LOCUS_21350 7154 9415 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593938.1 protein_id gnl|my_center|LOCUS_21350 10932 9649 gene locus_tag LOCUS_21360 10932 9649 CDS product putative acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091569.1 protein_id gnl|my_center|LOCUS_21360 11560 11084 gene locus_tag LOCUS_21370 11560 11084 CDS product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767389.1 protein_id gnl|my_center|LOCUS_21370 12851 11619 gene locus_tag LOCUS_21380 gene bioA 12851 11619 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295303.1 protein_id gnl|my_center|LOCUS_21380 12995 14035 gene locus_tag LOCUS_21390 gene bioB 12995 14035 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951213.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence089 52 600 gene locus_tag LOCUS_21400 52 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 597 2441 gene locus_tag LOCUS_21410 597 2441 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087218.1 protein_id gnl|my_center|LOCUS_21410 2722 3183 gene locus_tag LOCUS_21420 2722 3183 CDS product YehR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295429.1 protein_id gnl|my_center|LOCUS_21420 3693 3223 gene locus_tag LOCUS_21430 3693 3223 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950409.1 protein_id gnl|my_center|LOCUS_21430 4459 3740 gene locus_tag LOCUS_21440 gene btsR 4459 3740 CDS product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598641.1 protein_id gnl|my_center|LOCUS_21440 6156 4456 gene locus_tag LOCUS_21450 gene btsS 6156 4456 CDS product two-component regulatory system sensor histidine kinase BtsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295431.1 protein_id gnl|my_center|LOCUS_21450 6363 7094 gene locus_tag LOCUS_21460 gene mlrA 6363 7094 CDS product HTH-type transcriptional regulator MlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240401.1 protein_id gnl|my_center|LOCUS_21460 7973 7242 gene locus_tag LOCUS_21470 gene yehW 7973 7242 CDS product glycine betaine ABC transporter permease YehW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783123.1 protein_id gnl|my_center|LOCUS_21470 8904 7978 gene locus_tag LOCUS_21480 gene yehX 8904 7978 CDS product glycine betaine ABC transporter ATP binding protein YehX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569315.1 protein_id gnl|my_center|LOCUS_21480 10054 8897 gene locus_tag LOCUS_21490 gene yehY 10054 8897 CDS product glycine betaine ABC transporter permease YehY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220837.1 protein_id gnl|my_center|LOCUS_21490 10978 10061 gene locus_tag LOCUS_21500 gene osmF 10978 10061 CDS product glycine betaine ABC transporter substrate-binding protein OsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130308.1 protein_id gnl|my_center|LOCUS_21500 13486 11189 gene locus_tag LOCUS_21510 gene bglX 13486 11189 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871504.1 protein_id gnl|my_center|LOCUS_21510 13682 14491 gene locus_tag LOCUS_21520 13682 14491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence090 <1 2192 gene locus_tag LOCUS_21530 <1 2192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000263098.1:DNA-directed RNA polymerase subunit beta 2269 6492 gene locus_tag LOCUS_21540 gene rpoC 2269 6492 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653944.1 protein_id gnl|my_center|LOCUS_21540 6705 7244 gene locus_tag LOCUS_21550 6705 7244 CDS product heat-shock protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307500.1 protein_id gnl|my_center|LOCUS_21550 8787 7654 gene locus_tag LOCUS_21560 gene thiH 8787 7654 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847447.1 protein_id gnl|my_center|LOCUS_21560 9554 8784 gene locus_tag LOCUS_21570 gene thiG 9554 8784 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944104.1 protein_id gnl|my_center|LOCUS_21570 9756 9556 gene locus_tag LOCUS_21580 gene thiS 9756 9556 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166226.1 protein_id gnl|my_center|LOCUS_21580 10495 9740 gene locus_tag LOCUS_21590 gene thiF 10495 9740 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999737.1 protein_id gnl|my_center|LOCUS_21590 11123 10488 gene locus_tag LOCUS_21600 gene thiE 11123 10488 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284615.1 protein_id gnl|my_center|LOCUS_21600 13018 11123 gene locus_tag LOCUS_21610 gene thiC 13018 11123 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276926.1 protein_id gnl|my_center|LOCUS_21610 13727 13251 gene locus_tag LOCUS_21620 gene rsd 13727 13251 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934302.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence091 4267 1169 gene locus_tag LOCUS_21630 gene ygfK 4267 1169 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502395.1 protein_id gnl|my_center|LOCUS_21630 5167 4589 gene locus_tag LOCUS_21640 gene mocA 5167 4589 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272828.1 protein_id gnl|my_center|LOCUS_21640 5561 6040 gene locus_tag LOCUS_21650 5561 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 6088 7713 gene locus_tag LOCUS_21660 gene yqeB 6088 7713 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020381.1 protein_id gnl|my_center|LOCUS_21660 8866 7934 gene locus_tag LOCUS_21670 gene arcC 8866 7934 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037992.1 protein_id gnl|my_center|LOCUS_21670 10299 8914 gene locus_tag LOCUS_21680 gene hyuA 10299 8914 CDS product D-phenylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264442.1 protein_id gnl|my_center|LOCUS_21680 11563 10352 gene locus_tag LOCUS_21690 11563 10352 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107125.1 protein_id gnl|my_center|LOCUS_21690 12817 11621 gene locus_tag LOCUS_21700 gene dpaL 12817 11621 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110493.1 protein_id gnl|my_center|LOCUS_21700 14062 12875 gene locus_tag LOCUS_21710 gene ygeW 14062 12875 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978544.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence092 <1 540 gene locus_tag LOCUS_21720 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001125331.1:TIGR04211 family SH3 domain-containing protein 604 1842 gene locus_tag LOCUS_21730 gene cca 604 1842 CDS product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708487.1 protein_id gnl|my_center|LOCUS_21730 2852 2031 gene locus_tag LOCUS_21740 gene bacA 2852 2031 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281927.1 protein_id gnl|my_center|LOCUS_21740 3313 2942 gene locus_tag LOCUS_21750 gene folB 3313 2942 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295541.1 protein_id gnl|my_center|LOCUS_21750 3415 4032 gene locus_tag LOCUS_21760 gene plsY 3415 4032 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272796.1 protein_id gnl|my_center|LOCUS_21760 4977 4045 gene locus_tag LOCUS_21770 gene ttdR 4977 4045 CDS product DNA-binding transcriptional activator TtdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935206.1 protein_id gnl|my_center|LOCUS_21770 5184 6095 gene locus_tag LOCUS_21780 gene ttdA 5184 6095 CDS product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986797.1 protein_id gnl|my_center|LOCUS_21780 6092 6697 gene locus_tag LOCUS_21790 gene ttdB 6092 6697 CDS product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722957.1 protein_id gnl|my_center|LOCUS_21790 6745 8208 gene locus_tag LOCUS_21800 gene ttdT 6745 8208 CDS product L-tartrate/succinate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804973.1 protein_id gnl|my_center|LOCUS_21800 9264 8251 gene locus_tag LOCUS_21810 gene tsaD 9264 8251 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264352.1 protein_id gnl|my_center|LOCUS_21810 9502 9717 gene locus_tag LOCUS_21820 gene rpsU 9502 9717 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 protein_id gnl|my_center|LOCUS_21820 9828 11573 gene locus_tag LOCUS_21830 gene dnaG 9828 11573 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918827.1 protein_id gnl|my_center|LOCUS_21830 11768 13609 gene locus_tag LOCUS_21840 gene rpoD 11768 13609 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437376.1 protein_id gnl|my_center|LOCUS_21840 14194 13688 gene locus_tag LOCUS_21850 gene mug 14194 13688 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228937.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence093 276 479 gene locus_tag LOCUS_21860 gene tatE 276 479 CDS product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503931.1 protein_id gnl|my_center|LOCUS_21860 1506 580 gene locus_tag LOCUS_21870 gene lipA 1506 580 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042632.1 protein_id gnl|my_center|LOCUS_21870 2668 1715 gene locus_tag LOCUS_21880 2668 1715 CDS product YbeF family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378026.1 protein_id gnl|my_center|LOCUS_21880 3568 2927 gene locus_tag LOCUS_21890 gene lipB 3568 2927 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284027.1 protein_id gnl|my_center|LOCUS_21890 3932 3669 gene locus_tag LOCUS_21900 gene ybeD 3932 3669 CDS product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850550.1 protein_id gnl|my_center|LOCUS_21900 5253 4042 gene locus_tag LOCUS_21910 gene dacA 5253 4042 CDS product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092082.1 protein_id gnl|my_center|LOCUS_21910 5170 5415 gene locus_tag LOCUS_21920 5170 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 6480 5392 gene locus_tag LOCUS_21930 gene rlpA 6480 5392 CDS product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231430.1 protein_id gnl|my_center|LOCUS_21930 7603 6491 gene locus_tag LOCUS_21940 gene mrdB 7603 6491 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131719.1 protein_id gnl|my_center|LOCUS_21940 9507 7606 gene locus_tag LOCUS_21950 gene mrdA 9507 7606 CDS product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776191.1 protein_id gnl|my_center|LOCUS_21950 10005 9538 gene locus_tag LOCUS_21960 gene rlmH 10005 9538 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776104.1 protein_id gnl|my_center|LOCUS_21960 10326 10009 gene locus_tag LOCUS_21970 gene rsfS 10326 10009 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161664.1 protein_id gnl|my_center|LOCUS_21970 11197 10586 gene locus_tag LOCUS_21980 11197 10586 CDS product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241872.1 protein_id gnl|my_center|LOCUS_21980 11862 11221 gene locus_tag LOCUS_21990 gene nadD 11862 11221 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838889.1 protein_id gnl|my_center|LOCUS_21990 12895 11864 gene locus_tag LOCUS_22000 gene holA 12895 11864 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620535.1 protein_id gnl|my_center|LOCUS_22000 13476 12895 gene locus_tag LOCUS_22010 gene lptE 13476 12895 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269673.1 protein_id gnl|my_center|LOCUS_22010 <14016 13491 gene locus_tag LOCUS_22020 <14016 13491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001340834.1:leucine--tRNA ligase >Feature sequence094 3184 383 gene locus_tag LOCUS_22030 gene sucA 3184 383 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181473.1 protein_id gnl|my_center|LOCUS_22030 3476 4798 gene locus_tag LOCUS_22040 gene deoA 3476 4798 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477807.1 protein_id gnl|my_center|LOCUS_22040 4850 6073 gene locus_tag LOCUS_22050 gene deoB 4850 6073 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816471.1 protein_id gnl|my_center|LOCUS_22050 6130 6849 gene locus_tag LOCUS_22060 gene deoD 6130 6849 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224877.1 protein_id gnl|my_center|LOCUS_22060 7016 8347 gene locus_tag LOCUS_22070 gene yjjJ 7016 8347 CDS product type II toxin-antitoxin system HipA family toxin YjjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293115.1 protein_id gnl|my_center|LOCUS_22070 9364 8348 gene locus_tag LOCUS_22080 gene lplA 9364 8348 CDS product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105884.1 protein_id gnl|my_center|LOCUS_22080 10036 9392 gene locus_tag LOCUS_22090 10036 9392 CDS product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124615.1 protein_id gnl|my_center|LOCUS_22090 10142 11110 gene locus_tag LOCUS_22100 gene serB 10142 11110 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132955.1 protein_id gnl|my_center|LOCUS_22100 11159 12541 gene locus_tag LOCUS_22110 gene radA 11159 12541 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029687.1 protein_id gnl|my_center|LOCUS_22110 12562 13794 gene locus_tag LOCUS_22120 gene nadR 12562 13794 CDS product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093814.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence095 <1 1081 gene locus_tag LOCUS_22130 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000291549.1:lactose permease 2402 1251 gene locus_tag LOCUS_22140 gene argE 2402 1251 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298964.1 protein_id gnl|my_center|LOCUS_22140 2556 3560 gene locus_tag LOCUS_22150 gene argC 2556 3560 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935370.1 protein_id gnl|my_center|LOCUS_22150 3571 4344 gene locus_tag LOCUS_22160 gene argB 3571 4344 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295507.1 protein_id gnl|my_center|LOCUS_22160 4405 5778 gene locus_tag LOCUS_22170 gene argH 4405 5778 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230087.1 protein_id gnl|my_center|LOCUS_22170 6045 6962 gene locus_tag LOCUS_22180 gene oxyR 6045 6962 CDS product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025939.1 protein_id gnl|my_center|LOCUS_22180 8345 6945 gene locus_tag LOCUS_22190 gene sthA 8345 6945 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120810.1 protein_id gnl|my_center|LOCUS_22190 8622 9326 gene locus_tag LOCUS_22200 gene fabR 8622 9326 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470429.1 protein_id gnl|my_center|LOCUS_22200 9326 9685 gene locus_tag LOCUS_22210 9326 9685 CDS product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806411.1 protein_id gnl|my_center|LOCUS_22210 10825 9725 gene locus_tag LOCUS_22220 gene trmA 10825 9725 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187022.1 protein_id gnl|my_center|LOCUS_22220 11194 13038 gene locus_tag LOCUS_22230 gene btuB 11194 13038 CDS product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591359.1 protein_id gnl|my_center|LOCUS_22230 12983 13840 gene locus_tag LOCUS_22240 gene murI 12983 13840 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201820.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence096 1552 629 gene locus_tag LOCUS_22250 gene hycD 1552 629 CDS product formate hydrogenlyase subunit HycD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115223.1 protein_id gnl|my_center|LOCUS_22250 3381 1555 gene locus_tag LOCUS_22260 gene hycC 3381 1555 CDS product formate hydrogenlyase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274396.1 protein_id gnl|my_center|LOCUS_22260 3989 3378 gene locus_tag LOCUS_22270 gene hycB 3989 3378 CDS product formate hydrogenlyase subunit HycB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079186.1 protein_id gnl|my_center|LOCUS_22270 4575 4114 gene locus_tag LOCUS_22280 gene hycA 4575 4114 CDS product formate hydrogenlyase regulator HycA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158056.1 protein_id gnl|my_center|LOCUS_22280 4787 5137 gene locus_tag LOCUS_22290 gene hypA 4787 5137 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508457.1 protein_id gnl|my_center|LOCUS_22290 5141 6013 gene locus_tag LOCUS_22300 gene hypB 5141 6013 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337665.1 protein_id gnl|my_center|LOCUS_22300 6004 6276 gene locus_tag LOCUS_22310 gene hypC 6004 6276 CDS product hydrogenase 3 maturation protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334881.1 protein_id gnl|my_center|LOCUS_22310 6276 7397 gene locus_tag LOCUS_22320 gene hypD 6276 7397 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212985.1 protein_id gnl|my_center|LOCUS_22320 7394 8404 gene locus_tag LOCUS_22330 gene hypE 7394 8404 CDS product hydrogenase maturation carbamoyl dehydratase HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059922.1 protein_id gnl|my_center|LOCUS_22330 8478 10556 gene locus_tag LOCUS_22340 gene flhA 8478 10556 CDS product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301332.1 protein_id gnl|my_center|LOCUS_22340 10946 10593 gene locus_tag LOCUS_22350 10946 10593 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015497.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence097 551 865 gene locus_tag LOCUS_22360 gene fliE 551 865 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274299.1 protein_id gnl|my_center|LOCUS_22360 1214 1564 gene locus_tag LOCUS_22370 1214 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22370 2026 2217 gene locus_tag LOCUS_22380 2026 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2965 2486 gene locus_tag LOCUS_22390 2965 2486 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494172.1 protein_id gnl|my_center|LOCUS_22390 3744 3076 gene locus_tag LOCUS_22400 3744 3076 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334583.1 protein_id gnl|my_center|LOCUS_22400 4086 3853 gene locus_tag LOCUS_22410 gene yedF 4086 3853 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790504.1 protein_id gnl|my_center|LOCUS_22410 5288 4083 gene locus_tag LOCUS_22420 gene yedE 5288 4083 CDS product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118897.1 protein_id gnl|my_center|LOCUS_22420 5475 5888 gene locus_tag LOCUS_22430 gene yedD 5475 5888 CDS product lipoprotein YedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350519.1 protein_id gnl|my_center|LOCUS_22430 7409 5922 gene locus_tag LOCUS_22440 gene amyA 7409 5922 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245695.1 protein_id gnl|my_center|LOCUS_22440 7852 7487 gene locus_tag LOCUS_22450 gene fliT 7852 7487 CDS product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015033.1 protein_id gnl|my_center|LOCUS_22450 8262 7852 gene locus_tag LOCUS_22460 gene fliS 8262 7852 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270671.1 protein_id gnl|my_center|LOCUS_22460 9693 8287 gene locus_tag LOCUS_22470 gene fliD 9693 8287 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146784.1 protein_id gnl|my_center|LOCUS_22470 9959 11455 gene locus_tag LOCUS_22480 gene fliC 9959 11455 CDS product H48 family flagellin FliC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079739.1 protein_id gnl|my_center|LOCUS_22480 11776 12495 gene locus_tag LOCUS_22490 gene fliA 11776 12495 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087467.1 protein_id gnl|my_center|LOCUS_22490 12541 13092 gene locus_tag LOCUS_22500 gene fliZ 12541 13092 CDS product flagella biosynthesis regulatory protein FliZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350518.1 protein_id gnl|my_center|LOCUS_22500 >Feature sequence098 <1 556 gene locus_tag LOCUS_22510 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000210111.1:gluconate transporter note possible pseudo, frameshifted 556 1020 gene locus_tag LOCUS_22520 556 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22520 1670 1077 gene locus_tag LOCUS_22530 gene yhgN 1670 1077 CDS product NAAT family transporter YhgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002544.1 protein_id gnl|my_center|LOCUS_22530 1863 2966 gene locus_tag LOCUS_22540 gene asd 1863 2966 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799956.1 protein_id gnl|my_center|LOCUS_22540 3239 5425 gene locus_tag LOCUS_22550 gene glgB 3239 5425 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283723.1 protein_id gnl|my_center|LOCUS_22550 5422 7395 gene locus_tag LOCUS_22560 gene glgX 5422 7395 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192523.1 protein_id gnl|my_center|LOCUS_22560 7413 8708 gene locus_tag LOCUS_22570 gene glgC 7413 8708 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253975.1 protein_id gnl|my_center|LOCUS_22570 8708 10141 gene locus_tag LOCUS_22580 gene glgA 8708 10141 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197646.1 protein_id gnl|my_center|LOCUS_22580 10160 12607 gene locus_tag LOCUS_22590 gene glgP 10160 12607 CDS product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993449.1 protein_id gnl|my_center|LOCUS_22590 >Feature sequence099 505 116 gene locus_tag LOCUS_22600 gene mutT 505 116 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736007.1 protein_id gnl|my_center|LOCUS_22600 3270 565 gene locus_tag LOCUS_22610 gene secA 3270 565 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905789.1 protein_id gnl|my_center|LOCUS_22610 3919 3332 gene locus_tag LOCUS_22620 gene secM 3919 3332 CDS product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014321.1 protein_id gnl|my_center|LOCUS_22620 4992 4075 gene locus_tag LOCUS_22630 gene lpxC 4992 4075 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595482.1 protein_id gnl|my_center|LOCUS_22630 6244 5093 gene locus_tag LOCUS_22640 gene ftsZ 6244 5093 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462776.1 protein_id gnl|my_center|LOCUS_22640 7567 6305 gene locus_tag LOCUS_22650 gene ftsA 7567 6305 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588474.1 protein_id gnl|my_center|LOCUS_22650 8394 7564 gene locus_tag LOCUS_22660 gene ftsQ 8394 7564 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075748.1 protein_id gnl|my_center|LOCUS_22660 9316 8396 gene locus_tag LOCUS_22670 gene ddlB 9316 8396 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130056.1 protein_id gnl|my_center|LOCUS_22670 10784 9309 gene locus_tag LOCUS_22680 gene murC 10784 9309 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096049.1 protein_id gnl|my_center|LOCUS_22680 11905 10838 gene locus_tag LOCUS_22690 gene murG 11905 10838 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016560.1 protein_id gnl|my_center|LOCUS_22690 12603 11902 gene locus_tag LOCUS_22700 12603 11902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 >Feature sequence100 1510 17 gene locus_tag LOCUS_22710 1510 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 1793 1975 gene locus_tag LOCUS_22720 1793 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 3809 2127 gene locus_tag LOCUS_22730 gene glcA 3809 2127 CDS product glycolate permease GlcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259302.1 protein_id gnl|my_center|LOCUS_22730 6335 4164 gene locus_tag LOCUS_22740 gene glcB 6335 4164 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084131.1 protein_id gnl|my_center|LOCUS_22740 6761 6357 gene locus_tag LOCUS_22750 6761 6357 CDS product GlcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853256.1 protein_id gnl|my_center|LOCUS_22750 7989 6766 gene locus_tag LOCUS_22760 gene glcF 7989 6766 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194661.1 protein_id gnl|my_center|LOCUS_22760 9052 8000 gene locus_tag LOCUS_22770 gene glcE 9052 8000 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943100.1 protein_id gnl|my_center|LOCUS_22770 10551 9052 gene locus_tag LOCUS_22780 gene glcD 10551 9052 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026117.1 protein_id gnl|my_center|LOCUS_22780 10802 11566 gene locus_tag LOCUS_22790 gene glcC 10802 11566 CDS product transcriptional regulator GlcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297764.1 protein_id gnl|my_center|LOCUS_22790 <12687 11573 gene locus_tag LOCUS_22800 <12687 11573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000981816.1:protein YghO >Feature sequence101 256 2454 gene locus_tag LOCUS_22810 gene speF 256 2454 CDS product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040195.1 protein_id gnl|my_center|LOCUS_22810 2451 3770 gene locus_tag LOCUS_22820 gene potE 2451 3770 CDS product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075845.1 protein_id gnl|my_center|LOCUS_22820 4119 4328 gene locus_tag LOCUS_22830 4119 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22830 4407 4769 gene locus_tag LOCUS_22840 4407 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22840 5274 4810 gene locus_tag LOCUS_22850 5274 4810 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856353.1 protein_id gnl|my_center|LOCUS_22850 5372 5465 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7187 5547 gene locus_tag LOCUS_22860 gene pgm 7187 5547 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297249.1 protein_id gnl|my_center|LOCUS_22860 7758 7213 gene locus_tag LOCUS_22870 gene seqA 7758 7213 CDS product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848387.1 protein_id gnl|my_center|LOCUS_22870 7943 8707 gene locus_tag LOCUS_22880 gene ybfF 7943 8707 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773288.1 protein_id gnl|my_center|LOCUS_22880 8778 9140 gene locus_tag LOCUS_22890 gene ybfE 8778 9140 CDS product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291238.1 protein_id gnl|my_center|LOCUS_22890 9280 9810 gene locus_tag LOCUS_22900 gene fldA 9280 9810 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018618.1 protein_id gnl|my_center|LOCUS_22900 10099 10545 gene locus_tag LOCUS_22910 gene fur 10099 10545 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131702.1 protein_id gnl|my_center|LOCUS_22910 10955 10629 gene locus_tag LOCUS_22920 gene chiQ 10955 10629 CDS product ChiQ/YbfN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733579.1 protein_id gnl|my_center|LOCUS_22920 12411 11005 gene locus_tag LOCUS_22930 gene chiP 12411 11005 CDS product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258819.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence102 20 1381 gene locus_tag LOCUS_22940 gene phoQ 20 1381 CDS product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734671.1 protein_id gnl|my_center|LOCUS_22940 1457 2578 gene locus_tag LOCUS_22950 gene roxA 1457 2578 CDS product [50S ribosomal protein L16]-arginine 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456506.1 protein_id gnl|my_center|LOCUS_22950 3853 2627 gene locus_tag LOCUS_22960 gene pepT 3853 2627 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359434.1 protein_id gnl|my_center|LOCUS_22960 3909 4124 gene locus_tag LOCUS_22970 3909 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310720.1 protein_id gnl|my_center|LOCUS_22970 4121 5239 gene locus_tag LOCUS_22980 gene potA 4121 5239 CDS product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531594.1 protein_id gnl|my_center|LOCUS_22980 5223 6080 gene locus_tag LOCUS_22990 gene potB 5223 6080 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799401.1 protein_id gnl|my_center|LOCUS_22990 6077 6871 gene locus_tag LOCUS_23000 gene potC 6077 6871 CDS product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580316.1 protein_id gnl|my_center|LOCUS_23000 6868 7914 gene locus_tag LOCUS_23010 gene potD 6868 7914 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759317.1 protein_id gnl|my_center|LOCUS_23010 7972 8433 gene locus_tag LOCUS_23020 7972 8433 CDS product DUF3592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076376.1 protein_id gnl|my_center|LOCUS_23020 8430 9218 gene locus_tag LOCUS_23030 8430 9218 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713462.1 protein_id gnl|my_center|LOCUS_23030 10177 9338 gene locus_tag LOCUS_23040 gene cobB 10177 9338 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952737.1 protein_id gnl|my_center|LOCUS_23040 11104 10193 gene locus_tag LOCUS_23050 gene nagK 11104 10193 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291270.1 protein_id gnl|my_center|LOCUS_23050 12377 11133 gene locus_tag LOCUS_23060 gene lolE 12377 11133 CDS product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251348.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence103 687 271 gene locus_tag LOCUS_23070 687 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2627 684 gene locus_tag LOCUS_23080 gene ccmF 2627 684 CDS product cytochrome c-type biogenesis heme lyase CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982447.1 protein_id gnl|my_center|LOCUS_23080 3103 2624 gene locus_tag LOCUS_23090 gene ccmE 3103 2624 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026418.1 protein_id gnl|my_center|LOCUS_23090 3309 3100 gene locus_tag LOCUS_23100 3309 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 4067 3306 gene locus_tag LOCUS_23110 gene ccmC 4067 3306 CDS product heme exporter protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295447.1 protein_id gnl|my_center|LOCUS_23110 4747 4085 gene locus_tag LOCUS_23120 gene ccmB 4747 4085 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971730.1 protein_id gnl|my_center|LOCUS_23120 5367 4744 gene locus_tag LOCUS_23130 gene ccmA 5367 4744 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525587.1 protein_id gnl|my_center|LOCUS_23130 5982 5380 gene locus_tag LOCUS_23140 gene napC 5982 5380 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528376.1 protein_id gnl|my_center|LOCUS_23140 6441 5992 gene locus_tag LOCUS_23150 gene napB 6441 5992 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835174.1 protein_id gnl|my_center|LOCUS_23150 7301 6438 gene locus_tag LOCUS_23160 gene napH 7301 6438 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013515.1 protein_id gnl|my_center|LOCUS_23160 7902 7288 gene locus_tag LOCUS_23170 gene napG 7902 7288 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091291.1 protein_id gnl|my_center|LOCUS_23170 10476 7990 gene locus_tag LOCUS_23180 gene napA 10476 7990 CDS product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778061.1 protein_id gnl|my_center|LOCUS_23180 10736 10473 gene locus_tag LOCUS_23190 gene napD 10736 10473 CDS product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557378.1 protein_id gnl|my_center|LOCUS_23190 11329 11493 gene locus_tag LOCUS_23200 gene yojO 11329 11493 CDS product protein YojO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296837.1 protein_id gnl|my_center|LOCUS_23200 11628 12116 gene locus_tag LOCUS_23210 gene eco 11628 12116 CDS product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849209.1 protein_id gnl|my_center|LOCUS_23210 >Feature sequence104 1153 206 gene locus_tag LOCUS_23220 gene dusC 1153 206 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264861.1 protein_id gnl|my_center|LOCUS_23220 1392 1790 gene locus_tag LOCUS_23230 1392 1790 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295452.1 protein_id gnl|my_center|LOCUS_23230 1787 2482 gene locus_tag LOCUS_23240 1787 2482 CDS product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968208.1 protein_id gnl|my_center|LOCUS_23240 2612 3496 gene locus_tag LOCUS_23250 gene cdd 2612 3496 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553555.1 protein_id gnl|my_center|LOCUS_23250 3646 4365 gene locus_tag LOCUS_23260 gene sanA 3646 4365 CDS product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920064.1 protein_id gnl|my_center|LOCUS_23260 4368 4607 gene locus_tag LOCUS_23270 4368 4607 CDS product DUF2542 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383096.1 protein_id gnl|my_center|LOCUS_23270 4801 6039 gene locus_tag LOCUS_23280 gene preT 4801 6039 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136389.1 protein_id gnl|my_center|LOCUS_23280 6033 7268 gene locus_tag LOCUS_23290 gene preA 6033 7268 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956071.1 protein_id gnl|my_center|LOCUS_23290 7322 7336 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8419 7409 gene locus_tag LOCUS_23300 gene mglC 8419 7409 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275118.1 protein_id gnl|my_center|LOCUS_23300 9064 8435 gene locus_tag LOCUS_23310 9064 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23310 9936 8995 gene locus_tag LOCUS_23320 9936 8995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23320 10995 9997 gene locus_tag LOCUS_23330 gene mglB 10995 9997 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036964.1 protein_id gnl|my_center|LOCUS_23330 12315 11275 gene locus_tag LOCUS_23340 gene galS 12315 11275 CDS product HTH-type transcriptional regulator GalS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628648.1 protein_id gnl|my_center|LOCUS_23340 >Feature sequence105 1425 22 gene locus_tag LOCUS_23350 1425 22 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075716.1 protein_id gnl|my_center|LOCUS_23350 1724 1437 gene locus_tag LOCUS_23360 gene eutN 1724 1437 CDS product ethanolamine utilization microcompartment protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762196.1 protein_id gnl|my_center|LOCUS_23360 2124 1831 gene locus_tag LOCUS_23370 gene eutM 2124 1831 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 protein_id gnl|my_center|LOCUS_23370 3179 2163 gene locus_tag LOCUS_23380 gene pta 3179 2163 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582977.1 protein_id gnl|my_center|LOCUS_23380 3979 3176 gene locus_tag LOCUS_23390 gene eutT 3979 3176 CDS product ethanolamine utilization cob(I)yrinic acid a,c-diamide adenosyltransferase EutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651298.1 protein_id gnl|my_center|LOCUS_23390 4677 3976 gene locus_tag LOCUS_23400 gene eutQ 4677 3976 CDS product ethanolamine utilization acetate kinase EutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733906.1 protein_id gnl|my_center|LOCUS_23400 5131 4652 gene locus_tag LOCUS_23410 gene eutP 5131 4652 CDS product ethanolamine utilization acetate kinase EutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820763.1 protein_id gnl|my_center|LOCUS_23410 5479 5144 gene locus_tag LOCUS_23420 gene eutS 5479 5144 CDS product ethanolamine utilization microcompartment protein EutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356956.1 protein_id gnl|my_center|LOCUS_23420 8051 5772 gene locus_tag LOCUS_23430 gene maeB 8051 5772 CDS product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342644.1 protein_id gnl|my_center|LOCUS_23430 8340 9290 gene locus_tag LOCUS_23440 gene tal 8340 9290 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003709.1 protein_id gnl|my_center|LOCUS_23440 9310 11298 gene locus_tag LOCUS_23450 gene tkt 9310 11298 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087280.1 protein_id gnl|my_center|LOCUS_23450 11612 12055 gene locus_tag LOCUS_23460 gene cmtB 11612 12055 CDS product PTS mannitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239650.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence106 322 1704 gene locus_tag LOCUS_23470 322 1704 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412379.1 protein_id gnl|my_center|LOCUS_23470 1741 2463 gene locus_tag LOCUS_23480 gene folM 1741 2463 CDS product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520804.1 protein_id gnl|my_center|LOCUS_23480 2795 2460 gene locus_tag LOCUS_23490 2795 2460 CDS product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524868.1 protein_id gnl|my_center|LOCUS_23490 2924 3643 gene locus_tag LOCUS_23500 gene rstA 2924 3643 CDS product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092508.1 protein_id gnl|my_center|LOCUS_23500 3647 4948 gene locus_tag LOCUS_23510 gene rstB 3647 4948 CDS product two-component system sensor histidine kinase RstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732512.1 protein_id gnl|my_center|LOCUS_23510 5012 5953 gene locus_tag LOCUS_23520 gene tus 5012 5953 CDS product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135181.1 protein_id gnl|my_center|LOCUS_23520 7353 5950 gene locus_tag LOCUS_23530 gene fumC 7353 5950 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099085.1 protein_id gnl|my_center|LOCUS_23530 9142 7496 gene locus_tag LOCUS_23540 gene fumB 9142 7496 CDS product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066639.1 protein_id gnl|my_center|LOCUS_23540 9341 10516 gene locus_tag LOCUS_23550 gene manA 9341 10516 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170664.1 protein_id gnl|my_center|LOCUS_23550 10617 12125 gene locus_tag LOCUS_23560 10617 12125 CDS product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043339.1 protein_id gnl|my_center|LOCUS_23560 >Feature sequence107 1408 470 gene locus_tag LOCUS_23570 gene psuG 1408 470 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292460.1 protein_id gnl|my_center|LOCUS_23570 2337 1396 gene locus_tag LOCUS_23580 2337 1396 CDS product pseudouridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208118.1 protein_id gnl|my_center|LOCUS_23580 4451 2760 gene locus_tag LOCUS_23590 gene fruA 4451 2760 CDS product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854447.1 protein_id gnl|my_center|LOCUS_23590 5406 4468 gene locus_tag LOCUS_23600 gene fruK 5406 4468 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091263.1 protein_id gnl|my_center|LOCUS_23600 6449 5406 gene locus_tag LOCUS_23610 gene fruB 6449 5406 CDS product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487223.1 protein_id gnl|my_center|LOCUS_23610 6903 8084 gene locus_tag LOCUS_23620 gene setB 6903 8084 CDS product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551980.1 protein_id gnl|my_center|LOCUS_23620 8335 8081 gene locus_tag LOCUS_23630 8335 8081 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389030.1 protein_id gnl|my_center|LOCUS_23630 8490 9062 gene locus_tag LOCUS_23640 gene yeiP 8490 9062 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136827.1 protein_id gnl|my_center|LOCUS_23640 9285 10751 gene locus_tag LOCUS_23650 9285 10751 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091940.1 protein_id gnl|my_center|LOCUS_23650 10869 11855 gene locus_tag LOCUS_23660 gene yeiR 10869 11855 CDS product zinc-binding GTPase YeiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198828.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence108 802 590 gene locus_tag LOCUS_23670 gene cspH 802 590 CDS product cold shock-like protein CspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087763.1 protein_id gnl|my_center|LOCUS_23670 1088 1300 gene locus_tag LOCUS_23680 gene cspG 1088 1300 CDS product cold shock protein CspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066490.1 protein_id gnl|my_center|LOCUS_23680 1694 1867 gene locus_tag LOCUS_23690 1694 1867 CDS product addiction module toxin, GnsA/GnsB family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019197.1 protein_id gnl|my_center|LOCUS_23690 2989 1916 gene locus_tag LOCUS_23700 2989 1916 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829662.1 protein_id gnl|my_center|LOCUS_23700 5775 3061 gene locus_tag LOCUS_23710 gene torS 5775 3061 CDS product TMAO reductase system sensor histidine kinase/response regulator TorS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300633.1 protein_id gnl|my_center|LOCUS_23710 5888 6916 gene locus_tag LOCUS_23720 gene torT 5888 6916 CDS product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264933.1 protein_id gnl|my_center|LOCUS_23720 7581 6889 gene locus_tag LOCUS_23730 gene torR 7581 6889 CDS product two-component system response regulator TorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120125.1 protein_id gnl|my_center|LOCUS_23730 7711 8883 gene locus_tag LOCUS_23740 gene torC 7711 8883 CDS product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230242.1 protein_id gnl|my_center|LOCUS_23740 8883 11429 gene locus_tag LOCUS_23750 gene torA 8883 11429 CDS product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062091.1 protein_id gnl|my_center|LOCUS_23750 11426 12025 gene locus_tag LOCUS_23760 gene torD 11426 12025 CDS product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209894.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence109 1856 1263 gene locus_tag LOCUS_23770 gene rclC 1856 1263 CDS product reactive chlorine species resistance protein RclC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299021.1 protein_id gnl|my_center|LOCUS_23770 2104 1868 gene locus_tag LOCUS_23780 gene rclB 2104 1868 CDS product reactive chlorine resistance periplasmic protein RclB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000474084.1 protein_id gnl|my_center|LOCUS_23780 3538 2213 gene locus_tag LOCUS_23790 gene rclA 3538 2213 CDS product reactive chlorine resistance oxidoreductase RclA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046307.1 protein_id gnl|my_center|LOCUS_23790 3764 4618 gene locus_tag LOCUS_23800 gene rclR 3764 4618 CDS product reactive chlorine-specific transcriptional regulator RclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339594.1 protein_id gnl|my_center|LOCUS_23800 5145 5864 gene locus_tag LOCUS_23810 5145 5864 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102108.1 protein_id gnl|my_center|LOCUS_23810 5875 7302 gene locus_tag LOCUS_23820 5875 7302 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023927.1 protein_id gnl|my_center|LOCUS_23820 7295 7990 gene locus_tag LOCUS_23830 7295 7990 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370307.1 protein_id gnl|my_center|LOCUS_23830 8901 8233 gene locus_tag LOCUS_23840 gene ykgH 8901 8233 CDS product protein YkgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209100.1 protein_id gnl|my_center|LOCUS_23840 10784 9114 gene locus_tag LOCUS_23850 gene betA 10784 9114 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159094.1 protein_id gnl|my_center|LOCUS_23850 <11929 10798 gene locus_tag LOCUS_23860 <11929 10798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000089110.1:betaine-aldehyde dehydrogenase >Feature sequence110 3060 52 gene locus_tag LOCUS_23870 3060 52 CDS product Tn3-like element Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143760.1 protein_id gnl|my_center|LOCUS_23870 3219 3082 gene locus_tag LOCUS_23880 3219 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 3224 3775 gene locus_tag LOCUS_23890 3224 3775 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213258.1 protein_id gnl|my_center|LOCUS_23890 3791 5887 gene locus_tag LOCUS_23900 3791 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 6224 5991 gene locus_tag LOCUS_23910 6224 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 7100 6234 gene locus_tag LOCUS_23920 gene mhpC 7100 6234 CDS product 2-hydroxy-6-oxonona-2,4-dienedioate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121907.1 protein_id gnl|my_center|LOCUS_23920 8062 7118 gene locus_tag LOCUS_23930 gene mhpB 8062 7118 CDS product 3-carboxyethylcatechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543457.1 protein_id gnl|my_center|LOCUS_23930 9728 8064 gene locus_tag LOCUS_23940 9728 8064 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007407.1 protein_id gnl|my_center|LOCUS_23940 9919 10752 gene locus_tag LOCUS_23950 9919 10752 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301325.1 protein_id gnl|my_center|LOCUS_23950 >Feature sequence111 602 1153 gene locus_tag LOCUS_23960 gene smrB 602 1153 CDS product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730806.1 protein_id gnl|my_center|LOCUS_23960 2045 1224 gene locus_tag LOCUS_23970 gene yfcO 2045 1224 CDS product fimbrial adhesin YfcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698745.1 protein_id gnl|my_center|LOCUS_23970 2586 2047 gene locus_tag LOCUS_23980 2586 2047 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043398.1 protein_id gnl|my_center|LOCUS_23980 3071 2583 gene locus_tag LOCUS_23990 3071 2583 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232541.1 protein_id gnl|my_center|LOCUS_23990 3565 3068 gene locus_tag LOCUS_24000 3565 3068 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311011.1 protein_id gnl|my_center|LOCUS_24000 4332 3580 gene locus_tag LOCUS_24010 4332 3580 CDS product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281606.1 protein_id gnl|my_center|LOCUS_24010 5248 4352 gene locus_tag LOCUS_24020 5248 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24020 6940 5261 gene locus_tag LOCUS_24030 6940 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24030 7642 7079 gene locus_tag LOCUS_24040 7642 7079 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033316.1 protein_id gnl|my_center|LOCUS_24040 8808 8323 gene locus_tag LOCUS_24050 gene sixA 8808 8323 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195819.1 protein_id gnl|my_center|LOCUS_24050 11155 9011 gene locus_tag LOCUS_24060 gene fadJ 11155 9011 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426176.1 protein_id gnl|my_center|LOCUS_24060 <11856 11155 gene locus_tag LOCUS_24070 <11856 11155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000531952.1:acetyl-CoA C-acyltransferase FadI >Feature sequence112 505 1473 gene locus_tag LOCUS_24080 gene hcr 505 1473 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178677.1 protein_id gnl|my_center|LOCUS_24080 1606 3324 gene locus_tag LOCUS_24090 gene poxB 1606 3324 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815337.1 protein_id gnl|my_center|LOCUS_24090 3361 4362 gene locus_tag LOCUS_24100 gene ltaE 3361 4362 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566376.1 protein_id gnl|my_center|LOCUS_24100 4373 5803 gene locus_tag LOCUS_24110 4373 5803 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136554.1 protein_id gnl|my_center|LOCUS_24110 5866 6915 gene locus_tag LOCUS_24120 5866 6915 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069300.1 protein_id gnl|my_center|LOCUS_24120 7742 6912 gene locus_tag LOCUS_24130 gene amiD 7742 6912 CDS product N-acetylmuramoyl-L-alanine amidase AmiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252135.1 protein_id gnl|my_center|LOCUS_24130 8062 7739 gene locus_tag LOCUS_24140 8062 7739 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160737.1 protein_id gnl|my_center|LOCUS_24140 8188 8703 gene locus_tag LOCUS_24150 8188 8703 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270734.1 protein_id gnl|my_center|LOCUS_24150 8849 9649 gene locus_tag LOCUS_24160 gene artP 8849 9649 CDS product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027205.1 protein_id gnl|my_center|LOCUS_24160 9667 10398 gene locus_tag LOCUS_24170 gene artJ 9667 10398 CDS product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756569.1 protein_id gnl|my_center|LOCUS_24170 10405 11121 gene locus_tag LOCUS_24180 gene artQ 10405 11121 CDS product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001691.1 protein_id gnl|my_center|LOCUS_24180 11121 11789 gene locus_tag LOCUS_24190 gene artM 11121 11789 CDS product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464491.1 protein_id gnl|my_center|LOCUS_24190 >Feature sequence113 1464 1144 gene locus_tag LOCUS_24200 gene psiF 1464 1144 CDS product phosphate starvation-inducible protein PsiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295332.1 protein_id gnl|my_center|LOCUS_24200 2998 1583 gene locus_tag LOCUS_24210 gene phoA 2998 1583 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814403.1 protein_id gnl|my_center|LOCUS_24210 3359 3099 gene locus_tag LOCUS_24220 gene iraP 3359 3099 CDS product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792970.1 protein_id gnl|my_center|LOCUS_24220 3822 4916 gene locus_tag LOCUS_24230 gene ddlA 3822 4916 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413677.1 protein_id gnl|my_center|LOCUS_24230 5152 4940 gene locus_tag LOCUS_24240 5152 4940 CDS product DUF2754 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295334.1 protein_id gnl|my_center|LOCUS_24240 5412 5720 gene locus_tag LOCUS_24250 5412 5720 CDS product YaiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763151.1 protein_id gnl|my_center|LOCUS_24250 6873 5779 gene locus_tag LOCUS_24260 gene yaiW 6873 5779 CDS product surface-exposed outer membrane lipoprotein YaiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092067.1 protein_id gnl|my_center|LOCUS_24260 8106 6886 gene locus_tag LOCUS_24270 gene sbmA 8106 6886 CDS product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301663.1 protein_id gnl|my_center|LOCUS_24270 8458 9615 gene locus_tag LOCUS_24280 gene ampH 8458 9615 CDS product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830741.1 protein_id gnl|my_center|LOCUS_24280 10239 9616 gene locus_tag LOCUS_24290 gene iprA 10239 9616 CDS product hydrogen peroxide resistance inhibitor IprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295335.1 protein_id gnl|my_center|LOCUS_24290 <11792 10327 gene locus_tag LOCUS_24300 <11792 10327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000556441.1:autotransporter outer membrane beta-barrel domain-containing protein >Feature sequence114 499 1074 gene locus_tag LOCUS_24310 499 1074 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749261.1 protein_id gnl|my_center|LOCUS_24310 2168 1116 gene locus_tag LOCUS_24320 2168 1116 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144615.1 protein_id gnl|my_center|LOCUS_24320 2393 3313 gene locus_tag LOCUS_24330 gene lpxL 2393 3313 CDS product kdo(2)-lipid IV(A) lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183364.1 protein_id gnl|my_center|LOCUS_24330 3485 4711 gene locus_tag LOCUS_24340 gene mdtG 3485 4711 CDS product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074172.1 protein_id gnl|my_center|LOCUS_24340 4794 5168 gene locus_tag LOCUS_24350 4794 5168 CDS product acidic protein MsyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180056.1 protein_id gnl|my_center|LOCUS_24350 5396 5169 gene locus_tag LOCUS_24360 5396 5169 CDS product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237205.1 protein_id gnl|my_center|LOCUS_24360 8112 5569 gene locus_tag LOCUS_24370 gene mdoH 8112 5569 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295445.1 protein_id gnl|my_center|LOCUS_24370 9658 8105 gene locus_tag LOCUS_24380 gene mdoG 9658 8105 CDS product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001343212.1 protein_id gnl|my_center|LOCUS_24380 10034 11191 gene locus_tag LOCUS_24390 gene mdoC 10034 11191 CDS product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070375.1 protein_id gnl|my_center|LOCUS_24390 11444 11199 gene locus_tag LOCUS_24400 11444 11199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 >Feature sequence115 580 686 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3191 750 gene locus_tag LOCUS_24410 gene rnr 3191 750 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076332.1 protein_id gnl|my_center|LOCUS_24410 3655 3230 gene locus_tag LOCUS_24420 gene nsrR 3655 3230 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177639.1 protein_id gnl|my_center|LOCUS_24420 5158 3860 gene locus_tag LOCUS_24430 gene purA 5158 3860 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527955.1 protein_id gnl|my_center|LOCUS_24430 5459 5262 gene locus_tag LOCUS_24440 5459 5262 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089295.1 protein_id gnl|my_center|LOCUS_24440 6545 5541 gene locus_tag LOCUS_24450 gene hflC 6545 5541 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232412.1 protein_id gnl|my_center|LOCUS_24450 7570 6548 gene locus_tag LOCUS_24460 gene hflK 7570 6548 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312488.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24460 7805 7506 gene locus_tag LOCUS_24470 7805 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24470 9171 7891 gene locus_tag LOCUS_24480 gene hflX 9171 7891 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460362.1 protein_id gnl|my_center|LOCUS_24480 9555 9247 gene locus_tag LOCUS_24490 gene hfq 9555 9247 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051883.1 protein_id gnl|my_center|LOCUS_24490 10591 9641 gene locus_tag LOCUS_24500 10591 9641 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280345.1 protein_id gnl|my_center|LOCUS_24500 <11590 10584 gene locus_tag LOCUS_24510 <11590 10584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001122505.1:DNA mismatch repair endonuclease MutL >Feature sequence116 1519 431 gene locus_tag LOCUS_24520 1519 431 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065016.1 protein_id gnl|my_center|LOCUS_24520 2379 1522 gene locus_tag LOCUS_24530 gene nfo 2379 1522 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873894.1 protein_id gnl|my_center|LOCUS_24530 3502 2453 gene locus_tag LOCUS_24540 3502 2453 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182053.1 protein_id gnl|my_center|LOCUS_24540 3676 4482 gene locus_tag LOCUS_24550 gene yieE 3676 4482 CDS product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548294.1 protein_id gnl|my_center|LOCUS_24550 4687 6156 gene locus_tag LOCUS_24560 gene lysP 4687 6156 CDS product lysine-specific permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253273.1 protein_id gnl|my_center|LOCUS_24560 6546 8441 gene locus_tag LOCUS_24570 gene cirA 6546 8441 CDS product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489247.1 protein_id gnl|my_center|LOCUS_24570 9309 8473 gene locus_tag LOCUS_24580 gene yeiG 9309 8473 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425438.1 protein_id gnl|my_center|LOCUS_24580 9567 10235 gene locus_tag LOCUS_24590 gene folE 9567 10235 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139613.1 protein_id gnl|my_center|LOCUS_24590 10252 11409 gene locus_tag LOCUS_24600 gene yeiB 10252 11409 CDS product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440926.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence117 1311 355 gene locus_tag LOCUS_24610 gene rseB 1311 355 CDS product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812053.1 protein_id gnl|my_center|LOCUS_24610 1961 1311 gene locus_tag LOCUS_24620 gene rseA 1961 1311 CDS product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168459.1 protein_id gnl|my_center|LOCUS_24620 2569 1994 gene locus_tag LOCUS_24630 gene rpoE 2569 1994 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295364.1 protein_id gnl|my_center|LOCUS_24630 2977 4599 gene locus_tag LOCUS_24640 gene nadB 2977 4599 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094491.1 protein_id gnl|my_center|LOCUS_24640 5243 4584 gene locus_tag LOCUS_24650 gene trmN 5243 4584 CDS product tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295363.1 protein_id gnl|my_center|LOCUS_24650 5453 6787 gene locus_tag LOCUS_24660 gene srmB 5453 6787 CDS product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219203.1 protein_id gnl|my_center|LOCUS_24660 6852 6967 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8444 8539 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9131 9820 gene locus_tag LOCUS_24670 gene ung 9131 9820 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262716.1 protein_id gnl|my_center|LOCUS_24670 10905 9868 gene locus_tag LOCUS_24680 10905 9868 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997403.1 protein_id gnl|my_center|LOCUS_24680 >Feature sequence118 1020 271 gene locus_tag LOCUS_24690 gene btuD 1020 271 CDS product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029474.1 protein_id gnl|my_center|LOCUS_24690 1571 1020 gene locus_tag LOCUS_24700 gene btuE 1571 1020 CDS product bifunctional thioredoxin/glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154168.1 protein_id gnl|my_center|LOCUS_24700 2614 1634 gene locus_tag LOCUS_24710 gene btuC 2614 1634 CDS product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956528.1 protein_id gnl|my_center|LOCUS_24710 3014 2715 gene locus_tag LOCUS_24720 gene ihfA 3014 2715 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229265.1 protein_id gnl|my_center|LOCUS_24720 5406 3019 gene locus_tag LOCUS_24730 gene pheT 5406 3019 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672380.1 protein_id gnl|my_center|LOCUS_24730 6404 5421 gene locus_tag LOCUS_24740 gene pheS 6404 5421 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018596.1 protein_id gnl|my_center|LOCUS_24740 7211 6855 gene locus_tag LOCUS_24750 gene rplT 7211 6855 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124850.1 protein_id gnl|my_center|LOCUS_24750 7461 7264 gene locus_tag LOCUS_24760 gene rpmI 7461 7264 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124225.1 protein_id gnl|my_center|LOCUS_24760 7992 7558 gene locus_tag LOCUS_24770 gene infC 7992 7558 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058403.1 protein_id gnl|my_center|LOCUS_24770 10032 8104 gene locus_tag LOCUS_24780 gene thrS 10032 8104 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144202.1 protein_id gnl|my_center|LOCUS_24780 10556 11029 gene locus_tag LOCUS_24790 10556 11029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24790 >Feature sequence119 405 1007 gene locus_tag LOCUS_24800 gene ais 405 1007 CDS product lipopolysaccharide core heptose(II)-phosphate phosphatase Ais inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879112.1 protein_id gnl|my_center|LOCUS_24800 1471 1046 gene locus_tag LOCUS_24810 gene nudI 1471 1046 CDS product nucleoside triphosphatase NudI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300564.1 protein_id gnl|my_center|LOCUS_24810 1750 2292 gene locus_tag LOCUS_24820 1750 2292 CDS product YfaZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300392.1 protein_id gnl|my_center|LOCUS_24820 2392 3594 gene locus_tag LOCUS_24830 2392 3594 CDS product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921621.1 protein_id gnl|my_center|LOCUS_24830 3814 4596 gene locus_tag LOCUS_24840 3814 4596 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894185.1 protein_id gnl|my_center|LOCUS_24840 4611 5816 gene locus_tag LOCUS_24850 gene rhmD 4611 5816 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001319848.1 protein_id gnl|my_center|LOCUS_24850 5873 7162 gene locus_tag LOCUS_24860 5873 7162 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100890.1 protein_id gnl|my_center|LOCUS_24860 7180 7983 gene locus_tag LOCUS_24870 gene yfaU 7180 7983 CDS product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992954.1 protein_id gnl|my_center|LOCUS_24870 8926 8024 gene locus_tag LOCUS_24880 8926 8024 CDS product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140553.1 protein_id gnl|my_center|LOCUS_24880 10309 9119 gene locus_tag LOCUS_24890 gene glpC 10309 9119 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000379.1 protein_id gnl|my_center|LOCUS_24890 <11086 10306 gene locus_tag LOCUS_24900 <11086 10306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001209927.1:glycerol-3-phosphate dehydrogenase subunit GlpB >Feature sequence120 1001 291 gene locus_tag LOCUS_24910 gene ecpE 1001 291 CDS product fimbrial chaperone EcpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350485.1 protein_id gnl|my_center|LOCUS_24910 2541 970 gene locus_tag LOCUS_24920 gene ecpD 2541 970 CDS product fimbrial adhesin EcpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310578.1 protein_id gnl|my_center|LOCUS_24920 3127 2603 gene locus_tag LOCUS_24930 3127 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24930 5165 3054 gene locus_tag LOCUS_24940 gene ecpC 5165 3054 CDS product fimbrial usher EcpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131096.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24940 5859 5191 gene locus_tag LOCUS_24950 gene ecpB 5859 5191 CDS product fimbrial chaperone EcpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716398.1 protein_id gnl|my_center|LOCUS_24950 6504 5917 gene locus_tag LOCUS_24960 gene ecpA 6504 5917 CDS product common pilus major fimbrillin subunit EcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730972.1 protein_id gnl|my_center|LOCUS_24960 7121 6579 gene locus_tag LOCUS_24970 gene ecpR 7121 6579 CDS product ECP biosynthesis operon DNA-binding transcriptional regulator EcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220247.1 protein_id gnl|my_center|LOCUS_24970 8005 8172 gene locus_tag LOCUS_24980 8005 8172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 8613 8347 gene locus_tag LOCUS_24990 8613 8347 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803998.1 protein_id gnl|my_center|LOCUS_24990 10190 11077 gene locus_tag LOCUS_25000 10190 11077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 >Feature sequence121 716 177 gene locus_tag LOCUS_25010 gene hofN 716 177 CDS product DNA utilization protein HofN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069315.1 protein_id gnl|my_center|LOCUS_25010 1495 716 gene locus_tag LOCUS_25020 gene hofM 1495 716 CDS product DNA utilization protein HofM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295166.1 protein_id gnl|my_center|LOCUS_25020 1636 4167 gene locus_tag LOCUS_25030 gene mrcA 1636 4167 CDS product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336003.1 protein_id gnl|my_center|LOCUS_25030 4893 4333 gene locus_tag LOCUS_25040 gene nudE 4893 4333 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045744.1 protein_id gnl|my_center|LOCUS_25040 5213 7348 gene locus_tag LOCUS_25050 gene igaA 5213 7348 CDS product intracellular growth attenuator protein IgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104533.1 protein_id gnl|my_center|LOCUS_25050 7413 8081 gene locus_tag LOCUS_25060 gene yrfG 7413 8081 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936227.1 protein_id gnl|my_center|LOCUS_25060 8092 8493 gene locus_tag LOCUS_25070 gene hslR 8092 8493 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660483.1 protein_id gnl|my_center|LOCUS_25070 8518 9216 gene locus_tag LOCUS_25080 8518 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25080 9188 9391 gene locus_tag LOCUS_25090 9188 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25090 10962 9454 gene locus_tag LOCUS_25100 10962 9454 CDS product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370879.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence122 946 29 gene locus_tag LOCUS_25110 946 29 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904502.1 protein_id gnl|my_center|LOCUS_25110 1092 1769 gene locus_tag LOCUS_25120 gene fetA 1092 1769 CDS product iron ABC transporter ATP-binding protein FetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157540.1 protein_id gnl|my_center|LOCUS_25120 1756 2535 gene locus_tag LOCUS_25130 gene fetB 1756 2535 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295323.1 protein_id gnl|my_center|LOCUS_25130 3452 2598 gene locus_tag LOCUS_25140 gene cnoX 3452 2598 CDS product chaperedoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300573.1 protein_id gnl|my_center|LOCUS_25140 4322 3513 gene locus_tag LOCUS_25150 gene ybbO 4322 3513 CDS product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148959.1 protein_id gnl|my_center|LOCUS_25150 4968 4312 gene locus_tag LOCUS_25160 gene tesA 4968 4312 CDS product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297298.1 protein_id gnl|my_center|LOCUS_25160 4906 5592 gene locus_tag LOCUS_25170 4906 5592 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110573.1 protein_id gnl|my_center|LOCUS_25170 5589 8003 gene locus_tag LOCUS_25180 5589 8003 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561872.1 protein_id gnl|my_center|LOCUS_25180 >Feature sequence123 661 110 gene locus_tag LOCUS_25190 gene yjgA 661 110 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166270.1 protein_id gnl|my_center|LOCUS_25190 755 2107 gene locus_tag LOCUS_25200 gene pmbA 755 2107 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162171.1 protein_id gnl|my_center|LOCUS_25200 2349 2651 gene locus_tag LOCUS_25210 gene cybC 2349 2651 CDS product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232245.1 protein_id gnl|my_center|LOCUS_25210 3160 2696 gene locus_tag LOCUS_25220 gene nrdG 3160 2696 CDS product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106233.1 protein_id gnl|my_center|LOCUS_25220 5456 3318 gene locus_tag LOCUS_25230 gene nrdD 5456 3318 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187778.1 protein_id gnl|my_center|LOCUS_25230 7505 5850 gene locus_tag LOCUS_25240 gene treC 7505 5850 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336303.1 protein_id gnl|my_center|LOCUS_25240 8976 7555 gene locus_tag LOCUS_25250 gene treB 8976 7555 CDS product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001407733.1 protein_id gnl|my_center|LOCUS_25250 10042 9095 gene locus_tag LOCUS_25260 gene treR 10042 9095 CDS product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181307.1 protein_id gnl|my_center|LOCUS_25260 >Feature sequence124 48 704 gene locus_tag LOCUS_25270 gene pphB 48 704 CDS product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141337.1 protein_id gnl|my_center|LOCUS_25270 1522 755 gene locus_tag LOCUS_25280 gene ygbI 1522 755 CDS product DNA-binding transcriptional repressor YgbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300386.1 protein_id gnl|my_center|LOCUS_25280 1718 2626 gene locus_tag LOCUS_25290 1718 2626 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848004.1 protein_id gnl|my_center|LOCUS_25290 2623 3789 gene locus_tag LOCUS_25300 2623 3789 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393459.1 protein_id gnl|my_center|LOCUS_25300 3881 4519 gene locus_tag LOCUS_25310 3881 4519 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278994.1 protein_id gnl|my_center|LOCUS_25310 4524 5300 gene locus_tag LOCUS_25320 4524 5300 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136934.1 protein_id gnl|my_center|LOCUS_25320 5434 6753 gene locus_tag LOCUS_25330 5434 6753 CDS product GntP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104441.1 protein_id gnl|my_center|LOCUS_25330 7839 6847 gene locus_tag LOCUS_25340 gene rpoS 7839 6847 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081588.1 protein_id gnl|my_center|LOCUS_25340 9041 7902 gene locus_tag LOCUS_25350 gene nlpD 9041 7902 CDS product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272590.1 protein_id gnl|my_center|LOCUS_25350 9807 9181 gene locus_tag LOCUS_25360 gene pcm 9807 9181 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254708.1 protein_id gnl|my_center|LOCUS_25360 10562 9801 gene locus_tag LOCUS_25370 gene surE 10562 9801 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295182.1 protein_id gnl|my_center|LOCUS_25370 >Feature sequence125 475 858 gene locus_tag LOCUS_25380 gene drpB 475 858 CDS product cell division protein DrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313057.1 protein_id gnl|my_center|LOCUS_25380 898 1593 gene locus_tag LOCUS_25390 898 1593 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365562.1 protein_id gnl|my_center|LOCUS_25390 1660 3078 gene locus_tag LOCUS_25400 gene dcm 1660 3078 CDS product DNA-cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157239.1 protein_id gnl|my_center|LOCUS_25400 3059 3529 gene locus_tag LOCUS_25410 gene vsr 3059 3529 CDS product VSPR family DNA mismatch endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786005.1 protein_id gnl|my_center|LOCUS_25410 4438 3518 gene locus_tag LOCUS_25420 gene yedA 4438 3518 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212226.1 protein_id gnl|my_center|LOCUS_25420 4611 5528 gene locus_tag LOCUS_25430 4611 5528 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922686.1 protein_id gnl|my_center|LOCUS_25430 5607 5789 gene locus_tag LOCUS_25440 5607 5789 CDS product DUF2158 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009307.1 protein_id gnl|my_center|LOCUS_25440 5978 7654 gene locus_tag LOCUS_25450 gene dgcQ 5978 7654 CDS product cellulose biosynthesis regulator diguanylate cyclase DgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350521.1 protein_id gnl|my_center|LOCUS_25450 8466 7651 gene locus_tag LOCUS_25460 8466 7651 CDS product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491520.1 protein_id gnl|my_center|LOCUS_25460 8991 8764 gene locus_tag LOCUS_25470 gene yodD 8991 8764 CDS product peroxide/acid resistance protein YodD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844800.1 protein_id gnl|my_center|LOCUS_25470 9154 9342 gene locus_tag LOCUS_25480 gene dsrB 9154 9342 CDS product protein DsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867217.1 protein_id gnl|my_center|LOCUS_25480 10009 9386 gene locus_tag LOCUS_25490 gene rcsA 10009 9386 CDS product transcriptional regulator RcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104001.1 protein_id gnl|my_center|LOCUS_25490 >Feature sequence126 1122 1886 gene locus_tag LOCUS_25500 1122 1886 CDS product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692135.1 protein_id gnl|my_center|LOCUS_25500 1906 2844 gene locus_tag LOCUS_25510 1906 2844 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080722.1 protein_id gnl|my_center|LOCUS_25510 2900 4189 gene locus_tag LOCUS_25520 2900 4189 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278525.1 protein_id gnl|my_center|LOCUS_25520 4186 4479 gene locus_tag LOCUS_25530 4186 4479 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081081.1 protein_id gnl|my_center|LOCUS_25530 4482 6182 gene locus_tag LOCUS_25540 gene fadK 4482 6182 CDS product medium-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553704.1 protein_id gnl|my_center|LOCUS_25540 8617 6239 gene locus_tag LOCUS_25550 gene ppsA 8617 6239 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069375.1 protein_id gnl|my_center|LOCUS_25550 9031 9783 gene locus_tag LOCUS_25560 gene ppsR 9031 9783 CDS product posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368046.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence127 <1 2433 gene locus_tag LOCUS_25570 <1 2433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001126348.1:carbamoyl-phosphate synthase large subunit 2660 2481 gene locus_tag LOCUS_25580 2660 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 2695 3090 gene locus_tag LOCUS_25590 gene caiF 2695 3090 CDS product carnitine metabolism transcriptional regulator CaiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333125.1 protein_id gnl|my_center|LOCUS_25590 3766 3176 gene locus_tag LOCUS_25600 gene caiE 3766 3176 CDS product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122871.1 protein_id gnl|my_center|LOCUS_25600 4557 3772 gene locus_tag LOCUS_25610 gene caiD 4557 3772 CDS product crotonobetainyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295419.1 protein_id gnl|my_center|LOCUS_25610 6234 4666 gene locus_tag LOCUS_25620 gene caiC 6234 4666 CDS product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350478.1 protein_id gnl|my_center|LOCUS_25620 7510 6293 gene locus_tag LOCUS_25630 gene caiB 7510 6293 CDS product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349936.1 protein_id gnl|my_center|LOCUS_25630 8781 7639 gene locus_tag LOCUS_25640 gene caiA 8781 7639 CDS product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347117.1 protein_id gnl|my_center|LOCUS_25640 10152 8812 gene locus_tag LOCUS_25650 gene caiT 10152 8812 CDS product L-carnitine/gamma-butyrobetaine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787104.1 protein_id gnl|my_center|LOCUS_25650 >Feature sequence128 1104 178 gene locus_tag LOCUS_25660 gene gluQRS 1104 178 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937424.1 protein_id gnl|my_center|LOCUS_25660 1596 1141 gene locus_tag LOCUS_25670 gene dksA 1596 1141 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155227.1 protein_id gnl|my_center|LOCUS_25670 2478 1774 gene locus_tag LOCUS_25680 gene sfsA 2478 1774 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000396036.1 protein_id gnl|my_center|LOCUS_25680 3023 2493 gene locus_tag LOCUS_25690 gene thpR 3023 2493 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294700.1 protein_id gnl|my_center|LOCUS_25690 3052 5526 gene locus_tag LOCUS_25700 gene hrpB 3052 5526 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938639.1 protein_id gnl|my_center|LOCUS_25700 5529 5735 gene locus_tag LOCUS_25710 5529 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 5722 8256 gene locus_tag LOCUS_25720 gene mrcB 5722 8256 CDS product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918162.1 protein_id gnl|my_center|LOCUS_25720 >Feature sequence129 <1 1711 gene locus_tag LOCUS_25730 <1 1711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000965936.1:fatty acid oxidation complex subunit alpha FadB 1721 2884 gene locus_tag LOCUS_25740 gene fadA 1721 2884 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438725.1 protein_id gnl|my_center|LOCUS_25740 3966 3265 gene locus_tag LOCUS_25750 gene fre 3966 3265 CDS product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209826.1 protein_id gnl|my_center|LOCUS_25750 5505 4012 gene locus_tag LOCUS_25760 gene ubiD 5505 4012 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339804.1 protein_id gnl|my_center|LOCUS_25760 5672 6160 gene locus_tag LOCUS_25770 gene rfaH 5672 6160 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192396.1 protein_id gnl|my_center|LOCUS_25770 6939 6157 gene locus_tag LOCUS_25780 gene tatD 6939 6157 CDS product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459630.1 protein_id gnl|my_center|LOCUS_25780 7757 6981 gene locus_tag LOCUS_25790 gene tatC 7757 6981 CDS product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109942.1 protein_id gnl|my_center|LOCUS_25790 8275 7760 gene locus_tag LOCUS_25800 gene tatB 8275 7760 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459594.1 protein_id gnl|my_center|LOCUS_25800 8548 8279 gene locus_tag LOCUS_25810 gene tatA 8548 8279 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295260.1 protein_id gnl|my_center|LOCUS_25810 10138 8627 gene locus_tag LOCUS_25820 gene ubiB 10138 8627 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187530.1 protein_id gnl|my_center|LOCUS_25820 >Feature sequence130 1283 24 gene locus_tag LOCUS_25830 gene rhaA 1283 24 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311268.1 protein_id gnl|my_center|LOCUS_25830 2749 1280 gene locus_tag LOCUS_25840 gene rhaB 2749 1280 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144073.1 protein_id gnl|my_center|LOCUS_25840 3037 3873 gene locus_tag LOCUS_25850 gene rhaS 3037 3873 CDS product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217137.1 protein_id gnl|my_center|LOCUS_25850 4010 4795 gene locus_tag LOCUS_25860 gene rhaR 4010 4795 CDS product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336056.1 protein_id gnl|my_center|LOCUS_25860 5826 4792 gene locus_tag LOCUS_25870 gene rhaT 5826 4792 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063526.1 protein_id gnl|my_center|LOCUS_25870 6111 6731 gene locus_tag LOCUS_25880 gene sodA 6111 6731 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122641.1 protein_id gnl|my_center|LOCUS_25880 6991 7974 gene locus_tag LOCUS_25890 gene kdgT 6991 7974 CDS product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166063.1 protein_id gnl|my_center|LOCUS_25890 8123 8797 gene locus_tag LOCUS_25900 gene yiiM 8123 8797 CDS product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270260.1 protein_id gnl|my_center|LOCUS_25900 8869 8875 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9883 8909 gene locus_tag LOCUS_25910 9883 8909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 >Feature sequence131 1625 333 gene locus_tag LOCUS_25920 gene pbp4b 1625 333 CDS product penicillin binding protein PBP4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001327042.1 protein_id gnl|my_center|LOCUS_25920 3066 1642 gene locus_tag LOCUS_25930 gene murP 3066 1642 CDS product PTS N-acetylmuramic acid transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040483.1 protein_id gnl|my_center|LOCUS_25930 3966 3070 gene locus_tag LOCUS_25940 gene murQ 3966 3070 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159160.1 protein_id gnl|my_center|LOCUS_25940 4130 4987 gene locus_tag LOCUS_25950 gene murR 4130 4987 CDS product HTH-type transcriptional regulator MurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966470.1 protein_id gnl|my_center|LOCUS_25950 5116 5907 gene locus_tag LOCUS_25960 gene ucpA 5116 5907 CDS product SDR family oxidoreductase UcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517431.1 protein_id gnl|my_center|LOCUS_25960 6211 7227 gene locus_tag LOCUS_25970 gene cysP 6211 7227 CDS product thiosulfate/sulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290230.1 protein_id gnl|my_center|LOCUS_25970 7227 8060 gene locus_tag LOCUS_25980 gene cysT 7227 8060 CDS product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458406.1 protein_id gnl|my_center|LOCUS_25980 8060 8935 gene locus_tag LOCUS_25990 gene cysW 8060 8935 CDS product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852686.1 protein_id gnl|my_center|LOCUS_25990 8925 9461 gene locus_tag LOCUS_26000 8925 9461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26000 >Feature sequence132 1670 558 gene locus_tag LOCUS_26010 gene potF 1670 558 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126072.1 protein_id gnl|my_center|LOCUS_26010 2497 2021 gene locus_tag LOCUS_26020 2497 2021 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203025.1 protein_id gnl|my_center|LOCUS_26020 3487 2585 gene locus_tag LOCUS_26030 gene rimK 3487 2585 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684321.1 protein_id gnl|my_center|LOCUS_26030 4270 3548 gene locus_tag LOCUS_26040 gene nfsA 4270 3548 CDS product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189159.1 protein_id gnl|my_center|LOCUS_26040 4541 4254 gene locus_tag LOCUS_26050 4541 4254 CDS product DUF1418 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201560.1 protein_id gnl|my_center|LOCUS_26050 4701 4958 gene locus_tag LOCUS_26060 gene grxA 4701 4958 CDS product glutaredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195240.1 protein_id gnl|my_center|LOCUS_26060 5635 7320 gene locus_tag LOCUS_26070 5635 7320 CDS product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024876.1 protein_id gnl|my_center|LOCUS_26070 8031 7495 gene locus_tag LOCUS_26080 gene rcdA 8031 7495 CDS product DNA-binding transcriptional regulator RcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295289.1 protein_id gnl|my_center|LOCUS_26080 8115 9323 gene locus_tag LOCUS_26090 8115 9323 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217859.1 protein_id gnl|my_center|LOCUS_26090 >Feature sequence133 454 260 gene locus_tag LOCUS_26100 454 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 766 1296 gene locus_tag LOCUS_26110 gene rppH 766 1296 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564489.1 protein_id gnl|my_center|LOCUS_26110 1309 3555 gene locus_tag LOCUS_26120 gene ptsP 1309 3555 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957910.1 protein_id gnl|my_center|LOCUS_26120 3706 4581 gene locus_tag LOCUS_26130 gene lgt 3706 4581 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204658.1 protein_id gnl|my_center|LOCUS_26130 4588 5382 gene locus_tag LOCUS_26140 gene thyA 4588 5382 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816232.1 protein_id gnl|my_center|LOCUS_26140 5566 6036 gene locus_tag LOCUS_26150 5566 6036 CDS product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 protein_id gnl|my_center|LOCUS_26150 6027 6590 gene locus_tag LOCUS_26160 6027 6590 CDS product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144315.1 protein_id gnl|my_center|LOCUS_26160 6587 6994 gene locus_tag LOCUS_26170 6587 6994 CDS product DUF2509 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078376.1 protein_id gnl|my_center|LOCUS_26170 6979 7302 gene locus_tag LOCUS_26180 6979 7302 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276460.1 protein_id gnl|my_center|LOCUS_26180 >Feature sequence134 <1 1210 gene locus_tag LOCUS_26190 <1 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001269327.1:autotransporter assembly complex protein TamA 1207 4986 gene locus_tag LOCUS_26200 gene tamB 1207 4986 CDS product autotransporter assembly complex protein TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060911.1 protein_id gnl|my_center|LOCUS_26200 4989 5330 gene locus_tag LOCUS_26210 4989 5330 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219160.1 protein_id gnl|my_center|LOCUS_26210 5542 5793 gene locus_tag LOCUS_26220 gene chpS 5542 5793 CDS product type II toxin-antitoxin system antitoxin ChpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223208.1 protein_id gnl|my_center|LOCUS_26220 5787 6137 gene locus_tag LOCUS_26230 gene chpB 5787 6137 CDS product endoribonuclease toxin ChpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239577.1 protein_id gnl|my_center|LOCUS_26230 6747 6217 gene locus_tag LOCUS_26240 gene ppa 6747 6217 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055075.1 protein_id gnl|my_center|LOCUS_26240 7057 8013 gene locus_tag LOCUS_26250 gene ytfQ 7057 8013 CDS product galactofuranose ABC transporter substrate-binding protein YtfQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265913.1 protein_id gnl|my_center|LOCUS_26250 8153 9655 gene locus_tag LOCUS_26260 8153 9655 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205805.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence135 212 1153 gene locus_tag LOCUS_26270 212 1153 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091499.1 protein_id gnl|my_center|LOCUS_26270 1204 2490 gene locus_tag LOCUS_26280 1204 2490 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287715.1 protein_id gnl|my_center|LOCUS_26280 2487 2774 gene locus_tag LOCUS_26290 gene fixX 2487 2774 CDS product ferredoxin-like protein FixX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203741.1 protein_id gnl|my_center|LOCUS_26290 2831 4162 gene locus_tag LOCUS_26300 2831 4162 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183198.1 protein_id gnl|my_center|LOCUS_26300 4270 4800 gene locus_tag LOCUS_26310 gene kefF 4270 4800 CDS product glutathione-regulated potassium-efflux system oxidoreductase KefF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600725.1 protein_id gnl|my_center|LOCUS_26310 4793 6655 gene locus_tag LOCUS_26320 gene kefC 4793 6655 CDS product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377098.1 protein_id gnl|my_center|LOCUS_26320 6736 7326 gene locus_tag LOCUS_26330 gene folA 6736 7326 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301983.1 protein_id gnl|my_center|LOCUS_26330 8246 7404 gene locus_tag LOCUS_26340 gene apaH 8246 7404 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257192.1 protein_id gnl|my_center|LOCUS_26340 8630 8253 gene locus_tag LOCUS_26350 gene apaG 8630 8253 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610901.1 protein_id gnl|my_center|LOCUS_26350 9454 8633 gene locus_tag LOCUS_26360 gene rsmA 9454 8633 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065381.1 protein_id gnl|my_center|LOCUS_26360 >Feature sequence136 2032 797 gene locus_tag LOCUS_26370 gene narK 2032 797 CDS product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019827.1 protein_id gnl|my_center|LOCUS_26370 2501 2283 gene locus_tag LOCUS_26380 2501 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069498.1 protein_id gnl|my_center|LOCUS_26380 2527 4323 gene locus_tag LOCUS_26390 gene narX 2527 4323 CDS product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918073.1 protein_id gnl|my_center|LOCUS_26390 4316 4966 gene locus_tag LOCUS_26400 gene narL 4316 4966 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070491.1 protein_id gnl|my_center|LOCUS_26400 6361 4967 gene locus_tag LOCUS_26410 gene ychO 6361 4967 CDS product inverse autotransporter invasin YchO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086217.1 protein_id gnl|my_center|LOCUS_26410 6546 6899 gene locus_tag LOCUS_26420 gene ychN 6546 6899 CDS product DsrE/F sulfur relay family protein YchN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169669.1 protein_id gnl|my_center|LOCUS_26420 7617 6943 gene locus_tag LOCUS_26430 gene chaC 7617 6943 CDS product glutathione-specific gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336325.1 protein_id gnl|my_center|LOCUS_26430 8026 7796 gene locus_tag LOCUS_26440 gene chaB 8026 7796 CDS product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146444.1 protein_id gnl|my_center|LOCUS_26440 8296 9396 gene locus_tag LOCUS_26450 gene chaA 8296 9396 CDS product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063607.1 protein_id gnl|my_center|LOCUS_26450 >Feature sequence137 521 865 gene locus_tag LOCUS_26460 521 865 CDS product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202798.1 protein_id gnl|my_center|LOCUS_26460 2458 869 gene locus_tag LOCUS_26470 gene yejF 2458 869 CDS product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194927.1 protein_id gnl|my_center|LOCUS_26470 3485 2460 gene locus_tag LOCUS_26480 3485 2460 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088923.1 protein_id gnl|my_center|LOCUS_26480 4579 3485 gene locus_tag LOCUS_26490 4579 3485 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501604.1 protein_id gnl|my_center|LOCUS_26490 6400 4580 gene locus_tag LOCUS_26500 6400 4580 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637046.1 protein_id gnl|my_center|LOCUS_26500 7969 6476 gene locus_tag LOCUS_26510 7969 6476 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470560.1 protein_id gnl|my_center|LOCUS_26510 8779 8213 gene locus_tag LOCUS_26520 gene mepS 8779 8213 CDS product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241011.1 protein_id gnl|my_center|LOCUS_26520 >Feature sequence138 647 730 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1402 2289 gene locus_tag LOCUS_26530 1402 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26530 2217 2284 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2286 2924 gene locus_tag LOCUS_26540 2286 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26540 2877 2918 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3026 3457 gene locus_tag LOCUS_26550 3026 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26550 3529 3635 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4139 3954 gene locus_tag LOCUS_26560 4139 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001328114.1 protein_id gnl|my_center|LOCUS_26560 4453 5547 gene locus_tag LOCUS_26570 gene pdeL 4453 5547 CDS product DNA-binding transcriptional activator/c-di-GMP phosphodiesterase PdeL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301264.1 protein_id gnl|my_center|LOCUS_26570 6521 5589 gene locus_tag LOCUS_26580 6521 5589 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084394.1 protein_id gnl|my_center|LOCUS_26580 7110 6613 gene locus_tag LOCUS_26590 7110 6613 CDS product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013892.1 protein_id gnl|my_center|LOCUS_26590 7368 7973 gene locus_tag LOCUS_26600 7368 7973 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023635.1 protein_id gnl|my_center|LOCUS_26600 8013 8876 gene locus_tag LOCUS_26610 8013 8876 CDS product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310582.1 protein_id gnl|my_center|LOCUS_26610 >Feature sequence139 1070 1651 gene locus_tag LOCUS_26620 gene acpH 1070 1651 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009885.1 protein_id gnl|my_center|LOCUS_26620 3473 1656 gene locus_tag LOCUS_26630 gene malZ 3473 1656 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930752.1 protein_id gnl|my_center|LOCUS_26630 5002 3629 gene locus_tag LOCUS_26640 gene proY 5002 3629 CDS product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295329.1 protein_id gnl|my_center|LOCUS_26640 6397 5078 gene locus_tag LOCUS_26650 gene brnQ 6397 5078 CDS product branched-chain amino acid transporter carrier protein BrnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149639.1 protein_id gnl|my_center|LOCUS_26650 8099 6804 gene locus_tag LOCUS_26660 gene phoR 8099 6804 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893623.1 protein_id gnl|my_center|LOCUS_26660 8846 8157 gene locus_tag LOCUS_26670 gene phoB 8846 8157 CDS product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113933.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence140 319 591 gene locus_tag LOCUS_26680 319 591 CDS product DUF3811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207634.1 protein_id gnl|my_center|LOCUS_26680 1596 724 gene locus_tag LOCUS_26690 gene rluF 1596 724 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936377.1 protein_id gnl|my_center|LOCUS_26690 1808 2497 gene locus_tag LOCUS_26700 gene pepE 1808 2497 CDS product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421763.1 protein_id gnl|my_center|LOCUS_26700 4219 2588 gene locus_tag LOCUS_26710 4219 2588 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956830.1 protein_id gnl|my_center|LOCUS_26710 6952 4439 gene locus_tag LOCUS_26720 6952 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26720 8122 6983 gene locus_tag LOCUS_26730 8122 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26730 8322 9146 gene locus_tag LOCUS_26740 gene iclR 8322 9146 CDS product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226403.1 protein_id gnl|my_center|LOCUS_26740 >Feature sequence141 738 1538 gene locus_tag LOCUS_26750 gene nagB 738 1538 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237072.1 protein_id gnl|my_center|LOCUS_26750 1598 2746 gene locus_tag LOCUS_26760 gene nagA 1598 2746 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271153.1 protein_id gnl|my_center|LOCUS_26760 2755 3975 gene locus_tag LOCUS_26770 gene nagC 2755 3975 CDS product DNA-binding transcriptional regulator NagC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187594.1 protein_id gnl|my_center|LOCUS_26770 4023 4775 gene locus_tag LOCUS_26780 gene nagD 4023 4775 CDS product ribonucleotide monophosphatase NagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153129.1 protein_id gnl|my_center|LOCUS_26780 5164 6828 gene locus_tag LOCUS_26790 gene asnB 5164 6828 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337077.1 protein_id gnl|my_center|LOCUS_26790 7208 7284 gene locus_tag LOCUS_t00380 7208 7284 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7294 7378 gene locus_tag LOCUS_t00390 7294 7378 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7422 7544 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7578 7654 gene locus_tag LOCUS_t00400 7578 7654 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7702 7776 gene locus_tag LOCUS_t00410 7702 7776 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7814 7888 gene locus_tag LOCUS_t00420 7814 7888 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9217 8042 gene locus_tag LOCUS_26800 gene ubiF 9217 8042 CDS product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184541.1 protein_id gnl|my_center|LOCUS_26800 >Feature sequence142 414 1751 gene locus_tag LOCUS_26810 414 1751 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098105.1 protein_id gnl|my_center|LOCUS_26810 1729 2508 gene locus_tag LOCUS_26820 1729 2508 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299652.1 protein_id gnl|my_center|LOCUS_26820 2505 3365 gene locus_tag LOCUS_26830 2505 3365 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299097.1 protein_id gnl|my_center|LOCUS_26830 4088 3513 gene locus_tag LOCUS_26840 4088 3513 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130266.1 protein_id gnl|my_center|LOCUS_26840 4365 4105 gene locus_tag LOCUS_26850 4365 4105 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109529.1 protein_id gnl|my_center|LOCUS_26850 5657 4356 gene locus_tag LOCUS_26860 5657 4356 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301334.1 protein_id gnl|my_center|LOCUS_26860 6070 5705 gene locus_tag LOCUS_26870 gene queD 6070 5705 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987944.1 protein_id gnl|my_center|LOCUS_26870 6386 8185 gene locus_tag LOCUS_26880 gene cysJ 6386 8185 CDS product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211913.1 protein_id gnl|my_center|LOCUS_26880 >Feature sequence143 1442 246 gene locus_tag LOCUS_26890 1442 246 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860444.1 protein_id gnl|my_center|LOCUS_26890 2123 1566 gene locus_tag LOCUS_26900 2123 1566 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362029.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26900 2785 2561 gene locus_tag LOCUS_26910 2785 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 2739 3701 gene locus_tag LOCUS_26920 gene tauA 2739 3701 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018417.1 protein_id gnl|my_center|LOCUS_26920 3714 4481 gene locus_tag LOCUS_26930 gene tauB 3714 4481 CDS product taurine ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939375.1 protein_id gnl|my_center|LOCUS_26930 4478 5305 gene locus_tag LOCUS_26940 gene tauC 4478 5305 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114620.1 protein_id gnl|my_center|LOCUS_26940 5302 6153 gene locus_tag LOCUS_26950 gene tauD 5302 6153 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004027.1 protein_id gnl|my_center|LOCUS_26950 7234 6260 gene locus_tag LOCUS_26960 gene hemB 7234 6260 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295337.1 protein_id gnl|my_center|LOCUS_26960 7758 9218 gene locus_tag LOCUS_26970 7758 9218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence144 360 1004 gene locus_tag LOCUS_26980 gene cheZ 360 1004 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983609.1 protein_id gnl|my_center|LOCUS_26980 1206 2354 gene locus_tag LOCUS_26990 gene flhB 1206 2354 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278954.1 protein_id gnl|my_center|LOCUS_26990 2347 4425 gene locus_tag LOCUS_27000 gene flhA 2347 4425 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066983.1 protein_id gnl|my_center|LOCUS_27000 4425 4817 gene locus_tag LOCUS_27010 gene flhe 4425 4817 CDS product flagellar protein FlhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259583.1 protein_id gnl|my_center|LOCUS_27010 5425 4937 gene locus_tag LOCUS_27020 5425 4937 CDS product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299676.1 protein_id gnl|my_center|LOCUS_27020 7335 5602 gene locus_tag LOCUS_27030 gene argS 7335 5602 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025322.1 protein_id gnl|my_center|LOCUS_27030 7551 8117 gene locus_tag LOCUS_27040 7551 8117 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326725.1 protein_id gnl|my_center|LOCUS_27040 8131 8877 gene locus_tag LOCUS_27050 gene cutC 8131 8877 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185741.1 protein_id gnl|my_center|LOCUS_27050 >Feature sequence145 1198 764 gene locus_tag LOCUS_27060 gene uspF 1198 764 CDS product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300461.1 protein_id gnl|my_center|LOCUS_27060 2370 1285 gene locus_tag LOCUS_27070 gene ompN 2370 1285 CDS product porin OmpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837921.1 protein_id gnl|my_center|LOCUS_27070 1310 1333 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6261 2737 gene locus_tag LOCUS_27080 gene nifJ 6261 2737 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628244.1 protein_id gnl|my_center|LOCUS_27080 6535 6801 gene locus_tag LOCUS_27090 6535 6801 CDS product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295715.1 protein_id gnl|my_center|LOCUS_27090 7220 6798 gene locus_tag LOCUS_27100 gene hslJ 7220 6798 CDS product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298828.1 protein_id gnl|my_center|LOCUS_27100 8320 7331 gene locus_tag LOCUS_27110 gene ldhA 8320 7331 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762236.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence146 1502 51 gene locus_tag LOCUS_27120 gene djlC 1502 51 CDS product co-chaperone DjlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300403.1 protein_id gnl|my_center|LOCUS_27120 2113 1499 gene locus_tag LOCUS_27130 2113 1499 CDS product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030934.1 protein_id gnl|my_center|LOCUS_27130 2308 2862 gene locus_tag LOCUS_27140 2308 2862 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035674.1 protein_id gnl|my_center|LOCUS_27140 4299 2872 gene locus_tag LOCUS_27150 4299 2872 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786572.1 protein_id gnl|my_center|LOCUS_27150 5003 4296 gene locus_tag LOCUS_27160 5003 4296 CDS product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367023.1 protein_id gnl|my_center|LOCUS_27160 5167 6144 gene locus_tag LOCUS_27170 gene ybeQ 5167 6144 CDS product Sel1 family TPR-like repeat protein YbeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578178.1 protein_id gnl|my_center|LOCUS_27170 6696 6214 gene locus_tag LOCUS_27180 6696 6214 CDS product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044880.1 protein_id gnl|my_center|LOCUS_27180 >Feature sequence147 59 1237 gene locus_tag LOCUS_27190 59 1237 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127781.1 protein_id gnl|my_center|LOCUS_27190 2229 1234 gene locus_tag LOCUS_27200 gene flk 2229 1234 CDS product flagella biosynthesis regulator Flk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615834.1 protein_id gnl|my_center|LOCUS_27200 2328 3464 gene locus_tag LOCUS_27210 gene pdxB 2328 3464 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699148.1 protein_id gnl|my_center|LOCUS_27210 3530 4543 gene locus_tag LOCUS_27220 3530 4543 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289167.1 protein_id gnl|my_center|LOCUS_27220 4543 5355 gene locus_tag LOCUS_27230 gene truA 4543 5355 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283586.1 protein_id gnl|my_center|LOCUS_27230 5438 6097 gene locus_tag LOCUS_27240 5438 6097 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364335.1 protein_id gnl|my_center|LOCUS_27240 6253 7167 gene locus_tag LOCUS_27250 gene accD 6253 7167 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118404.1 protein_id gnl|my_center|LOCUS_27250 7237 8505 gene locus_tag LOCUS_27260 gene folC 7237 8505 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584546.1 protein_id gnl|my_center|LOCUS_27260 >Feature sequence148 2317 305 gene locus_tag LOCUS_27270 gene opgB 2317 305 CDS product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292679.1 protein_id gnl|my_center|LOCUS_27270 3065 2571 gene locus_tag LOCUS_27280 gene yjjA 3065 2571 CDS product DUF2501 domain-containing protein YjjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001308243.1 protein_id gnl|my_center|LOCUS_27280 3851 3114 gene locus_tag LOCUS_27290 gene dnaC 3851 3114 CDS product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799911.1 protein_id gnl|my_center|LOCUS_27290 4393 3854 gene locus_tag LOCUS_27300 gene dnaT 4393 3854 CDS product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098818.1 protein_id gnl|my_center|LOCUS_27300 4973 4500 gene locus_tag LOCUS_27310 4973 4500 CDS product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538191.1 protein_id gnl|my_center|LOCUS_27310 5674 4964 gene locus_tag LOCUS_27320 5674 4964 CDS product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001338213.1 protein_id gnl|my_center|LOCUS_27320 6353 7078 gene locus_tag LOCUS_27330 6353 7078 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936635.1 protein_id gnl|my_center|LOCUS_27330 7090 7713 gene locus_tag LOCUS_27340 gene bglJ 7090 7713 CDS product DNA-binding transcriptional activator BglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094869.1 protein_id gnl|my_center|LOCUS_27340 8539 7751 gene locus_tag LOCUS_27350 gene fhuF 8539 7751 CDS product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331618.1 protein_id gnl|my_center|LOCUS_27350 >Feature sequence149 4770 3055 gene locus_tag LOCUS_27360 gene narQ 4770 3055 CDS product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300881.1 protein_id gnl|my_center|LOCUS_27360 4961 6940 gene locus_tag LOCUS_27370 gene aegA 4961 6940 CDS product formate-dependent uric acid utilization protein AegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078880.1 protein_id gnl|my_center|LOCUS_27370 7008 7583 gene locus_tag LOCUS_27380 gene nudK 7008 7583 CDS product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300814.1 protein_id gnl|my_center|LOCUS_27380 7868 8752 gene locus_tag LOCUS_27390 7868 8752 CDS product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270542.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence150 1899 814 gene locus_tag LOCUS_27400 gene acrA 1899 814 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386618.1 protein_id gnl|my_center|LOCUS_27400 2149 2796 gene locus_tag LOCUS_27410 gene acrR 2149 2796 CDS product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101737.1 protein_id gnl|my_center|LOCUS_27410 2924 6286 gene locus_tag LOCUS_27420 gene mscK 2924 6286 CDS product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177732.1 protein_id gnl|my_center|LOCUS_27420 6659 6498 gene locus_tag LOCUS_27430 gene rsmS 6659 6498 CDS product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051153.1 protein_id gnl|my_center|LOCUS_27430 7200 6673 gene locus_tag LOCUS_27440 gene priC 7200 6673 CDS product primosomal replication protein N'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844874.1 protein_id gnl|my_center|LOCUS_27440 7270 7647 gene locus_tag LOCUS_27450 7270 7647 CDS product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188905.1 protein_id gnl|my_center|LOCUS_27450 7800 8351 gene locus_tag LOCUS_27460 gene apt 7800 8351 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127356.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence151 510 142 gene locus_tag LOCUS_27470 gene yffN 510 142 CDS product protein YffN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683389.1 protein_id gnl|my_center|LOCUS_27470 767 522 gene locus_tag LOCUS_27480 gene yffM 767 522 CDS product protein YffM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723122.1 protein_id gnl|my_center|LOCUS_27480 1113 1159 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1900 1259 gene locus_tag LOCUS_27490 gene yffL 1900 1259 CDS product protein YffL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458337.1 protein_id gnl|my_center|LOCUS_27490 3299 2091 gene locus_tag LOCUS_27500 3299 2091 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047773.1 protein_id gnl|my_center|LOCUS_27500 3478 4839 gene locus_tag LOCUS_27510 gene eutB 3478 4839 CDS product ethanolamine ammonia-lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769961.1 protein_id gnl|my_center|LOCUS_27510 4860 5747 gene locus_tag LOCUS_27520 gene eutC 4860 5747 CDS product ethanolamine ammonia-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372316.1 protein_id gnl|my_center|LOCUS_27520 5757 6179 gene locus_tag LOCUS_27530 5757 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27530 6104 6132 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6353 6853 gene locus_tag LOCUS_27540 gene eutK 6353 6853 CDS product ethanolamine utilization microcompartment protein EutK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606257.1 protein_id gnl|my_center|LOCUS_27540 6899 7951 gene locus_tag LOCUS_27550 gene eutR 6899 7951 CDS product HTH-type transcriptional regulator EutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753690.1 protein_id gnl|my_center|LOCUS_27550 <8619 7957 gene locus_tag LOCUS_27560 <8619 7957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000801365.1:oxygen-dependent coproporphyrinogen oxidase >Feature sequence152 257 1324 gene locus_tag LOCUS_27570 gene hisB 257 1324 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080105.1 protein_id gnl|my_center|LOCUS_27570 1324 1914 gene locus_tag LOCUS_27580 gene hisH 1324 1914 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103560.1 protein_id gnl|my_center|LOCUS_27580 1914 2651 gene locus_tag LOCUS_27590 gene hisA 1914 2651 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586462.1 protein_id gnl|my_center|LOCUS_27590 2633 3409 gene locus_tag LOCUS_27600 gene hisF 2633 3409 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880182.1 protein_id gnl|my_center|LOCUS_27600 3403 4014 gene locus_tag LOCUS_27610 gene hisIE 3403 4014 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954911.1 protein_id gnl|my_center|LOCUS_27610 5090 4110 gene locus_tag LOCUS_27620 gene wzzB 5090 4110 CDS product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393575.1 protein_id gnl|my_center|LOCUS_27620 6402 5236 gene locus_tag LOCUS_27630 gene ugd 6402 5236 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704857.1 protein_id gnl|my_center|LOCUS_27630 8057 6651 gene locus_tag LOCUS_27640 gene gndA 8057 6651 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043484.1 protein_id gnl|my_center|LOCUS_27640 >Feature sequence153 <1 2240 gene locus_tag LOCUS_27650 <1 2240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001267253.1:mechanosensitive channel protein 3163 2237 gene locus_tag LOCUS_27660 gene rlmF 3163 2237 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295299.1 protein_id gnl|my_center|LOCUS_27660 3439 3699 gene locus_tag LOCUS_27670 gene mcbA 3439 3699 CDS product DUF1471 family periplasmic protein McbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710619.1 protein_id gnl|my_center|LOCUS_27670 4002 3754 gene locus_tag LOCUS_27680 4002 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 3964 6246 gene locus_tag LOCUS_27690 3964 6246 CDS product catecholate siderophore receptor Fiu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000430057.1 protein_id gnl|my_center|LOCUS_27690 6288 6965 gene locus_tag LOCUS_27700 gene ybiX 6288 6965 CDS product PKHD-type hydroxylase YbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990177.1 protein_id gnl|my_center|LOCUS_27700 7039 7305 gene locus_tag LOCUS_27710 gene ybiI 7039 7305 CDS product C4-type zinc finger protein YbiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146343.1 protein_id gnl|my_center|LOCUS_27710 7570 7830 gene locus_tag LOCUS_27720 gene ybiJ 7570 7830 CDS product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849301.1 protein_id gnl|my_center|LOCUS_27720 8292 8059 gene locus_tag LOCUS_27730 8292 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 >Feature sequence154 1204 410 gene locus_tag LOCUS_27740 1204 410 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365173.1 protein_id gnl|my_center|LOCUS_27740 1342 1683 gene locus_tag LOCUS_27750 1342 1683 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617184.1 protein_id gnl|my_center|LOCUS_27750 1724 1883 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4533 2029 gene locus_tag LOCUS_27760 gene copA 4533 2029 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083955.1 protein_id gnl|my_center|LOCUS_27760 4795 5727 gene locus_tag LOCUS_27770 gene glsA 4795 5727 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883034.1 protein_id gnl|my_center|LOCUS_27770 5730 7022 gene locus_tag LOCUS_27780 5730 7022 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982172.1 protein_id gnl|my_center|LOCUS_27780 7147 7554 gene locus_tag LOCUS_27790 gene cueR 7147 7554 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026747.1 protein_id gnl|my_center|LOCUS_27790 8013 7555 gene locus_tag LOCUS_27800 8013 7555 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970323.1 protein_id gnl|my_center|LOCUS_27800 >Feature sequence155 1042 116 gene locus_tag LOCUS_27810 1042 116 CDS product aldose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052655.1 protein_id gnl|my_center|LOCUS_27810 2397 1156 gene locus_tag LOCUS_27820 gene yihS 2397 1156 CDS product sulfoquinovose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870916.1 protein_id gnl|my_center|LOCUS_27820 3292 2414 gene locus_tag LOCUS_27830 gene yihT 3292 2414 CDS product sulfofructosephosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046453.1 protein_id gnl|my_center|LOCUS_27830 4212 3316 gene locus_tag LOCUS_27840 gene yihU 4212 3316 CDS product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718893.1 protein_id gnl|my_center|LOCUS_27840 4380 5276 gene locus_tag LOCUS_27850 gene yihV 4380 5276 CDS product sulfofructose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621656.1 protein_id gnl|my_center|LOCUS_27850 5310 6095 gene locus_tag LOCUS_27860 5310 6095 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059678.1 protein_id gnl|my_center|LOCUS_27860 6194 6793 gene locus_tag LOCUS_27870 gene yihX 6194 6793 CDS product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295269.1 protein_id gnl|my_center|LOCUS_27870 6787 7659 gene locus_tag LOCUS_27880 6787 7659 CDS product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920762.1 protein_id gnl|my_center|LOCUS_27880 7656 8093 gene locus_tag LOCUS_27890 gene dtd 7656 8093 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560983.1 protein_id gnl|my_center|LOCUS_27890 >Feature sequence156 <1 619 gene locus_tag LOCUS_27900 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000946934.1:exodeoxyribonuclease V subunit gamma 795 3683 gene locus_tag LOCUS_27910 gene ptrA 795 3683 CDS product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138201.1 protein_id gnl|my_center|LOCUS_27910 3676 7218 gene locus_tag LOCUS_27920 gene recB 3676 7218 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285993.1 protein_id gnl|my_center|LOCUS_27920 >Feature sequence157 119 1270 gene locus_tag LOCUS_27930 gene yiaY 119 1270 CDS product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741518.1 protein_id gnl|my_center|LOCUS_27930 1435 2973 gene locus_tag LOCUS_27940 gene aldB 1435 2973 CDS product aldehyde dehydrogenase AldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183980.1 protein_id gnl|my_center|LOCUS_27940 3404 3192 gene locus_tag LOCUS_27950 3404 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332751.1 protein_id gnl|my_center|LOCUS_27950 3518 3841 gene locus_tag LOCUS_27960 3518 3841 CDS product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478195.1 protein_id gnl|my_center|LOCUS_27960 3847 4983 gene locus_tag LOCUS_27970 3847 4983 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364884.1 protein_id gnl|my_center|LOCUS_27970 5954 4980 gene locus_tag LOCUS_27980 5954 4980 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164036.1 protein_id gnl|my_center|LOCUS_27980 6078 6818 gene locus_tag LOCUS_27990 6078 6818 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906819.1 protein_id gnl|my_center|LOCUS_27990 7860 7165 gene locus_tag LOCUS_28000 gene araD 7860 7165 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893142.1 protein_id gnl|my_center|LOCUS_28000 >Feature sequence158 316 1131 gene locus_tag LOCUS_28010 gene ygiD 316 1131 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188362.1 protein_id gnl|my_center|LOCUS_28010 2329 1169 gene locus_tag LOCUS_28020 2329 1169 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442860.1 protein_id gnl|my_center|LOCUS_28020 2877 2335 gene locus_tag LOCUS_28030 2877 2335 CDS product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831543.1 protein_id gnl|my_center|LOCUS_28030 4635 3154 gene locus_tag LOCUS_28040 gene tolC 4635 3154 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735278.1 protein_id gnl|my_center|LOCUS_28040 4840 5469 gene locus_tag LOCUS_28050 gene nudF 4840 5469 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917117.1 protein_id gnl|my_center|LOCUS_28050 5470 5892 gene locus_tag LOCUS_28060 5470 5892 CDS product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833393.1 protein_id gnl|my_center|LOCUS_28060 5917 6744 gene locus_tag LOCUS_28070 gene cpdA 5917 6744 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444747.1 protein_id gnl|my_center|LOCUS_28070 6744 7325 gene locus_tag LOCUS_28080 gene yqiA 6744 7325 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105733.1 protein_id gnl|my_center|LOCUS_28080 >Feature sequence159 793 14 gene locus_tag LOCUS_28090 793 14 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000563040.1 protein_id gnl|my_center|LOCUS_28090 1863 790 gene locus_tag LOCUS_28100 1863 790 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299799.1 protein_id gnl|my_center|LOCUS_28100 2146 1985 gene locus_tag LOCUS_28110 2146 1985 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176651.1 protein_id gnl|my_center|LOCUS_28110 2878 2273 gene locus_tag LOCUS_28120 gene osmY 2878 2273 CDS product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295748.1 protein_id gnl|my_center|LOCUS_28120 4860 3271 gene locus_tag LOCUS_28130 gene prfC 4860 3271 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175940.1 protein_id gnl|my_center|LOCUS_28130 5628 4951 gene locus_tag LOCUS_28140 gene yjjG 5628 4951 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870710.1 protein_id gnl|my_center|LOCUS_28140 6089 5643 gene locus_tag LOCUS_28150 gene rimI 6089 5643 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092461.1 protein_id gnl|my_center|LOCUS_28150 6471 6058 gene locus_tag LOCUS_28160 gene holD 6471 6058 CDS product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204012.1 protein_id gnl|my_center|LOCUS_28160 6574 7605 gene locus_tag LOCUS_28170 gene rsmC 6574 7605 CDS product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272330.1 protein_id gnl|my_center|LOCUS_28170 7873 7959 gene locus_tag LOCUS_t00430 7873 7959 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7988 8074 gene locus_tag LOCUS_t00440 7988 8074 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence160 2132 1203 gene locus_tag LOCUS_28180 gene ilvE 2132 1203 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208520.1 protein_id gnl|my_center|LOCUS_28180 2415 2152 gene locus_tag LOCUS_28190 gene ilvM 2415 2152 CDS product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983255.1 protein_id gnl|my_center|LOCUS_28190 2948 2412 gene locus_tag LOCUS_28200 2948 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28200 4056 3073 gene locus_tag LOCUS_28210 4056 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28210 4647 6167 gene locus_tag LOCUS_28220 4647 6167 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058964.1 protein_id gnl|my_center|LOCUS_28220 6530 6192 gene locus_tag LOCUS_28230 gene maoP 6530 6192 CDS product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841001.1 protein_id gnl|my_center|LOCUS_28230 6649 7488 gene locus_tag LOCUS_28240 gene hdfR 6649 7488 CDS product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379245.1 protein_id gnl|my_center|LOCUS_28240 7659 7584 gene locus_tag LOCUS_t00450 7659 7584 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 7744 7668 gene locus_tag LOCUS_t00460 7744 7668 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 7912 7802 gene locus_tag LOCUS_r00020 7912 7802 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence161 <1 994 gene locus_tag LOCUS_28250 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000179510.1:mal regulon transcriptional regulator MalI 1106 1873 gene locus_tag LOCUS_28260 gene hdhA 1106 1873 CDS product 7-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483353.1 protein_id gnl|my_center|LOCUS_28260 2094 2684 gene locus_tag LOCUS_28270 gene uidR 2094 2684 CDS product DNA-binding transcriptional regulator UidR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969092.1 protein_id gnl|my_center|LOCUS_28270 3075 4886 gene locus_tag LOCUS_28280 gene uidA 3075 4886 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945878.1 protein_id gnl|my_center|LOCUS_28280 4883 6256 gene locus_tag LOCUS_28290 gene uidB 4883 6256 CDS product glucuronide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075849.1 protein_id gnl|my_center|LOCUS_28290 6307 7560 gene locus_tag LOCUS_28300 gene uidC 6307 7560 CDS product glucuronide uptake porin UidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227023.1 protein_id gnl|my_center|LOCUS_28300 >Feature sequence162 736 5 gene locus_tag LOCUS_28310 gene dnaQ 736 5 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340895.1 protein_id gnl|my_center|LOCUS_28310 801 1268 gene locus_tag LOCUS_28320 gene rnhA 801 1268 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917883.1 protein_id gnl|my_center|LOCUS_28320 1987 1265 gene locus_tag LOCUS_28330 1987 1265 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326702.1 protein_id gnl|my_center|LOCUS_28330 2021 2776 gene locus_tag LOCUS_28340 gene gloB 2021 2776 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052715.1 protein_id gnl|my_center|LOCUS_28340 2986 4206 gene locus_tag LOCUS_28350 gene mltD 2986 4206 CDS product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644685.1 protein_id gnl|my_center|LOCUS_28350 4877 4254 gene locus_tag LOCUS_28360 4877 4254 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016007.1 protein_id gnl|my_center|LOCUS_28360 5684 4881 gene locus_tag LOCUS_28370 5684 4881 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230983.1 protein_id gnl|my_center|LOCUS_28370 5925 6839 gene locus_tag LOCUS_28380 gene yafC 5925 6839 CDS product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648572.1 protein_id gnl|my_center|LOCUS_28380 7639 6836 gene locus_tag LOCUS_28390 gene dkgB 7639 6836 CDS product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997010.1 protein_id gnl|my_center|LOCUS_28390 >Feature sequence163 291 797 gene locus_tag LOCUS_28400 gene tpx 291 797 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084387.1 protein_id gnl|my_center|LOCUS_28400 2382 841 gene locus_tag LOCUS_28410 gene tyrR 2382 841 CDS product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300658.1 protein_id gnl|my_center|LOCUS_28410 3591 2530 gene locus_tag LOCUS_28420 3591 2530 CDS product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138728.1 protein_id gnl|my_center|LOCUS_28420 4985 3588 gene locus_tag LOCUS_28430 4985 3588 CDS product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825775.1 protein_id gnl|my_center|LOCUS_28430 5141 6139 gene locus_tag LOCUS_28440 5141 6139 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075375.1 protein_id gnl|my_center|LOCUS_28440 7155 6250 gene locus_tag LOCUS_28450 gene ompG 7155 6250 CDS product monomeric porin OmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735257.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence164 <1 828 gene locus_tag LOCUS_28460 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000111836.1:acyl-CoA synthetase FdrA 828 2954 gene locus_tag LOCUS_28470 828 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 3056 3595 gene locus_tag LOCUS_28480 3056 3595 CDS product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096705.1 protein_id gnl|my_center|LOCUS_28480 3617 3820 gene locus_tag LOCUS_28490 3617 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 4552 3719 gene locus_tag LOCUS_28500 gene fghA 4552 3719 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000419081.1 protein_id gnl|my_center|LOCUS_28500 5755 4646 gene locus_tag LOCUS_28510 gene frmA 5755 4646 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842106.1 protein_id gnl|my_center|LOCUS_28510 6065 5790 gene locus_tag LOCUS_28520 gene frmR 6065 5790 CDS product formaldehyde-responsive transcriptional repressor FrmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141271.1 protein_id gnl|my_center|LOCUS_28520 7026 6253 gene locus_tag LOCUS_28530 7026 6253 CDS product YaiO family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000596084.1 protein_id gnl|my_center|LOCUS_28530 7471 7028 gene locus_tag LOCUS_28540 7471 7028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 >Feature sequence165 2594 3697 gene locus_tag LOCUS_28550 gene ompC 2594 3697 CDS product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865568.1 protein_id gnl|my_center|LOCUS_28550 3809 4864 gene locus_tag LOCUS_28560 gene apbE 3809 4864 CDS product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406064.1 protein_id gnl|my_center|LOCUS_28560 5204 4986 gene locus_tag LOCUS_28570 5204 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 5187 6002 gene locus_tag LOCUS_28580 gene ada 5187 6002 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710375.1 protein_id gnl|my_center|LOCUS_28580 6002 6652 gene locus_tag LOCUS_28590 gene alkB 6002 6652 CDS product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884971.1 protein_id gnl|my_center|LOCUS_28590 >Feature sequence166 16 534 gene locus_tag LOCUS_28600 16 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 569 1654 gene locus_tag LOCUS_28610 gene aroC 569 1654 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333535.1 protein_id gnl|my_center|LOCUS_28610 1658 2482 gene locus_tag LOCUS_28620 gene mepA 1658 2482 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043825.1 protein_id gnl|my_center|LOCUS_28620 2482 3291 gene locus_tag LOCUS_28630 2482 3291 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447361.1 protein_id gnl|my_center|LOCUS_28630 3291 3839 gene locus_tag LOCUS_28640 gene epmC 3291 3839 CDS product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089222.1 protein_id gnl|my_center|LOCUS_28640 3873 4151 gene locus_tag LOCUS_28650 3873 4151 CDS product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559764.1 protein_id gnl|my_center|LOCUS_28650 6278 4272 gene locus_tag LOCUS_28660 gene mnmC 6278 4272 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683799.1 protein_id gnl|my_center|LOCUS_28660 6437 7657 gene locus_tag LOCUS_28670 gene fabB 6437 7657 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817178.1 protein_id gnl|my_center|LOCUS_28670 >Feature sequence167 150 305 gene locus_tag LOCUS_28680 150 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28680 341 1708 gene locus_tag LOCUS_28690 gene ghxQ 341 1708 CDS product guanine/hypoxanthine transporter GhxQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012163.1 protein_id gnl|my_center|LOCUS_28690 2232 1744 gene locus_tag LOCUS_28700 2232 1744 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838428.1 protein_id gnl|my_center|LOCUS_28700 3110 2232 gene locus_tag LOCUS_28710 3110 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28710 4171 3104 gene locus_tag LOCUS_28720 4171 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28720 3149 3191 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4592 6040 gene locus_tag LOCUS_28730 gene uacT 4592 6040 CDS product urate/proton symporter UacT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295374.1 protein_id gnl|my_center|LOCUS_28730 6290 6838 gene locus_tag LOCUS_28740 gene idi 6290 6838 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192820.1 protein_id gnl|my_center|LOCUS_28740 7571 6882 gene locus_tag LOCUS_28750 7571 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 >Feature sequence168 <1 802 gene locus_tag LOCUS_28760 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001256538.1:phosphatidylglycerophosphatase B 951 1259 gene locus_tag LOCUS_28770 gene lapA 951 1259 CDS product lipopolysaccharide assembly protein LapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876286.1 protein_id gnl|my_center|LOCUS_28770 1266 2435 gene locus_tag LOCUS_28780 gene lapB 1266 2435 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891353.1 protein_id gnl|my_center|LOCUS_28780 2677 3366 gene locus_tag LOCUS_28790 gene pyrF 2677 3366 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176270.1 protein_id gnl|my_center|LOCUS_28790 3366 3692 gene locus_tag LOCUS_28800 gene yciH 3366 3692 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295580.1 protein_id gnl|my_center|LOCUS_28800 4036 3818 gene locus_tag LOCUS_28810 gene osmB 4036 3818 CDS product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498253.1 protein_id gnl|my_center|LOCUS_28810 5054 4305 gene locus_tag LOCUS_28820 5054 4305 CDS product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088620.1 protein_id gnl|my_center|LOCUS_28820 5317 5144 gene locus_tag LOCUS_28830 gene yciZ 5317 5144 CDS product protein YciZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288368.1 protein_id gnl|my_center|LOCUS_28830 7363 5465 gene locus_tag LOCUS_28840 gene pdeR 7363 5465 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859945.1 protein_id gnl|my_center|LOCUS_28840 >Feature sequence169 694 173 gene locus_tag LOCUS_28850 gene yjjX 694 173 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001341279.1 protein_id gnl|my_center|LOCUS_28850 737 1384 gene locus_tag LOCUS_28860 gene gpmB 737 1384 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942344.1 protein_id gnl|my_center|LOCUS_28860 2250 1381 gene locus_tag LOCUS_28870 gene robA 2250 1381 CDS product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371666.1 protein_id gnl|my_center|LOCUS_28870 2461 2934 gene locus_tag LOCUS_28880 gene creA 2461 2934 CDS product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875487.1 protein_id gnl|my_center|LOCUS_28880 2947 3636 gene locus_tag LOCUS_28890 gene creB 2947 3636 CDS product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188654.1 protein_id gnl|my_center|LOCUS_28890 3636 5060 gene locus_tag LOCUS_28900 gene creC 3636 5060 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219577.1 protein_id gnl|my_center|LOCUS_28900 5118 6470 gene locus_tag LOCUS_28910 gene creD 5118 6470 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920294.1 protein_id gnl|my_center|LOCUS_28910 7246 6530 gene locus_tag LOCUS_28920 gene arcA 7246 6530 CDS product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194358.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence170 <1 1359 gene locus_tag LOCUS_28930 <1 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001192973.1:fumarate reductase (quinol) flavoprotein subunit 1352 2086 gene locus_tag LOCUS_28940 gene frdB 1352 2086 CDS product fumarate reductase iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829498.1 protein_id gnl|my_center|LOCUS_28940 2097 2492 gene locus_tag LOCUS_28950 gene frdC 2097 2492 CDS product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208757.1 protein_id gnl|my_center|LOCUS_28950 2503 2862 gene locus_tag LOCUS_28960 gene frdD 2503 2862 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299198.1 protein_id gnl|my_center|LOCUS_28960 2925 4058 gene locus_tag LOCUS_28970 gene ampC 2925 4058 CDS product BlaEC family class C beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336292.1 protein_id gnl|my_center|LOCUS_28970 4147 4680 gene locus_tag LOCUS_28980 gene blc 4147 4680 CDS product lipocalin Blc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238378.1 protein_id gnl|my_center|LOCUS_28980 4994 4677 gene locus_tag LOCUS_28990 gene sugE 4994 4677 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118482.1 protein_id gnl|my_center|LOCUS_28990 5316 5170 gene locus_tag LOCUS_29000 gene ecnB 5316 5170 CDS product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239596.1 protein_id gnl|my_center|LOCUS_29000 6170 5604 gene locus_tag LOCUS_29010 gene efp 6170 5604 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257278.1 protein_id gnl|my_center|LOCUS_29010 6212 7240 gene locus_tag LOCUS_29020 gene epmB 6212 7240 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940549.1 protein_id gnl|my_center|LOCUS_29020 >Feature sequence171 576 40 gene locus_tag LOCUS_29030 576 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 1045 581 gene locus_tag LOCUS_29040 gene fliL 1045 581 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133106.1 protein_id gnl|my_center|LOCUS_29040 2277 1150 gene locus_tag LOCUS_29050 2277 1150 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620071.1 protein_id gnl|my_center|LOCUS_29050 2717 2274 gene locus_tag LOCUS_29060 gene fliJ 2717 2274 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807579.1 protein_id gnl|my_center|LOCUS_29060 4109 2736 gene locus_tag LOCUS_29070 gene fliI 4109 2736 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213294.1 protein_id gnl|my_center|LOCUS_29070 4795 4109 gene locus_tag LOCUS_29080 gene fliH 4795 4109 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282715.1 protein_id gnl|my_center|LOCUS_29080 5783 4788 gene locus_tag LOCUS_29090 gene fliG 5783 4788 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067950.1 protein_id gnl|my_center|LOCUS_29090 7329 5776 gene locus_tag LOCUS_29100 gene fliF 7329 5776 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994429.1 protein_id gnl|my_center|LOCUS_29100 >Feature sequence172 2149 809 gene locus_tag LOCUS_29110 gene dcuB 2149 809 CDS product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899522.1 protein_id gnl|my_center|LOCUS_29110 3439 2720 gene locus_tag LOCUS_29120 gene dcuR 3439 2720 CDS product two-component system response regulator DcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611288.1 protein_id gnl|my_center|LOCUS_29120 5055 3436 gene locus_tag LOCUS_29130 5055 3436 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216477.1 protein_id gnl|my_center|LOCUS_29130 5248 5478 gene locus_tag LOCUS_29140 gene yjdI 5248 5478 CDS product 4Fe-4S mono-cluster protein YjdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371704.1 protein_id gnl|my_center|LOCUS_29140 5490 5762 gene locus_tag LOCUS_29150 5490 5762 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405651.1 protein_id gnl|my_center|LOCUS_29150 5989 6285 gene locus_tag LOCUS_29160 gene ghoS 5989 6285 CDS product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398619.1 protein_id gnl|my_center|LOCUS_29160 6313 6486 gene locus_tag LOCUS_29170 gene ghoT 6313 6486 CDS product type V toxin-antitoxin system toxin GhoT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173343.1 protein_id gnl|my_center|LOCUS_29170 7294 6605 gene locus_tag LOCUS_29180 7294 6605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 >Feature sequence173 159 698 gene locus_tag LOCUS_29190 159 698 CDS product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326929.1 protein_id gnl|my_center|LOCUS_29190 997 1881 gene locus_tag LOCUS_29200 gene tsx 997 1881 CDS product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295328.1 protein_id gnl|my_center|LOCUS_29200 2405 2058 gene locus_tag LOCUS_29210 gene yajD 2405 2058 CDS product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974813.1 protein_id gnl|my_center|LOCUS_29210 3505 2534 gene locus_tag LOCUS_29220 gene secF 3505 2534 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046637.1 protein_id gnl|my_center|LOCUS_29220 5330 3516 gene locus_tag LOCUS_29230 gene secD 5330 3516 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934822.1 protein_id gnl|my_center|LOCUS_29230 5723 5391 gene locus_tag LOCUS_29240 gene yajC 5723 5391 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007629.1 protein_id gnl|my_center|LOCUS_29240 6873 5746 gene locus_tag LOCUS_29250 6873 5746 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667319.1 protein_id gnl|my_center|LOCUS_29250 >Feature sequence174 93 386 gene locus_tag LOCUS_29260 93 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 615 2912 gene locus_tag LOCUS_29270 615 2912 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360263.1 protein_id gnl|my_center|LOCUS_29270 2920 4248 gene locus_tag LOCUS_29280 2920 4248 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086904.1 protein_id gnl|my_center|LOCUS_29280 5620 4295 gene locus_tag LOCUS_29290 gene rimO 5620 4295 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049367.1 protein_id gnl|my_center|LOCUS_29290 5833 6216 gene locus_tag LOCUS_29300 gene bssR 5833 6216 CDS product biofilm formation regulator BssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497137.1 protein_id gnl|my_center|LOCUS_29300 >Feature sequence175 <1 726 gene locus_tag LOCUS_29310 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001132469.1:efflux RND transporter permease AcrB 1272 1646 gene locus_tag LOCUS_29320 gene tomB 1272 1646 CDS product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344800.1 protein_id gnl|my_center|LOCUS_29320 1672 1890 gene locus_tag LOCUS_29330 1672 1890 CDS product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291435.1 protein_id gnl|my_center|LOCUS_29330 2062 2613 gene locus_tag LOCUS_29340 gene maa 2062 2613 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102564.1 protein_id gnl|my_center|LOCUS_29340 2729 3199 gene locus_tag LOCUS_29350 2729 3199 CDS product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136192.1 protein_id gnl|my_center|LOCUS_29350 3357 4913 gene locus_tag LOCUS_29360 gene pdeB 3357 4913 CDS product cyclic-guanylate-specific phosphodiesterase PdeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310610.1 protein_id gnl|my_center|LOCUS_29360 5308 4955 gene locus_tag LOCUS_29370 5308 4955 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878140.1 protein_id gnl|my_center|LOCUS_29370 5687 5998 gene locus_tag LOCUS_29380 gene atl 5687 5998 CDS product DNA base-flipping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300427.1 protein_id gnl|my_center|LOCUS_29380 6601 6029 gene locus_tag LOCUS_29390 6601 6029 CDS product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779842.1 protein_id gnl|my_center|LOCUS_29390 6819 6995 gene locus_tag LOCUS_29400 6819 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29400 >Feature sequence176 432 746 gene locus_tag LOCUS_29410 gene rhaM 432 746 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619493.1 protein_id gnl|my_center|LOCUS_29410 1047 1493 gene locus_tag LOCUS_29420 1047 1493 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729595.1 protein_id gnl|my_center|LOCUS_29420 1504 2955 gene locus_tag LOCUS_29430 1504 2955 CDS product PTS fructose-like transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446023.1 protein_id gnl|my_center|LOCUS_29430 2945 4015 gene locus_tag LOCUS_29440 2945 4015 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019484.1 protein_id gnl|my_center|LOCUS_29440 4015 5763 gene locus_tag LOCUS_29450 4015 5763 CDS product putative frv operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931299.1 protein_id gnl|my_center|LOCUS_29450 6868 5813 gene locus_tag LOCUS_29460 6868 5813 CDS product YiiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295677.1 protein_id gnl|my_center|LOCUS_29460 >Feature sequence177 845 282 gene locus_tag LOCUS_29470 gene idnK 845 282 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896738.1 protein_id gnl|my_center|LOCUS_29470 1062 2093 gene locus_tag LOCUS_29480 gene idnD 1062 2093 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197411.1 protein_id gnl|my_center|LOCUS_29480 2117 2881 gene locus_tag LOCUS_29490 gene idnO 2117 2881 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998695.1 protein_id gnl|my_center|LOCUS_29490 2943 4262 gene locus_tag LOCUS_29500 gene idnT 2943 4262 CDS product gnt-II system L-idonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128335.1 protein_id gnl|my_center|LOCUS_29500 4329 5327 gene locus_tag LOCUS_29510 gene idnR 4329 5327 CDS product DNA-binding transcriptional regulator IdnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309159.1 protein_id gnl|my_center|LOCUS_29510 5405 6907 gene locus_tag LOCUS_29520 5405 6907 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294573.1 protein_id gnl|my_center|LOCUS_29520 >Feature sequence178 1212 130 gene locus_tag LOCUS_29530 gene lptG 1212 130 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295681.1 protein_id gnl|my_center|LOCUS_29530 2219 1212 gene locus_tag LOCUS_29540 gene lptF 2219 1212 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584114.1 protein_id gnl|my_center|LOCUS_29540 2579 4090 gene locus_tag LOCUS_29550 gene pepA 2579 4090 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397144.1 protein_id gnl|my_center|LOCUS_29550 4250 4693 gene locus_tag LOCUS_29560 gene holC 4250 4693 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786400.1 protein_id gnl|my_center|LOCUS_29560 >Feature sequence179 2469 1012 gene locus_tag LOCUS_29570 gene ascF 2469 1012 CDS product PTS cellobiose/arbutin/salicin transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107828.1 protein_id gnl|my_center|LOCUS_29570 2738 3739 gene locus_tag LOCUS_29580 gene ascG 2738 3739 CDS product DNA-binding transcriptional regulator AscG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001394680.1 protein_id gnl|my_center|LOCUS_29580 3888 4415 gene locus_tag LOCUS_29590 gene hydN 3888 4415 CDS product electron transport protein HydN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078777.1 protein_id gnl|my_center|LOCUS_29590 4568 6820 gene locus_tag LOCUS_29600 gene hypF 4568 6820 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107704.1 protein_id gnl|my_center|LOCUS_29600 >Feature sequence180 <1 1000 gene locus_tag LOCUS_29610 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001295576.1:type I DNA topoisomerase 1210 2184 gene locus_tag LOCUS_29620 gene cysB 1210 2184 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776253.1 protein_id gnl|my_center|LOCUS_29620 2515 2643 gene locus_tag LOCUS_29630 2515 2643 CDS product YmiA family putative membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908596.1 protein_id gnl|my_center|LOCUS_29630 2646 2813 gene locus_tag LOCUS_29640 gene yciX 2646 2813 CDS product protein YciX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297116.1 protein_id gnl|my_center|LOCUS_29640 3186 5861 gene locus_tag LOCUS_29650 gene acnA 3186 5861 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099535.1 protein_id gnl|my_center|LOCUS_29650 6515 5925 gene locus_tag LOCUS_29660 gene ribA 6515 5925 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176295.1 protein_id gnl|my_center|LOCUS_29660 >Feature sequence181 <1 592 gene locus_tag LOCUS_29670 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000118826.1:8-amino-7-oxononanoate synthase 579 1427 gene locus_tag LOCUS_29680 gene bioC 579 1427 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246761.1 protein_id gnl|my_center|LOCUS_29680 1420 2097 gene locus_tag LOCUS_29690 gene bioD 1420 2097 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044843.1 protein_id gnl|my_center|LOCUS_29690 2676 4697 gene locus_tag LOCUS_29700 gene uvrB 2676 4697 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042533.1 protein_id gnl|my_center|LOCUS_29700 4753 4823 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5799 4891 gene locus_tag LOCUS_29710 gene yvcK 5799 4891 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295302.1 protein_id gnl|my_center|LOCUS_29710 >Feature sequence182 21 941 gene locus_tag LOCUS_29720 21 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 2334 1003 gene locus_tag LOCUS_29730 gene argA 2334 1003 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237947.1 protein_id gnl|my_center|LOCUS_29730 2566 3819 gene locus_tag LOCUS_29740 gene amiC 2566 3819 CDS product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016907.1 protein_id gnl|my_center|LOCUS_29740 3969 3893 gene locus_tag LOCUS_t00470 3969 3893 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4208 5275 gene locus_tag LOCUS_29750 gene mltA 4208 5275 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678646.1 protein_id gnl|my_center|LOCUS_29750 5369 5450 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5520 6326 gene locus_tag LOCUS_29760 gene tcdA 5520 6326 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117728.1 protein_id gnl|my_center|LOCUS_29760 >Feature sequence183 220 62 gene locus_tag LOCUS_29770 220 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 867 217 gene locus_tag LOCUS_29780 gene yabP 867 217 CDS product protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393555.1 protein_id gnl|my_center|LOCUS_29780 1977 1162 gene locus_tag LOCUS_29790 gene djlA 1977 1162 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200579.1 protein_id gnl|my_center|LOCUS_29790 2232 2963 gene locus_tag LOCUS_29800 2232 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29800 2994 4586 gene locus_tag LOCUS_29810 2994 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29810 4639 5925 gene locus_tag LOCUS_29820 gene surA 4639 5925 CDS product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800457.1 protein_id gnl|my_center|LOCUS_29820 >Feature sequence184 <1 880 gene locus_tag LOCUS_29830 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001215339.1:ABC transporter substrate-binding protein 886 2388 gene locus_tag LOCUS_29840 886 2388 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224958.1 protein_id gnl|my_center|LOCUS_29840 2388 3041 gene locus_tag LOCUS_29850 2388 3041 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300558.1 protein_id gnl|my_center|LOCUS_29850 3108 4415 gene locus_tag LOCUS_29860 gene ynjE 3108 4415 CDS product thiosulfate sulfurtransferase YnjE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350515.1 protein_id gnl|my_center|LOCUS_29860 5044 4424 gene locus_tag LOCUS_29870 5044 4424 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295484.1 protein_id gnl|my_center|LOCUS_29870 5131 5538 gene locus_tag LOCUS_29880 gene nudG 5131 5538 CDS product CTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781888.1 protein_id gnl|my_center|LOCUS_29880 5776 5504 gene locus_tag LOCUS_29890 5776 5504 CDS product YnjH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085240.1 protein_id gnl|my_center|LOCUS_29890 >Feature sequence185 1540 452 gene locus_tag LOCUS_29900 gene mdtA 1540 452 CDS product multidrug efflux RND transporter subunit MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678989.1 protein_id gnl|my_center|LOCUS_29900 2587 3246 gene locus_tag LOCUS_29910 2587 3246 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003154.1 protein_id gnl|my_center|LOCUS_29910 3324 4004 gene locus_tag LOCUS_29920 gene pphC 3324 4004 CDS product protein-serine/threonine phosphatase PphC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119090.1 protein_id gnl|my_center|LOCUS_29920 4027 4242 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4681 4265 gene locus_tag LOCUS_29930 4681 4265 CDS product DUF2314 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722348.1 protein_id gnl|my_center|LOCUS_29930 >Feature sequence186 <1 1025 gene locus_tag LOCUS_29940 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001194582.1:anthranilate synthase component I 1025 2620 gene locus_tag LOCUS_29950 gene trpD 1025 2620 CDS product bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763511.1 protein_id gnl|my_center|LOCUS_29950 2621 3982 gene locus_tag LOCUS_29960 gene trpCF 2621 3982 CDS product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983871.1 protein_id gnl|my_center|LOCUS_29960 3994 5187 gene locus_tag LOCUS_29970 gene trpB 3994 5187 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209520.1 protein_id gnl|my_center|LOCUS_29970 5187 5495 gene locus_tag LOCUS_29980 5187 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29980 5476 5979 gene locus_tag LOCUS_29990 5476 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29990 6336 6539 gene locus_tag LOCUS_30000 6336 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 >Feature sequence187 668 105 gene locus_tag LOCUS_30010 668 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30010 892 665 gene locus_tag LOCUS_30020 892 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30020 985 1368 gene locus_tag LOCUS_30030 gene crcB 985 1368 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939747.1 protein_id gnl|my_center|LOCUS_30030 1631 1422 gene locus_tag LOCUS_30040 gene cspE 1631 1422 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034825.1 protein_id gnl|my_center|LOCUS_30040 2366 1806 gene locus_tag LOCUS_30050 gene pagP 2366 1806 CDS product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103094.1 protein_id gnl|my_center|LOCUS_30050 2955 4340 gene locus_tag LOCUS_30060 gene dcuC 2955 4340 CDS product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955063.1 protein_id gnl|my_center|LOCUS_30060 5061 4381 gene locus_tag LOCUS_30070 gene dpiA 5061 4381 CDS product two-component response regulator DpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126500.1 protein_id gnl|my_center|LOCUS_30070 <6610 5030 gene locus_tag LOCUS_30080 <6610 5030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000939767.1:sensor histidine kinase DpiB >Feature sequence188 322 1062 gene locus_tag LOCUS_30090 gene dpaA 322 1062 CDS product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225679.1 protein_id gnl|my_center|LOCUS_30090 1800 1033 gene locus_tag LOCUS_30100 1800 1033 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333380.1 protein_id gnl|my_center|LOCUS_30100 2584 2006 gene locus_tag LOCUS_30110 gene lpcA 2584 2006 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284050.1 protein_id gnl|my_center|LOCUS_30110 2824 5268 gene locus_tag LOCUS_30120 gene fadE 2824 5268 CDS product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973083.1 protein_id gnl|my_center|LOCUS_30120 5784 5311 gene locus_tag LOCUS_30130 gene ivy 5784 5311 CDS product Ivy family C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532698.1 protein_id gnl|my_center|LOCUS_30130 >Feature sequence189 574 1875 gene locus_tag LOCUS_30140 gene ygiF 574 1875 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046281.1 protein_id gnl|my_center|LOCUS_30140 1898 4738 gene locus_tag LOCUS_30150 gene glnE 1898 4738 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301081.1 protein_id gnl|my_center|LOCUS_30150 4786 6219 gene locus_tag LOCUS_30160 gene hldE 4786 6219 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869178.1 protein_id gnl|my_center|LOCUS_30160 >Feature sequence190 897 376 gene locus_tag LOCUS_30170 gene ruvC 897 376 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295503.1 protein_id gnl|my_center|LOCUS_30170 1672 932 gene locus_tag LOCUS_30180 1672 932 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907248.1 protein_id gnl|my_center|LOCUS_30180 2210 1701 gene locus_tag LOCUS_30190 gene nudB 2210 1701 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300367.1 protein_id gnl|my_center|LOCUS_30190 4043 2271 gene locus_tag LOCUS_30200 gene aspS 4043 2271 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258678.1 protein_id gnl|my_center|LOCUS_30200 4353 4919 gene locus_tag LOCUS_30210 4353 4919 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891621.1 protein_id gnl|my_center|LOCUS_30210 4916 5734 gene locus_tag LOCUS_30220 4916 5734 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639274.1 protein_id gnl|my_center|LOCUS_30220 5787 6182 gene locus_tag LOCUS_30230 5787 6182 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252980.1 protein_id gnl|my_center|LOCUS_30230 >Feature sequence191 410 1060 gene locus_tag LOCUS_30240 gene csgD 410 1060 CDS product biofilm master transcriptional regulator CsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481509.1 protein_id gnl|my_center|LOCUS_30240 1065 1454 gene locus_tag LOCUS_30250 gene csgE 1065 1454 CDS product curli production assembly/transport protein CsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833288.1 protein_id gnl|my_center|LOCUS_30250 1479 1895 gene locus_tag LOCUS_30260 gene csgF 1479 1895 CDS product curli production assembly/transport protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264088.1 protein_id gnl|my_center|LOCUS_30260 1922 2755 gene locus_tag LOCUS_30270 gene csgG 1922 2755 CDS product curli production assembly/transport protein CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189321.1 protein_id gnl|my_center|LOCUS_30270 3340 2819 gene locus_tag LOCUS_30280 3340 2819 CDS product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307110.1 protein_id gnl|my_center|LOCUS_30280 3966 3412 gene locus_tag LOCUS_30290 gene ycdY 3966 3412 CDS product molecular chaperone YcdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001921.1 protein_id gnl|my_center|LOCUS_30290 4727 3990 gene locus_tag LOCUS_30300 gene ycdX 4727 3990 CDS product zinc-binding phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283667.1 protein_id gnl|my_center|LOCUS_30300 5720 4782 gene locus_tag LOCUS_30310 gene ghrA 5720 4782 CDS product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351317.1 protein_id gnl|my_center|LOCUS_30310 5954 6041 gene locus_tag LOCUS_t00480 5954 6041 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence192 134 721 gene locus_tag LOCUS_30320 gene mog 134 721 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295414.1 protein_id gnl|my_center|LOCUS_30320 1322 756 gene locus_tag LOCUS_30330 gene satP 1322 756 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528538.1 protein_id gnl|my_center|LOCUS_30330 1638 1471 gene locus_tag LOCUS_30340 1638 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30340 2184 1654 gene locus_tag LOCUS_30350 2184 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30350 2591 2181 gene locus_tag LOCUS_30360 2591 2181 CDS product DUF2541 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843565.1 protein_id gnl|my_center|LOCUS_30360 2968 4884 gene locus_tag LOCUS_30370 gene dnaK 2968 4884 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516135.1 protein_id gnl|my_center|LOCUS_30370 4973 6103 gene locus_tag LOCUS_30380 gene dnaJ 4973 6103 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118476.1 protein_id gnl|my_center|LOCUS_30380 >Feature sequence193 <1 3630 gene locus_tag LOCUS_30390 <1 3630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001326840.1:trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase 4308 3670 gene locus_tag LOCUS_30400 gene rutR 4308 3670 CDS product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191701.1 protein_id gnl|my_center|LOCUS_30400 4593 5687 gene locus_tag LOCUS_30410 gene rutA 4593 5687 CDS product pyrimidine utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326839.1 protein_id gnl|my_center|LOCUS_30410 >Feature sequence194 1990 2241 gene locus_tag LOCUS_30420 1990 2241 CDS product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031530.1 protein_id gnl|my_center|LOCUS_30420 3326 2277 gene locus_tag LOCUS_30430 gene sohB 3326 2277 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422045.1 protein_id gnl|my_center|LOCUS_30430 3546 4304 gene locus_tag LOCUS_30440 3546 4304 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559286.1 protein_id gnl|my_center|LOCUS_30440 4301 4891 gene locus_tag LOCUS_30450 gene cobO 4301 4891 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278906.1 protein_id gnl|my_center|LOCUS_30450 5806 4931 gene locus_tag LOCUS_30460 gene rluB 5806 4931 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291216.1 protein_id gnl|my_center|LOCUS_30460 >Feature sequence195 458 1579 gene locus_tag LOCUS_30470 gene tyrA 458 1579 CDS product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225229.1 protein_id gnl|my_center|LOCUS_30470 2782 1622 gene locus_tag LOCUS_30480 gene pheA 2782 1622 CDS product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200120.1 protein_id gnl|my_center|LOCUS_30480 3373 3032 gene locus_tag LOCUS_30490 gene raiA 3373 3032 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178456.1 protein_id gnl|my_center|LOCUS_30490 4381 3644 gene locus_tag LOCUS_30500 gene bamD 4381 3644 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197686.1 protein_id gnl|my_center|LOCUS_30500 4516 5409 gene locus_tag LOCUS_30510 4516 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 5172 5248 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5303 5572 gene locus_tag LOCUS_30520 5303 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 >Feature sequence196 99 1523 gene locus_tag LOCUS_30530 gene miaB 99 1523 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162740.1 protein_id gnl|my_center|LOCUS_30530 1676 2716 gene locus_tag LOCUS_30540 1676 2716 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018040.1 protein_id gnl|my_center|LOCUS_30540 2713 3180 gene locus_tag LOCUS_30550 gene ybeY 2713 3180 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084469.1 protein_id gnl|my_center|LOCUS_30550 3270 4148 gene locus_tag LOCUS_30560 gene corC 3270 4148 CDS product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278605.1 protein_id gnl|my_center|LOCUS_30560 4173 5711 gene locus_tag LOCUS_30570 gene lnt 4173 5711 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853021.1 protein_id gnl|my_center|LOCUS_30570 >Feature sequence197 1348 890 gene locus_tag LOCUS_30580 gene mraZ 1348 890 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295770.1 protein_id gnl|my_center|LOCUS_30580 2636 1950 gene locus_tag LOCUS_30590 2636 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 2737 4728 gene locus_tag LOCUS_30600 2737 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 4740 5399 gene locus_tag LOCUS_30610 gene rluA 4740 5399 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525176.1 protein_id gnl|my_center|LOCUS_30610 >Feature sequence198 1789 284 gene locus_tag LOCUS_30620 gene glpD 1789 284 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448136.1 protein_id gnl|my_center|LOCUS_30620 1979 2305 gene locus_tag LOCUS_30630 gene glpE 1979 2305 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371928.1 protein_id gnl|my_center|LOCUS_30630 2350 3180 gene locus_tag LOCUS_30640 gene glpG 2350 3180 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928723.1 protein_id gnl|my_center|LOCUS_30640 3197 3955 gene locus_tag LOCUS_30650 3197 3955 CDS product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815099.1 protein_id gnl|my_center|LOCUS_30650 5535 3937 gene locus_tag LOCUS_30660 gene rtcR 5535 3937 CDS product DNA-binding transcriptional regulator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232948.1 protein_id gnl|my_center|LOCUS_30660 >Feature sequence199 3135 976 gene locus_tag LOCUS_30670 gene aas 3135 976 CDS product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899054.1 protein_id gnl|my_center|LOCUS_30670 3720 4751 gene locus_tag LOCUS_30680 gene galR 3720 4751 CDS product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201063.1 protein_id gnl|my_center|LOCUS_30680 <5954 4758 gene locus_tag LOCUS_30690 <5954 4758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001120711.1:diaminopimelate decarboxylase >Feature sequence200 283 1569 gene locus_tag LOCUS_30700 gene thrC 283 1569 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781074.1 protein_id gnl|my_center|LOCUS_30700 1922 2083 gene locus_tag LOCUS_30710 1922 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 2126 2200 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3075 2299 gene locus_tag LOCUS_30720 gene yaaA 3075 2299 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906197.1 protein_id gnl|my_center|LOCUS_30720 4575 3145 gene locus_tag LOCUS_30730 4575 3145 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112606.1 protein_id gnl|my_center|LOCUS_30730 5613 5723 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5789 5938 gene locus_tag LOCUS_30740 5789 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 >Feature sequence201 1061 1288 gene locus_tag LOCUS_30750 1061 1288 CDS product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135667.1 protein_id gnl|my_center|LOCUS_30750 1308 3068 gene locus_tag LOCUS_30760 gene yejM 1308 3068 CDS product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256203.1 protein_id gnl|my_center|LOCUS_30760 3143 3219 gene locus_tag LOCUS_t00490 3143 3219 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5655 3322 gene locus_tag LOCUS_30770 gene yejO 5655 3322 CDS product autotransporter YejO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554226.1 protein_id gnl|my_center|LOCUS_30770 >Feature sequence202 1396 113 gene locus_tag LOCUS_30780 gene gltA 1396 113 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785834.1 protein_id gnl|my_center|LOCUS_30780 1378 1569 gene locus_tag LOCUS_30790 1378 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333072.1 protein_id gnl|my_center|LOCUS_30790 2090 2494 gene locus_tag LOCUS_30800 gene sdhC 2090 2494 CDS product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263355.1 protein_id gnl|my_center|LOCUS_30800 2488 2835 gene locus_tag LOCUS_30810 gene sdhD 2488 2835 CDS product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254365.1 protein_id gnl|my_center|LOCUS_30810 2835 4601 gene locus_tag LOCUS_30820 gene sdhA 2835 4601 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775540.1 protein_id gnl|my_center|LOCUS_30820 4617 5333 gene locus_tag LOCUS_30830 gene sdhB 4617 5333 CDS product succinate dehydrogenase iron-sulfur subunit SdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235254.1 protein_id gnl|my_center|LOCUS_30830 >Feature sequence203 <1 703 gene locus_tag LOCUS_30840 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001177086.1:glutamate/aspartate ABC transporter substrate-binding protein GltI 873 1613 gene locus_tag LOCUS_30850 gene gltJ 873 1613 CDS product glutamate/aspartate ABC transporter permease GltJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020941.1 protein_id gnl|my_center|LOCUS_30850 1613 2287 gene locus_tag LOCUS_30860 gene gltK 1613 2287 CDS product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272824.1 protein_id gnl|my_center|LOCUS_30860 2287 3012 gene locus_tag LOCUS_30870 gene gltL 2287 3012 CDS product glutamate/aspartate ABC transporter ATP-binding protein GltL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631384.1 protein_id gnl|my_center|LOCUS_30870 3130 4065 gene locus_tag LOCUS_30880 gene rihA 3130 4065 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207520.1 protein_id gnl|my_center|LOCUS_30880 4149 4394 gene locus_tag LOCUS_30890 4149 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30890 4437 5819 gene locus_tag LOCUS_30900 gene hscC 4437 5819 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367875.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30900 >Feature sequence204 20 502 gene locus_tag LOCUS_30910 20 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 503 1918 gene locus_tag LOCUS_30920 503 1918 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130850.1 protein_id gnl|my_center|LOCUS_30920 1915 4050 gene locus_tag LOCUS_30930 1915 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 4241 4573 gene locus_tag LOCUS_30940 4241 4573 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350529.1 protein_id gnl|my_center|LOCUS_30940 >Feature sequence205 1059 247 gene locus_tag LOCUS_30950 gene hcaB 1059 247 CDS product 3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281379.1 protein_id gnl|my_center|LOCUS_30950 1376 1056 gene locus_tag LOCUS_30960 1376 1056 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080102.1 protein_id gnl|my_center|LOCUS_30960 1894 1376 gene locus_tag LOCUS_30970 1894 1376 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276072.1 protein_id gnl|my_center|LOCUS_30970 3252 1891 gene locus_tag LOCUS_30980 3252 1891 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211172.1 protein_id gnl|my_center|LOCUS_30980 3388 4278 gene locus_tag LOCUS_30990 gene hcaR 3388 4278 CDS product DNA-binding transcriptional regulator HcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423261.1 protein_id gnl|my_center|LOCUS_30990 4438 5577 gene locus_tag LOCUS_31000 4438 5577 CDS product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244193.1 protein_id gnl|my_center|LOCUS_31000 >Feature sequence206 2002 1217 gene locus_tag LOCUS_31010 2002 1217 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021334.1 protein_id gnl|my_center|LOCUS_31010 2321 3598 gene locus_tag LOCUS_31020 2321 3598 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164544.1 protein_id gnl|my_center|LOCUS_31020 3625 5103 gene locus_tag LOCUS_31030 3625 5103 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039688.1 protein_id gnl|my_center|LOCUS_31030 >Feature sequence207 424 810 gene locus_tag LOCUS_31040 gene rutC 424 810 CDS product 3-aminoacrylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126780.1 protein_id gnl|my_center|LOCUS_31040 818 1618 gene locus_tag LOCUS_31050 gene rutD 818 1618 CDS product pyrimidine utilization protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777653.1 protein_id gnl|my_center|LOCUS_31050 1628 2218 gene locus_tag LOCUS_31060 1628 2218 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001176.1 protein_id gnl|my_center|LOCUS_31060 2229 2723 gene locus_tag LOCUS_31070 gene rutF 2229 2723 CDS product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028083.1 protein_id gnl|my_center|LOCUS_31070 2744 4072 gene locus_tag LOCUS_31080 gene rutG 2744 4072 CDS product pyrimidine utilization transport protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326838.1 protein_id gnl|my_center|LOCUS_31080 4502 4329 gene locus_tag LOCUS_31090 4502 4329 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273658.1 protein_id gnl|my_center|LOCUS_31090 >Feature sequence208 1054 2520 gene locus_tag LOCUS_31100 gene guaB 1054 2520 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299507.1 protein_id gnl|my_center|LOCUS_31100 2589 4166 gene locus_tag LOCUS_31110 gene guaA 2589 4166 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138270.1 protein_id gnl|my_center|LOCUS_31110 4798 4259 gene locus_tag LOCUS_31120 4798 4259 CDS product DUF5384 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755173.1 protein_id gnl|my_center|LOCUS_31120 5329 4814 gene locus_tag LOCUS_31130 5329 4814 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295476.1 protein_id gnl|my_center|LOCUS_31130 >Feature sequence209 <1 1381 gene locus_tag LOCUS_31140 <1 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000122013.1:DNA polymerase III subunit gamma/tau note possible pseudo, frameshifted 1275 1592 gene locus_tag LOCUS_31150 1275 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31150 1645 1974 gene locus_tag LOCUS_31160 1645 1974 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 protein_id gnl|my_center|LOCUS_31160 1974 2579 gene locus_tag LOCUS_31170 gene recR 1974 2579 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195025.1 protein_id gnl|my_center|LOCUS_31170 2689 4563 gene locus_tag LOCUS_31180 gene htpG 2689 4563 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678201.1 protein_id gnl|my_center|LOCUS_31180 4744 5388 gene locus_tag LOCUS_31190 gene adk 4744 5388 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220233.1 protein_id gnl|my_center|LOCUS_31190 >Feature sequence210 1984 332 gene locus_tag LOCUS_31200 gene ushA 1984 332 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771748.1 protein_id gnl|my_center|LOCUS_31200 2202 3422 gene locus_tag LOCUS_31210 gene fsr 2202 3422 CDS product fosmidomycin MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251608.1 protein_id gnl|my_center|LOCUS_31210 3660 5336 gene locus_tag LOCUS_31220 gene ybaL 3660 5336 CDS product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546237.1 protein_id gnl|my_center|LOCUS_31220 >Feature sequence211 131 1066 gene locus_tag LOCUS_31230 gene ldtA 131 1066 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350523.1 protein_id gnl|my_center|LOCUS_31230 1197 1122 gene locus_tag LOCUS_t00500 1197 1122 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1524 2441 gene locus_tag LOCUS_31240 gene nac 1524 2441 CDS product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011462.1 protein_id gnl|my_center|LOCUS_31240 2543 3493 gene locus_tag LOCUS_31250 gene cbl 2543 3493 CDS product HTH-type transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011008.1 protein_id gnl|my_center|LOCUS_31250 3606 3531 gene locus_tag LOCUS_t00510 3606 3531 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3872 5254 gene locus_tag LOCUS_31260 gene yeeO 3872 5254 CDS product toxic metabolite efflux MATE transporter YeeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943916.1 protein_id gnl|my_center|LOCUS_31260 >Feature sequence212 <1 909 gene locus_tag LOCUS_31270 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000702551.1:nitrate reductase subunit beta 909 1604 gene locus_tag LOCUS_31280 gene narW 909 1604 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166353.1 protein_id gnl|my_center|LOCUS_31280 1601 2281 gene locus_tag LOCUS_31290 gene narI 1601 2281 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617115.1 protein_id gnl|my_center|LOCUS_31290 2360 3253 gene locus_tag LOCUS_31300 2360 3253 CDS product PhzF family isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804385.1 protein_id gnl|my_center|LOCUS_31300 4194 3349 gene locus_tag LOCUS_31310 gene nhoA 4194 3349 CDS product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187925.1 protein_id gnl|my_center|LOCUS_31310 4367 4936 gene locus_tag LOCUS_31320 4367 4936 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085899.1 protein_id gnl|my_center|LOCUS_31320 5166 4933 gene locus_tag LOCUS_31330 gene pptA 5166 4933 CDS product tautomerase PptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120143.1 protein_id gnl|my_center|LOCUS_31330 >Feature sequence213 642 67 gene locus_tag LOCUS_31340 gene gmhB 642 67 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140187.1 protein_id gnl|my_center|LOCUS_31340 830 1861 gene locus_tag LOCUS_31350 gene metN 830 1861 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594006.1 protein_id gnl|my_center|LOCUS_31350 1854 2507 gene locus_tag LOCUS_31360 1854 2507 CDS product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294600.1 protein_id gnl|my_center|LOCUS_31360 2547 3191 gene locus_tag LOCUS_31370 gene metQ 2547 3191 CDS product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874227.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31370 3240 3362 gene locus_tag LOCUS_31380 3240 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31380 3480 3884 gene locus_tag LOCUS_31390 gene rcsF 3480 3884 CDS product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202329.1 protein_id gnl|my_center|LOCUS_31390 3881 4588 gene locus_tag LOCUS_31400 3881 4588 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094011.1 protein_id gnl|my_center|LOCUS_31400 >Feature sequence214 2 313 gene locus_tag LOCUS_31410 2 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 342 674 gene locus_tag LOCUS_31420 342 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31420 780 1604 gene locus_tag LOCUS_31430 780 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31430 1614 2066 gene locus_tag LOCUS_31440 gene gatA 1614 2066 CDS product PTS galactitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182899.1 protein_id gnl|my_center|LOCUS_31440 2097 2381 gene locus_tag LOCUS_31450 gene gatB 2097 2381 CDS product PTS galactitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823270.1 protein_id gnl|my_center|LOCUS_31450 2385 3740 gene locus_tag LOCUS_31460 2385 3740 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490679.1 protein_id gnl|my_center|LOCUS_31460 3788 4828 gene locus_tag LOCUS_31470 gene gatD 3788 4828 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844219.1 protein_id gnl|my_center|LOCUS_31470 >Feature sequence215 688 993 gene locus_tag LOCUS_31480 688 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31480 1039 1410 gene locus_tag LOCUS_31490 1039 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31490 1410 1736 gene locus_tag LOCUS_31500 1410 1736 CDS product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107564.1 protein_id gnl|my_center|LOCUS_31500 1926 2645 gene locus_tag LOCUS_31510 1926 2645 CDS product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984796.1 protein_id gnl|my_center|LOCUS_31510 2821 3867 gene locus_tag LOCUS_31520 gene ansB 2821 3867 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394140.1 protein_id gnl|my_center|LOCUS_31520 3984 4991 gene locus_tag LOCUS_31530 3984 4991 CDS product DUF1202 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745210.1 protein_id gnl|my_center|LOCUS_31530 >Feature sequence216 2191 365 gene locus_tag LOCUS_31540 gene atoS 2191 365 CDS product two-component system sensor histidine kinase AtoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559125.1 protein_id gnl|my_center|LOCUS_31540 2358 5009 gene locus_tag LOCUS_31550 gene rcsC 2358 5009 CDS product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876011.1 protein_id gnl|my_center|LOCUS_31550 >Feature sequence217 139 1008 gene locus_tag LOCUS_31560 139 1008 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214331.1 protein_id gnl|my_center|LOCUS_31560 1033 3462 gene locus_tag LOCUS_31570 gene torZ 1033 3462 CDS product trimethylamine N-oxide reductase TorZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176781.1 protein_id gnl|my_center|LOCUS_31570 4597 3626 gene locus_tag LOCUS_31580 gene cmoB 4597 3626 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564725.1 protein_id gnl|my_center|LOCUS_31580 >Feature sequence218 583 38 gene locus_tag LOCUS_31590 gene hemG 583 38 CDS product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853959.1 protein_id gnl|my_center|LOCUS_31590 2046 595 gene locus_tag LOCUS_31600 gene trkH 2046 595 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545677.1 protein_id gnl|my_center|LOCUS_31600 2702 2085 gene locus_tag LOCUS_31610 2702 2085 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001308167.1 protein_id gnl|my_center|LOCUS_31610 4030 2699 gene locus_tag LOCUS_31620 gene pepQ 4030 2699 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444561.1 protein_id gnl|my_center|LOCUS_31620 >Feature sequence219 2184 1012 gene locus_tag LOCUS_31630 gene emrA 2184 1012 CDS product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326681.1 protein_id gnl|my_center|LOCUS_31630 2841 2311 gene locus_tag LOCUS_31640 gene emrR 2841 2311 CDS product multidrug efflux transporter EmrAB transcriptional repressor EmrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378442.1 protein_id gnl|my_center|LOCUS_31640 3267 2932 gene locus_tag LOCUS_31650 gene ygaH 3267 2932 CDS product L-valine transporter subunit YgaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119763.1 protein_id gnl|my_center|LOCUS_31650 3994 3257 gene locus_tag LOCUS_31660 gene ygaZ 3994 3257 CDS product L-valine exporter subunit YgaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445651.1 protein_id gnl|my_center|LOCUS_31660 <4888 4118 gene locus_tag LOCUS_31670 <4888 4118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000169332.1:MFS transporter >Feature sequence220 160 270 gene locus_tag LOCUS_r00030 160 270 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 598 1896 gene locus_tag LOCUS_31680 gene kgtP 598 1896 CDS product alpha-ketoglutarate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841103.1 protein_id gnl|my_center|LOCUS_31680 2165 1893 gene locus_tag LOCUS_31690 2165 1893 CDS product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300818.1 protein_id gnl|my_center|LOCUS_31690 3620 2262 gene locus_tag LOCUS_31700 gene pssA 3620 2262 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949265.1 protein_id gnl|my_center|LOCUS_31700 4630 3731 gene locus_tag LOCUS_31710 4630 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 >Feature sequence221 <1 725 gene locus_tag LOCUS_31720 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001300708.1:serine-type D-Ala-D-Ala carboxypeptidase 1530 772 gene locus_tag LOCUS_31730 gene deoR 1530 772 CDS product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450121.1 protein_id gnl|my_center|LOCUS_31730 2184 1588 gene locus_tag LOCUS_31740 gene ybjG 2184 1588 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295291.1 protein_id gnl|my_center|LOCUS_31740 2469 3701 gene locus_tag LOCUS_31750 gene mdfA 2469 3701 CDS product multidrug efflux MFS transporter MdfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180089.1 protein_id gnl|my_center|LOCUS_31750 4026 3742 gene locus_tag LOCUS_31760 gene ybjH 4026 3742 CDS product protein YbjH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605480.1 protein_id gnl|my_center|LOCUS_31760 4642 4112 gene locus_tag LOCUS_31770 4642 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 >Feature sequence222 <1 534 gene locus_tag LOCUS_31780 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000217234.1:TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase 531 1883 gene locus_tag LOCUS_31790 gene wzyE 531 1883 CDS product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055129.1 protein_id gnl|my_center|LOCUS_31790 1886 2626 gene locus_tag LOCUS_31800 gene wecG 1886 2626 CDS product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064040.1 protein_id gnl|my_center|LOCUS_31800 2817 4202 gene locus_tag LOCUS_31810 2817 4202 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774731.1 protein_id gnl|my_center|LOCUS_31810 4305 4381 gene locus_tag LOCUS_t00520 4305 4381 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4440 4515 gene locus_tag LOCUS_t00530 4440 4515 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4536 4622 gene locus_tag LOCUS_t00540 4536 4622 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence223 436 236 gene locus_tag LOCUS_31820 436 236 CDS product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417058.1 protein_id gnl|my_center|LOCUS_31820 602 1147 gene locus_tag LOCUS_31830 602 1147 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185290.1 protein_id gnl|my_center|LOCUS_31830 1144 1566 gene locus_tag LOCUS_31840 gene arfB 1144 1566 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635537.1 protein_id gnl|my_center|LOCUS_31840 1580 2290 gene locus_tag LOCUS_31850 gene nlpE 1580 2290 CDS product envelope stress response activation lipoprotein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239163.1 protein_id gnl|my_center|LOCUS_31850 2391 2424 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3037 2483 gene locus_tag LOCUS_31860 3037 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 4446 3361 gene locus_tag LOCUS_31870 4446 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31870 >Feature sequence224 660 1346 gene locus_tag LOCUS_31880 660 1346 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223132.1 protein_id gnl|my_center|LOCUS_31880 1707 4169 gene locus_tag LOCUS_31890 gene thrA 1707 4169 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264707.1 protein_id gnl|my_center|LOCUS_31890 >Feature sequence225 1549 590 gene locus_tag LOCUS_31900 gene ssuA 1549 590 CDS product aliphatic sulfonate ABC transporter substrate-binding protein SsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244308.1 protein_id gnl|my_center|LOCUS_31900 2117 1542 gene locus_tag LOCUS_31910 gene ssuE 2117 1542 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263933.1 protein_id gnl|my_center|LOCUS_31910 2473 3012 gene locus_tag LOCUS_31920 2473 3012 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750293.1 protein_id gnl|my_center|LOCUS_31920 3372 3518 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3857 3934 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence226 400 119 gene locus_tag LOCUS_31930 400 119 CDS product DUF2773 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942006.1 protein_id gnl|my_center|LOCUS_31930 892 608 gene locus_tag LOCUS_31940 gene ppnP 892 608 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941942.1 protein_id gnl|my_center|LOCUS_31940 1641 964 gene locus_tag LOCUS_31950 1641 964 CDS product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276420.1 protein_id gnl|my_center|LOCUS_31950 2090 1899 gene locus_tag LOCUS_31960 gene yaiA 2090 1899 CDS product protein YaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142439.1 protein_id gnl|my_center|LOCUS_31960 2607 2140 gene locus_tag LOCUS_31970 gene aroL 2607 2140 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193393.1 protein_id gnl|my_center|LOCUS_31970 3305 2847 gene locus_tag LOCUS_31980 3305 2847 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158159.1 protein_id gnl|my_center|LOCUS_31980 3425 4234 gene locus_tag LOCUS_31990 gene proC 3425 4234 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295331.1 protein_id gnl|my_center|LOCUS_31990 >Feature sequence227 159 1637 gene locus_tag LOCUS_32000 gene uxaB 159 1637 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854633.1 protein_id gnl|my_center|LOCUS_32000 331 358 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1844 2758 gene locus_tag LOCUS_32010 1844 2758 CDS product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313828.1 protein_id gnl|my_center|LOCUS_32010 3520 2762 gene locus_tag LOCUS_32020 gene tam 3520 2762 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286597.1 protein_id gnl|my_center|LOCUS_32020 3867 3577 gene locus_tag LOCUS_32030 gene lsrG 3867 3577 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558527.1 protein_id gnl|my_center|LOCUS_32030 <4536 3891 gene locus_tag LOCUS_32040 <4536 3891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000774165.1:3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase >Feature sequence228 39 911 gene locus_tag LOCUS_32050 39 911 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723275.1 protein_id gnl|my_center|LOCUS_32050 898 1893 gene locus_tag LOCUS_32060 gene yjfF 898 1893 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000596014.1 protein_id gnl|my_center|LOCUS_32060 2924 1926 gene locus_tag LOCUS_32070 gene fbp 2924 1926 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853753.1 protein_id gnl|my_center|LOCUS_32070 3100 4473 gene locus_tag LOCUS_32080 gene mpl 3100 4473 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219813.1 protein_id gnl|my_center|LOCUS_32080 >Feature sequence229 297 599 gene locus_tag LOCUS_32090 297 599 CDS product YjeO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276180.1 protein_id gnl|my_center|LOCUS_32090 3951 628 gene locus_tag LOCUS_32100 gene mscM 3951 628 CDS product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236847.1 protein_id gnl|my_center|LOCUS_32100 <4511 3973 gene locus_tag LOCUS_32110 <4511 3973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000934933.1:archaetidylserine decarboxylase >Feature sequence230 284 772 gene locus_tag LOCUS_32120 gene hybE 284 772 CDS product hydrogenase-2 assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134014.1 protein_id gnl|my_center|LOCUS_32120 765 1106 gene locus_tag LOCUS_32130 gene hypA 765 1106 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544953.1 protein_id gnl|my_center|LOCUS_32130 1119 1367 gene locus_tag LOCUS_32140 gene hybG 1119 1367 CDS product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334896.1 protein_id gnl|my_center|LOCUS_32140 2356 1490 gene locus_tag LOCUS_32150 gene yghU 2356 1490 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295515.1 protein_id gnl|my_center|LOCUS_32150 2561 4420 gene locus_tag LOCUS_32160 gene gss 2561 4420 CDS product bifunctional glutathionylspermidine amidase/synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297309.1 protein_id gnl|my_center|LOCUS_32160 >Feature sequence231 <1 740 gene locus_tag LOCUS_32170 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000673575.1:Obg family GTPase CgtA 2245 926 gene locus_tag LOCUS_32180 gene dacB 2245 926 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212619.1 protein_id gnl|my_center|LOCUS_32180 2607 3083 gene locus_tag LOCUS_32190 gene greA 2607 3083 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148001.1 protein_id gnl|my_center|LOCUS_32190 3532 3239 gene locus_tag LOCUS_32200 gene yhbY 3532 3239 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054420.1 protein_id gnl|my_center|LOCUS_32200 3658 4287 gene locus_tag LOCUS_32210 gene rlmE 3658 4287 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145975.1 protein_id gnl|my_center|LOCUS_32210 >Feature sequence232 444 43 gene locus_tag LOCUS_32220 444 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 1639 359 gene locus_tag LOCUS_32230 1639 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32230 466 530 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2147 3436 gene locus_tag LOCUS_32240 gene ygjG 2147 3436 CDS product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301395.1 protein_id gnl|my_center|LOCUS_32240 3810 3478 gene locus_tag LOCUS_32250 3810 3478 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450594.1 protein_id gnl|my_center|LOCUS_32250 >Feature sequence233 1939 95 gene locus_tag LOCUS_32260 gene selB 1939 95 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582468.1 protein_id gnl|my_center|LOCUS_32260 3327 1936 gene locus_tag LOCUS_32270 gene selA 3327 1936 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206275.1 protein_id gnl|my_center|LOCUS_32270 4033 3425 gene locus_tag LOCUS_32280 4033 3425 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779792.1 protein_id gnl|my_center|LOCUS_32280 >Feature sequence234 1805 138 gene locus_tag LOCUS_32290 gene ettA 1805 138 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046749.1 protein_id gnl|my_center|LOCUS_32290 2016 2702 gene locus_tag LOCUS_32300 2016 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32300 2744 3952 gene locus_tag LOCUS_32310 2744 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32310 4042 4368 gene locus_tag LOCUS_32320 gene trpR 4042 4368 CDS product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068679.1 protein_id gnl|my_center|LOCUS_32320 >Feature sequence235 47 499 gene locus_tag LOCUS_32330 gene fkpB 47 499 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004655.1 protein_id gnl|my_center|LOCUS_32330 501 1451 gene locus_tag LOCUS_32340 gene ispH 501 1451 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166395.1 protein_id gnl|my_center|LOCUS_32340 1517 2431 gene locus_tag LOCUS_32350 gene rihC 1517 2431 CDS product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239142.1 protein_id gnl|my_center|LOCUS_32350 2598 3419 gene locus_tag LOCUS_32360 gene dapB 2598 3419 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543604.1 protein_id gnl|my_center|LOCUS_32360 >Feature sequence236 <1 976 gene locus_tag LOCUS_32370 <1 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000373021.1:NADP-specific glutamate dehydrogenase 4222 2261 gene locus_tag LOCUS_32380 gene topB 4222 2261 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235800.1 protein_id gnl|my_center|LOCUS_32380 >Feature sequence237 3210 577 gene locus_tag LOCUS_32390 gene mngB 3210 577 CDS product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648976.1 protein_id gnl|my_center|LOCUS_32390 4226 3228 gene locus_tag LOCUS_32400 4226 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 >Feature sequence238 781 29 gene locus_tag LOCUS_32410 781 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 <4254 778 gene locus_tag LOCUS_32420 <4254 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000040458.1:nitrate reductase Z subunit alpha >Feature sequence239 1255 641 gene locus_tag LOCUS_32430 1255 641 CDS product YagU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019920.1 protein_id gnl|my_center|LOCUS_32430 1673 2362 gene locus_tag LOCUS_32440 gene paoA 1673 2362 CDS product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070700.1 protein_id gnl|my_center|LOCUS_32440 2359 3315 gene locus_tag LOCUS_32450 gene paoB 2359 3315 CDS product aldehyde oxidoreductase FAD-binding subunit PaoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643333.1 protein_id gnl|my_center|LOCUS_32450 3312 4184 gene locus_tag LOCUS_32460 3312 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 >Feature sequence240 1550 78 gene locus_tag LOCUS_32470 gene modF 1550 78 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096869.1 protein_id gnl|my_center|LOCUS_32470 2406 1618 gene locus_tag LOCUS_32480 gene modE 2406 1618 CDS product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147439.1 protein_id gnl|my_center|LOCUS_32480 2535 2684 gene locus_tag LOCUS_32490 gene acrZ 2535 2684 CDS product multidrug efflux pump accessory protein AcrZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891515.1 protein_id gnl|my_center|LOCUS_32490 2838 3611 gene locus_tag LOCUS_32500 gene modA 2838 3611 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101984.1 protein_id gnl|my_center|LOCUS_32500 >Feature sequence241 1071 1520 gene locus_tag LOCUS_32510 gene alaE 1071 1520 CDS product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492656.1 protein_id gnl|my_center|LOCUS_32510 1901 1557 gene locus_tag LOCUS_32520 1901 1557 CDS product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281320.1 protein_id gnl|my_center|LOCUS_32520 2053 2382 gene locus_tag LOCUS_32530 2053 2382 CDS product DUF883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295174.1 protein_id gnl|my_center|LOCUS_32530 2630 2875 gene locus_tag LOCUS_32540 gene nrdH 2630 2875 CDS product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223227.1 protein_id gnl|my_center|LOCUS_32540 2872 3282 gene locus_tag LOCUS_32550 gene nrdI 2872 3282 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080947.1 protein_id gnl|my_center|LOCUS_32550 >Feature sequence242 <1 1089 gene locus_tag LOCUS_32560 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000626685.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase 1083 2165 gene locus_tag LOCUS_32570 gene mraY 1083 2165 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964131.1 protein_id gnl|my_center|LOCUS_32570 2168 3484 gene locus_tag LOCUS_32580 gene murD 2168 3484 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796481.1 protein_id gnl|my_center|LOCUS_32580 >Feature sequence243 112 1140 gene locus_tag LOCUS_32590 gene murB 112 1140 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016699.1 protein_id gnl|my_center|LOCUS_32590 1137 2102 gene locus_tag LOCUS_32600 gene birA 1137 2102 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654630.1 protein_id gnl|my_center|LOCUS_32600 3057 2131 gene locus_tag LOCUS_32610 gene coaA 3057 2131 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023081.1 protein_id gnl|my_center|LOCUS_32610 3443 3518 gene locus_tag LOCUS_t00550 3443 3518 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3527 3611 gene locus_tag LOCUS_t00560 3527 3611 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3728 3802 gene locus_tag LOCUS_t00570 3728 3802 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3809 3884 gene locus_tag LOCUS_t00580 3809 3884 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence244 212 1639 gene locus_tag LOCUS_32620 gene mmuP 212 1639 CDS product S-methylmethionine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393629.1 protein_id gnl|my_center|LOCUS_32620 1626 2558 gene locus_tag LOCUS_32630 gene mmuM 1626 2558 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081352.1 protein_id gnl|my_center|LOCUS_32630 3713 2667 gene locus_tag LOCUS_32640 gene fbpC 3713 2667 CDS product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192349.1 protein_id gnl|my_center|LOCUS_32640 >Feature sequence245 <1 677 gene locus_tag LOCUS_32650 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001221332.1:exonuclease subunit SbcD 674 2239 gene locus_tag LOCUS_32660 674 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32660 2163 3803 gene locus_tag LOCUS_32670 2163 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32670 >Feature sequence246 379 1050 gene locus_tag LOCUS_32680 gene nrfC 379 1050 CDS product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220281.1 protein_id gnl|my_center|LOCUS_32680 1047 2003 gene locus_tag LOCUS_32690 gene nrfD 1047 2003 CDS product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195171.1 protein_id gnl|my_center|LOCUS_32690 2059 3741 gene locus_tag LOCUS_32700 2059 3741 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311310.1 protein_id gnl|my_center|LOCUS_32700 >Feature sequence247 <1 575 gene locus_tag LOCUS_32710 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001352260.1:16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF 693 929 gene locus_tag LOCUS_32720 693 929 CDS product YebV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295499.1 protein_id gnl|my_center|LOCUS_32720 1048 1093 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1896 1237 gene locus_tag LOCUS_32730 gene pphA 1896 1237 CDS product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812724.1 protein_id gnl|my_center|LOCUS_32730 2630 2289 gene locus_tag LOCUS_32740 2630 2289 CDS product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976476.1 protein_id gnl|my_center|LOCUS_32740 3515 2643 gene locus_tag LOCUS_32750 gene copD 3515 2643 CDS product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879289.1 protein_id gnl|my_center|LOCUS_32750 3893 3519 gene locus_tag LOCUS_32760 gene yobA 3893 3519 CDS product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168747.1 protein_id gnl|my_center|LOCUS_32760 >Feature sequence248 3161 291 gene locus_tag LOCUS_32770 3161 291 CDS product molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583615.1 protein_id gnl|my_center|LOCUS_32770 3937 3158 gene locus_tag LOCUS_32780 gene ygfM 3937 3158 CDS product molybdopterin-dependent oxidoreductase FAD-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572462.1 protein_id gnl|my_center|LOCUS_32780 >Feature sequence249 813 97 gene locus_tag LOCUS_32790 813 97 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532923.1 protein_id gnl|my_center|LOCUS_32790 2610 1156 gene locus_tag LOCUS_32800 gene amn 2610 1156 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060244.1 protein_id gnl|my_center|LOCUS_32800 <4014 2712 gene locus_tag LOCUS_32810 <4014 2712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000378575.1:shikimate transporter >Feature sequence250 1140 211 gene locus_tag LOCUS_32820 gene fdhE 1140 211 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027703.1 protein_id gnl|my_center|LOCUS_32820 1772 1137 gene locus_tag LOCUS_32830 gene fdoI 1772 1137 CDS product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829013.1 protein_id gnl|my_center|LOCUS_32830 2671 1769 gene locus_tag LOCUS_32840 gene fdoH 2671 1769 CDS product formate dehydrogenase O subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331377.1 protein_id gnl|my_center|LOCUS_32840 <3960 2684 gene locus_tag LOCUS_32850 <3960 2684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010723259.1:formate dehydrogenase-N subunit alpha >Feature sequence251 298 161 gene locus_tag LOCUS_32860 298 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32860 1171 302 gene locus_tag LOCUS_32870 gene amiA 1171 302 CDS product N-acetylmuramoyl-L-alanine amidase AmiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102886.1 protein_id gnl|my_center|LOCUS_32870 1385 1810 gene locus_tag LOCUS_32880 1385 1810 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405996.1 protein_id gnl|my_center|LOCUS_32880 1797 2246 gene locus_tag LOCUS_32890 1797 2246 CDS product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350539.1 protein_id gnl|my_center|LOCUS_32890 2307 2882 gene locus_tag LOCUS_32900 2307 2882 CDS product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838944.1 protein_id gnl|my_center|LOCUS_32900 2978 3877 gene locus_tag LOCUS_32910 gene yfeX 2978 3877 CDS product porphyrinogen peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350538.1 protein_id gnl|my_center|LOCUS_32910 >Feature sequence252 1658 201 gene locus_tag LOCUS_32920 gene yjeM 1658 201 CDS product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336293.1 protein_id gnl|my_center|LOCUS_32920 2899 1922 gene locus_tag LOCUS_32930 gene epmA 2899 1922 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004771.1 protein_id gnl|my_center|LOCUS_32930 >Feature sequence253 <3911 1216 gene locus_tag LOCUS_32940 <3911 1216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001197875.1:multidrug efflux RND transporter permease subunit MdtB >Feature sequence254 1301 2740 gene locus_tag LOCUS_32950 gene norV 1301 2740 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029634.1 protein_id gnl|my_center|LOCUS_32950 2737 3870 gene locus_tag LOCUS_32960 gene norW 2737 3870 CDS product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064752.1 protein_id gnl|my_center|LOCUS_32960 >Feature sequence255 131 1897 gene locus_tag LOCUS_32970 gene ftsI 131 1897 CDS product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642196.1 protein_id gnl|my_center|LOCUS_32970 1884 3371 gene locus_tag LOCUS_32980 gene murE 1884 3371 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775093.1 protein_id gnl|my_center|LOCUS_32980 >Feature sequence256 963 265 gene locus_tag LOCUS_32990 963 265 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977128.1 protein_id gnl|my_center|LOCUS_32990 1664 987 gene locus_tag LOCUS_33000 gene ydjY 1664 987 CDS product lipoprotein YdjY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939212.1 protein_id gnl|my_center|LOCUS_33000 2379 1669 gene locus_tag LOCUS_33010 2379 1669 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300395.1 protein_id gnl|my_center|LOCUS_33010 3364 2546 gene locus_tag LOCUS_33020 gene xthA 3364 2546 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673918.1 protein_id gnl|my_center|LOCUS_33020 >Feature sequence257 1063 1944 gene locus_tag LOCUS_33030 gene rnm 1063 1944 CDS product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285661.1 protein_id gnl|my_center|LOCUS_33030 1941 2561 gene locus_tag LOCUS_33040 1941 2561 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295575.1 protein_id gnl|my_center|LOCUS_33040 >Feature sequence258 1901 237 gene locus_tag LOCUS_33050 gene glnS 1901 237 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287154.1 protein_id gnl|my_center|LOCUS_33050 <3826 2104 gene locus_tag LOCUS_33060 <3826 2104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001023093.1:PTS N-acetyl glucosamine transporter subunit IIABC >Feature sequence259 2119 722 gene locus_tag LOCUS_33070 gene zraS 2119 722 CDS product two-component system sensor histidine kinase ZraS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211892.1 protein_id gnl|my_center|LOCUS_33070 2226 2354 gene locus_tag LOCUS_33080 2226 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 2357 2782 gene locus_tag LOCUS_33090 2357 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 3419 2784 gene locus_tag LOCUS_33100 3419 2784 CDS product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084037.1 protein_id gnl|my_center|LOCUS_33100 3764 3492 gene locus_tag LOCUS_33110 gene hupA 3764 3492 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044513.1 protein_id gnl|my_center|LOCUS_33110 >Feature sequence260 53 1003 gene locus_tag LOCUS_33120 gene galK 53 1003 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053399.1 protein_id gnl|my_center|LOCUS_33120 997 2037 gene locus_tag LOCUS_33130 gene galM 997 2037 CDS product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931389.1 protein_id gnl|my_center|LOCUS_33130 2239 2991 gene locus_tag LOCUS_33140 gene gpmA 2239 2991 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295305.1 protein_id gnl|my_center|LOCUS_33140 <3798 3149 gene locus_tag LOCUS_33150 <3798 3149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001109183.1:3-deoxy-7-phosphoheptulonate synthase AroG >Feature sequence261 562 864 gene locus_tag LOCUS_33160 562 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 1276 836 gene locus_tag LOCUS_33170 1276 836 CDS product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106835.1 protein_id gnl|my_center|LOCUS_33170 1905 1303 gene locus_tag LOCUS_33180 1905 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 2146 1871 gene locus_tag LOCUS_33190 2146 1871 CDS product phage N-6-adenine-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066913.1 protein_id gnl|my_center|LOCUS_33190 3005 2637 gene locus_tag LOCUS_33200 gene yfdO 3005 2637 CDS product protein YdfO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128175.1 protein_id gnl|my_center|LOCUS_33200 3149 3316 gene locus_tag LOCUS_33210 3149 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 3363 3725 gene locus_tag LOCUS_33220 gene yfdP 3363 3725 CDS product protein YfdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135673.1 protein_id gnl|my_center|LOCUS_33220 >Feature sequence262 <1 545 gene locus_tag LOCUS_33230 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000476011.1:tRNA 5-hydroxyuridine modification protein YegQ 1837 1505 gene locus_tag LOCUS_33240 1837 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130399.1 protein_id gnl|my_center|LOCUS_33240 2228 3127 gene locus_tag LOCUS_33250 gene yegS 2228 3127 CDS product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807348.1 protein_id gnl|my_center|LOCUS_33250 3655 3209 gene locus_tag LOCUS_33260 3655 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 >Feature sequence263 214 1092 gene locus_tag LOCUS_33270 gene xdhB 214 1092 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459182.1 protein_id gnl|my_center|LOCUS_33270 1089 1568 gene locus_tag LOCUS_33280 gene xdhC 1089 1568 CDS product xanthine dehydrogenase iron sulfur-binding subunit XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016605.1 protein_id gnl|my_center|LOCUS_33280 3386 1608 gene locus_tag LOCUS_33290 3386 1608 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417791.1 protein_id gnl|my_center|LOCUS_33290 >Feature sequence264 612 1040 gene locus_tag LOCUS_33300 gene uspC 612 1040 CDS product universal stress protein UspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122416.1 protein_id gnl|my_center|LOCUS_33300 2471 1047 gene locus_tag LOCUS_33310 gene otsA 2471 1047 CDS product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295646.1 protein_id gnl|my_center|LOCUS_33310 3057 2446 gene locus_tag LOCUS_33320 gene otsB 3057 2446 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295645.1 protein_id gnl|my_center|LOCUS_33320 3191 3255 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence265 795 31 gene locus_tag LOCUS_33330 gene deoC 795 31 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298497.1 protein_id gnl|my_center|LOCUS_33330 699 718 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1053 2603 gene locus_tag LOCUS_33340 1053 2603 CDS product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143253.1 protein_id gnl|my_center|LOCUS_33340 2734 3438 gene locus_tag LOCUS_33350 2734 3438 CDS product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088415.1 protein_id gnl|my_center|LOCUS_33350 >Feature sequence266 1192 857 gene locus_tag LOCUS_33360 gene mazF 1192 857 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254738.1 protein_id gnl|my_center|LOCUS_33360 1440 1192 gene locus_tag LOCUS_33370 gene mazE 1440 1192 CDS product type II toxin-antitoxin system antitoxin MazE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581937.1 protein_id gnl|my_center|LOCUS_33370 3509 1518 gene locus_tag LOCUS_33380 3509 1518 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226815.1 protein_id gnl|my_center|LOCUS_33380 >Feature sequence267 1268 342 gene locus_tag LOCUS_33390 gene motB 1268 342 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795630.1 protein_id gnl|my_center|LOCUS_33390 2152 1265 gene locus_tag LOCUS_33400 gene motA 2152 1265 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906340.1 protein_id gnl|my_center|LOCUS_33400 2857 2279 gene locus_tag LOCUS_33410 gene flhC 2857 2279 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291603.1 protein_id gnl|my_center|LOCUS_33410 3210 2860 gene locus_tag LOCUS_33420 gene flhD 3210 2860 CDS product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295647.1 protein_id gnl|my_center|LOCUS_33420 >Feature sequence268 460 2658 gene locus_tag LOCUS_33430 gene ycjT 460 2658 CDS product kojibiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198036.1 protein_id gnl|my_center|LOCUS_33430 2655 3314 gene locus_tag LOCUS_33440 gene pgmB 2655 3314 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775794.1 protein_id gnl|my_center|LOCUS_33440 >Feature sequence269 412 1254 gene locus_tag LOCUS_33450 412 1254 CDS product ISAs1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420862.1 protein_id gnl|my_center|LOCUS_33450 699 715 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1402 1911 gene locus_tag LOCUS_33460 1402 1911 CDS product YbgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053305.1 protein_id gnl|my_center|LOCUS_33460 1908 3326 gene locus_tag LOCUS_33470 gene phrB 1908 3326 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207142.1 protein_id gnl|my_center|LOCUS_33470 >Feature sequence270 365 403 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 466 1377 gene locus_tag LOCUS_33480 466 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33480 3191 1536 gene locus_tag LOCUS_33490 gene aslA 3191 1536 CDS product arylsulfatase AslA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395863.1 protein_id gnl|my_center|LOCUS_33490 >Feature sequence271 247 2 gene locus_tag LOCUS_33500 247 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 2135 225 gene locus_tag LOCUS_33510 gene tkt 2135 225 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098613.1 protein_id gnl|my_center|LOCUS_33510 273 397 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2413 3171 gene locus_tag LOCUS_33520 gene loiP 2413 3171 CDS product metalloprotease LoiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326497.1 protein_id gnl|my_center|LOCUS_33520 >Feature sequence272 1 462 gene locus_tag LOCUS_33530 1 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 1534 494 gene locus_tag LOCUS_33540 1534 494 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199295.1 protein_id gnl|my_center|LOCUS_33540 1860 1642 gene locus_tag LOCUS_33550 gene ygdR 1860 1642 CDS product lipoprotein YgdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758655.1 protein_id gnl|my_center|LOCUS_33550 2711 1998 gene locus_tag LOCUS_33560 2711 1998 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895624.1 protein_id gnl|my_center|LOCUS_33560 <3408 2780 gene locus_tag LOCUS_33570 <3408 2780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000082201.1:DNA mismatch repair endonuclease MutH >Feature sequence273 345 1598 gene locus_tag LOCUS_33580 345 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33580 1517 1537 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1989 2100 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2168 2458 gene locus_tag LOCUS_33590 gene ilvN 2168 2458 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181706.1 protein_id gnl|my_center|LOCUS_33590 2534 3124 gene locus_tag LOCUS_33600 gene uhpA 2534 3124 CDS product transcriptional regulator UhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633668.1 protein_id gnl|my_center|LOCUS_33600 >Feature sequence274 523 657 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1421 885 gene locus_tag LOCUS_33610 gene ssb1 1421 885 CDS product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168299.1 protein_id gnl|my_center|LOCUS_33610 1675 3249 gene locus_tag LOCUS_33620 1675 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33620 >Feature sequence275 1649 309 gene locus_tag LOCUS_33630 gene fadL 1649 309 CDS product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295701.1 protein_id gnl|my_center|LOCUS_33630 2021 2305 gene locus_tag LOCUS_33640 2021 2305 CDS product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296261.1 protein_id gnl|my_center|LOCUS_33640 >Feature sequence276 <1 2933 gene locus_tag LOCUS_33650 <1 2933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000177906.1:beta-galactosidase >Feature sequence277 1749 1576 gene locus_tag LOCUS_33660 1749 1576 CDS product periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731833.1 protein_id gnl|my_center|LOCUS_33660 2524 1994 gene locus_tag LOCUS_33670 gene cybB 2524 1994 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954775.1 protein_id gnl|my_center|LOCUS_33670 >Feature sequence278 593 81 gene locus_tag LOCUS_33680 gene mobB 593 81 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907622.1 protein_id gnl|my_center|LOCUS_33680 1174 590 gene locus_tag LOCUS_33690 gene mobA 1174 590 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052181.1 protein_id gnl|my_center|LOCUS_33690 1244 1513 gene locus_tag LOCUS_33700 1244 1513 CDS product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295263.1 protein_id gnl|my_center|LOCUS_33700 1590 2576 gene locus_tag LOCUS_33710 gene srkA 1590 2576 CDS product stress response kinase SrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065497.1 protein_id gnl|my_center|LOCUS_33710 2593 3219 gene locus_tag LOCUS_33720 gene dsbA 2593 3219 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725337.1 protein_id gnl|my_center|LOCUS_33720 >Feature sequence279 <1 900 gene locus_tag LOCUS_33730 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000246534.1:class 1b ribonucleoside-diphosphate reductase subunit alpha 910 1869 gene locus_tag LOCUS_33740 gene nrdF 910 1869 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777969.1 protein_id gnl|my_center|LOCUS_33740 >Feature sequence280 <1 606 gene locus_tag LOCUS_33750 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001321419.1:A/G-specific adenine glycosylase 634 909 gene locus_tag LOCUS_33760 634 909 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091700.1 protein_id gnl|my_center|LOCUS_33760 971 2053 gene locus_tag LOCUS_33770 gene mltC 971 2053 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760323.1 protein_id gnl|my_center|LOCUS_33770 2255 2956 gene locus_tag LOCUS_33780 2255 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 >Feature sequence281 1054 395 gene locus_tag LOCUS_33790 gene yeiL 1054 395 CDS product transcriptional regulator YeiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310375.1 protein_id gnl|my_center|LOCUS_33790 1223 2164 gene locus_tag LOCUS_33800 gene rihB 1223 2164 CDS product ribosylpyrimidine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415429.1 protein_id gnl|my_center|LOCUS_33800 >Feature sequence282 1749 829 gene locus_tag LOCUS_33810 gene gsiC 1749 829 CDS product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936043.1 protein_id gnl|my_center|LOCUS_33810 <3174 1767 gene locus_tag LOCUS_33820 <3174 1767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000090140.1:glutathione ABC transporter substrate-binding protein GsiB >Feature sequence283 1346 222 gene locus_tag LOCUS_33830 1346 222 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216257.1 protein_id gnl|my_center|LOCUS_33830 <3159 1346 gene locus_tag LOCUS_33840 <3159 1346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000149156.1:ribosome-associated ATPase/putative transporter RbbA >Feature sequence284 2570 2905 gene locus_tag LOCUS_33850 2570 2905 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300891.1 protein_id gnl|my_center|LOCUS_33850 >Feature sequence285 1345 41 gene locus_tag LOCUS_33860 gene gsk 1345 41 CDS product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671574.1 protein_id gnl|my_center|LOCUS_33860 1497 2456 gene locus_tag LOCUS_33870 gene aes 1497 2456 CDS product acetyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801813.1 protein_id gnl|my_center|LOCUS_33870 <3057 2453 gene locus_tag LOCUS_33880 <3057 2453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001250103.1:ferrochelatase >Feature sequence286 37 195 gene locus_tag LOCUS_33890 37 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 235 897 gene locus_tag LOCUS_33900 235 897 CDS product DUF2057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847791.1 protein_id gnl|my_center|LOCUS_33900 984 1451 gene locus_tag LOCUS_33910 gene mgsA 984 1451 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275684.1 protein_id gnl|my_center|LOCUS_33910 3051 1483 gene locus_tag LOCUS_33920 gene helD 3051 1483 CDS product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295354.1 protein_id gnl|my_center|LOCUS_33920 >Feature sequence287 294 512 gene locus_tag LOCUS_33930 gene hemP 294 512 CDS product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966807.1 protein_id gnl|my_center|LOCUS_33930 1952 516 gene locus_tag LOCUS_33940 gene selO 1952 516 CDS product protein adenylyltransferase SelO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175703.1 protein_id gnl|my_center|LOCUS_33940 2081 2308 gene locus_tag LOCUS_33950 2081 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 >Feature sequence288 351 1316 gene locus_tag LOCUS_33960 gene fcl 351 1316 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043654.1 protein_id gnl|my_center|LOCUS_33960 1316 1798 gene locus_tag LOCUS_33970 gene gmm 1316 1798 CDS product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393539.1 protein_id gnl|my_center|LOCUS_33970 >Feature sequence289 410 144 gene locus_tag LOCUS_33980 410 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33980 1590 598 gene locus_tag LOCUS_33990 gene proX 1590 598 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216525.1 protein_id gnl|my_center|LOCUS_33990 2712 1648 gene locus_tag LOCUS_34000 gene proW 2712 1648 CDS product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774978.1 protein_id gnl|my_center|LOCUS_34000 2833 2705 gene locus_tag LOCUS_34010 2833 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 >Feature sequence290 927 1835 gene locus_tag LOCUS_34020 gene mak 927 1835 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219309.1 protein_id gnl|my_center|LOCUS_34020 1936 2044 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <2926 2086 gene locus_tag LOCUS_34030 <2926 2086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001326926.1:MFS transporter AraJ >Feature sequence291 >Feature sequence292 2334 1165 gene locus_tag LOCUS_34040 gene uhpB 2334 1165 CDS product signal transduction histidine-protein kinase/phosphatase UhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295243.1 protein_id gnl|my_center|LOCUS_34040 2337 2446 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence293 683 264 gene locus_tag LOCUS_34050 gene nusB 683 264 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801125.1 protein_id gnl|my_center|LOCUS_34050 1173 703 gene locus_tag LOCUS_34060 gene ribE 1173 703 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021161.1 protein_id gnl|my_center|LOCUS_34060 2365 1262 gene locus_tag LOCUS_34070 gene ribD 2365 1262 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150457.1 protein_id gnl|my_center|LOCUS_34070 >Feature sequence294 <1 787 gene locus_tag LOCUS_34080 <1 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000422182.1:microcin J25 efflux ABC transporter YojI 1005 2651 gene locus_tag LOCUS_34090 gene mqo 1005 2651 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758077.1 protein_id gnl|my_center|LOCUS_34090 >Feature sequence295 445 29 gene locus_tag LOCUS_34100 445 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34100 465 528 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1979 918 gene locus_tag LOCUS_34110 1979 918 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393448.1 protein_id gnl|my_center|LOCUS_34110 <2746 2045 gene locus_tag LOCUS_34120 <2746 2045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001276670.1:ABC transporter permease >Feature sequence296 106 1170 gene locus_tag LOCUS_34130 gene hemE 106 1170 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137657.1 protein_id gnl|my_center|LOCUS_34130 1180 1851 gene locus_tag LOCUS_34140 gene nfi 1180 1851 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362388.1 protein_id gnl|my_center|LOCUS_34140 1894 2484 gene locus_tag LOCUS_34150 1894 2484 CDS product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940106.1 protein_id gnl|my_center|LOCUS_34150 >Feature sequence297 1268 696 gene locus_tag LOCUS_34160 gene kdpC 1268 696 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300431.1 protein_id gnl|my_center|LOCUS_34160 2560 1277 gene locus_tag LOCUS_34170 2560 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34170 >Feature sequence298 95 1450 gene locus_tag LOCUS_34180 gene lyxK 95 1450 CDS product L-xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196054.1 protein_id gnl|my_center|LOCUS_34180 1447 2109 gene locus_tag LOCUS_34190 gene ulaD 1447 2109 CDS product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089481.1 protein_id gnl|my_center|LOCUS_34190 >Feature sequence299 1546 356 gene locus_tag LOCUS_34200 1546 356 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032666220.1 protein_id gnl|my_center|LOCUS_34200 1891 1807 gene locus_tag LOCUS_t00590 1891 1807 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence300 2364 1399 gene locus_tag LOCUS_34210 gene iaaA 2364 1399 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513781.1 protein_id gnl|my_center|LOCUS_34210 >Feature sequence301 1251 49 gene locus_tag LOCUS_34220 gene nupC 1251 49 CDS product nucleoside permease NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376337.1 protein_id gnl|my_center|LOCUS_34220 >Feature sequence302 868 122 gene locus_tag LOCUS_34230 868 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34230 1037 1759 gene locus_tag LOCUS_34240 gene mngR 1037 1759 CDS product mannosyl-D-glycerate transport/metabolism system transcriptional repressor MngR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509902.1 protein_id gnl|my_center|LOCUS_34240 <2604 1863 gene locus_tag LOCUS_34250 <2604 1863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000025458.1:succinate--CoA ligase subunit alpha >Feature sequence303 1190 297 gene locus_tag LOCUS_34260 gene galF 1190 297 CDS product UTP--glucose-1-phosphate uridylyltransferase GalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183060.1 protein_id gnl|my_center|LOCUS_34260 <2554 1365 gene locus_tag LOCUS_34270 <2554 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001116026.1:colanic acid biosynthesis protein WcaM