COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..239782 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(321..608) product DUF2623 family protein YghW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059139.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene yghW CDS complement(727..1614) product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005010978.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene yghX CDS 1771..2811 product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262172.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene gpr CDS complement(2851..3345) product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439331.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 3536..4420 product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018760.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene yghA CDS complement(4692..5117) product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240712.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene exbD CDS complement(5124..5858) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527844.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene exbB CDS 6110..7297 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001320425.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene metC CDS 7437..8096 product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268419.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene yghB CDS complement(8136..9035) product DNA-binding transcriptional regulator YqhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298382.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene yqhC CDS 9229..10392 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058802.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene yqhD CDS 10497..11324 product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013149.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene dkgA CDS 11524..12450 product YbjP/YqhG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691619.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 12501..12758 product lipoprotein YqhH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848528.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene yqhH CDS complement(12801..15020) product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095154.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(15131..16543) product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059388.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene ftsP CDS complement(16618..17355) product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965712.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene plsC CDS complement(17589..19847) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281881.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene parC CDS complement(19985..21592) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295629.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(21725..22120) product type II toxin-antitoxin system antitoxin MqsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650107.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene mqsA CDS complement(22122..22418) product type II toxin-antitoxin system toxin MqsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415584.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene mqsR CDS complement(22623..23105) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183505.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(23158..23550) product OB fold stress tolerance protein YgiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712658.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene ygiW CDS 23702..24361 product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221493.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene qseB CDS 24358..25707 product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673402.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene qseC CDS complement(25753..26085) product DUF2645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917684.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 26404..26985 product NADPH:quinone oxidoreductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065430.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene mdaB CDS 27016..27330 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958598.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(27378..29270) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195296.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene parE CDS complement(29299..29880) product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105733.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene yqiA CDS complement(29880..30707) product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444747.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene cpdA CDS complement(30732..31154) product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833393.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(31155..31784) product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917117.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene nudF CDS 31989..33470 product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735278.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene tolC CDS 33747..34289 product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831543.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 34295..35455 product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442860.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(35493..36308) product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188362.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene ygiD CDS 36424..37197 product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295627.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene zupT CDS complement(37255..37425) product protein YqiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469266.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene yqiD CDS complement(37687..38340) product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076997.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene ribB CDS 38714..39004 product ubiquinone biosynthesis accessory factor UbiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222100.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene ubiK CDS 39288..39839 product fimbrial-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272145.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 39890..42403 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277116.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 42419..43168 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269824.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 43170..44234 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269802.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(44277..44477) product cell surface composition regulator GlgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350095.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene glgS CDS 44746..45375 product DUF1449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599926.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 45402..47063 product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000341044.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(47856..49289) product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869178.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene hldE CDS complement(49337..52177) product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301081.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene glnE CDS complement(52200..53501) product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046281.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene ygiF CDS 53743..54363 product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125331.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 54427..55665 product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708487.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene cca CDS complement(55828..56649) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281927.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene bacA CDS complement(56740..57111) product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295541.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene folB CDS 57213..57830 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272796.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene plsY CDS complement(57843..58775) product DNA-binding transcriptional activator TtdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935206.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene ttdR CDS 58982..59893 product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986797.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene ttdA CDS 59890..60495 product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722957.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene ttdB CDS 60543..62006 product L-tartrate/succinate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804973.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene ttdT CDS complement(62049..63062) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264352.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene tsaD CDS 63300..63515 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene rpsU CDS 63626..65371 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918827.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene dnaG CDS 65566..67407 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437371.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene rpoD CDS complement(67486..67992) product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228937.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene mug tRNA 68117..68192 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(68246..69010) product NADPH-dependent ferric chelate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066494.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene nfeF CDS 69298..69921 product DNA-binding transcriptional regulator NfeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018003.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene nfeR CDS complement(70075..71595) product aerotaxis sensor receptor Aer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094721.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene aer CDS 72103..73392 product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301395.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene ygjG CDS complement(73434..73766) product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450594.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 73985..74968 product transcriptional regulator EbgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212475.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene ebgR CDS 75152..78244 product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082856.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene ebgA CDS 78241..78690 product beta-galactosidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219954.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 78753..80186 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285432.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 80320..81390 product protein YgjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767652.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene ygjJ CDS 81407..83758 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695487.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene ygjK CDS 84184..86202 product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121433.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene fadH CDS complement(86247..86663) product type II toxin-antitoxin system antitoxin HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560266.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene higA CDS complement(86660..86974) product type II toxin-antitoxin system toxin HigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550189.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene higB CDS complement(87258..88394) product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018695.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene rlmG CDS 88479..88982 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295542.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 89059..89751 product vancomycin high temperature exclusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942548.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 89812..90816 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456357.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 91099..92064 product TerC family membrane protein Alx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098805.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene alx CDS complement(92245..92403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 92680..93924 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211656.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene sstT CDS complement(93929..94480) product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128136.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(94563..96050) product altronate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199352.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene uxaA CDS complement(96065..97477) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187442.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene uxaC CDS 97960..99258 product hexuronate transporter ExuT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226465.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene exuT CDS 99388..100164 product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406488.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene exuR CDS 100509..101171 product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422149.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene yqjA CDS 101175..101558 product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166760.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene mzrA CDS 101705..102073 product DUF1090 family protein YqjC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295543.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene yqjC CDS 102111..102416 product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031415.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 102419..102823 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785722.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 102813..103112 product YqjK-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096086.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 103298..103690 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732240.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 103760..104746 product glutathionyl-hydroquinone reductase YqjG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531205.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene yqjG CDS 105039..105404 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384145.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 105646..106002 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198807.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(106053..106949) product DNA-binding transcriptional regulator YhaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041010.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene yhaJ CDS 107054..107755 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633576.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 107778..107942 product protein YhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295544.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene yhaL CDS complement(108076..109386) product cysteine desulfidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460514.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene cyuA CDS complement(109414..110745) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401598.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(111021..112385) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene tdcG CDS complement(112457..112846) product enamine/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719990.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(112860..115154) product 2-ketobutyrate formate-lyase/pyruvate formate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861734.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene tdcE CDS complement(115188..116396) product propionate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295545.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene tdcD CDS complement(116422..117753) product threonine/serine transporter TdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107723.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene tdcC CDS complement(117775..118764) product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548347.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene tdcB CDS complement(118863..119801) product transcriptional regulator TdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104211.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene tdcA CDS 120590..121129 product protein YhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675733.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene yhaB CDS 121151..122254 product YhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484600.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(123256..124401) product glycerate 2-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300387.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene garK CDS complement(124498..125397) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566608.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene garR CDS complement(125418..126188) product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058209.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene garL CDS complement(126204..127538) product galactarate/glucarate/glycerate transporter GarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene garP CDS 127913..129484 product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273753.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene garD CDS 129632..129967 product type II toxin-antitoxin system antitoxin PrlF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296435.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene prlF CDS 130129..130431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 note possible pseudo, internal stop codon CDS complement(130486..131295) product aga operon transcriptional regulator AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072187.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene agaR CDS 131544..132824 product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681920.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene kbaZ CDS 132847..133320 product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295547.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene agaV CDS 133331..134110 product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406214.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene agaW CDS 134100..134978 product PTS N-acetylgalactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295548.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene agaE CDS 134996..135430 product PTS galactosamine/N-acetylgalactosamine transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948824.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene agaF CDS 135427..136560 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326138.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene nagA CDS 136911..138065 product AgaS family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114873.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 138078..138938 product tagatose-bisphosphate aldolase subunit KbaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022766.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene kbaY CDS 139105..139581 product PTS galactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098022.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene agaB CDS 139620..140423 product PTS galactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544489.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene agaC CDS 140413..141204 product PTS galactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534351.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene agaD CDS 141259..141960 product galactosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311150.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 142361..142945 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045442.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 143121..143720 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044775.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 143750..146266 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136472.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 146409..147368 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816992.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(147411..148271) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809262.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene rsmI CDS 148336..150372 product penicillin-binding protein activator LpoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249104.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene lpoA CDS 150330..150725 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246830.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 150745..151335 product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158034.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene diaA CDS 151345..151920 product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646033.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene dolP CDS complement(152034..153074) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147624.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(153147..153782) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084526.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 153910..154428 product protein/nucleic acid deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037608.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene yhbO CDS complement(154408..154851) product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449030.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 154902..155204 product DNA damage response exodeoxyribonuclease YhbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189314.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene yhbQ CDS complement(155191..155694) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908554.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(155688..156233) product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295552.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 156421..157416 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421305.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 157425..158303 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301318.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 158384..159391 product luciferase-like monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130380.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(159509..160753) product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224351.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene mtr CDS complement(160907..162796) product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301504.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene deaD CDS complement(162976..163860) product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802080.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene nlpI CDS complement(163969..166104) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295554.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene pnp CDS complement(166351..166620) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059466.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene rpsO CDS complement(166769..167713) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089698.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene truB CDS complement(167713..168114) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040205.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene rbfA CDS complement(168278..170950) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133044.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene infB CDS complement(170975..172462) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031057.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene nusA CDS complement(172490..172912) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296446.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene rimP tRNA complement(173149..173225) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 173573..174916 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207680.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene argG CDS complement(174924..176549) product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333576.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 tRNA complement(177008..177094) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(177109..177441) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295556.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene secG CDS complement(177669..179006) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071134.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene glmM CDS complement(178999..179847) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311155.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene folP CDS complement(179937..181880) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107467.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene ftsH CDS complement(181971..182600) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145975.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene rlmE CDS 182726..183019 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054420.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene yhbY CDS complement(183175..183651) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148001.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene greA CDS 184013..185332 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212651.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene dacB CDS complement(185518..186690) product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673561.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene cgtA CDS complement(186706..187671) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813037.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(187798..188055) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940595.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene rpmA CDS complement(188076..188387) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271401.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene rplU CDS 188646..189617 product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047336.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene ispB CDS 189846..190124 product DNA-binding transcriptional regulator SfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445413.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene sfsB CDS complement(190172..191431) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357259.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene murA CDS complement(191486..191755) product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568740.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene ibaG CDS complement(191900..192193) product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004488.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene mlaB CDS complement(192193..192828) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476487.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene mlaC CDS complement(192847..193398) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296448.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene mlaD CDS complement(193403..194185) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925795.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene mlaE CDS complement(194193..195002) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438245.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene mlaF CDS 195212..196189 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922901.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 196203..197189 product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295557.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene kdsD CDS 197210..197776 product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030016.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene kdsC CDS 197773..198348 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030537.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene lptC CDS 198317..198874 product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669785.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene lptA CDS 198881..199606 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224099.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene lptB CDS 199654..201087 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809051.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene rpoN CDS 201110..201397 product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176599.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene hpf CDS 201515..202006 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183676.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene ptsN CDS 202052..202906 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243741.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene rapZ CDS 202903..203175 product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216791.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene npr CDS 203389..204021 product PhoP regulatory network protein YrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620405.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene yrbL CDS complement(204018..204746) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047091.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene mtgA CDS complement(204743..205396) product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300411.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene elbB CDS complement(205626..207962) product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809774.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene arcB CDS complement(208058..209020) product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299745.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 209554..214122 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213702.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene gltB CDS 214135..215553 product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081674.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene gltD CDS 216233..216538 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639208.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(216614..217078) product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979880.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene nanQ CDS complement(217075..217950) product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153624.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene nanK CDS complement(217947..218636) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300570.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(218684..220174) product sialic acid transporter NanT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108459.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene nanT CDS complement(220283..221176) product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224714.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene nanA CDS complement(221298..222080) product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523844.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene nanR CDS 222469..223836 product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467018.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene dcuC CDS complement(223879..224376) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366129.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene sspB CDS complement(224382..225020) product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257293.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene sspA CDS complement(225415..225807) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene rpsI CDS complement(225823..226251) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene rplM CDS complement(226470..227441) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192344.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene zapE CDS 227785..228189 product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295270.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene zapG CDS 228343..229710 product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295271.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene degQ CDS 229800..230867 product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497724.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene degS CDS complement(230929..231867) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295272.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene mdh CDS 232302..232772 product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257846.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene argR CDS 233086..233400 product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509740.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene yhcN CDS complement(233456..233728) product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029005.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(233820..235787) product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510962.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene aaeB CDS complement(235793..236725) product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854033.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene aaeA CDS complement(236733..236936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 237119..238048 product HTH-type transcriptional activator AaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440317.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene aaeR CDS complement(238176..239621) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055909.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene tldD sequence02 source 1..223667 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..745 product ISAs1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420862.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 893..1402 product YbgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076004.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 1399..2820 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628038.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene phrB CDS complement(2859..4340) product dipeptide permease DtpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032694.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene dtpD CDS 4611..5354 product radiation resistance protein YbgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798871.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene ybgI CDS 5377..6033 product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188343.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene pxpB CDS 6027..6959 product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912724.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene pxpC CDS 6949..7683 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687142.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene pxpA CDS 7719..8510 product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113989.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene nei CDS complement(8507..9544) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297246.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(9705..10766) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272420.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(10763..11494) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143529.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(11509..13968) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001316936.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(14019..14585) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472422.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(14975..16258) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785834.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene gltA CDS 16952..17356 product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263355.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene sdhC CDS 17350..17697 product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254365.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene sdhD CDS 17697..19463 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775540.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene sdhA CDS 19479..20195 product succinate dehydrogenase iron-sulfur subunit SdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235263.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene sdhB CDS 20496..23297 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181473.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene sucA CDS 23312..24529 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099820.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene odhB CDS 24895..26061 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048602.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene sucC CDS 26061..26930 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025458.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene sucD CDS complement(27034..27756) product mannosyl-D-glycerate transport/metabolism system transcriptional repressor MngR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509899.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene mngR CDS 27925..29841 product PTS 2-O-a-mannosyl-D-glycerate transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242633.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene mngA CDS 29859..32492 product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648976.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene mngB CDS 32517..32744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324497.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 33339..34907 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884361.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene cydA CDS 34923..36062 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568275.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene cydB CDS 36190..36483 product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034602.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene ybgE CDS 36633..37037 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098384.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene ybgC CDS 37043..37726 product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131314.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene tolQ CDS 37730..38158 product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090097.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene tolR CDS 38223..39488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 39621..40913 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295307.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene tolB CDS 40948..41469 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295306.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene pal CDS 41479..42270 product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097580.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene cpoB tRNA 42435..42510 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 42646..42721 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 42724..42799 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 42851..42926 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 42930..43005 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 43152..43227 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 43360..43435 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 43713..44756 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115290.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene nadA CDS 44794..45513 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345410.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene pnuC CDS complement(45510..46451) product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951276.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene zitB CDS complement(46565..46945) product YbgS-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784351.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 47261..48313 product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109196.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene aroG CDS complement(48471..49223) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295305.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene gpmA CDS complement(49425..50465) product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931389.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene galM CDS complement(50459..51607) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053415.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene galK CDS complement(51611..52657) product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191497.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene galT CDS complement(52667..53683) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265438.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene galE CDS complement(53944..55416) product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096869.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene modF CDS complement(55484..56272) product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147439.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene modE CDS 56401..56550 product multidrug efflux pump accessory protein AcrZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891515.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene acrZ CDS 56717..57490 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101984.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene modA CDS 57490..58179 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604034.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene modB CDS 58182..59240 product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891692.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene modC CDS complement(59241..60059) product bifunctional pyridoxal phosphate/fructose-1,6-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300666.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene ybhA CDS 60214..61209 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815435.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene pgl CDS complement(61250..62008) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643361.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 62501..63439 product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723652.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 63515..64948 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036475.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 65131..67392 product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593938.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(67533..68816) product putative acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091569.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(68951..70021) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533642.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(70257..70424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545728.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(70497..70781) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917774.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(70774..71058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 71568..71753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(71886..72434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 72454..73005 product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816478.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 73008..74630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 74630..75391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 75414..75899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 75899..76294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 77754..79091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(79129..80274) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266577.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(81058..81534) product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767389.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(81593..82825) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099955.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene bioA CDS 82969..84009 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951213.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene bioB CDS 84006..85160 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118818.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene bioF CDS 85147..85902 product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246761.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene bioC CDS 85895..86572 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044843.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene bioD CDS 87151..89172 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042533.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene uvrB CDS complement(89364..90272) product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295302.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene yvcK CDS 90669..91658 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295301.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene moaA CDS 91680..92192 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084639.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene moaB CDS 92195..92680 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080885.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene moaC CDS 92673..92918 product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598612.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene moaD CDS 92920..93372 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852287.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene moaE CDS 93508..94212 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373624.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 94417..95130 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446911.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(95166..96122) product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045450.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(96122..97363) product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650337.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene clsB CDS complement(97360..98121) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113348.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 98254..98664 product YbhQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871982.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(98626..99732) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469031.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(99743..100876) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070131.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(100869..102605) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198117.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(102598..103596) product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976400.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene hlyD CDS complement(103596..104267) product DNA-binding transcriptional regulator CecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340357.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene cecR CDS 104496..105860 product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007101.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene rhlE CDS complement(106092..106541) product N-glycosidase YbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145126.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene ybiA CDS 106694..108844 product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340191.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene dinG CDS 108872..109834 product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386551.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene ybiB CDS 109975..111060 product hydroxycarboxylate dehydrogenase HcXB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443530.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene hcxB CDS complement(111289..111549) product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849301.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene ybiJ CDS complement(111814..112080) product C4-type zinc finger protein YbiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146343.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene ybiI CDS complement(112154..112831) product PKHD-type hydroxylase YbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990177.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene ybiX CDS complement(112873..115155) product catecholate siderophore receptor Fiu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000430000.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(115420..115680) product DUF1471 family periplasmic protein McbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710619.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene mcbA CDS 115956..116882 product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295299.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene rlmF CDS complement(116879..119104) product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267253.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene ybiO CDS complement(119365..120087) product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569083.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene glnQ CDS complement(120084..120743) product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159065.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene glnP CDS complement(120882..121628) product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843866.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene glnH CDS complement(122032..122535) product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100800.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene dps CDS complement(122834..123721) product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295297.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene rhtA CDS 124074..124589 product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295296.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene ompX CDS complement(124638..126221) product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054678.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene opgE CDS complement(126493..126621) product manganase accumulation protein MntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001761.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene mntS CDS 126807..127274 product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091016.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene mntR CDS 127271..128389 product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056457.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(128448..129368) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056384.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene ldtB CDS 129587..131179 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961458.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(131347..132612) product DUF1479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168797.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(132764..133579) product sugar-phosphatase YbiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114272.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene ybiV CDS complement(133725..136157) product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209345.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(136163..137062) product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462972.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 137193..137855 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336208.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene fsa CDS complement(137931..138680) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829244.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene moeB CDS complement(138680..139915) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397381.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene moeA CDS 140119..141084 product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513775.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene iaaA CDS 141071..142942 product glutathione ABC transporter ATP-binding protein GsiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301279.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene gsiA CDS 142962..144500 product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090140.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene gsiB CDS 144518..145438 product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936043.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene gsiC CDS 145441..146352 product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236051.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene gsiD CDS 146782..148878 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360263.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 148886..150214 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086904.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(150261..151586) product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049367.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene rimO CDS 151799..152182 product biofilm formation regulator BssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497137.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene bssR CDS 152293..153408 product aldose sugar dehydrogenase YliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554959.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene yliI CDS complement(153405..154031) product glutathione S-transferase GstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061831.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene gstB CDS 154269..155480 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300708.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene dacC CDS complement(155527..156285) product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450121.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene deoR CDS complement(156343..156939) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295291.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene ybjG CDS 157224..158456 product multidrug efflux MFS transporter MdfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180089.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene mdfA CDS complement(158497..158775) product protein YbjH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480892.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene ybjH CDS complement(158867..159682) product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023565.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene ybjI CDS complement(159682..160890) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217859.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 160974..161510 product DNA-binding transcriptional regulator RcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295289.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene rcdA CDS complement(161690..162022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(162131..163147) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290950.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(163541..164110) product phage repressor protein CI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047327.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 164236..164457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247706.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 164490..164999 product phage regulatory CII family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460893.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 165171..165512 product DUF5347 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996717.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 165580..165813 product DUF2732 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244218.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 165813..166040 product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752613.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 166037..166894 product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104152.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 166891..169305 product replication endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017503.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 169458..169646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001580533.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 169657..169890 product DinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217561.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(170083..170418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 170891..171814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 171977..172939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(172957..173982) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208631010.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(173982..175748) product terminase ATPase subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098422.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 175891..176643 product GPO family capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216223.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 176780..177208 product Rz-like lysis system protein LysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162926034.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene lysB CDS 177304..177735 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039939.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 177728..178174 product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829122.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(178116..178922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 179026..179604 product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993775.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 179601..179960 product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177590.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 179947..180855 product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039067818.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 180848..181453 product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086812.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 181450..183072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 183074..183511 product tail assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344820.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(183483..184085) product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548498.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(184085..184627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 184655..184930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 184927..185295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(185840..187525) product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024876.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(188202..188459) product glutaredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195240.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene grxA CDS 188619..188906 product DUF1418 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201560.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 188890..189612 product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189159.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene nfsA CDS 189673..190575 product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684321.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene rimK CDS 190663..191139 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203025.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 191490..192602 product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126072.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene potF CDS 192697..193830 product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996005.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene potG CDS 193840..194793 product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105436.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene potH CDS 194790..195635 product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061665.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene potI CDS 195695..196183 product YbjO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389260.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 196224..197351 product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149709.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene rlmC CDS complement(197550..198281) product ABC transporter substrate-binding protein ArtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295905.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene artJ CDS complement(198572..199240) product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464491.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene artM CDS complement(199240..199956) product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001691.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene artQ CDS complement(199963..200694) product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756569.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene artJ CDS complement(200712..201512) product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027205.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene artP CDS complement(201658..202173) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270734.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 202299..202622 product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160737.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 202619..203449 product N-acetylmuramoyl-L-alanine amidase AmiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255151.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene amiD CDS complement(203446..204495) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069300.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(204558..205988) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136554.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(205999..207000) product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566370.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene ltaE CDS complement(207037..208755) product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815337.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene poxB CDS complement(208888..209856) product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178677.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene hcr CDS complement(209868..211520) product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458809.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene hcp CDS complement(211664..212563) product L-lysine exporter LysO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491142.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene lysO assembly_gap 212771..212836 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(213145..213840) product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298299.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene aqpZ CDS 214265..215923 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599802.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(215920..216912) product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241049.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 217045..218142 product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746460.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene macA CDS 218139..220085 product macrolide ABC transporter ATP-binding protein/permease MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188187.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene macB CDS complement(220158..220382) product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410785.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene cspD CDS 220705..221025 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520781.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene clpS CDS 221199..223331 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934041.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene clpA sequence03 source 1..202544 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(16..366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(849..1112) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274021.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene rpsT CDS 1495..2382 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767329.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene ribF CDS 2425..5241 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286857.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene ileS CDS 5241..5735 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083369.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene lspA CDS 5860..6309 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004655.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene fkpB CDS 6311..7261 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166395.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene ispH CDS 7327..8241 product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239137.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene rihC CDS 8408..9229 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543605.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene dapB CDS complement(9271..9438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 9684..10832 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597260.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene carA CDS 10850..14071 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126376.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene carB CDS complement(14119..14298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 14333..14728 product carnitine metabolism transcriptional regulator CaiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333125.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene caiF CDS complement(14937..15527) product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122884.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene caiE CDS complement(15533..16318) product crotonobetainyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295419.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene caiD CDS complement(16427..17980) product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301863.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene caiC CDS complement(18054..18791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 note possible pseudo, frameshifted CDS complement(18851..19270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 note possible pseudo, frameshifted CDS complement(19399..20541) product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347117.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene caiA CDS complement(20572..21912) product L-carnitine/gamma-butyrobetaine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787109.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene caiT CDS 22560..23330 product electron transfer flavoprotein FixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692204.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 23345..24286 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091499.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 24337..25623 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287715.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 25620..25907 product ferredoxin-like protein FixX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203741.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene fixX CDS 25964..27295 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183198.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 27403..27933 product glutathione-regulated potassium-efflux system oxidoreductase KefF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600725.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene kefF CDS 27926..29788 product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377194.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene kefC CDS 29869..30459 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301983.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene folA CDS complement(30537..31379) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257192.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene apaH CDS complement(31386..31763) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610901.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene apaG CDS complement(31766..32587) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065381.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene rsmA CDS complement(32584..33573) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241277.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene pdxA CDS complement(33573..34859) product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800457.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene surA CDS complement(34912..37266) product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746151.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene lptD CDS 37521..38336 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200579.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene djlA CDS complement(38453..39112) product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525176.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene rluA CDS complement(39124..42030) product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117011.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene rapA CDS complement(42195..44546) product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035670.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene polB CDS complement(44621..45316) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888654.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene araD assembly_gap 45391..45549 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(45634..47136) product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151734.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene araA CDS complement(47147..48847) product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951772.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene araB CDS 49177..50064 product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300811.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene araC CDS 50150..50914 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148403.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(51028..51726) product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916310.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene thiQ CDS complement(51710..53320) product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235721.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene thiP CDS complement(53296..54279) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301364.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene thiB CDS complement(54443..56098) product DNA-binding transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297366.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene sgrR CDS 56296..56547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 56438..57598 product sugar efflux transporter SetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637846.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene setA CDS complement(57647..58252) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818228.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene leuD CDS complement(58263..59663) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140652.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene leuC CDS complement(59666..60757) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042353.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene leuB CDS complement(60757..62328) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082850.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene leuA CDS 63149..64111 product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001395589.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene leuO CDS 64429..66153 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295534.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene ilvI CDS 66156..66647 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300383.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene ilvN CDS 66827..67831 product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762401.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene cra CDS 68433..68891 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295770.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene mraZ CDS 68893..69834 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970479.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene rsmH CDS 69831..70196 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625658.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene ftsL CDS 70212..71978 product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642196.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene ftsI CDS 71965..73452 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785141.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene murE CDS 73449..74807 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626688.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene murF CDS 74801..75883 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964131.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene mraY CDS 75886..77202 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796481.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene murD CDS 77202..78446 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295532.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene ftsW CDS 78443..79510 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016560.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene murG CDS 79564..81039 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096048.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene murC CDS 81032..81952 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130056.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene ddlB CDS 81954..82784 product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075744.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene ftsQ CDS 82781..84043 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588474.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene ftsA CDS 84104..85255 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462776.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene ftsZ CDS 85356..86273 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595482.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene lpxC CDS 86429..87016 product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014321.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene secM CDS 87078..89783 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905789.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene secA CDS 89843..90232 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736007.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene mutT CDS complement(90448..90645) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005042.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene yacG CDS complement(90655..91398) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194734.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene zapD CDS complement(91398..92018) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269520.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene coaE CDS 92243..93286 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217338.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene guaC CDS complement(93321..94523) product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157266.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene hofC CDS complement(94513..95898) product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025145.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene gspE CDS complement(95908..96348) product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360904.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene ppdD CDS complement(96551..97444) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135174.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene nadC CDS 97532..98083 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923721.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene ampD CDS 98080..98934 product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172005.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene ampE CDS complement(98977..100350) product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969915.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene aroP CDS 100891..101655 product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331776.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene pdhR CDS 101816..104479 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003820.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene aceE CDS 104494..106386 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963564.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene aceF CDS 106678..108135 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102483.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene lpdA CDS complement(108206..109948) product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784470.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 110414..113011 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307570.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene acnB CDS 113186..113548 product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384306.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene yacL CDS complement(113586..114380) product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734287.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene speD CDS complement(114396..115262) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818411.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene speE CDS complement(115368..115676) product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295568.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 115881..117431 product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189647.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene cueO CDS complement(117633..120023) product quinoprotein glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297052.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene gcd CDS 120229..120765 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683335.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene hpt CDS complement(120806..121468) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651599.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene can CDS 121577..122503 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150637.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 122500..123270 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972203.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 123375..123815 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901987.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 123879..125108 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277917.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(125112..125492) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621515.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene panD CDS 125766..126668 product recombination-promoting nuclease RpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339954.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene rpnC CDS complement(126742..127593) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905383.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene panC CDS complement(127605..128399) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805441.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene panB CDS complement(128512..129786) product fimbrial-like adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713138.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(129839..130435) product fimbrial-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553764.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(130462..131064) product fimbrial-like protein YadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143205.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene yadL CDS complement(131079..131648) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591057.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(131665..134265) product Yad fimbria usher protein HtrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153166.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene htrE CDS complement(134300..135040) product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465930.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(135145..135729) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038438.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(136099..136578) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215124.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene folK CDS complement(136575..137939) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723084.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene pcnB CDS complement(138032..138958) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937424.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene gluQRS CDS complement(138995..139450) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155227.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene dksA CDS complement(139628..140332) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000396036.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene sfsA CDS complement(140347..140877) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294700.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene thpR CDS 140906..143380 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938639.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene hrpB CDS 143383..143589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 143576..146101 product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918166.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene mrcB CDS 146321..148564 product ferrichrome porin FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124438.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene fhuA CDS 148615..149412 product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158929.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene fhuC CDS 149412..150302 product Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310529.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene fhuD CDS 150299..152281 product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044072.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene fhuB CDS complement(152439..153719) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045290.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene hemL CDS 153944..155365 product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845394.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene clcA CDS 155447..155791 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295564.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene erpA CDS complement(155838..156461) product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964221.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(156499..157299) product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129927.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene btuF CDS complement(157292..157990) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689844.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene mtnN CDS 158074..159591 product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057067.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene dgt CDS 159721..161145 product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753946.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene degP CDS 161300..162457 product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929439.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene cdaR CDS complement(162546..162932) product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272188.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(163094..163906) product phosphodiesterase YaeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625631.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene yaeI CDS complement(163960..164784) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186650.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene dapD CDS complement(164815..167487) product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094571.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene glnD CDS complement(167549..168343) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018194.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene map CDS 168711..169436 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246882.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene rpsB CDS 169694..170545 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818114.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene tsf CDS 170692..171417 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224573.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene pyrH CDS 171709..172266 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622418.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene frr CDS 172358..173554 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811923.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene ispC CDS 173740..174501 product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979579.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene ispU CDS 174622..175371 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922446.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene cdsA CDS 175383..176735 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295561.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene rseP CDS 176765..179197 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240896.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene bamA CDS 179319..179804 product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758956.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene skp CDS 179808..180833 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139279.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene lpxD CDS 180938..181393 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210739.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene fabZ CDS 181397..182185 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565966.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene lpxA CDS 182185..183333 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139654.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene lpxB CDS 183330..183926 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569423.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene rnhB CDS 183963..187445 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294769.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene dnaE CDS 187458..188417 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055746.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene accA CDS 188516..190657 product lysine decarboxylase LdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020973.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene ldcC CDS 190714..191103 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901098.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 191168..192466 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602174.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene tilS CDS complement(192515..192775) product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062312.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene rof CDS complement(192762..192962) product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417058.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 193128..193673 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185290.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 193670..194092 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635545.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene arfB CDS 194106..194816 product envelope stress response activation lipoprotein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239181.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene nlpE CDS complement(195016..195840) product YaeF family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336393.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(195893..197611) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260712.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene proS CDS complement(197722..198429) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094011.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(198426..198830) product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202329.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene rcsF CDS complement(198948..199763) product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874224.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene metQ CDS complement(199803..200456) product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294600.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(200449..201480) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593994.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene metN CDS 201668..202240 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140174.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene gmhB sequence04 source 1..171061 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 263..1321 product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231922.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene rsxD CDS 1325..1945 product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920799.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene rsxG CDS 1949..2644 product electron transport complex subunit RsxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289652.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene rsxE CDS 2644..3279 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030339.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene nth CDS 3890..5392 product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100932.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene dtpA CDS 5498..6103 product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765749.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene gstA CDS complement(6147..7007) product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789751.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene pdxY CDS complement(7069..8343) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295400.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene tyrS CDS complement(8472..9128) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282319.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene pdxH CDS complement(9187..9516) product C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178044.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene mliC CDS complement(9614..10723) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835077.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene anmK CDS 10997..11464 product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597196.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene slyB CDS complement(11511..11945) product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296943.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene slyA CDS 12146..12382 product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670998.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 12385..13242 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296942.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 13242..15254 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994333.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(15255..15776) product superoxide dismutase [Cu-Zn] SodC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296937.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene sodC CDS complement(15857..16753) product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250656.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 17144..17743 product DNA-binding transcriptional regulator NemR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032936.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene nemR CDS 17780..18877 product N-ethylmaleimide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093589.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene nemA CDS 18958..19365 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237796.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene gloA CDS 19468..20115 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282281.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene rnt CDS 20208..24824 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310858.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(24875..25222) product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108172.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene grxD CDS complement(25304..25456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 25556..26371 product peptidoglycan DD-endopeptidase MepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101193.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene mepH CDS 26499..27080 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007283.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene sodB CDS complement(27315..28484) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701040.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 29038..30063 product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190982.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene purR CDS complement(30060..30992) product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269493.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene punR CDS 31105..32316 product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182363.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene punC CDS 32607..33755 product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098896.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene cfa CDS complement(33795..34436) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493947.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene ribE CDS 34651..36024 product multidrug efflux MATE transporter MdtK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174940.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene mdtK CDS complement(36065..37321) product AIDA repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534291.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 tRNA 37629..37705 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 37710..37786 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 37894..38199 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212678.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 38325..39929 product FAD-NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716950.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(39941..40705) product protein YdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587525.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene ydhT CDS complement(40757..41542) product thiosulfate reductase cytochrome B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069979.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(41539..42093) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310861.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(42271..42909) product YdhW family putative oxidoreductase system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517579.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(42922..45024) product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273527.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(45045..45671) product ferredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070230.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(46126..46335) product fumarate hydratase FumD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528342.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene fumD CDS 46892..48304 product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295403.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene pykF CDS 48615..48851 product murein lipoprotein Lpp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648420.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene lpp CDS complement(48915..49919) product L,D-transpeptidase LdtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817105.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene ldtE CDS complement(50068..50484) product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196530.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene sufE CDS complement(50497..51717) product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144575.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene sufS CDS complement(51714..52985) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908012.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene sufD CDS complement(52960..53706) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948865.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene sufC CDS complement(53716..55203) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089364.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene sufB CDS complement(55212..55580) product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367160.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene sufA CDS complement(56128..56316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(56416..56826) product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637982.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene menI CDS complement(56823..59879) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612968.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 60268..61380 product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248636.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene ydiK CDS 61809..62165 product YdiL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301287.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 62298..62624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 note possible pseudo, frameshifted CDS 62624..63478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 note possible pseudo, frameshifted CDS 63705..64970 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081197.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 64982..65848 product quinate/shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383469.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene ydiB CDS 65879..66637 product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860167.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene aroD CDS 66782..68377 product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805700.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 68391..69542 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347850.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(69585..70496) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284784.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 70812..71576 product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692148.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 71596..72534 product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080700.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 72590..73879 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278525.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 73876..74169 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081071.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 74172..75872 product medium-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553704.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene fadK CDS complement(75929..78307) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069375.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene ppsA CDS 78721..79473 product posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368046.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene ppsR CDS 79630..80676 product 3-deoxy-7-phosphoheptulonate synthase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082229.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene aroH CDS 80781..80999 product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966807.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene hemP CDS complement(81003..82439) product protein adenylyltransferase SelO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175576.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene selO CDS complement(82502..83044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 note possible pseudo, frameshifted CDS complement(83461..83925) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209795.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(84003..84752) product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029466.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene btuD CDS complement(84752..85303) product bifunctional thioredoxin/glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154168.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene btuE CDS complement(85366..86346) product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956528.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene btuC CDS complement(86447..86746) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229265.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene ihfA CDS complement(86751..89138) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672380.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene pheT CDS complement(89153..90136) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018596.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene pheS CDS complement(90587..90943) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124850.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene rplT CDS complement(90996..91193) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124225.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene rpmI CDS complement(91290..91724) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058403.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene infC CDS complement(91836..93764) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144202.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene thrS CDS 94286..94759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 note possible pseudo, frameshifted CDS 95379..96185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(96517..97227) product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771391.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 97562..98491 product 6-phosphofructokinase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251727.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene pfkB CDS 98592..98882 product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146159.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene ghoS CDS 98988..99848 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267650.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(99889..100425) product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222172.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 100572..101240 product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106833.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene hxpB CDS 101403..101993 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295408.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 102126..103517 product cystine/sulfocysteine:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010696.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene tcyP CDS complement(103542..104324) product protein YdjO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310874.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene ydjO CDS complement(104613..104768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 105059..107320 product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077825.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene katE CDS complement(107578..108327) product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440471.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene chbG CDS complement(108340..109692) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078748.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene celF CDS complement(109797..110636) product transcriptional regulator ChbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983647.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene chbR CDS complement(110647..110997) product PTS N,N'-diacetylchitobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968919.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene chbA CDS complement(111048..112406) product PTS N,N'-diacetylchitobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073041.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene chbC CDS complement(112491..112811) product PTS N,N'-diacetylchitobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412169.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene chbB CDS complement(113110..113448) product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039044.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene osmE CDS 113650..114477 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175037.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene nadE CDS 114707..115594 product excinuclease Cho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252397.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene cho CDS complement(115554..116192) product environmental stress-induced protein Ves inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300480.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene ves CDS complement(116332..116817) product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228984.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene spy CDS complement(117147..118115) product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368506.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene astE CDS complement(118108..119451) product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994973.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene astB CDS complement(119448..120926) product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177212.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene astD CDS complement(120923..121957) product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989419.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene astA CDS complement(121954..123174) product succinylornithine/acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081983.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene astC CDS 123620..124426 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673918.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene xthA CDS 124593..125303 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309538.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 125331..125948 product lipoprotein YdjY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077942.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene ydjY CDS 125963..126670 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975812.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 126670..127218 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524097.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 127228..128394 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215339.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 128400..129902 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224958.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 129902..130555 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300558.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 130622..131929 product thiosulfate sulfurtransferase YnjE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350515.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene ynjE CDS complement(131938..132558) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295484.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 132645..133052 product CTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781888.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene nudG CDS complement(133018..133290) product YnjH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085240.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 133526..134869 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373021.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene gdhA CDS complement(134986..136026) product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756910.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(136154..138115) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235800.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene topB CDS complement(138120..139163) product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295485.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene selD CDS complement(139280..139831) product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339283.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 139992..141848 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259810.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene sppA CDS 142015..143031 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170162.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene ansA CDS 143042..143683 product bifunctional pyrazinamidase/nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135066.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(143776..145134) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438807.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(145252..146010) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719088.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(146147..147127) product NADH-dependent methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723719.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene ydjG CDS complement(147137..148084) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369231.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(148089..148925) product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878903.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(148946..149923) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798110.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(150006..151385) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435282.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(151412..152488) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645221.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(152858..153130) product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046791.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(153172..153585) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284618.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene msrB CDS 153927..154922 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153502.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene gapA CDS 155006..155890 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299317.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(155938..156792) product methylglyoxal reductase YeaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186371.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene yeaE CDS complement(156882..157628) product scaffolding protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163771.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene mipA CDS 158193..159998 product protein kinase YeaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019882.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene yeaG CDS 160111..161394 product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219686.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 161541..163016 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616433.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 163197..164687 product diguanylate cyclase DgcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766132.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene dgcJ CDS 164730..165233 product mischarged aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138051.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene yeaK CDS 165508..165954 product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460707.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(165911..166345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 166829..168010 product 2-nitroimidazole transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128491.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene nimT CDS 168065..168412 product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297652.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(168434..168688) product DUF333 domain-containing lipoprotein YoaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691930.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene yoaF CDS 168871..169896 product diguanylate cyclase DgcP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306169.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene dgcP CDS complement(170163..170411) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512153.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(170559..170741) product DUF1869 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513737.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(170745..170969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 sequence05 source 1..167615 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(31..1389) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409873.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 2096..4399 product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287458.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene pgaA CDS 4408..6426 product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945561.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene pgaB CDS 6539..7744 product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610451.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene pgaC CDS 7746..8159 product poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061095.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene pgaD CDS complement(8209..8997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(9618..10889) product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199471.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene efeB CDS complement(10895..12022) product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154398.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene efeO CDS complement(12080..12910) product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497942.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(13453..14961) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018486.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene putP CDS complement(15120..15272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 15384..19346 product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299828.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene putA CDS complement(19386..20024) product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191701.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene rutR CDS 20309..21403 product pyrimidine utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326839.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene rutA CDS 21403..22095 product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393558.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene rutB CDS 22107..22493 product 3-aminoacrylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126780.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene rutC CDS 22501..23301 product pyrimidine utilization protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777653.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene rutD CDS 23311..23901 product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001189.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 23912..24406 product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028095.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene rutF CDS 24427..25755 product pyrimidine utilization transport protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326838.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene rutG CDS complement(26013..26186) product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273658.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 26559..27155 product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151437.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene wrbA CDS 27176..27403 product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143120.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(27441..28682) product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044307.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene agp CDS complement(28965..30224) product YccE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535353.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 30485..31405 product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420621.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene cbpA CDS 31405..31710 product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024560.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene cbpM CDS complement(31862..32461) product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209869.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene torD CDS complement(32458..35004) product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062091.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene torA CDS complement(35004..36176) product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230242.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene torC CDS 36306..36998 product two-component system response regulator TorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120125.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene torR CDS complement(36971..37999) product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264933.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene torT CDS 38112..40826 product TMAO reductase system sensor histidine kinase/response regulator TorS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300633.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene torS CDS 40898..41971 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829662.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(42019..42192) product addiction module toxin, GnsA/GnsB family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019197.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(42586..42798) product cold shock protein CspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066490.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene cspG CDS 43084..43296 product cold shock-like protein CspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087763.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene cspH CDS 43715..44020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032438.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 44193..44771 product lipoprotein GfcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247610.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene gfcB CDS 44768..45514 product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038079.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 45514..47610 product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742329.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 47635..48795 product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295357.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 48783..49229 product protein-tyrosine-phosphatase Etp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057871.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene etp CDS 49249..51429 product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208668.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene etk CDS complement(51544..52842) product bifunctional acid phosphatase/4-phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297112.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene appA CDS complement(53027..54163) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460803.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene appB CDS complement(54175..55719) product cytochrome bd-II oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263582.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene appC CDS complement(55853..56710) product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004899.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(56707..57105) product hydrogenase-1 operon protein HyaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063978.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene hyaE CDS complement(57102..57689) product hydrogenase 1 maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003671.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(57686..58393) product Ni/Fe-hydrogenase b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186424.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene hyaC CDS complement(58412..60205) product Ni/Fe-hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107384.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene hyaB CDS complement(60202..61320) product hydrogenase 1 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058323.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene hyaA tRNA 61747..61834 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 62041..62700 product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375136.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene yccA CDS 62791..63120 product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301417.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene tusE CDS complement(63117..63395) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048252.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene yccX CDS 63490..64680 product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116297.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene rlmI CDS 64738..65055 product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295356.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene hspQ CDS complement(65100..65513) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301418.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 65686..66348 product DUF2057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847791.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 66435..66902 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275684.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene mgsA CDS complement(66934..68988) product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295354.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene helD CDS 69111..69557 product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261236.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 69567..71729 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875023.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene yccS CDS complement(71692..72321) product CRP-S regulon transcriptional coactivator Sxy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839153.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene sxy CDS 72534..73049 product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288710.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene sulA CDS complement(73033..73251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 73406..74446 product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750416.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene ompA CDS complement(74522..74974) product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877161.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene matP CDS 75160..76920 product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156526.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 76881..77507 product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018747.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene fabA CDS complement(77577..77744) product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828648.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene rmf CDS complement(78000..78563) product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759120.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene pqiC CDS complement(78560..80200) product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445533.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene pqiB CDS complement(80205..81458) product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333176.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene pqiA CDS complement(81588..83495) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053099.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(83507..85615) product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086539.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene rlmKL CDS 85859..86968 product 6-N-hydroxylaminopurine resistance protein YcbX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212426.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene ycbX CDS complement(86965..87507) product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295353.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene zapC CDS complement(87681..88691) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295352.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene pyrD CDS complement(88802..89482) product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307699.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(89505..90020) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919497.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(90028..90570) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730614.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(90582..91652) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165668.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(91643..94243) product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286312.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(94268..94969) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295349.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(95052..95591) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750293.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 95947..96522 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263933.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene ssuE CDS 96515..97474 product aliphatic sulfonate ABC transporter substrate-binding protein SsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488238.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene ssuA CDS 97471..98616 product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056006.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene ssuD CDS 98627..99418 product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235203.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene ssuC CDS 99415..100182 product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090506.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene ssuB CDS complement(100225..102837) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193841.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene pepN CDS 103103..104305 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297200.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene pncB CDS 104474..105874 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117881.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene asnS CDS 106476..107564 product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977920.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene ompF CDS complement(107580..107762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196607.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 107749..108939 product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462687.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene aspC CDS complement(109161..109808) product hydroxyacylglutathione hydrolase GloC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109486.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene gloC CDS complement(109835..110383) product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295932.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(110564..112411) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925969.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene ldtD CDS complement(112672..117132) product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572668.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene mukB CDS complement(117132..117836) product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295347.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene mukE CDS complement(117817..119139) product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288850.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene mukF CDS complement(119136..119921) product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298300.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene cmoM CDS 120057..120836 product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899600.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene elyC CDS complement(120813..121706) product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436922.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(121860..122606) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011603.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene kdsB CDS complement(122603..122785) product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350058.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene ycaR CDS complement(122837..124069) product winged helix DNA-binding protein YcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056538.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(124106..125092) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570539.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene lpxK CDS complement(125089..126837) product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551270.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene msbA CDS complement(126874..129138) product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705764.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(129346..129630) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167336.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene ihfB CDS complement(129790..131463) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140327.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene rpsA CDS complement(131574..132257) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125016.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene cmk CDS complement(132430..133194) product metallopeptidase YcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295345.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene ycaL CDS complement(133363..134646) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445231.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene aroA CDS complement(134717..135805) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057149.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene serC CDS complement(136004..136696) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642849.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 136826..138586 product 30S ribosomal protein S12 methylthiotransferase accessory factor YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295344.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene ycaO CDS 138991..139848 product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642546.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene focA CDS 139903..142185 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292822.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene pflB CDS 142377..143117 product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111043.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene pflA CDS complement(143199..143789) product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190363.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 143889..144797 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242684.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(144798..146228) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918506.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(146438..147586) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109259.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 147900..148526 product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165879.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene ycaC CDS complement(148561..149424) product dimethyl sulfoxide reductase anchor subunit DmsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534637.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene dmsC CDS complement(149426..150043) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213098.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene dmsB CDS complement(150054..152498) product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850303.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene dmsA CDS complement(152737..154029) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886683.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene serS CDS complement(154120..155463) product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067755.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene rarA CDS complement(155474..156088) product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976047.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene lolA CDS complement(156240..160268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(160403..160897) product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228473.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene lrp CDS 161442..162407 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537418.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene trxB CDS 162530..164296 product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043574.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene cydD CDS 164297..166018 product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202188.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene cydC CDS 166060..166764 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241678.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene aat CDS 167049..167267 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene infA tRNA 167520..167607 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 sequence06 source 1..167047 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 257..601 product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472021.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 603..995 product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826503.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(1047..2462) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695655.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene gltX assembly_gap 2742..2920 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 2985..3060 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 3065..3140 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 3260..3601 product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201413.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(3592..4518) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109794.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 4608..5606 product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765610.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(5603..5821) product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410201.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(5823..7838) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443681.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene ligA CDS complement(7909..8343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 8434..8760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 9125..9886 product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254839.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene cysZ CDS 10071..11042 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034402.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene cysK CDS 11426..11683 product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene ptsH CDS 11728..13455 product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623136.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene ptsI CDS 13496..14005 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522247.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene crr CDS complement(14048..14899) product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096674.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene pdxK CDS 15004..15378 product YfeK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719960.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 15411..16145 product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745534.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(16350..17261) product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309637.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene cysM CDS complement(17395..18492) product sulfate/thiosulfate ABC transporter ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021036.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene cysA CDS complement(18482..19357) product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852686.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene cysW CDS complement(19357..20190) product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458420.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene cysT CDS complement(20190..21206) product thiosulfate/sulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290236.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene cysP CDS complement(21510..22301) product SDR family oxidoreductase UcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517430.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene ucpA CDS complement(22430..23287) product HTH-type transcriptional regulator MurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966471.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene murR CDS 23451..24347 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175648.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene murQ CDS 24351..25775 product PTS N-acetylmuramic acid transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040483.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene murP CDS complement(25955..26854) product porphyrinogen peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084590.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene yfeX CDS complement(26950..27525) product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838944.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(27732..28181) product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300381.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(28168..28593) product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406000.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 28807..29676 product N-acetylmuramoyl-L-alanine amidase AmiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102886.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene amiA CDS 29680..30579 product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801367.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene hemF CDS complement(30585..31637) product HTH-type transcriptional regulator EutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753690.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene eutR CDS complement(31683..32183) product ethanolamine utilization microcompartment protein EutK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606257.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene eutK CDS complement(32196..32855) product ethanolamine utilization microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111038.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene eutL CDS complement(32865..33752) product ethanolamine ammonia-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372364.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene eutC CDS complement(33773..35134) product ethanolamine ammonia-lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769961.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene eutB CDS complement(35146..36549) product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097464.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene eutA CDS complement(36546..37772) product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512385.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene eutH assembly_gap 37824..38006 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(38137..39324) product ethanolamine utilization ethanol dehydrogenase EutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301866.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene eutG CDS complement(39314..40150) product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929729.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene eutJ CDS complement(40161..41564) product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075711.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(41576..41863) product ethanolamine utilization microcompartment protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762196.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene eutN CDS complement(41970..42263) product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene eutM CDS complement(42302..43318) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582977.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene pta CDS complement(43308..44117) product ethanolamine utilization cob(I)yrinic acid a,c-diamide adenosyltransferase EutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651298.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene eutT CDS complement(44114..44815) product ethanolamine utilization acetate kinase EutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733903.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene eutQ CDS complement(44790..45269) product ethanolamine utilization acetate kinase EutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820782.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene eutP CDS complement(45282..45617) product ethanolamine utilization microcompartment protein EutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356956.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene eutS CDS complement(45910..48189) product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342644.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene maeB CDS 48478..49428 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003709.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene tal CDS 49448..51451 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087280.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene tkt CDS complement(51546..52430) product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270542.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(52715..53290) product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300814.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene nudK CDS complement(53358..55337) product formate-dependent uric acid utilization protein AegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078880.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene aegA CDS 55528..57243 product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300881.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene narQ CDS 57407..60520 product multidrug efflux RND transporter permease AcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273151.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene acrD CDS 61059..61415 product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258236.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 61419..62546 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277801.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene dapE CDS 62574..62774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(62884..63582) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679799.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene ypfH CDS complement(63656..65671) product tRNA cytosine(34) acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829360.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene tmcA CDS complement(65686..66549) product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267498.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(66717..67430) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295467.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene purC CDS complement(67643..68677) product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297320.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene bamC CDS complement(68694..69572) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295469.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene dapA CDS 69718..70290 product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176187.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 70290..70760 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068682.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene bcp CDS 71013..71630 product hydrogenase 4 subunit HyfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295470.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene hyfA CDS 71630..73648 product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339489.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene hyfB CDS 73659..73973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 note possible pseudo, frameshifted CDS 73886..74605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 note possible pseudo, frameshifted CDS 74708..76057 product hydrogenase 4 subunit HyfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429104.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene hyfD CDS 76072..76722 product hydrogenase 4 membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147991.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene hyfE CDS 76727..78307 product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122577.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene hyfF CDS 78297..79964 product hydrogenase 4 catalytic subunit HyfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102321.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene hyfG CDS 79974..80513 product hydrogenase 4 subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916082.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene hyfH CDS 80510..81268 product hydrogenase 4 catalytic subunit HyfI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075546.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene hyfI CDS 81261..81674 product hydrogenase 4 assembly chaperone HyfJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326580.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene hyfJ CDS 81704..83716 product DNA-binding transcriptional regulator HyfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251558.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene hyfR CDS 83738..84586 product formate transporter FocB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244734.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene focB CDS complement(84624..85685) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892044.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 85898..87361 product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489667.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene bepA CDS 87382..87741 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166449.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene arsC CDS complement(87879..88625) product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247065.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(88675..89964) product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198328.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene uraA CDS complement(90050..90676) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295473.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene upp CDS 90986..92038 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295474.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene purM CDS 92038..92676 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028614.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene purN CDS 92841..94913 product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529576.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene ppk1 CDS 94918..96459 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121363.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene ppx CDS complement(96498..98573) product cyclic-guanylate-specific phosphodiesterase PdeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772731.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene pdeF CDS complement(98923..99075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017552.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 99093..99284 product YfgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076001.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 99598..100113 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295476.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 100129..100668 product DUF5384 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755173.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(100761..102338) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138270.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene guaA CDS complement(102407..103873) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299507.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene guaB CDS 104035..105405 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937912.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene xseA CDS complement(105402..105617) product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301158.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(105687..107159) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249410.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene der CDS complement(107277..108455) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177048.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene bamB CDS complement(108466..109086) product ancillary SecYEG translocon subunit YfgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409205.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene yfgM CDS complement(109104..110378) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107167.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene hisS CDS complement(110489..111607) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551807.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene ispG CDS complement(111634..112647) product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090858.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene rodZ CDS complement(112932..114086) product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003317.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(114236..114667) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963837.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene ndk CDS complement(114816..116993) product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137675.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene pbpC CDS complement(117129..122090) product alpha2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736312.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene yfhM CDS 122297..123142 product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108626.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene sseA CDS complement(123960..124736) product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295479.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene sseB CDS complement(124878..126161) product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133582.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene pepB CDS complement(126219..126419) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523616.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene iscX CDS complement(126431..126766) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124469.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene fdx CDS complement(126768..128618) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196613.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene hscA CDS complement(128635..129150) product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384413.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene hscB CDS complement(129246..129569) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028953.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene iscA CDS complement(129586..129972) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331707.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene iscU CDS complement(130000..131214) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295373.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene iscS CDS complement(131326..131814) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241357.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene iscR CDS complement(132175..132915) product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940019.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene trmJ CDS 133034..133837 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553451.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene suhB CDS 133982..134836 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299515.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 135123..136307 product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982994.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene csiE CDS complement(136299..137438) product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244193.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(137598..138488) product DNA-binding transcriptional regulator HcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423257.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene hcaR CDS 138624..139985 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211172.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 139982..140500 product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276076.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 140500..140820 product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080102.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 140817..141629 product 3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281372.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene hcaB CDS 141639..142841 product phenylpropionate dioxygenase ferredoxin reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660788.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 142938..143360 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094726.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(143408..144280) product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158547.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(144292..145353) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700809.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(145419..146417) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276670.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(146442..147953) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493470.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(147976..148959) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124894.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(149056..152337) product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386984.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 152455..153648 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(153846..155099) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919159.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene glyA CDS 155427..156617 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883122.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene hmpA CDS complement(156662..157000) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914032.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene glnB CDS complement(157061..158395) product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295369.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene glrR CDS complement(158385..159032) product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215861.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene qseG CDS 159032..159196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(159263..160645) product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297612.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene qseE CDS complement(161266..165153) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970122.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene purL CDS 165411..166943 product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734212.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene mltF sequence07 source 1..151626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(29..1897) product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102319.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene kup CDS 2120..3616 product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315921.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene ravA CDS 3610..5061 product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956642.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene viaA CDS complement(5066..6058) product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845133.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene asnA CDS 6210..6668 product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432970.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene asnC CDS 6758..7201 product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763731.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene mioC CDS 7580..9469 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499788.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene mnmG CDS 9533..9928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 note possible pseudo, frameshifted CDS 9966..10151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 note possible pseudo, frameshifted CDS 10768..11148 product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116695.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene atpI CDS 11157..11972 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135625.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene atpB CDS 12019..12258 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene atpE CDS 12320..12790 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052217.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene atpF CDS 12805..13338 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288587.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene atpH CDS 13351..14892 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176745.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene atpA CDS 14943..15806 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896498.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene atpG CDS 15833..17215 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190506.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene atpD CDS 17236..17655 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251965.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 18008..19378 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933736.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene glmU CDS 19540..21369 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334099.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene glmS CDS 21683..22723 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867146.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene pstS CDS 22809..23768 product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741620.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene pstC CDS 23768..24658 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251991.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene pstA CDS 24841..25614 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063125.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene pstB CDS 25629..26354 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377786.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene phoU CDS 26640..27476 product transcriptional antiterminator BglG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295251.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene bglG CDS 27609..29486 product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137312.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene bglF CDS 29505..30899 product 6-phospho-beta-glucosidase BglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643228.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene bglB CDS 30985..32601 product carbohydrate-specific porin BglH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489881.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene bglH CDS 32628..33797 product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295249.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 33812..34534 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766900.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(34596..35183) product PF03691 family colicin E2 tolerance protein CbrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193070.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene cbrC CDS complement(35232..35714) product protein CbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116772.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(35772..36437) product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078043.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene yieH CDS 36604..37941 product adenine permease AdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082693.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene adeP CDS complement(37995..38561) product class I chromate reductase YieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291268.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene yieF CDS complement(38583..39332) product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190670.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(39489..40457) product HTH-type transcriptional regulator YidZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748502.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene yidZ CDS complement(40423..41598) product multidrug efflux MFS transporter MdtL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085982.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene mdtL CDS complement(41730..42977) product low affinity tryptophan permease TnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131911.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene tnaB CDS complement(43068..44483) product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295247.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene tnaA CDS complement(45021..46385) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282347.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene mnmE CDS complement(46491..48137) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378258.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene yidC CDS complement(48361..48687) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239730.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene rnpA CDS complement(48737..48877) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831330.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene rpmH CDS 49553..50887 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059111.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene dnaA CDS 50892..51992 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673464.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene dnaN CDS 51992..53065 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060112.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene recF CDS 53094..55508 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072067.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene gyrB CDS 55748..56146 product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522208.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 56261..57073 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985549.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene yidA CDS complement(57119..57775) product protein YidX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772934.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene yidX CDS 58053..58742 product D-galactonate utilization transcriptional regulator DgoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174305.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene dgoR CDS 58739..59617 product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127112.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene dgoK CDS 59601..60218 product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198722.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene dgoA CDS 60215..61363 product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705001.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene dgoD CDS 61483..62775 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354284.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(62772..63836) product colicin M resistance lipid reductase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387166.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene cbrA CDS 63937..65151 product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295245.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(65153..65413) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313407.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 65791..66204 product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243437.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene ibpA CDS 66316..66744 product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243431.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene ibpB CDS 66940..68601 product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279763.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(68598..69083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 69531..71147 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952127.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 71147..72469 product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160113.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(72466..73359) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013540.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 73526..75241 product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087145.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 75238..76731 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828527.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(76778..77227) product protein YidI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene yidI CDS 77336..77683 product YidH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703959.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 77673..78035 product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113432.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 78032..78529 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148063.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(78537..79697) product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306726.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene emrD CDS 80859..82547 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168475.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene ilvB CDS 82551..82841 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181706.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene ilvN CDS 82916..83506 product transcriptional regulator UhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633668.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene uhpA CDS 83506..85008 product signal transduction histidine-protein kinase/phosphatase UhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295243.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene uhpB CDS 85018..86337 product MFS transporter family glucose-6-phosphate receptor UhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936566.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene uhpC CDS 86475..87866 product hexose-6-phosphate:phosphate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879194.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene uhpT CDS complement(87912..89678) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065718.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene adeD CDS 89853..91187 product adenine permease AdeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001403836.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene adeQ CDS 91240..91692 product DUF1198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295241.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 91903..93093 product purine ribonucleoside efflux pump NepI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288549.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene nepI CDS complement(93134..93427) product protein YicS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805509.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene yicS CDS 93649..94467 product lipoprotein NlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779426.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene nlpA CDS complement(94471..95394) product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535960.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(95505..96689) product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172876.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(97479..98324) product DUF4942 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280513.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(98409..98606) product DUF957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772029.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(98618..99106) product DUF5983 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761715.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(99103..99468) product TA system toxin CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094437.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(100447..100803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(101266..101502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(101836..105333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(105612..105797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 note possible pseudo, internal stop codon CDS 106612..106767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 106816..107190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(107501..108664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(108718..109203) product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168305.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene ssb1 CDS complement(109851..112232) product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065355591.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(112247..113185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 113786..114880 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065355593.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(115278..116321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999840.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(116732..117916) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218908.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 tRNA complement(118216..118310) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 118603..119985 product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834439.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 119995..122313 product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702898.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene yicI CDS complement(122366..124075) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300954.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(124196..125587) product xanthine/proton symporter XanP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295238.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene xanP CDS 125867..127072 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468833.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene gltS CDS 127075..127941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(127926..130007) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678419.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene recG CDS complement(130013..130702) product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070177.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene trmH CDS complement(130709..132817) product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280488.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene spoT CDS complement(132836..133111) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene rpoZ CDS complement(133166..133789) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295237.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene gmk CDS 134212..135729 product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870036.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene ligB CDS complement(135726..136343) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(136634..137458) product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297973.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene dinD CDS complement(137679..138542) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621336.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 138669..139385 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247089.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene rph CDS 139451..140092 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806177.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene pyrE CDS complement(140129..140725) product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311223.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene slmA CDS complement(140832..141290) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976070.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene dut CDS complement(141268..142488) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050139.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene coaBC CDS 142660..143328 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297375.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene radC CDS 143545..143781 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091955.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene rpmB CDS 143802..143969 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051798.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene rpmG CDS 144067..144876 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114543.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene mutM CDS complement(144915..145394) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171866.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene coaD CDS complement(145402..146679) product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891574.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene waaA CDS 147146..148150 product lipopolysaccharide core heptosyltransferase RfaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303718.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene rfaQ CDS 148147..149271 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634246.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 149264..150061 product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001357918.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene rfaP CDS 150077..151093 product lipopolysaccharide 3-alpha-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272734.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene waaO CDS 151110..151613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 sequence08 source 1..144017 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(48..446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 note possible pseudo, frameshifted CDS complement(1197..2537) product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295701.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene fadL CDS 2909..3193 product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296261.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 3374..4684 product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531952.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene fadI CDS 4684..6828 product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426176.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene fadJ CDS 7031..7516 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195819.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene sixA CDS 8196..8759 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033316.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 8899..11487 product fimbrial usher protein YfcU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112832.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene yfcU CDS 11507..12259 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281606.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 12276..12782 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642898.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 12779..13258 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738798.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 13255..13806 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054808.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 13835..14632 product StfH/YfcO family fimbrial adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301548.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(14758..15309) product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730805.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene smrB CDS 15475..16407 product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295704.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene prmB CDS 16442..17527 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297933.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene aroC CDS 17531..18355 product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043825.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene mepA CDS 18355..19164 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447361.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 19164..19712 product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089222.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene epmC CDS 19746..20024 product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559764.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(20145..22151) product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683799.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene mnmC CDS 22310..23530 product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817178.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene fabB CDS 23795..24973 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127753.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(24970..25845) product flagella biosynthesis regulator Flk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615834.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene flk CDS 26064..27200 product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699148.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene pdxB CDS 27266..28279 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289167.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 28279..29091 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283586.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene truA CDS 29174..29833 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364335.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 29989..30903 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118404.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene accD CDS 30973..32241 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584546.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene folC CDS 32231..32893 product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146992.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene dedD CDS 33152..33640 product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262113.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene cvpA CDS 33677..35194 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334220.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene purF CDS 35289..35858 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825700.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene ubiX CDS 36124..36906 product lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748271.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene argT CDS 37127..37909 product histidine ABC transporter substrate-binding protein HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737621.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene hisJ CDS 37999..38685 product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965522.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene hisQ CDS 38682..39398 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569958.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 39406..40179 product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293613.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene hisP CDS 40376..41266 product recombination-promoting nuclease RpnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156149.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene rpnB CDS complement(41314..42207) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028341.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(42228..42590) product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068457.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene folX CDS complement(42647..43294) product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566471.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene yfcG CDS 43430..44074 product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042440.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene yfcF CDS 44130..44681 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977007.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene yfcE CDS 44739..45281 product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437935.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene yfcD CDS complement(45314..46792) product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274493.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene yfcC CDS complement(47024..49168) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086722.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene pta CDS complement(49243..50445) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095707.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene ackA CDS 50784..51239 product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106627.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene yfbV CDS 51322..51816 product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426124.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 51827..52477 product hexitol phosphatase HxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203392.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene hxpA CDS 52564..54396 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012899.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(54455..55054) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813860.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene yfbR CDS complement(55138..56355) product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074527.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene alaA CDS 57275..58213 product transcriptional regulator LrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622290.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene lrhA CDS 58844..59287 product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062997.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene nuoA CDS 59303..59965 product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386733.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene nuoB CDS 60059..61861 product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247878.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene nuoC CDS 61864..62364 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545042.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene nuoE CDS 62361..63698 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789500.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene nuoF CDS 63751..66477 product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301902.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene nuoG CDS 66474..67451 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118512.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene nuoH CDS 67466..68008 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172749.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene nuoI CDS 68020..68574 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393511.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene nuoJ CDS 68571..68873 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612644.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene nuoK CDS 68870..70711 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056643.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene nuoL CDS 70942..72471 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926441.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene nuoM CDS 72478..73935 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156701.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene nuoN CDS complement(74003..74521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(74839..75360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 note possible pseudo, frameshifted CDS complement(75447..75950) product YfbM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525365.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(77070..78278) product deubiquitinase ElaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393504.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene elaD CDS complement(78469..79386) product ribonuclease BN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300687.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene rbn CDS 79451..79912 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574091.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 79967..80272 product stress response protein ElaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070621.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene elaB CDS 80351..81646 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191419.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene menF CDS 81735..83405 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295284.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene menD CDS 83402..84160 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600499.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene menH CDS 84175..85032 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639996.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene menB CDS 85032..85994 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255628.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene menC CDS 85991..87346 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577625.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene menE CDS 87456..87722 product signal transduction protein PmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295285.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene pmrD CDS complement(87716..88102) product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523880.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene arnF CDS complement(88102..88437) product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638031.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene arnE CDS complement(88434..90086) product lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844057.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene arnT CDS complement(90086..90976) product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169728.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene arnD CDS complement(90973..92955) product bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860273.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene arnA CDS complement(92955..93923) product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461657.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene arnC CDS complement(93927..95066) product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807509.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene arnB CDS 95374..95976 product lipopolysaccharide core heptose(II)-phosphate phosphatase Ais inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879112.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene ais CDS complement(96015..96440) product nucleoside triphosphatase NudI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300564.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene nudI CDS 96719..97261 product YfaZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300392.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 97361..98563 product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921621.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 98783..99565 product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894185.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 99580..100785 product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001319848.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene rhmD CDS 100842..102131 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100890.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 102149..102952 product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992954.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene yfaU CDS complement(102993..103895) product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140553.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(104088..105278) product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000377.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene glpC CDS complement(105275..106534) product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209898.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene glpB CDS complement(106524..108152) product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857257.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene glpA CDS 108425..109783 product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948732.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene glpT CDS 109788..110864 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779084.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene glpQ CDS complement(110906..111112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009396.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 111327..111977 product lipopolysaccharide kinase InaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301050.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene inaA CDS complement(112031..112285) product ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135040.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene yfaE CDS complement(112285..113454) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299501.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene nrdB CDS complement(113657..115942) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075164.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene nrdA CDS 116926..120390 product AIDA-I family autotransporter adhesin YfaL/EhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220077.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene yfaL CDS complement(120518..121240) product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990754.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 121387..124014 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281251.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene gyrA CDS 124163..125851 product DUF2138 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012305.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 125848..126471 product DUF1175 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295211.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 126615..131009 product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001442934.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 131010..132659 product YfaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104549.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 132664..133440 product YfaP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225852.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(133514..134698) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786547.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene atoB CDS complement(134729..136051) product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580275.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(136048..136698) product acetate CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339065.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene atoA CDS complement(136698..137360) product acetate CoA-transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850540.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene atoD CDS complement(137556..138941) product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125282.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene atoC CDS complement(138938..140710) product two-component system sensor histidine kinase AtoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559125.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene atoS CDS 140931..143780 product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876011.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene rcsC sequence09 source 1..140114 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(38..589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 tRNA complement(827..900) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(979..1734) product amidase activator ActS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272558.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene actS CDS 2149..4446 product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388150.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene xdhA CDS 4457..5335 product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459182.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene xdhB CDS 5332..5811 product xanthine dehydrogenase iron sulfur-binding subunit XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016605.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene xdhC CDS complement(5851..7629) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417808.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 8105..9295 product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978544.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene ygeW CDS 9353..10549 product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110493.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene dpaL CDS 10607..11818 product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107125.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 11871..13256 product D-phenylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264452.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene hyuA CDS 13304..14236 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037992.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene arcC CDS complement(14457..16082) product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020381.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene yqeB CDS complement(16130..16609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 17003..17581 product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272860.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene mocA CDS 17902..21000 product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502395.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene ygfK CDS 21003..22331 product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906252.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene ssnA CDS 22382..23161 product molybdopterin-dependent oxidoreductase FAD-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572462.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene ygfM CDS 23158..26028 product molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583615.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 26193..27593 product xanthine/proton symporter XanQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280192.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene xanQ CDS 27611..28927 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311109.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene guaD CDS 28963..30330 product guanine/hypoxanthine transporter GhxQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012163.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene ghxQ CDS complement(30366..30854) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838428.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(30854..32788) product formate-dependent uric acid utilization protein YgfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350545.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene ygfT CDS 33209..34657 product urate/proton symporter UacT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295374.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene uacT CDS 34907..35455 product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192814.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene idi CDS complement(35498..37015) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003071.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene lysS CDS complement(37025..37906) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001701073.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene prfB note possible pseudo, frameshifted CDS complement(38214..39947) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813185.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene recJ CDS complement(39953..40663) product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715214.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene dsbC CDS complement(40688..41584) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806638.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene xerD CDS 41696..42217 product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055874.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene fldB CDS complement(42257..42664) product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244777.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(42645..42911) product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354046.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene sdhE CDS 43154..44134 product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886062.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene ygfZ CDS complement(44330..44989) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250274.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(45153..45464) product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182954.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene yqfB CDS 45509..46942 product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295376.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene bglA CDS complement(46999..47742) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951964.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(48008..50881) product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195023.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene gcvP CDS complement(51000..51389) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295377.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene gcvH CDS complement(51413..52507) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068701.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene gcvT CDS complement(52954..54156) product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192185.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene ubiI CDS complement(54179..55357) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111195.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene ubiH CDS complement(55354..56679) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290122.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene pepP CDS complement(56705..57283) product UPF0149 family protein YgfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295378.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene ygfB CDS 57451..57780 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276008.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene zapA CDS 58080..58628 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192742.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(59017..60249) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151604.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene serA CDS complement(60505..61164) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189743.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene rpiA CDS complement(61220..61450) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545308.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 61592..62485 product DNA-binding transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828351.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene argP CDS 62689..64833 product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073223.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene scpA CDS 64826..65821 product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606525.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene meaB CDS 65832..66617 product methylmalonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122080.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene scpB CDS 66641..68119 product propionyl-CoA:succinate CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449965.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene scpC CDS complement(68116..69012) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350807.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(69179..69919) product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669834.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(70012..70647) product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493352.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene argO CDS complement(70786..71646) product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389818.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene mscS CDS complement(72004..73083) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034372.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene fbaA CDS complement(73298..74461) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111269.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene pgk CDS complement(74511..75530) product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218480.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene epd CDS complement(75815..76528) product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687705.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(76525..77034) product fumarase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224147.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene fumE CDS complement(77056..78021) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987283.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene glpX CDS complement(78018..79295) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853247.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(79310..80698) product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428805.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene cmtA CDS complement(80753..81085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 note possible pseudo, internal stop codon CDS complement(81483..83474) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098614.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene tkt CDS 83752..84510 product metalloprotease LoiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326497.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene loiP CDS complement(84716..85636) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105566.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene speB CDS complement(85774..87672) product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300904.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene speA CDS 88026..88241 product protein YqgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303650.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene yqgC CDS 88545..89699 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062128.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene metK CDS 90123..91517 product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112301.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene galP CDS 91636..92091 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300769.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 92186..92893 product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286500.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene endA CDS 92973..93704 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300912.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene rsmE CDS 93717..94667 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593273.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene gshB CDS 94776..95339 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053178.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 95339..95755 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017106.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene ruvX CDS complement(95939..96919) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326494.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 96937..97641 product pyridoxal phosphate homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997795.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene yggS CDS 97659..98225 product osmotic shock tolerance protein YggT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094831.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene yggT CDS 98222..98512 product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313260.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene yggU CDS 98520..99113 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174737.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene rdgB CDS 99106..100242 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239976.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene hemW CDS complement(100307..101314) product DUF1202 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745184.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(101431..102477) product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394107.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene ansB CDS complement(102653..103372) product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984796.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(103556..103882) product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107564.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(103882..104601) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786911.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene trmB CDS 104762..105814 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001321419.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene mutY CDS 105842..106117 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091700.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 106179..107261 product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298916.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene mltC CDS 107463..108719 product nucleoside permease NupG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333541.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene nupG CDS complement(108768..110894) product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839789.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene speC CDS 111275..112003 product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234526.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 tRNA 112109..112184 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 112382..113341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 113406..114323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250228.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 114408..115280 product GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001322100.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 115652..118498 product Ag43/Cah family autotransporter adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820574.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 118619..121135 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387066.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 121212..121667 product IrmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005051844.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 121746..121979 product DUF905 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119729.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 122079..122897 product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234716.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 122952..123437 product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214398.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 123453..123929 product RadC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602267.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 123992..124213 product DUF987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692300.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 124232..125293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 125383..125757 product TA system toxin CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854712.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 125754..126242 product DUF5983 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976853.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 126254..126451 product DUF957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839270.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 126548..127117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 127475..127630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 128441..129424 product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298261.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 129496..130644 product capsule polysaccharide export inner-membrane protein KpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905920.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 130668..132344 product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001331697.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 132354..133094 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030761.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene kdsB CDS 133091..135118 product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579521.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 135153..136385 product capsular biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161827.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(136639..137598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120131349.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(137633..138772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(139346..139936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 sequence10 source 1..128433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..512 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000291288.1:N-acetylglucosamine kinase locus_tag LOCUS_14630 CDS 528..1367 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952737.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene cobB CDS complement(1486..2274) product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713462.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(2324..2731) product DUF3592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076376.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 note possible pseudo, frameshifted CDS complement(2789..3835) product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759317.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene potD CDS complement(3832..4626) product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580316.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene potC CDS complement(4623..5480) product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799401.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene potB CDS complement(5464..6600) product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531594.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene potA CDS 6850..8076 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359446.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene pepT CDS complement(8125..9246) product [50S ribosomal protein L16]-arginine 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933638.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene roxA CDS complement(9322..10782) product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735404.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene phoQ CDS complement(10782..11453) product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265481.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene phoP CDS complement(11621..12991) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423729.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene purB CDS complement(12995..13642) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297479.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene hflD CDS complement(13672..14823) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297484.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(14832..15293) product phosphatase NudJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476093.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene nudJ CDS complement(15303..15836) product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248690.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene rluE CDS 16128..17378 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444487.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene icd CDS complement(18500..18904) product DUF1398 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373101.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(19125..19856) product DNA-binding transcriptional repressor BluR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332300.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene bluR CDS complement(20061..21272) product blue light-responsive regulator BluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297681.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene bluF CDS 21586..21822 product regulatory protein YcgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554140.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene ycgZ CDS 21865..22137 product two-component-system connector protein YmgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858002.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 22166..22432 product biofilm/acid-resistance regulator AriR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888772.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene ariR CDS 22617..22793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 23083..24648 product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246498.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 25398..26918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 26985..28019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 note possible pseudo, internal stop codon, frameshifted CDS complement(28102..28431) product YmgD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295611.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(28441..28725) product glycine zipper family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304448.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 29295..29483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 note possible pseudo, frameshifted CDS 29492..29704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 note possible pseudo, frameshifted CDS complement(30076..30342) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185665.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene minE CDS complement(30346..31158) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101055.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene minD CDS complement(31182..31877) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072536.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene minC CDS 32397..32765 product YcgJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056840.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(32868..33269) product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695220.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 33511..33804 product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125718.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 33876..34535 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284277.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 34612..35073 product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807626.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(35280..35711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 note possible pseudo, frameshifted CDS complement(35665..36324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 note possible pseudo, frameshifted CDS 36553..36972 product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897378.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 36972..38240 product DNA polymerase V catalytic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457616.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene umuC CDS complement(38286..38765) product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943459.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene dsbB CDS complement(38962..40503) product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406391.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene nhaB CDS 40724..41443 product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234823.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene fadR CDS complement(41495..43027) product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190854.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 43357..44655 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266908.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene dadA CDS 44665..45735 product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197881.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene dadX CDS complement(46121..47857) product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340194.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(47952..48866) product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051560.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene ldcA CDS 48839..49027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 48966..49577 product membrane-bound lytic murein transglycosylase EmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301104.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene emtA CDS complement(49579..50313) product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020169.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 50514..50768 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511315.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 50946..51386 product protein YcgY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615067.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene ycgY CDS complement(51465..53162) product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841714.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene treA CDS complement(53482..54900) product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301101.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene dhaM CDS complement(54911..55543) product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059411.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene dhaL CDS complement(55554..56624) product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733715.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene dhaK CDS 56930..58771 product dihydroxyacetone kinase operon transcriptional regulator DhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350505.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene dhaR CDS complement(58871..61738) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001334788.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(62507..63598) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505866.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene ychF CDS complement(63715..64299) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152933.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene pth CDS 64577..64855 product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823885.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene ychH CDS complement(64910..66589) product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033352.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene dauA CDS complement(66714..67727) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119392.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene prs CDS complement(67812..68663) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260333.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene ispE CDS complement(68663..69286) product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130692.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene lolB CDS 69500..70756 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299679.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene hemA CDS 70798..71880 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804726.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene prfA CDS 71880..72713 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456476.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene prmC CDS 72710..73102 product invasion regulator SirB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200374.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene sirB2 CDS 73106..73915 product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257044.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene sirB1 CDS 73951..74805 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811065.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene kdsA CDS complement(74952..75086) product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517635.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(75487..75621) product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517635.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(76022..76156) product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517635.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(76534..77634) product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295620.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene chaA CDS 77904..78134 product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146444.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene chaB CDS 78313..78987 product glutathione-specific gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386742.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene chaC CDS complement(79031..79384) product DsrE/F sulfur relay family protein YchN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169669.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene ychN CDS 79534..80964 product inverse autotransporter invasin YchO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464994.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene ychO CDS complement(80965..81615) product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070491.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene narL CDS complement(81608..83404) product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918073.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene narX CDS 83430..83648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069498.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 83899..85134 product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019827.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene narK CDS 85650..89393 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032935.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 89390..90928 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702660.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene narH CDS 90925..91635 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571699.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene narJ CDS 91635..92312 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160110.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene narI tRNA complement(92674..92758) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(92968..93052) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(93212..94054) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555849.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene purU CDS complement(94104..94562) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001362540.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 94636..95580 product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190792.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene rssA CDS 95672..96685 product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193447.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene rssB CDS 96887..97795 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718995.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene galU CDS complement(97939..98352) product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287378.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene hns CDS 99046..99573 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068079.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene tdk CDS complement(99875..102550) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301653.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene adhE CDS 103027..103674 product NAAT family transporter YchE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616554.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene ychE CDS 104412..106043 product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295623.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene oppA CDS 106129..107049 product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911112.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene oppB CDS 107064..107972 product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979661.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene oppC CDS 107984..108997 product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110945.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene oppD CDS 108994..109998 product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994905.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene oppF CDS complement(110051..110380) product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366959.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(110415..111875) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214516.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene cls CDS complement(112246..113379) product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020078.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene kch CDS complement(113799..114095) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967595.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 114319..115038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(115078..115476) product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108160.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene yciA CDS complement(115581..116120) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808667.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(116150..116893) product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028540.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 117250..117888 product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737226.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene ompW CDS complement(117948..118454) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079505.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(118500..119000) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056490.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(119086..119289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(119646..120452) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443067.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene trpA CDS complement(120452..121645) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209520.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene trpB CDS complement(121657..123018) product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001344826.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene trpCF CDS complement(123019..124614) product bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763511.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene trpD CDS complement(124614..126176) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194582.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene trpE CDS 126471..127331 product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285667.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene rnm CDS 127328..127948 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295575.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 127976..128374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 sequence11 source 1..127297 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(128..985) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201820.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene murI CDS complement(930..2774) product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591359.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene btuB CDS 3143..4243 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187022.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene trmA CDS complement(4283..4642) product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806411.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(4642..5346) product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470429.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene fabR CDS 5623..7023 product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120810.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene sthA CDS complement(7006..7923) product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025939.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene oxyR CDS complement(8190..9563) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230087.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene argH CDS complement(9624..10397) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295507.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene argB CDS complement(10408..11412) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935370.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene argC CDS 11566..12717 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298964.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene argE CDS 13069..15720 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005579.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene ppc CDS 15902..17635 product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556273.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 17850..18701 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274623.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(18688..19029) product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323846.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(19031..19909) product [formate-C-acetyltransferase]-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204139.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(19875..22172) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184831.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(22223..22543) product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161265.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(22558..23658) product PTS fructose transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004446.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 23946..26447 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185128.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene ptsP CDS 26459..27121 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424840.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene fsa CDS 27132..28235 product bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374004.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene gldA CDS 28510..29127 product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647891.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(29154..30059) product cystine transporter YijE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271242.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene yijE CDS complement(30152..32332) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295695.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene katG CDS complement(32661..33551) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007523.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene metF CDS complement(33900..36332) product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110772.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene metL CDS complement(36335..37495) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295694.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene metB CDS 37772..38089 product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852812.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene metJ CDS 38273..38881 product YiiX family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797352.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 38885..39511 product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792797.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(39566..39778) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710769.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene rpmE CDS 39981..42179 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301269.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene priA CDS 42335..43360 product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644904.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene cytR CDS 43557..44411 product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068828.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene ftsN CDS 44504..45034 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208242.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene hslV CDS 45044..46375 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293341.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene hslU CDS 46442..47368 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139496.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene menA CDS 47461..47946 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872908.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene rraA CDS complement(48031..48270) product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295521.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene zapB CDS 48702..49547 product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084268.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene glpF CDS 49570..51078 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136788.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene glpK CDS 51084..52223 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250644.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene glpX CDS 52320..53066 product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796310.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene fpr CDS complement(53071..53499) product universal stress protein UspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323556.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene uspD CDS complement(53526..53825) product DUF406 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655986.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(54037..54477) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155257.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 54578..55177 product YiiQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802226.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 55285..56052 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216325.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene tpiA CDS complement(56107..56862) product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005050421.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene cdh CDS complement(56969..57958) product sulfate/thiosulfate ABC transporter substrate-binding protein Sbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045689.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene sbp CDS complement(58278..59240) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591795.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene pfkA CDS complement(59421..60323) product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076742.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene fieF CDS complement(60472..60972) product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223800.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene cpxP CDS 61122..61820 product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033722.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene cpxR CDS 61817..63190 product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580417.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene cpxA CDS complement(63296..63970) product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270260.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene yiiM CDS complement(64119..65102) product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166063.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene kdgT CDS complement(65362..65982) product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297064.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene sodA CDS 66267..67301 product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063507.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene rhaT CDS complement(67298..68236) product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297062.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene rhaR CDS complement(68220..69056) product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217137.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene rhaS CDS 69344..70813 product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144081.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene rhaB CDS 70810..72069 product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001325794.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene rhaA CDS 72244..73068 product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179764.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene rhaD CDS 73078..73392 product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619496.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene rhaM CDS complement(73433..74827) product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749944.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 75304..75750 product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729595.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 75761..77212 product PTS fructose-like transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446023.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 77202..78272 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019484.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 78272..80020 product putative frv operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931299.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(80070..81125) product YiiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295677.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(81278..82111) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753617.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene fdhD CDS 82305..85355 product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723259.1 transl_table 11 codon_start 1 transl_except (pos:82890..82892,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_16620 gene fdnG CDS 85368..86270 product formate dehydrogenase O subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331377.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene fdoH CDS 86267..86902 product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829013.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene fdoI CDS 86899..87828 product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027708.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene fdhE CDS complement(88158..88400) product protein YiiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087409.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene yiiF CDS complement(88618..88836) product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295676.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(89689..90108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 note possible pseudo, internal stop codon CDS complement(90133..90630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 note possible pseudo, internal stop codon CDS complement(90675..91112) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560983.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene dtd CDS complement(91109..91981) product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920762.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(91975..92574) product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295269.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene yihX CDS complement(92673..93458) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059678.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(93492..94388) product sulfofructose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621656.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene yihV CDS 94556..95452 product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718893.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene yihU CDS 95476..96354 product sulfofructosephosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046453.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene yihT CDS 96371..97612 product sulfoquinovose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870916.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene yihS CDS 97750..98652 product aldose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052655.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 98891..100780 product sulfoquinovosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380843.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene yihQ CDS 100826..102211 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018380.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 102251..103654 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279692.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 103655..104413 product porin OmpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723465.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene ompL CDS complement(104504..105769) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956312.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(105871..106851) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256396.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(106859..107569) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829798.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(107786..109609) product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570668.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene typA CDS 109982..111391 product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271717.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene glnA CDS 111677..112726 product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190577.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene glnL CDS 112738..114147 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188776.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene glnG CDS complement(114559..115932) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116090.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene hemN CDS complement(116121..116630) product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295266.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene yihI CDS 117212..117844 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183349.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene yihA CDS complement(118089..118253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(118225..121011) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250006.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene polA CDS complement(121311..121529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 121564..122307 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306659.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(122348..123778) product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354487.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(123933..124559) product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725337.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene dsbA CDS complement(124576..125562) product stress response kinase SrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065497.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene srkA CDS complement(125639..125908) product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295263.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 125978..126562 product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052181.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene mobA CDS 126544..127071 product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907622.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene mobB sequence12 source 1..118695 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(129..401) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001530485.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(489..737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 622..972 product surface-adhesin E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602903.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(1193..2311) product 2,7-anhydro-N-acetylneuraminate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611568.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene nanY CDS complement(2323..3540) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179691.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 4167..5495 product IS4-like element IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547191.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 7124..7555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 note possible pseudo, internal stop codon, frameshifted CDS 7679..7921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 note possible pseudo, internal stop codon CDS complement(8322..9512) product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032666220.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 tRNA complement(9773..9857) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 10053..11072 product NADPH-dependent aldehyde reductase Ahr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309160.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene ahr CDS complement(11076..11639) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896738.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene idnK CDS 11856..12887 product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197411.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene idnD CDS 12911..13675 product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998695.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene idnO CDS 13738..15057 product gnt-II system L-idonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128335.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene idnT CDS 15124..16122 product DNA-binding transcriptional regulator IdnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309159.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene idnR CDS 16200..17702 product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294573.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(17863..18945) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295681.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene lptG CDS complement(18945..19952) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584114.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene lptF CDS 20312..21823 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397144.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene pepA CDS 22177..22620 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786399.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene holC CDS 22620..25475 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416407.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene valS CDS complement(25531..26727) product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079623.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 26920..27423 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059397.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(27469..27885) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002952.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene rraB CDS 28047..29051 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012907.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene argF CDS complement(29124..30776) product protein YjgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036434.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene yjgL CDS complement(30899..31351) product toxin-antitoxin biofilm protein TabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583470.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene tabA CDS complement(31496..32089) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023602305.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 32160..32873 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500691.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene bdcA CDS 33004..33399 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230281.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 33818..34753 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013046.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene pyrB CDS 34766..35227 product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148581.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene pyrI CDS 35300..35686 product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298042.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene ridA CDS complement(35892..38588) product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471889.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene mgtA CDS 38967..39914 product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181324.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene treR CDS 40033..41454 product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297258.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene treB CDS 41504..43159 product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183355.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene treC CDS 43553..45691 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187778.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene nrdD CDS 45850..46314 product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106233.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene nrdG CDS complement(46359..46745) product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232240.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene cybC CDS complement(46928..48280) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162171.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene pmbA CDS 48375..48926 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166270.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene yjgA CDS complement(49082..50455) product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219792.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene mpl CDS 50631..51629 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853753.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene fbp CDS complement(51662..52657) product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000596015.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene yjfF CDS complement(52644..53666) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301928.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(53680..55182) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205805.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(55322..56278) product galactofuranose ABC transporter substrate-binding protein YtfQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265933.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene ytfQ CDS 56588..57118 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055072.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene ppa CDS complement(57498..57839) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219160.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(57842..61621) product autotransporter assembly complex protein TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060946.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene tamB CDS complement(61618..63351) product autotransporter assembly complex protein TamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269316.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene tamA CDS complement(63321..63500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 63557..64195 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295196.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene msrA CDS 64518..65861 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935036.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(65923..66129) product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689228.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 66454..67011 product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175289.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(67001..67741) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886909.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene cysQ CDS 67931..69874 product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589431.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene cpdB CDS complement(69997..70377) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084622.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 70466..71326 product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560631.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene qorB CDS 71435..72400 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296686.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 72508..73170 product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331456.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene ytfE CDS complement(73215..74627) product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228371.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene cycA CDS complement(74936..75556) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211225.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene fklB CDS 75775..76413 product cell division protein YtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119478.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene ytfB CDS complement(76397..77044) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317442.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 77257..78048 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843394.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 78058..78900 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205251.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 78910..79686 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283536.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 79696..81237 product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226977.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 81234..83306 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080380.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 83429..84676 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033605.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(84778..85227) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196062.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene rplI CDS complement(85269..85496) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene rpsR CDS complement(85501..85815) product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296681.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene priB CDS complement(85822..86217) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216676.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene rpsF CDS 86545..86820 product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324306.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 note possible pseudo, frameshifted CDS complement(86949..87635) product L-ribulose-5-phosphate 4-epimerase UlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170847.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene ulaF CDS complement(87635..88489) product L-ribulose-5-phosphate 3-epimerase UlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949511.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene ulaE CDS complement(88499..89149) product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056760.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene ulaD CDS complement(89163..89627) product PTS ascorbate transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776505.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene ulaC CDS complement(89637..89942) product PTS ascorbate transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218362.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene ulaB CDS complement(89958..91355) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300695.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene ulaA CDS 91704..92774 product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295191.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene ulaG CDS 92882..93637 product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133631.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene ulaR CDS complement(93634..94383) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569708.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene yjfP CDS 94625..94894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 95043..95318 product DUF1471 family protease activator YjfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811566.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene yjfN CDS complement(95435..97060) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350567.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(97144..98307) product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943963.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(98310..98948) product DUF1190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101658.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(98958..99356) product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547760.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(99374..100033) product YjfK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012550.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(100084..100782) product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511955.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(100801..101202) product DUF2170 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220128.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(101329..102060) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293282.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene rlmB CDS complement(102240..104681) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076332.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene rnr CDS complement(104720..105145) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177639.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene nsrR CDS complement(105350..106648) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527955.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene purA CDS complement(106752..106949) product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089295.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(107031..108035) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232412.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene hflC CDS complement(108038..109297) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312488.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene hflK CDS complement(109383..110663) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460360.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene hflX CDS complement(110739..111047) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051883.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene hfq CDS complement(111133..112083) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280345.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(112076..113923) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122505.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene mutL CDS complement(113933..115270) product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990333.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene amiB CDS complement(115289..115750) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981977.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene tsaE CDS complement(115722..117254) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307537.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene nnr CDS 117268..118407 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294219.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene queG sequence13 source 1..115891 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(115..609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(621..1925) product YhfT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366862.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(1937..2290) product DUF2620 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719728.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(2301..3179) product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007010.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(3176..4402) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090644.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(4402..5565) product YhfX family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497341.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(5649..6011) product PRD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295165.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(6028..6933) product GntR family transcriptional regulator YhfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254790.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene yhfZ CDS complement(7223..8227) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165552.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene trpS CDS complement(8220..8978) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031729.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene gph CDS complement(8971..9648) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816280.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene rpe CDS complement(9666..10382) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742143.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene dam CDS complement(10609..11895) product cell division protein DamX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343178.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene damX CDS complement(11987..13075) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439846.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene aroB CDS complement(13132..13617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(14054..15292) product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815987.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene hofQ CDS complement(15204..15608) product DNA utilization protein HofP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264141.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene hofP CDS complement(15598..16038) product DNA utilization protein HofO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055760.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene hofO CDS complement(16022..16561) product DNA utilization protein HofN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069315.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene hofN CDS complement(16561..17340) product DNA utilization protein HofM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295166.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene hofM CDS 17481..20012 product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301905.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene mrcA CDS complement(20180..20740) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045744.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene nudE CDS 21060..23195 product intracellular growth attenuator protein IgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104533.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene igaA CDS 23260..23928 product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295168.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene yrfG CDS 23939..24340 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660483.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene hslR CDS 24365..25243 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135574.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene hslO CDS complement(25306..27030) product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370879.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 27409..29031 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265681.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene pckA CDS complement(29107..30450) product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253696.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene envZ CDS complement(30456..31175) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene ompR CDS 31403..31879 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856737.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene greB CDS 31976..34297 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980724.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 34735..34962 product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200455.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene feoA CDS 34979..37300 product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737007.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene feoB CDS 37300..37536 product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295699.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene feoC CDS 37739..38617 product recombination-promoting nuclease RpnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039062.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene rpnA CDS complement(38646..39416) product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060072.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene bioH CDS 40196..40771 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619389.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene nfuA CDS 41132..42448 product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131758.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene gntT CDS complement(42493..44577) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444321.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene malQ CDS complement(44587..46980) product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081903.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene malP CDS 47592..50297 product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906961.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene malT CDS complement(50340..51356) product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335950.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene rtcA CDS complement(51360..52586) product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105467.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene rtcB CDS 52775..54373 product DNA-binding transcriptional regulator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232948.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene rtcR CDS complement(54355..55113) product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815099.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(55130..55960) product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928723.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene glpG CDS complement(56005..56331) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371928.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene glpE CDS 56521..58026 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448136.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene glpD CDS complement(58844..59836) product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032214.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(59862..61367) product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181201.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(61495..63942) product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993449.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene glgP CDS complement(63961..65394) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197646.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene glgA CDS complement(65394..66689) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253975.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene glgC CDS complement(66707..68680) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192540.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene glgX CDS complement(68677..70863) product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283723.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene glgB CDS complement(71136..72239) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799956.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene asd CDS 72431..73024 product NAAT family transporter YhgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002544.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene yhgN CDS complement(73081..74421) product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210111.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene gntU CDS complement(74425..74913) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108330.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene gntK CDS complement(75091..76029) product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730252.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene gntR CDS complement(76310..77020) product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639811.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene yhhW CDS complement(77128..78165) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236293.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 78067..78264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 78498..78986 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295206.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene yhhY CDS 79223..80401 product Hcp1 family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065894.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 80398..80892 product protein YrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988501.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene yrhA CDS 80987..81142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 81342..81626 product YrhB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634159.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(81664..83406) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595082.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene ggt CDS 83526..83966 product DUF2756 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825996.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(83953..84696) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073575.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene ugpQ CDS complement(84693..85763) product sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907792.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene ugpC CDS complement(85765..86610) product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572176.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene ugpE CDS complement(86607..87494) product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099289.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene ugpA CDS complement(87592..88908) product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803190.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene ugpB CDS complement(89305..90018) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416895.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene livF CDS complement(90020..90787) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082101.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene livG CDS complement(90784..92061) product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803797.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene livM CDS complement(92058..92984) product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295111.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene livH CDS complement(93032..94195) product high-affinity branched-chain amino acid ABC transporter substrate-binding protein LivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827696.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene livK CDS 94565..94948 product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778795.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene panM CDS complement(95147..96250) product branched chain amino acid ABC transporter substrate-binding protein LivJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021996.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene livJ CDS complement(96521..97375) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130217.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene rpoH CDS complement(97620..98678) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042003.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene ftsX CDS complement(98671..99339) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617723.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene ftsE CDS complement(99342..100838) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040676.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene ftsY CDS 100988..101584 product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743193.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene rsmD CDS 101574..101843 product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295207.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(101846..102205) product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042886.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 102346..102972 product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964718.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 103046..105244 product Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106562.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene zntA CDS complement(105346..105591) product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130621.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene tusA CDS 105812..106477 product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100469.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 106550..107107 product phage sensitivity protein DcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245295.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene dcrB CDS complement(107111..108361) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240225.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 108460..109509 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300885.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 109564..110151 product 4'-phosphopantetheinyl transferase AcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285774.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene acpT CDS 110262..111836 product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953353.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene nikA CDS 111836..112780 product nickel ABC transporter permease subunit NikB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947068.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene nikB CDS 112777..113610 product nickel ABC transporter permease subunit NikC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008963.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene nikC CDS 113610..114374 product nickel import ATP-binding protein NikD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136229.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene nikD CDS 114371..115177 product nickel import ATP-binding protein NikE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173630.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene nikE CDS 115183..115584 product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190062.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene nikR sequence14 source 1..114904 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(312..950) product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457202.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene leuE CDS complement(1077..2000) product DNA-binding transcriptional regulator DmlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061578.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene dmlR CDS 2103..3188 product multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978494.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene dmlA CDS 3385..4824 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301380.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 4856..5980 product carnitine monooxygenase subunit YeaW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067822.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene yeaW CDS 6036..7001 product carnitine monooxygenase subunit YeaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287005.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene yeaX CDS complement(7055..8182) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109156.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene rnd CDS complement(8252..10003) product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954305.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene fadD CDS complement(10142..10723) product Slp family lipoprotein YeaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290576.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene yeaY CDS complement(10763..11458) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220981.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene tsaB CDS complement(11516..13426) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128847.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 13555..13902 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310311.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(13880..14074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 14265..14624 product DUF1889 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307845.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(14744..14923) product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457334.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 14997..16358 product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854972.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene pabB CDS 16362..16940 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456725.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 17124..18488 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624298.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene sdaA CDS 18619..20217 product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295494.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(20221..21777) product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394983.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene yoaE CDS 22240..23211 product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150543.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene manX CDS 23274..24074 product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406926.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene manY CDS 24087..24938 product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228655.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene manZ CDS 24993..25451 product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156255.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 25880..26446 product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296134.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene mntP CDS complement(26443..27252) product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010128.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene rlmA CDS complement(27418..27627) product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062678.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene cspE CDS complement(28452..28739) product YebO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006866.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 29116..29355 product YobH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211011.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(29498..30289) product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262182.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene kdgR CDS 30466..31839 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127216.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(31885..32766) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984517.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene htpX CDS complement(32958..35006) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315679.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene prc CDS complement(35026..35724) product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431370.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene proQ CDS complement(35821..36318) product L-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299249.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene msrC CDS 36553..37731 product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207283.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene yebS CDS 37700..40333 product lipid-binding membrane homeostasis protein YebT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297532.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene yebT CDS 40407..41852 product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057022.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene rsmF CDS 41970..42206 product YebV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295499.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 42227..42502 product YebW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929530.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(42503..43159) product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812724.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene pphA CDS complement(43554..43895) product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976472.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(43908..44780) product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879289.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene copD CDS complement(44784..45158) product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168747.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene yobA CDS 45297..45527 product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916763.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene holE CDS 45629..46285 product carbon-nitrogen hydrolase family protein YobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011658.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene yobB CDS 46309..46971 product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944256.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene exoX CDS complement(46968..49028) product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936951.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene ptrB CDS complement(49237..49896) product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024745.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(50223..50579) product protein YebF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295500.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene yebF CDS complement(50646..50936) product DNA damage-inducible protein YebG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257738.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene yebG CDS 51070..52248 product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173474.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene purT CDS complement(52304..52945) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800512.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene kdgA CDS complement(52982..54793) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069467.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene edd CDS complement(55028..56503) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301720.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene zwf CDS complement(56669..56818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155622.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 56841..57710 product DNA-binding transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056706.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene hexR CDS 57838..59280 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091148.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene pyk CDS complement(59411..60382) product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448381.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene lpxM CDS complement(60502..61824) product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001184045.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene mepM CDS complement(61840..62508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 62851..63606 product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202996.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene znuC CDS 63603..64388 product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571465.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene znuB CDS complement(64729..65739) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568519.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene ruvB CDS complement(65748..66359) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580323.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene ruvA CDS 66634..67236 product YebB family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024929.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(67238..67759) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295503.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene ruvC CDS complement(67794..68534) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907234.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(68563..69072) product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300367.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene nudB CDS complement(69133..70905) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258678.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene aspS CDS 71215..71781 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891621.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 71778..72596 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639274.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 72649..73044 product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252980.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 73085..73828 product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019588.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene cmoA CDS 73825..74796 product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564726.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene cmoB CDS complement(74961..77390) product trimethylamine N-oxide reductase TorZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176787.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene torZ CDS complement(77415..78515) product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214304.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(78903..79649) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185734.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene cutC CDS complement(79663..80229) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326063.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 80445..82178 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025322.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene argS CDS 82355..82843 product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299676.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(82963..83355) product flagellar protein FlhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259583.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene flhe CDS complement(83355..85433) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066983.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene flhA CDS complement(85426..86574) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278936.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene flhB CDS complement(86776..87420) product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983609.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene cheZ CDS complement(87431..87820) product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763867.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene cheY CDS complement(87835..88884) product protein-glutamate methylesterase/protein glutamine deamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036371.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene cheB CDS complement(88887..89747) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204335.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene cheR CDS complement(89766..91367) product methyl-accepting chemotaxis protein IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483239.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene tap CDS complement(91413..93074) product methyl-accepting chemotaxis protein II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297437.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene tar CDS complement(93219..93722) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147302.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene cheW CDS complement(93743..95701) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300654.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene cheA CDS complement(95712..96638) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795630.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene motB CDS complement(96635..97522) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906340.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene motA CDS complement(97649..98227) product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291603.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene flhC CDS complement(98230..98580) product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295647.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene flhD CDS 99360..99788 product universal stress protein UspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122437.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene uspC CDS complement(99795..101219) product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295646.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene otsA CDS complement(101194..101994) product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295645.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene otsB CDS complement(102161..103147) product arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100205.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene araH CDS complement(103162..104676) product arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187819.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene araG CDS complement(104746..105735) product arabinose ABC transporter substrate-binding protein AraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548675.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene araF CDS 106532..107035 product non-heme ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179469.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(107114..107365) product DUF2766 family protein YecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082127.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene yecJ CDS complement(107856..108032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 108324..108821 product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917208.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene ftnA CDS complement(108859..109098) product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377224.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 109288..110499 product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797573.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene tyrP CDS complement(110561..111226) product UPF0149 family protein YecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847882.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene yecA tRNA complement(111422..111508) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(111521..111594) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(111648..111723) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(111875..112423) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160187.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene pgsA CDS complement(112480..114246) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283421.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene uvrC CDS complement(114309..114797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20290 sequence15 source 1..111533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(306..749) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237004.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 906..1835 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122779.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene metA CDS 2104..3705 product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138905.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 gene aceB CDS 3735..5039 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857856.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene aceA CDS 5222..6958 product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137214.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene aceK CDS complement(6927..7523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 note possible pseudo, internal stop codon CDS complement(7590..8501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20360 note possible pseudo, internal stop codon CDS complement(8818..9642) product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226403.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene iclR CDS 9842..13525 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096011.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene metH CDS 13745..15376 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956830.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(15467..16156) product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421763.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene pepE CDS 16368..17240 product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936377.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene rluF CDS complement(17373..17645) product DUF3811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207634.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(17898..19247) product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290310.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene lysC CDS 19772..21421 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789986.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene pgi CDS 21920..22162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 22277..22915 product YjbF family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296632.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 22912..23649 product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595531.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 23649..25745 product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745776.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 26340..26750 product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202902.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene psiE CDS complement(26794..28269) product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097274.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene xylE CDS complement(28641..29531) product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252058.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene malG CDS complement(29546..31090) product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297290.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene malF CDS complement(31244..32434) product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695387.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene malE CDS 32799..33914 product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179165.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene malK CDS 33986..35326 product maltoporin LamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973663.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene lamB CDS 35569..36489 product maltose operon protein MalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326641.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene malM CDS 36718..36912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623309.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 37003..38298 product SopA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900533.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 note possible pseudo, frameshifted CDS 38521..39018 product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326644.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene ubiC CDS 39031..39903 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455227.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene ubiA CDS complement(40058..42481) product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017354.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene plsB CDS 42652..43020 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002907.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene dgkA CDS 43130..43738 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646078.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene lexA CDS 43811..45136 product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134731.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene dinF CDS 45252..45461 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030593.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(45503..46018) product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295691.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene zur CDS 46336..46590 product protein YjbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912571.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene yjbL CDS 46614..47321 product DUF2713 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311303.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 47780..48721 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298868.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene dusA CDS 48855..49097 product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891404.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene pspG CDS complement(49263..50246) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235508.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 50329..51744 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918363.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene dnaB CDS 51797..52876 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147328.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene alr CDS 53129..54322 product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486985.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene tyrB CDS 54441..54620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(54824..55066) product protein YjbS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001321562.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene yjbS CDS 55429..56142 product acid phosphatase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226928.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene aphA CDS 56253..56669 product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270375.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 56673..57029 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155657.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(57064..59886) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357740.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene uvrA CDS 60141..60677 product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168299.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 gene ssb1 CDS complement(60776..61057) product YjcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295689.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 61487..62422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 note possible pseudo, internal stop codon CDS 62432..63073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20840 note possible pseudo, internal stop codon CDS complement(63076..63399) product superoxide response transcriptional regulator SoxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019358.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene soxS CDS 63485..63949 product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412428.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene soxR CDS 64495..65844 product guanine/hypoxanthine transporter GhxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106882.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene ghxP CDS 65996..67645 product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402207.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(67799..69091) product T3SS effector pentapeptide repeat protein EspX5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270094.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene espX5 CDS complement(69269..70918) product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832573.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene actP CDS complement(70915..71229) product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296646.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(71429..73387) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078239.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene acs CDS 73780..75216 product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196875.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene nrfA CDS 75261..75827 product cytochrome c nitrite reductase pentaheme subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295391.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene nrfB CDS 75824..76495 product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220281.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene nrfC CDS 76492..77448 product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195171.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene nrfD CDS 77504..79186 product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071524619.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 79179..79562 product heme lyase NrfEFG subunit NrfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032546.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene nrfF CDS 79559..80155 product heme lyase NrfEFG subunit NrfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812982.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene nrfG CDS 80497..81810 product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789592.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene gltP CDS complement(82115..82804) product Sel1 family TPR-like repeat protein YjcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719886.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene yjcO CDS complement(82898..85045) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300547.1 transl_table 11 codon_start 1 transl_except (pos:84626..84628,aa:Sec) note codon on position 140 is selenocysteine opal codon. locus_tag LOCUS_21020 gene fdhF CDS complement(85243..86709) product multidrug efflux transporter outer membrane subunit MdtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610601.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene mdtP CDS complement(86706..88757) product multidrug efflux transporter permease subunit MdtO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275207.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene mdtO CDS complement(88757..89788) product multidrug efflux transporter periplasmic adaptor subunit MdtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446378.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene mdtN CDS complement(89807..90082) product YtcA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295389.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(90291..92276) product alkyl sulfatase YjcS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066019.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene yjcS CDS complement(92549..93478) product allose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171687.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene alsK CDS complement(93462..94157) product D-allulose-6-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311314.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene alsE CDS complement(94168..95148) product D-allose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000507106.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene alsC CDS complement(95127..96659) product D-allose ABC transporter ATP-binding protein AlsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235257.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene alsA CDS complement(96786..97721) product D-allose transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046187.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene alsB CDS complement(97780..98670) product als operon DNA-binding transcriptional repressor AlsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083216.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene alsR CDS 99029..99478 product bifunctional allose-6-phosphate isomerase/ribose-5-phosphate isomerase RpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716794.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene rpiB CDS 99547..99876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(100023..100781) product phosphonate metabolism protein PhnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059908.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene phnP CDS complement(100783..101217) product aminoalkylphosphonate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110490.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene phnO CDS complement(101204..101761) product ribose 1,5-bisphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971886.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene phnN CDS complement(101761..102897) product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586325.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene phnM CDS complement(102894..103574) product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611405.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene phnL CDS complement(103685..104443) product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075514.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene phnK CDS complement(104440..105285) product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002283.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene phnJ CDS complement(105278..106342) product alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295388.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene phnI CDS complement(106342..106926) product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171628.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene phnH CDS complement(106923..107375) product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542786.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene phnG CDS complement(107376..108101) product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295387.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene phnF CDS complement(108122..108952) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193500.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene phnE CDS complement(109007..110023) product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992000.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene phnD CDS complement(110048..110836) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193391.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene phnC CDS complement(110969..111412) product VOC family metalloprotein YjdN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131339.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene yjdN sequence16 source 1..110655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(85..573) product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849209.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene eco CDS complement(708..872) product protein YojO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296837.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene yojO CDS 1465..1728 product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557378.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene napD CDS 1725..4211 product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778067.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene napA CDS 4218..4913 product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091291.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene napG CDS 4900..5763 product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013515.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene napH CDS 5760..6209 product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835177.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene napB CDS 6219..6821 product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528376.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene napC CDS 6834..7457 product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525587.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene ccmA CDS 7454..8116 product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971730.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene ccmB CDS 8134..8895 product heme exporter protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295447.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene ccmC CDS 8892..9101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 9098..9577 product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026418.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene ccmE CDS 9574..11517 product cytochrome c-type biogenesis heme lyase CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982447.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene ccmF CDS 11514..12071 product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824439.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene dsbE CDS 12068..13120 product cytochrome c-type biogenesis thiol:disulfide oxidoreductase CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211587.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene ccmH CDS complement(13331..13978) product nitrate/nitrite response regulator protein NarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113637.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene narP CDS 14298..16889 product autotransporter YejO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554226.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene yejO tRNA complement(16992..17068) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(17143..18903) product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256203.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene yejM CDS complement(18923..19150) product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135667.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 19332..20339 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050793.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene yejK CDS complement(20478..20762) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494183.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene rplY CDS complement(20887..22647) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578061.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 22796..23491 product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234850.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene rsuA CDS 23519..24709 product multidrug efflux MFS transporter Bcr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213371.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene bcr CDS 25042..25386 product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202798.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(25390..26979) product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194927.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene yejF CDS complement(26981..28006) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088916.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(28006..29100) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501604.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(29101..30921) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001349933.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(30997..32490) product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470560.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(32734..33300) product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241011.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene mepS CDS complement(33712..34425) product Kdo(2)-lipid A phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594599.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene lpxT CDS complement(34464..35450) product zinc-binding GTPase YeiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198822.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene yeiR CDS complement(35568..37034) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091940.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(37257..37829) product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136827.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene yeiP CDS 37984..38238 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389030.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(38235..39416) product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551969.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene setB CDS 39784..40914 product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487246.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene fruB CDS 40914..41852 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091263.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene fruK CDS 41869..43560 product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854472.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene fruA CDS 43984..44925 product pseudouridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208134.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 44913..45851 product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292468.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene psuG CDS 45966..47195 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353878.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(47266..47925) product transcriptional regulator YeiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310375.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene yeiL CDS 48094..49035 product ribosylpyrimidine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415455.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene rihB CDS 49135..50385 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382966.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(50441..51529) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065016.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(51532..52389) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873880.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene nfo CDS complement(52463..53512) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182053.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 53686..54492 product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548294.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene yieE CDS 54697..56166 product lysine-specific permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253273.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene lysP CDS 56556..58451 product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489247.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene cirA CDS complement(58483..59319) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425438.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene yeiG CDS 59577..60245 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139613.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene folE CDS 60262..61419 product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440895.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene yeiB CDS complement(61368..61571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 61561..62601 product HTH-type transcriptional regulator GalS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628659.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene galS CDS 62881..63879 product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036964.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene mglB CDS 63940..65460 product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255032.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene mglA CDS 65476..66486 product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275118.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene mglC CDS complement(66729..67964) product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956071.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene preA CDS complement(67958..69196) product NAD-dependent dihydropyrimidine dehydrogenase subunit PreT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136389.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene preT CDS complement(69390..69629) product DUF2542 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383096.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(69632..70351) product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920064.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene sanA CDS complement(70501..71385) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553555.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene cdd CDS complement(71515..72210) product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968208.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(72207..72605) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295452.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 72843..73790 product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264861.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene dusC CDS 74542..75906 product multidrug resistance outer membrane protein MdtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078114.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene mdtQ CDS 75959..76720 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079538.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(76850..77428) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296821.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 77598..78185 product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295454.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 78359..79291 product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001319943.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene pbpG CDS complement(79329..81044) product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097403.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene dld CDS 81240..83537 product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871517.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene bglX CDS 83789..84706 product glycine betaine ABC transporter substrate-binding protein OsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130308.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene osmF CDS 84713..85870 product glycine betaine ABC transporter permease YehY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220837.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene yehY CDS 85863..86789 product glycine betaine ABC transporter ATP binding protein YehX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569315.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene yehX CDS 86794..87525 product glycine betaine ABC transporter permease YehW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783120.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene yehW CDS complement(87673..88404) product HTH-type transcriptional regulator MlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240401.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene mlrA CDS 88611..90311 product two-component regulatory system sensor histidine kinase BtsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295431.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene btsS CDS 90308..91027 product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598641.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene btsR CDS 91074..91544 product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295430.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(91585..92046) product YehR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296231.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(92171..94171) product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351453.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(94168..95304) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333512.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(95297..97576) product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294387.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(97587..98675) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350535.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(98982..99299) product protein YehK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636925.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene yehK CDS complement(99360..102992) product DUF4132 domain-containing protein YehI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356817.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene yehI CDS complement(103002..106796) product WGR and DUF4132 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215613.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(106937..108979) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295427.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene metG CDS 109102..110211 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005448.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene apbC sequence17 source 1..104929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 29..104 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(200..1039) product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379245.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene hdfR CDS 1158..1496 product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841001.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene maoP CDS complement(1521..3041) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058964.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 3632..5278 product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012613.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene ilvG CDS 5275..5538 product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983255.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene ilvM CDS 5558..6487 product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208520.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene ilvE CDS 6552..8402 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127391.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene ilvD CDS 8402..9949 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785596.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene ilvA CDS complement(10001..10894) product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365791.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene ilvY CDS 11044..12519 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024939.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene ilvC CDS complement(12606..12887) product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140251.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene ppiC CDS complement(13316..13534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22360 note possible pseudo, frameshifted CDS 13751..15772 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238899.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene rep CDS complement(15819..17303) product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640241.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene gppA CDS complement(17437..18702) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047499.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene rhlB CDS 18833..19162 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305383.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene trxA CDS 19489..20748 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054527.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene rho CDS 20758..20976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127070.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 20988..22091 product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050960.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene wecA CDS 22103..23149 product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295256.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene wzzE CDS 23205..24335 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866670.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene wecB CDS 24332..25594 product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006621.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene wecC CDS 25594..26661 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226601.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene rffG CDS 26680..27561 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676056.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene rfbA CDS 27539..28213 product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145183.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene rffC CDS 28218..29348 product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612043.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene rffA CDS 29350..30600 product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050260.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene wzxE CDS 30597..31676 product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217284.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 gene rffT CDS 31673..33025 product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055132.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene wzyE CDS 33028..33768 product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064038.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene wecG CDS 33959..35344 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774731.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 tRNA 35447..35523 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 35582..35657 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 35678..35764 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 35807..35883 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 36030..37265 product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941553.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(37423..39018) product arylsulfatase AslA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395844.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene aslA CDS complement(39764..40960) product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921791.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene hemY CDS complement(40963..42168) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139085.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene hemX CDS complement(42190..42930) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026063.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene hemD CDS complement(42927..43889) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606154.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene hemC CDS 44255..46801 product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281696.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene cyaA CDS complement(46841..47161) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999947.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene cyaY CDS 47631..47834 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799889.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 47871..48695 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160654.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene dapF CDS 48692..49399 product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812796.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 49396..50292 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130686.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene xerC CDS 50292..51008 product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213584.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene yigB CDS 51092..53254 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383407.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene uvrD CDS complement(53309..54211) product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751607.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(54294..55058) product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951184.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 55428..56378 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947159.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 gene corA CDS complement(56420..56842) product DUF943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837563.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(56908..57756) product DUF3289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066403.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 57909..58085 product CorA family divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315926.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(58126..58506) product DUF2628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032581.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(58995..59885) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339104.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene rarD CDS complement(59937..60404) product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277142.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 gene yigI CDS 60569..61438 product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259692.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene pldA CDS 61557..63392 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099855.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene recQ CDS 63456..64076 product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928828.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene rhtC CDS complement(64138..64758) product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171707.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene rhtB CDS 64869..65891 product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487654.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene pldB CDS 65899..66699 product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285349.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene yigL CDS 66775..67674 product biotin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196238.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene bioP CDS complement(67562..68515) product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573618.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene metR CDS 68752..71013 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153907.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene metE CDS complement(71107..72003) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470719.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(72081..73304) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227356.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(73330..73719) product glutamyl-tRNA amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214035.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(73736..74692) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240546.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene arcC CDS complement(74685..76109) product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093933.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(76106..77665) product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865648.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene fdrA CDS complement(77760..78620) product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314263.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(78626..79294) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194414.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(79551..80360) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298606.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 80622..81386 product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045178.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene udp CDS complement(81420..82910) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463030.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(82923..83429) product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093393.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(83446..84420) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589798.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(84445..85074) product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116472.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(85064..86068) product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117529.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(86092..86859) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852398.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 87076..88503 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347714.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene rmuC CDS 88598..89353 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227958.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene ubiE CDS 89367..89972 product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295259.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene ubiJ CDS 89969..91609 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187530.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene ubiB CDS 91688..91957 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295260.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene tatA CDS 91961..92476 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459594.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene tatB CDS 92479..93255 product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109942.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene tatC CDS 93297..94079 product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301305.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene tatD CDS complement(94076..94564) product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192396.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene rfaH CDS 94731..96224 product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339804.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene ubiD CDS 96270..96971 product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209826.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene fre CDS complement(97254..98417) product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438700.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene fadA CDS complement(98427..100616) product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965936.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene fadB CDS 100806..102137 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444561.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene pepQ CDS 102137..102751 product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001308167.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 102790..104241 product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545677.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene trkH CDS 104253..104798 product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853959.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene hemG sequence18 source 1..95046 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(387..920) product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092910.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 1026..1298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(1264..1608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 1824..1958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 1969..2124 product YdaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169151.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(2121..2732) product superinfection exclusion B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001312793.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 3051..3272 product killing protein KilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560223.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene kilR CDS 3266..3442 product YdaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001352098.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 3517..3792 product protein RacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632297.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 3894..6494 product exodeoxyribonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105143.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene recE CDS 6487..7296 product recombination protein RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166319.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene recT CDS 7314..7547 product type I toxin-antitoxin system endodeoxyribonuclease toxin RalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317028.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene ralR CDS 7540..7749 product double-strand break reduction protein RcbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276809.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene rcbA CDS 7828..8043 product excisionase XisR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079604.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene xisR CDS 8516..9280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 9332..10267 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157407.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene ttcA CDS complement(10396..11769) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123737.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene dbpA CDS complement(12247..13230) product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387388.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene zntB CDS 13485..14717 product diguanylate cyclase DgcM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628058.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene dgcM CDS complement(14738..15301) product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046829.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene smrA CDS complement(15631..16539) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885454.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 16715..18025 product p-aminobenzoyl-glutamate hydrolase subunit AbgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444929.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene abgA CDS 18025..19470 product p-aminobenzoyl-glutamate hydrolase subunit AbgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156451.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene abgB CDS 19507..21033 product p-aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062973.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene abgT CDS 21044..21559 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945011.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene ogt CDS 21754..22506 product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611911.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene fnr CDS 22658..23608 product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262123.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene uspE CDS complement(23658..23915) product DUF2534 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605090.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 24159..25190 product low conductance mechanosensitive channel YnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559900.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene ynaI CDS complement(25241..26854) product murein tripeptide ABC transporter substrate-binding protein MppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683020.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene mppA CDS complement(27191..28090) product DNA-binding transcriptional regulator PgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817708.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene pgrR CDS 28228..29148 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300523.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 29219..29401 product protein YmjC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800171.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene ymjC CDS 29483..30211 product murein tripeptide amidase MpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219122.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene mpaA CDS complement(30186..31151) product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261211.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene ycjG CDS 31270..31776 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084387.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene tpx CDS complement(31820..33361) product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300658.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 gene tyrR CDS complement(33509..34570) product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138728.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(34567..35964) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825775.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 36120..37118 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075375.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(37229..38134) product monomeric porin OmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735257.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene ompG CDS complement(38179..39261) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057985.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(39275..39934) product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775794.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene pgmB CDS complement(39931..42129) product kojibiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198036.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene ycjT CDS complement(42195..43250) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001395397.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(43260..44048) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690229.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(44067..45119) product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737347.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(45150..45992) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224659.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(45979..46860) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080790.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(46881..48173) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597466.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(48187..49866) product glucosylglycerate phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810500.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene ycjM CDS complement(50079..50393) product thiosulfate sulfurtransferase PspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473109.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene pspE CDS complement(50468..50689) product phage shock protein PspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295585.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene pspD CDS complement(50698..51057) product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907385.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene pspC CDS complement(51057..51281) product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274963.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene pspB CDS complement(51335..52003) product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511025.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene pspA CDS 52170..53147 product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301108.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene pspF CDS complement(53267..54532) product 4-aminobutyrate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069229.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene puuE CDS complement(54570..55850) product gamma-glutamylputrescine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134870.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene puuB CDS complement(55852..57339) product aldehyde dehydrogenase PuuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009090.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene puuC CDS complement(57614..58171) product HTH-type transcriptional regulator PuuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278727.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene puuR CDS complement(58198..58950) product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300506.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene puuD CDS 59174..60592 product glutamate-putrescine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296746.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene puuA CDS 60895..62280 product putrescine/proton symporter PuuP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302119.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 gene puuP CDS 62414..62659 product DUF2543 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015099.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 63013..64614 product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250216.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene sapA CDS 64611..65576 product putrescine ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583277.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene sapB CDS 65563..66453 product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146163.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene sapC CDS 66453..67445 product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128858.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene sapD CDS 67447..68253 product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573407.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene sapF CDS complement(68354..68518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 68447..68674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 69042..69830 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506490.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene fabI CDS 69974..71101 product CMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602331.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 71169..73103 product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484984.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene rnb CDS 73338..75323 product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859953.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene pdeR CDS 75470..75643 product protein YciZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288368.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene yciZ CDS 75733..76482 product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088621.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 76751..76969 product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498253.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene osmB CDS complement(77095..77424) product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295580.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene yciH CDS complement(77421..78158) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176278.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene pyrF CDS complement(78351..79520) product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891353.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene lapB CDS complement(79527..79835) product lipopolysaccharide assembly protein LapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876286.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene lapA CDS complement(79984..80748) product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256538.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene pgpB CDS 80918..81508 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176295.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene ribA CDS complement(81572..84247) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099535.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene acnA CDS complement(84620..84787) product protein YciX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297116.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene yciX CDS complement(84790..84918) product YmiA family putative membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908596.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(85249..86223) product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776253.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene cysB CDS complement(86433..89030) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297122.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene topA CDS 89410..89661 product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031530.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS complement(89697..90746) product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422045.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene sohB CDS 90966..91724 product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559286.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 91721..92311 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278906.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene cobO CDS complement(92351..93226) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291216.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene rluB CDS complement(93439..94878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24160 sequence19 source 1..93789 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 120..3374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(3431..4477) product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437621.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene mcrC CDS complement(4477..5856) product 5-methylcytosine-specific restriction endonuclease subunit McrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443951.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene mcrB CDS complement(6018..6359) product endoribonuclease SymE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132601.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene symE CDS complement(6587..8011) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073935.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(8008..9597) product type I restriction-modification system methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063200.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene hsdM CDS complement(9798..13310) product type I restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981385.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene hsdR CDS 13498..14412 product adenine/cytosine-specific restriction endonuclease Mrr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217934.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene mrr CDS complement(14458..15414) product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297640.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 gene yjiA CDS complement(15425..15628) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467859.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(15678..17843) product pyruvate/proton symporter BtsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117680.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 gene btsT CDS complement(18221..18733) product 4-hydroxyphenylacetate 3-monooxygenase reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175460.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(18751..20313) product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801481.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene hpaB CDS complement(20564..21454) product 4-hydroxyphenylacetate catabolism regulatory protein HpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205639.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene hpaA CDS complement(21464..22840) product 4-hydroxyphenylacetate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285769.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene hpaX CDS complement(22964..23752) product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431692.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene hpaI CDS complement(23763..24566) product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459750.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene hpaH CDS complement(24634..25014) product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119872.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(25024..25875) product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516990.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene hpaD CDS complement(25877..27343) product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723530.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene hpaE CDS complement(27340..28629) product 4-hydroxyphenylacetate degradation bifunctional isomerase/decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679076.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene hpaG CDS 28901..29347 product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543916.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene hpaR CDS 29466..31121 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919536.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene tsr CDS complement(31170..32531) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410113.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(32746..33369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24410 note possible pseudo, frameshifted CDS complement(33366..33659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24420 note possible pseudo, frameshifted CDS 33798..34820 product L-galactonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106030.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene lgoD CDS complement(34958..37249) product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292679.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene opgB CDS complement(37503..37997) product DUF2501 domain-containing protein YjjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001308243.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene yjjA CDS complement(38046..38783) product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799911.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene dnaC CDS complement(38786..39325) product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098818.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 gene dnaT CDS complement(39432..39905) product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538191.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(39896..40729) product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307560.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 41285..42010 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936635.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 42022..42645 product DNA-binding transcriptional activator BglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094869.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene bglJ CDS complement(42683..43471) product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331618.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene fhuF CDS 43612..43848 product DUF1435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393508.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 tRNA complement(43887..43973) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(44008..44094) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(44123..44209) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(44477..45508) product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272330.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene rsmC CDS 45611..46024 product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204012.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene holD CDS 45993..46439 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092461.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene rimI CDS 46454..47131 product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870710.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene yjjG CDS 47222..48811 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175940.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene prfC CDS 49204..49809 product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295748.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene osmY CDS 49936..50097 product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176651.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 50219..51292 product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299799.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 51289..52068 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000563040.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(52488..53063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(53323..54873) product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143253.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 55131..55910 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295412.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene deoC CDS 56037..57359 product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477811.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene deoA CDS 57411..58634 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816471.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 gene deoB CDS 58714..59433 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224879.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene deoD CDS complement(59594..59857) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566150.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(59889..60905) product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105865.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene lplA CDS complement(60933..61577) product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124615.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 61683..62651 product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132955.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene serB CDS 62700..64082 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029698.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene radA CDS 64103..65335 product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093810.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene nadR CDS complement(65642..67309) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046749.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene ettA CDS 67520..69457 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409451.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene sltY CDS 69547..69873 product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068679.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene trpR CDS complement(69958..70488) product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001341279.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 gene yjjX CDS 70531..71178 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942344.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene gpmB CDS complement(71175..72044) product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371666.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene robA CDS 72255..72728 product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875487.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 gene creA CDS 72741..73430 product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188664.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene creB CDS 73430..74854 product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219596.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 gene creC CDS 74912..75481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24840 note possible pseudo, internal stop codon CDS 75506..76264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 note possible pseudo, internal stop codon CDS complement(76324..77040) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194358.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene arcA CDS 77676..78362 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223164.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 78722..81184 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264697.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene thrA CDS 81186..82118 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241660.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene thrB CDS 82119..83405 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781063.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene thrC CDS 83733..83918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(84067..84843) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906203.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene yaaA CDS complement(84913..86343) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112597.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 86622..87575 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130189.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene tal CDS 87690..88277 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094682.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene mog CDS complement(88312..88878) product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528538.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene satP CDS complement(89027..89740) product acidic protein MsyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102379.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene msyB CDS complement(89766..90170) product DUF2541 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843568.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 90547..92463 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516135.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene dnaK CDS 92552..93682 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118464.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene dnaJ sequence20 source 1..93543 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 210..662 product PTS galactitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182899.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene gatA CDS 693..977 product PTS galactitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823270.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene gatB CDS 981..2336 product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490679.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS 2384..3424 product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844219.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene gatD CDS 3530..4303 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295426.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(4385..5284) product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807362.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene yegS CDS 5629..6006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130399.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(6272..7285) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815648.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(7401..7700) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815649.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS 7822..8097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 8108..8278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 8275..8775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 8839..9063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 9063..9362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 9365..9589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS 9586..9861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 9851..12133 product replication endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816116.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS 12228..13445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 13432..13584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 13581..13946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 13946..15913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(16229..16960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 17006..17143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(17215..18000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 18084..18719 product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048619997.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 18716..19063 product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098787.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 19068..19976 product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816096.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 19969..20499 product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816095.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 20510..23368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS complement(23580..24692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(24670..24885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 25928..27118 product phage tail sheath protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046120.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 27131..27910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(28483..29844) product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476014.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene yegQ CDS complement(29990..30322) product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929408.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(30513..31235) product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137877.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene baeR CDS complement(31232..32635) product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675150.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene baeS CDS complement(32632..34047) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130850.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(34048..37125) product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667481.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene mdtC CDS complement(37126..40248) product multidrug efflux RND transporter permease subunit MdtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197875.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene mdtB CDS complement(40248..41495) product multidrug efflux RND transporter subunit MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678969.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene mdtA CDS 43040..43699 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003151.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS 43777..44457 product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119071.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 44454..46394 product protein kinase YegI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640171.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 gene yegI CDS complement(46407..47759) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469740.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 gene yegD CDS 47893..48741 product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275665.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene alkA CDS complement(48842..52147) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043761.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 52465..53106 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295424.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene udk CDS 53198..53779 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234777.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene dcd CDS 53801..55654 product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252360.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene asmA CDS complement(55928..57511) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300971.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 58263..59309 product polysaccharide export protein Wza inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978094.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene wza CDS 59315..59758 product low molecular weight protein-tyrosine-phosphatase Wzb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482901.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene wzb CDS 59761..61923 product tyrosine-protein kinase Wzc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137113.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene wzc CDS 62016..62855 product colanic acid biosynthesis glycosyltransferase WcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654503.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene wcaA CDS 62858..63346 product colanic acid biosynthesis acetyltransferase WcaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888740.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene wcaB CDS 63343..64560 product colanic acid biosynthesis glycosyltransferase WcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023915.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 gene wcaC CDS 64535..65752 product colanic acid polymerase WcaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107816.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene wcaD CDS 65763..66509 product colanic acid biosynthesis glycosyltransferase WcaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927066.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene wcaE CDS 66525..67073 product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153547.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene wcaF CDS 67100..68221 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048190.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 gene gmd CDS 68224..69189 product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043654.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene fcl CDS 69192..69671 product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309580.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene gmm CDS 69668..70891 product colanic acid biosynthesis fucosyltransferase WcaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699727.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene wcaI CDS 70894..72330 product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079285.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 gene cpsB CDS 72523..73893 product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350528.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene cpsG CDS 73948..75342 product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183124.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 gene wcaJ CDS 75344..76822 product colanic acid undecaprenyl disphosphate flippase WzxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058490.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene wzxC CDS 76984..78264 product colanic acid biosynthesis pyruvyl transferase WcaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602263.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene wcaK CDS 78261..79481 product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862652.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene wcaL CDS 79492..80886 product colanic acid biosynthesis protein WcaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116062.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 gene wcaM CDS 81061..81954 product UTP--glucose-1-phosphate uridylyltransferase GalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183060.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene galF CDS 82258..83412 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699450.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene rfbB CDS 83412..84311 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023616.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene rfbD CDS 84370..85248 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene rfbA CDS 85253..85798 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100801.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 gene rfbC CDS 85802..87226 product O7 family O-antigen flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060533.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene wzx CDS 87236..88348 product dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998544.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene vioA CDS 88350..88928 product dTDP-4-amino-4,6-dideoxy-D-glucose acetyltransferase VioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323726.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene vioB CDS 88925..89671 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690820.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 89671..90492 product sugar polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340445.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 90489..91664 product O7 family O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230642.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene wzy CDS 91661..92773 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161786.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 92763..93530 product UDP-Gal:alpha-D-GlcNAc-diphosphoundecaprenol beta-1,3-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278665.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 gene wbbD sequence21 source 1..89706 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 85..858 product YaiO family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000596085.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 1044..1319 product formaldehyde-responsive transcriptional repressor FrmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141271.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene frmR CDS 1354..2463 product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842102.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene frmA CDS 2556..3389 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000419081.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene fghA CDS complement(3615..4154) product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096705.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(4256..5467) product 3-(3-hydroxy-phenyl)propionate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107627.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(5845..6858) product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013510.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 gene dmpG CDS complement(6855..7805) product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044314.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene mhpF CDS complement(7802..8611) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160710.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 gene mhpD CDS complement(8621..9487) product 2-hydroxy-6-oxonona-2,4-dienedioate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121898.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 gene mhpC CDS complement(9505..10449) product 3-carboxyethylcatechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543457.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 gene mhpB CDS complement(10451..12115) product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007409.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 12306..13139 product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301325.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 13207..14298 product DNA-binding transcriptional repressor LacI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307621.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 gene lacI CDS 14421..17495 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177906.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene lacZ CDS 17547..18800 product lactose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291549.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 gene lacY CDS 18857..19477 product galactoside O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335915.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene lacA CDS complement(19580..20734) product cyanate transporter CynX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927953.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene cynX CDS complement(20767..21237) product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616243.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene cynS CDS complement(21268..21927) product carbonic anhydrase CynT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658652.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 gene cynT CDS 22036..22935 product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952503.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 gene cynR CDS complement(23272..24555) product cytosine/isoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301240.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene codA CDS complement(24545..25804) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076233.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene codB CDS complement(26040..27926) product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010288.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 gene prpE CDS complement(27966..29417) product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275859.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene prpD CDS complement(29451..30620) product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285908.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 gene prpC CDS complement(30967..31857) product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052206.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 gene prpB CDS 32096..33682 product propionate catabolism operon regulatory protein PrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941052.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene prpR CDS complement(33780..34055) product DUF1471 family periplasmic protein YahO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691956.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 gene yahO CDS 34241..34873 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976975.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 tRNA complement(35125..35205) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(35548..36363) product protein YahL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301260.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene yahL CDS complement(36607..37656) product NADPH-dependent aldehyde reductase YahK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692754.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 gene yahK CDS complement(38033..39415) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665120.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(39425..40375) product carbamate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661672.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 assembly_gap 40626..40771 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(40799..42217) product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083455.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(42217..43764) product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111784.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene fdrA CDS complement(43754..44617) product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001316891.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(44657..45262) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023635.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 45520..46017 product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013880.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 46109..47041 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084394.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(47083..48171) product DNA-binding transcriptional activator/c-di-GMP phosphodiesterase PdeL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301264.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene pdeL CDS 48491..48676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001328114.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(49046..51034) product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131044.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene betT CDS 51208..51795 product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301903.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 gene betI CDS 51809..53281 product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089077.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene betB CDS 53295..54965 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159094.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene betA CDS 55178..55846 product protein YkgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209100.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene ykgH CDS complement(56089..56784) product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370307.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(56777..58204) product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023927.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(58215..58934) product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102108.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS complement(59461..60315) product reactive chlorine-specific transcriptional regulator RclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339594.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene rclR CDS 60541..61866 product reactive chlorine resistance oxidoreductase RclA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046307.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene rclA CDS 61975..62211 product reactive chlorine resistance periplasmic protein RclB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000474077.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene rclB CDS 62223..62816 product reactive chlorine species resistance protein RclC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299021.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene rclC CDS 63407..64258 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306920.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(64398..68654) product inverse autotransporter adhesin FdeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092539.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene fdeC CDS 70231..70497 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803998.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS 70497..70637 product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866436.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene ykgO CDS complement(70672..70839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 71722..72264 product ECP biosynthesis operon DNA-binding transcriptional regulator EcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220247.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene ecpR CDS 72290..72925 product common pilus major fimbrillin subunit EcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730972.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene ecpA CDS 72983..73651 product fimbrial chaperone EcpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716398.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene ecpB CDS 73677..76202 product fimbrial usher EcpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131063.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene ecpC CDS 76192..77835 product fimbrial adhesin EcpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310578.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene ecpD CDS 77804..78514 product fimbrial chaperone EcpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305432.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene ecpE CDS complement(79186..79398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(79403..80017) product YagU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019920.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 80434..81123 product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070694.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene paoA CDS 81120..82076 product aldehyde oxidoreductase FAD-binding subunit PaoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643333.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene paoB CDS 82073..84271 product aldehyde oxidoreductase molybdenum-binding subunit PaoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667043.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene paoC CDS 84281..85237 product molybdenum cofactor insertion chaperone PaoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121321.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 gene paoD CDS 85216..85626 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111342.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 tRNA complement(85753..85828) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(85943..87196) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893267.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 gene proA CDS complement(87208..88311) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285288.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 gene proB CDS 88599..89636 product phosphoporin PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749881.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene phoE sequence22 source 1..81510 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(9..96) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 331..1269 product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351317.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 gene ghrA CDS 1324..2061 product zinc-binding phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283664.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene ycdX CDS 2085..2639 product molecular chaperone YcdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001902.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene ycdY CDS 2711..3232 product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307110.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS complement(3296..4129) product curli production assembly/transport protein CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189321.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene csgG CDS complement(4156..4572) product curli production assembly/transport protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264088.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene csgF CDS complement(4597..4986) product curli production assembly/transport protein CsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833288.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene csgE CDS complement(4991..5641) product biofilm master transcriptional regulator CsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481500.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene csgD CDS 6369..6851 product curli minor subunit CsgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791650.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene csgB CDS 6892..7347 product curli major subunit CsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771437.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene csgA CDS 7406..7738 product curli assembly chaperone CsgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094300.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene csgC CDS 7859..8170 product protein YmdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489587.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene ymdA CDS 8265..8798 product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857405.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene ymdB CDS 8800..10221 product cardiolipin synthase ClsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299031.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene clsC CDS complement(10229..11386) product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070375.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene mdoC CDS 11762..13315 product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001343212.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene mdoG CDS 13308..15851 product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295445.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene mdoH CDS 16024..16251 product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237205.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(16252..16626) product acidic protein MsyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180056.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(16709..17935) product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074172.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene mdtG CDS complement(18107..19027) product kdo(2)-lipid IV(A) lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183364.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene lpxL CDS 19252..20304 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144615.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(20346..20921) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749261.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS complement(20925..21491) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011114.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(21913..23031) product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872833.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene solA CDS complement(23146..23400) product biofilm formation regulator BssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414437.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene bssS CDS complement(23690..23935) product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217754.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene dinI CDS complement(24009..24929) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126540.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene pyrC CDS complement(25161..25721) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295443.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(25855..26502) product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780912.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 gene grxB CDS complement(26566..27774) product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092206.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene mdtH CDS 28010..28594 product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468186.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene rimJ CDS 28605..29252 product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877107.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 29254..30177 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736158.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 30287..31822 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050683.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene murJ CDS complement(31862..32278) product flagella biosynthesis chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197363.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene flgN CDS complement(32283..32576) product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020880.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene flgM CDS complement(32652..33311) product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905458.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene flgA CDS 33466..33882 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884702.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene flgB CDS 33886..34290 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196460.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene flgC CDS 34302..34997 product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020486.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene flgD CDS 35022..36227 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885878.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene flgE CDS 36247..37002 product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349316.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene flgF CDS 37174..37956 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625837.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene flgG CDS 38009..38707 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295442.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene flgH CDS 38716..39816 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589326.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene flgI CDS 39816..40757 product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295441.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene flgJ CDS 40823..42466 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096479.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene flgK CDS 42478..43431 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212764.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 gene flgL CDS complement(43627..46812) product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827370.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene rne CDS 47385..48344 product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846343.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 gene rluC CDS complement(48456..49079) product 7-methyl-GTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974786.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene yceF CDS 49239..49760 product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174481.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene yceD CDS 49812..49985 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290727.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene rpmF CDS 50066..51136 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197578.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 gene plsX CDS 51204..52157 product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288132.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene fabH CDS 52173..53102 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191372.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene fabD CDS 53115..53849 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008535.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene fabG CDS 54060..54296 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103754.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene acpP CDS 54384..55625 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044679.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene fabF CDS 55745..56554 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478706.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene pabC CDS 56557..57579 product cell division protein YceG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756838.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene yceG CDS 57569..58210 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257000.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene tmk CDS 58207..59211 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267941.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene holB CDS 59222..60019 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480245.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 60314..61747 product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475719.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene ptsG CDS complement(61807..63996) product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953450.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 gene fhuE CDS 64330..64689 product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807125.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene hinT CDS 64692..65069 product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225281.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 65083..65724 product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164439.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene lpoB CDS 65705..66529 product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116592.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene thiK CDS 66540..67565 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529331.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene nagZ CDS 67588..68130 product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587933.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene ycfP CDS 68538..69842 product NADH-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211045.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene ndh CDS 70069..70608 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043459.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS complement(70670..71302) product TetR family copper-responsive transcriptional repressor ComR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179805.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 gene comR CDS 71543..71800 product multiple stress resistance protein BhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800153.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene bhsA CDS complement(71883..72842) product L,D-transpeptidase LdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300895.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene ldtC CDS complement(72989..76435) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297549.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene mfd CDS complement(76563..77636) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810253.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS 77898..79097 product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284714.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene lolC CDS 79090..79791 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033695.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 gene lolD CDS 79791..81035 product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251389.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene lolE CDS 81064..81495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27430 sequence23 source 1..69170 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1758..2336) product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991805.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene rsxB CDS complement(2336..2917) product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133193.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene rsxA CDS complement(2994..3434) product DUF2569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214176.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS complement(3520..3735) product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217950.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene ydgT CDS 4376..5416 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300538.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(5450..6451) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567490.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene add CDS complement(6555..7727) product bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459374.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene malY CDS complement(7737..9329) product PTS maltose transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125609.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene malX CDS 9504..10532 product mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179510.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene malI CDS 10643..11410 product 7-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483353.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene hdhA CDS 11631..12221 product DNA-binding transcriptional regulator UidR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969092.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 gene uidR CDS 12612..14423 product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945913.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene uidA CDS 14420..15793 product glucuronide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075893.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene uidB CDS 15844..17097 product glucuronide uptake porin UidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227015.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene uidC CDS complement(17323..18831) product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043339.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(18932..20107) product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170664.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene manA CDS 20306..21952 product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066639.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene fumB CDS 22095..23498 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099085.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene fumC CDS complement(23495..24436) product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135186.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene tus CDS complement(24500..25801) product two-component system sensor histidine kinase RstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732491.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene rstB CDS complement(25805..26524) product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092508.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene rstA CDS 26653..26988 product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524868.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(26985..27707) product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520804.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 gene folM CDS complement(27744..29126) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412379.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(29312..30256) product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769322.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene ydgH CDS 30780..32312 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300486.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 gene pntA CDS 32323..33711 product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014036.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene pntB CDS complement(33736..34770) product AI-2 transporter TqsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118241.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene tqsA CDS 35182..35547 product multidrug/spermidine efflux SMR transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276149.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene mdtJ CDS 35534..35863 product multidrug/spermidine efflux SMR transporter subunit MdtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046661.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene mdtI CDS complement(35902..36723) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260840.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(36999..37334) product acid resistance repetitive basic protein Asr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743951.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene asr CDS complement(37731..38984) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091840.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 39091..39984 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019525.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS 40119..41339 product DNA-binding transcriptional repressor Mlc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225262.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene mlc CDS 41464..42159 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919231.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene bioD CDS complement(42112..43368) product voltage-gated ClC-type chloride channel ClcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302066.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene clcB CDS complement(43563..44177) product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148710.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene dmsD CDS complement(44220..45074) product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526503.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(45076..45693) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213028.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene dmsB CDS complement(45704..48130) product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340362.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS complement(48188..50614) product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041675.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(50813..51118) product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300836.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 51190..51936 product YnfC family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571976.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(51939..52499) product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138581.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene speG CDS complement(52534..52875) product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705211.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 53010..53336 product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598292.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 53373..53561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS 53542..54756 product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295394.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene rspA CDS 54768..55787 product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836066.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(55975..56238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27940 note possible pseudo, frameshifted CDS complement(56280..57254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27950 note possible pseudo, frameshifted CDS complement(57289..57540) product excisionase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005552.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(57613..60084) product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001515375.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS complement(60178..60369) product lysis protein YdfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083297.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 gene ydfD CDS complement(60366..60554) product cell division inhibition protein DicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854559.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene dicB CDS 61057..61257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS complement(61226..61591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS complement(61603..61755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(61924..62331) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381212.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 62412..62639 product Cro/CI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909905.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 62623..63144 product toxin YdaT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705349.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 63176..64090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054512.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS 64131..64553 product DUF977 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151262.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 64936..65502 product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021554705.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 66115..66270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 66490..66738 product protein Rem inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980991.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene rem CDS 67085..67735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 67753..68130 product antiterminator Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204777.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(68286..68810) product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780585.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 69003..69152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28140 sequence24 source 1..65591 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(1..76) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(287..832) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295188.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 gene orn CDS 927..1979 product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041970.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 gene rsgA CDS 2076..3044 product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934927.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 gene asd CDS 3066..6389 product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236847.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 gene mscM CDS complement(6539..7996) product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300174.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 gene yjeM CDS complement(8260..9237) product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004771.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene epmA CDS 9562..11370 product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192973.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 gene frdA CDS 11363..12097 product fumarate reductase iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829498.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 gene frdB CDS 12108..12503 product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208757.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 gene frdC CDS 12514..12873 product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299198.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene frdD CDS 12936..14069 product BlaEC family class C beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477369.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 14158..14694 product lipocalin Blc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238378.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene blc CDS complement(14688..15005) product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118482.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 gene sugE CDS complement(15181..15327) product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239596.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene ecnB CDS complement(15615..16181) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257278.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 gene efp CDS 16223..17251 product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940508.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene epmB CDS 17646..18515 product YjeJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008046.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(18708..19061) product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168693.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(19199..20845) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729117.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene groL CDS complement(20889..21182) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026276.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 21458..22714 product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015852.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 gene yjeH CDS complement(22730..23206) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267448.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene fxsA CDS 23543..24979 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069437.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene aspA CDS 25097..26398 product anaerobic C4-dicarboxylate transporter DcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961959.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 gene dcuA CDS 26514..26852 product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883400.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene cutA CDS 26828..28525 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068927.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene dsbD CDS 28562..29137 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188520.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 tRNA 29244..29319 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS 29936..31474 product lysine decarboxylation/transport transcriptional activator CadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187177.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 gene cadC CDS 31840..33174 product cadaverine/lysine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092909.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 gene cadB CDS 33254..35401 product lysine decarboxylase CadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295383.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 gene cadA CDS 35460..36917 product dipeptide/tripeptide permease DtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856829.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 gene dtpC CDS 37154..38671 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295074.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 gene lysS CDS complement(38790..38963) product type V toxin-antitoxin system toxin GhoT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173343.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 gene ghoT CDS complement(38991..39287) product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398619.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 gene ghoS CDS complement(39514..39786) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405651.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(39798..40028) product 4Fe-4S mono-cluster protein YjdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371704.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 gene yjdI CDS 40209..41120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28510 note possible pseudo, frameshifted CDS 41204..41845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 note possible pseudo, frameshifted CDS 41842..42561 product two-component system response regulator DcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611288.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 gene dcuR CDS 43132..44472 product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899522.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 gene dcuB CDS 44550..46196 product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066681.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 gene fumB CDS 46319..46948 product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198752.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(47087..48496) product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028114.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 gene melB CDS complement(48611..49966) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988031.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene melA CDS 50249..51157 product transcriptional regulator MelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090758.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 gene melR CDS 51353..53623 product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001381593.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 gene adiA CDS 53948..54709 product DNA-binding transcriptional activator AdiY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217060.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 gene adiY CDS 54846..56183 product arginine/agmatine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093154.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 gene adiC CDS 56317..57930 product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298860.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene eptA CDS 57927..58595 product two-component system response regulator BasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697915.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 gene basR CDS 58596..59696 product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300761.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 gene pmrB CDS complement(59873..61375) product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298520.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene proP CDS complement(61639..62517) product YjcZ-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169188.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(62514..64742) product clamp-binding protein CrfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288590.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 gene crfC CDS 65143..65478 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300891.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 sequence25 source 1..64581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 119..2473 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295325.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene lon CDS 2682..2954 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043542.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene hupB CDS 3146..5017 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969372.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 gene ppiD CDS 5168..5539 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680314.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS 5645..6043 product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194534.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene fadM CDS complement(6095..6790) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817229.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene queC CDS complement(6855..8555) product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238234.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 8655..9473 product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113027.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 gene cof CDS 9626..10084 product DNA-binding transcriptional regulator DecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884589.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 gene decR CDS 10114..11886 product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235584.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 11879..13660 product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256174.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 13841..14179 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780338.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene glnK CDS 14209..15495 product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000685029.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 gene amtB CDS complement(15544..16404) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075876.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 gene tesB CDS 16622..17194 product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779826.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(17225..17536) product DNA base-flipping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300427.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 gene atl CDS 17915..18268 product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878140.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(18310..19866) product cyclic-guanylate-specific phosphodiesterase PdeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961238.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene pdeB CDS complement(20024..20494) product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136192.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(20610..21161) product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102564.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene maa CDS complement(21333..21551) product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291435.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(21577..21951) product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344800.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 gene tomB CDS complement(22497..25646) product efflux RND transporter permease AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132469.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 gene acrB CDS complement(25669..26754) product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386618.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 gene acrA CDS 27004..27651 product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101737.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene acrR CDS 27779..31141 product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177732.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene mscK CDS complement(31353..31514) product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051153.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene rsmS CDS complement(31528..32055) product primosomal replication protein N'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844874.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 gene priC CDS 32125..32502 product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188905.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS 32655..33206 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127356.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene apt CDS 33335..35266 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122013.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 gene dnaX CDS 35319..35648 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS 35648..36253 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195025.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene recR CDS 36363..38237 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678201.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 gene htpG CDS 38418..39062 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220233.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene adk CDS 39298..40260 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250117.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene hemH CDS complement(40257..41216) product acetyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801813.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 gene aes CDS 41368..42672 product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671574.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 gene gsk CDS complement(42805..44481) product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546237.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 gene ybaL CDS complement(44719..45939) product fosmidomycin MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251608.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene fsr CDS 46157..47809 product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771748.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 gene ushA CDS complement(47846..48325) product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186631.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 gene ybaK CDS complement(48529..49323) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365173.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 49407..49802 product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617184.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 assembly_gap 50036..50106 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(50176..52680) product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083955.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene copA CDS 52942..53874 product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883034.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene glsA CDS 53877..55169 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982170.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 55294..55701 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026747.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 gene cueR CDS complement(55702..56160) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970323.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(56157..57074) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904502.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 57220..57897 product iron ABC transporter ATP-binding protein FetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157548.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene fetA CDS 57884..58663 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295323.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene fetB CDS complement(58726..59580) product chaperedoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300573.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene cnoX CDS complement(59641..60450) product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148959.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene ybbO CDS complement(60440..61096) product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297298.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene tesA CDS 61034..61720 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110573.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 61717..64131 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561872.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 sequence26 source 1..60545 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 114..773 product protein deglycase HchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218212.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 gene hchA CDS complement(881..2239) product two-component system sensor histidine kinase HprS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826732.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene hprS CDS complement(2239..3021) product response regulator transcription factor HprR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007193.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene hprR CDS 3043..3456 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920127.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene hiuH CDS 3565..4569 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000740067.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene msrP CDS 4570..5205 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240091.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene msrQ CDS 5462..6112 product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007759.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene zinT CDS 6455..6985 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079074.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 tRNA complement(7555..7644) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS 7738..8535 product DgsA anti-repressor MtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300801.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 gene mtfA tRNA 8636..8711 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 9082..16101 product inverse autotransporter adhesin YeeJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723107.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene yeeJ CDS complement(16363..16689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29370 note possible pseudo, internal stop codon CDS complement(16711..17415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29380 note possible pseudo, internal stop codon CDS 17730..19046 product shikimate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378575.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 gene shiA CDS 19148..20602 product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060244.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 gene amn CDS 20945..21661 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532923.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 tRNA complement(22115..22190) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(22291..23673) product toxic metabolite efflux MATE transporter YeeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943916.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 gene yeeO tRNA 23939..24014 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(24052..25002) product HTH-type transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011008.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 gene cbl CDS complement(25104..26021) product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011462.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 gene nac tRNA 26348..26423 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS complement(26479..27414) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350523.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 gene ldtA CDS complement(27476..28555) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166160.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 gene cobT CDS complement(28567..29310) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326708.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 gene cobS CDS complement(29307..29852) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973176.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 gene cobU CDS complement(31841..32383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 32399..32701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(33619..34026) product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221617.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(34014..34415) product putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270978.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS complement(35563..35892) product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450409.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS complement(36064..37122) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200891.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(37320..37793) product DNA gyrase inhibitor SbmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105393.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene sbmC CDS complement(37912..38955) product serine-type D-Ala-D-Ala carboxypeptidase DacD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296209.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene dacD CDS 39287..40714 product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980557.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene sbcB CDS complement(40757..40984) product thiosulfate utilization sulfurtransferase TsuB/YeeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985273.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene tsuB CDS complement(40998..41960) product thiosulfate utilization transporter TsuA/YeeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492348.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 gene tsuA CDS complement(42235..43593) product putrescine/proton symporter PlaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019197.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 gene plaP CDS complement(43860..44789) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803363.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(44835..45659) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754737.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 46282..47181 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131756.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 gene hisG CDS 47187..48491 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350335.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 gene hisD CDS 48488..49558 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108921.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene hisC CDS 49558..50625 product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039066265.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 gene hisB CDS 50625..51215 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103560.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene hisH CDS 51215..51952 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586449.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene hisA CDS 51934..52710 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880182.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene hisF CDS 52704..53315 product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954911.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 gene hisIE CDS complement(53411..54391) product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350693.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene wzzB CDS complement(54537..55703) product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704855.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 gene ugd CDS complement(55951..57357) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043504.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene gndA CDS complement(57521..58885) product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954427.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 gene cpsG CDS complement(58919..60343) product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097982.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 sequence27 source 1..59794 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 196..267 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(211..287) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(291..383) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(699..884) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene csrA CDS complement(1119..3749) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047184.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene alaS CDS complement(3877..4377) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140508.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene recX CDS complement(4446..5507) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963143.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene recA CDS complement(5587..6084) product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 gene pncC CDS complement(6229..7314) product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301333.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 gene mltB CDS 7570..8133 product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573321.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 gene srlA CDS 8130..9089 product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148875.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 gene srlE CDS 9100..9471 product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216210.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 gene srlB CDS 9475..10254 product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077351.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 gene srlD CDS 10360..10719 product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252908.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 gene gutM CDS 10786..11559 product glucitol operon DNA-binding transcriptional repressor SrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804550.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 gene srlR CDS 11552..12517 product arabinose-5-phosphate isomerase GutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287420.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 gene gutQ CDS complement(12514..14028) product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010749.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene norR CDS 14215..15654 product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029605.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene norV CDS 15651..16784 product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064748.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 gene norW CDS complement(16912..19164) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107704.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 gene hypF CDS complement(19317..19844) product electron transport protein HydN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078777.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 gene hydN CDS complement(19993..20994) product DNA-binding transcriptional regulator AscG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302219.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 gene ascG CDS 21263..22720 product PTS cellobiose/arbutin/salicin transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107844.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 gene ascF CDS 22729..24153 product 6-phospho-beta-glucosidase AscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110337.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene ascB CDS complement(24312..24782) product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132961.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene hycI CDS complement(24775..25185) product formate hydrogenlyase assembly protein HycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291921.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 gene hycH CDS complement(25182..25949) product formate hydrogenlyase subunit HycG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067401.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 gene hycG CDS complement(25949..26491) product formate hydrogenlyase subunit HycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493785.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 gene hycF CDS complement(26501..28210) product formate hydrogenlyase subunit HycE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288122.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 gene hycE CDS complement(28228..29151) product formate hydrogenlyase subunit HycD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115224.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene hycD CDS complement(29154..30980) product formate hydrogenlyase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274388.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene hycC CDS complement(30977..31588) product formate hydrogenlyase subunit HycB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079186.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene hycB CDS complement(31713..32174) product formate hydrogenlyase regulator HycA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158056.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene hycA CDS 32374..32736 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508457.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene hypA CDS 32740..33612 product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337665.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene hypB CDS 33603..33875 product hydrogenase 3 maturation protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334881.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene hypC CDS 33875..34996 product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212985.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene hypD CDS 34993..36003 product hydrogenase maturation carbamoyl dehydratase HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059922.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 gene hypE CDS 36077..38155 product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301332.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 gene flhA CDS complement(38192..38545) product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015497.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 38832..41393 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272928.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 gene mutS CDS 41499..42155 product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141316.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene pphB CDS complement(42206..42973) product DNA-binding transcriptional repressor YgbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300386.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 gene ygbI CDS 43169..44077 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847985.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS 44074..45336 product 3-oxo-tetronate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590392.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 45333..45971 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278994.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 45976..46752 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136934.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS 46841..48205 product GntP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104441.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(48299..49291) product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081550.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 gene rpoS CDS complement(49354..50493) product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272590.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 gene nlpD CDS complement(50633..51259) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254708.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 gene pcm CDS complement(51253..52014) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295182.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 gene surE CDS complement(51995..53044) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568943.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 gene truD CDS complement(53041..53520) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219242.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 gene ispF CDS complement(53520..54230) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246138.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 gene ispD CDS complement(54249..54560) product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517476.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene ftsB CDS complement(54548..54769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(54754..55077) product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246104.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(55127..55732) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173673.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 gene cysC CDS complement(55732..57159) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090361.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 gene cysN CDS complement(57161..58069) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372108.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene cysD CDS 58321..59358 product alkaline phosphatase isozyme conversion aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490426.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene iap repeat_region 59440..59712 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtttatccccgctggcgcggggaacac sequence28 source 1..55532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..947 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000145424.1:hydrogenase 2 small subunit locus_tag LOCUS_30350 CDS 950..1936 product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081870.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 gene hybA CDS 1926..3104 product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017703.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 gene hybB CDS 3101..4804 product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083065.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene hybC CDS 4804..5298 product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221946.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS 5291..5779 product hydrogenase-2 assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134014.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene hybE CDS 5772..6113 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544952.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 gene hypA CDS 6126..6374 product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334896.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 gene hybG CDS complement(6497..7363) product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295515.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 gene yghU CDS 7568..9427 product bifunctional glutathionylspermidine amidase/synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297309.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene gss CDS 9719..11218 product inorganic phosphate transporter PitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933296.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene pitB CDS complement(11267..11959) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190781.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS 12172..12846 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076243.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS 12878..13636 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339531.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS 13682..15031 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896880.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 15031..15855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984978.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS 15864..16427 product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298770.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 16458..17528 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779645.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 gene lptF CDS 17525..18604 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640208.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 gene lptG CDS complement(18639..19811) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524972.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(19811..20059) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248097.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS complement(20091..21005) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145289.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(21002..22690) product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298766.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 23100..24242 product protein YghO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388786.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene yghO CDS complement(24249..25013) product transcriptional regulator GlcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297764.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 gene glcC CDS 25264..26763 product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026117.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 gene glcD CDS 26763..27815 product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943059.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 gene glcE CDS 27826..29049 product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194661.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene glcF CDS 29054..29458 product GlcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853256.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 29480..31651 product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084131.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 gene glcB CDS 32006..33688 product glycolate permease GlcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259302.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene glcA CDS 34306..38727 product lipoprotein metalloprotease SslE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034472.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene sslE CDS 38891..39700 product prepilin peptidase PppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895874.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 gene pppA CDS 39808..40176 product type II secretion system pilot lipoprotein GspS-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309757.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene gspS2 CDS 40323..41153 product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317325.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 gene gspC CDS 41183..43243 product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498829.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 gene gspD CDS 43243..44736 product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249314.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 gene gspE CDS 44736..45959 product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173410.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene gspF CDS 45976..46431 product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087296.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene gspG CDS 46435..46998 product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115140.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 gene gspH CDS 46995..47366 product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820120.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene gspI CDS 47363..47968 product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250454.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 gene gspJ CDS 47965..48942 product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633238.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 gene gspK CDS 48939..50117 product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095001.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 gene gspL CDS 50119..50655 product GspM family type II secretion system protein YghD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942815.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 gene yghD CDS 51716..52492 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124279.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 52489..53166 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590233.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 53399..54751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 54769..55491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30830 sequence29 source 1..54724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 354..1637 product MHS family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347482.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS 1726..3186 product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527804.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(3222..3425) product putative selenium delivery protein YdfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214712.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene ydfZ CDS complement(3602..4288) product DNA-binding transcriptional regulator rspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215549.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 gene rspR CDS complement(4377..5123) product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636571.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene ydfG CDS 5260..7305 product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210373.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene dcp CDS complement(7349..7867) product 2-oxo-tetronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024746.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 8143..8535 product YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671737.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene ydeI CDS 8790..9680 product diguanylate cyclase DgcZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592814.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 gene dgcZ CDS complement(10121..11221) product efflux MFS transporter YdeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054189.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene ydeE CDS 11503..12402 product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087187.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 gene eamA CDS complement(12433..12651) product multiple antibiotic resistance protein MarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803657.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene marB CDS complement(12683..13066) product MDR efflux pump AcrAB transcriptional activator MarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091199.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene marA CDS complement(13086..13520) product multiple antibiotic resistance transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843414.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene marR CDS 13740..14060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS 14050..14334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS 14455..15120 product NAAT family transporter MarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885033.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 gene marC CDS complement(15145..16335) product L-arabinose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210785.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene ydeA CDS complement(16485..17600) product putative protein YneK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258599.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene yneK CDS complement(17678..18559) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366501.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 18660..20048 product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156615.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene sad CDS 20112..21038 product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257409.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 gene glsB CDS 21038..21397 product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191027.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 21536..22954 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558061.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 23181..24632 product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854633.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene uxaB CDS 24839..25753 product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637082.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(25757..26515) product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286597.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene tam CDS complement(26572..26862) product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558527.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene lsrG CDS complement(26886..27761) product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774178.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 gene lsrF CDS complement(27788..28810) product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172466.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene lsrB CDS complement(28822..29619) product autoinducer 2 ABC transporter permease LsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222721.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 gene lsrD CDS 29702..31174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS 31379..31663 product type II toxin-antitoxin system antitoxin HipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301023.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 gene hipB CDS 31663..32985 product type II toxin-antitoxin system serine/threonine protein kinase toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125439.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene hipA CDS 33357..33839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS 34200..34574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31190 note possible pseudo, internal stop codon CDS 34680..34910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31200 note possible pseudo, internal stop codon CDS 35006..35302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31210 note possible pseudo, frameshifted CDS 35257..36390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31220 note possible pseudo, internal stop codon, frameshifted CDS 36454..37602 product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017447.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 37616..38146 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876763.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS 38159..38662 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825452.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 38721..39635 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520676.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 39969..42248 product acid resistance putative oxidoreductase YdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726691.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 gene ydeP CDS 42496..42693 product two-component system connector SafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543384.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 gene safA CDS 42768..43529 product acid stress response transcriptional regulator YdeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060493.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene ydeO CDS 43931..45613 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303114.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 45764..46822 product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301030.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS 47206..48798 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628576.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 48836..51208 product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832437.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 51265..54048 product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723101.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 sequence30 source 1..54355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(393..605) product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014594.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 gene cspA CDS complement(886..1176) product HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455798.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS 1610..2320 product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602794.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(2370..3344) product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805027.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 gene ghrB CDS complement(3448..4107) product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747625.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS 4314..6593 product biotin sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013950.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene bisC CDS complement(6562..7002) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617470.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS complement(6999..7562) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438948.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene tag CDS 7720..8418 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584472.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS 8647..9855 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189020.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 10221..11870 product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269197.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene eptB tRNA 11962..12038 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS 12949..14556 product dipeptide ABC transporter substrate-binding protein DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222883.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 gene dppA CDS 14864..15883 product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938855.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 gene dppB CDS 15893..16795 product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084677.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene dppC CDS 16806..17789 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196486.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 gene dppD CDS 17786..18790 product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107012.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 gene dppF CDS complement(18820..20091) product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295225.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 20399..20674 product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254105.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS 21365..21640 product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254108.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS complement(21727..23406) product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191622.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene bcsG CDS complement(23403..23594) product cellulose biosynthesis protein BcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988308.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene bcsF CDS complement(23591..25150) product cellulose biosynthesis c-di-GMP-binding protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204931.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene bcsE CDS 25435..25623 product cellulose biosynthesis protein BcsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063318.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene bcsR CDS 25635..26387 product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279528.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene bcsQ CDS 26384..29002 product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025892.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 gene bcsA CDS 29013..31352 product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307454.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene bcsB CDS 31359..32465 product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302749.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene bcsZ CDS 32447..35920 product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225124.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 gene bcsC CDS 36041..37990 product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266293.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene hmsP CDS 38173..39459 product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858214.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 gene dctA CDS 39680..41176 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163141.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS complement(41272..42201) product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306595.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene kdgK CDS 42565..43200 product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295219.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 gene pdeH CDS 43270..45330 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296794.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(45512..46834) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149003.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(47245..48258) product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191237.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 gene yhjD CDS complement(48307..49188) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357790.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 49726..50328 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167676.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(50379..52028) product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934218.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS 52433..53830 product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784827.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene ccp sequence31 source 1..52023 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(34..1011) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298537.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene rdgC CDS 1070..1978 product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219309.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene mak CDS complement(2223..3491) product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196824.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 gene araJ CDS complement(3533..6679) product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698951.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 gene sbcC CDS complement(6676..7878) product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221319.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 gene sbcD CDS 8068..8757 product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113933.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 gene phoB CDS 8815..10110 product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893611.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 gene phoR CDS 10517..11836 product branched-chain amino acid transporter carrier protein BrnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149639.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 gene brnQ CDS 11912..13285 product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295329.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 gene proY CDS 13441..15258 product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930752.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 gene malZ CDS complement(15263..15607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31850 note possible pseudo, internal stop codon CDS complement(15653..15844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31860 note possible pseudo, internal stop codon CDS 15937..17007 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266503.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS 17063..18190 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667319.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 18213..18545 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007629.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 gene yajC CDS 18606..20420 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934822.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 gene secD CDS 20431..21402 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046637.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 gene secF CDS 21530..21877 product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974813.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 gene yajD CDS complement(22165..22938) product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295328.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 gene tsx CDS complement(23237..23776) product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949994.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 23927..24376 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543535.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 gene nrdR CDS 24380..25483 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150457.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 gene ribD CDS 25572..26042 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021161.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene ribE CDS 26062..26481 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801125.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene nusB CDS 26559..27536 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742109.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 gene thiL CDS 27514..28032 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154044.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 gene pgpA CDS complement(28086..29060) product 1-deoxyxylulose-5-phosphate synthase YajO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199799.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene yajO CDS complement(29240..31102) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006797.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 gene dxs CDS complement(31127..32026) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347217.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 gene ispA CDS complement(32026..32268) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124935.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 gene xseB CDS 32474..33922 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668685.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 gene thiI CDS complement(33976..34566) product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276309.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 gene yajL CDS complement(34529..35440) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705865.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 gene panE CDS 35608..36099 product nucleotide binding protein YajQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138904.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 gene yajQ CDS complement(36227..37591) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000978.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS 38008..38943 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297127.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS complement(38999..39541) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227784.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS complement(39525..39836) product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297137.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(40021..40911) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971336.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene cyoE CDS complement(40923..41252) product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019869.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(41252..41767) product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179819.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(41856..43847) product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467180.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene cyoB CDS complement(43869..44756) product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239441.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene cyoA CDS complement(45278..46753) product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098438.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene ampG CDS complement(46797..47375) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295326.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS 47680..47997 product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973448.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene bolA CDS 48341..49639 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198384.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 gene tig CDS 49885..50508 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122253.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 gene clpP CDS 50634..51908 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130305.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene clpX sequence32 source 1..51568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 34..4281 product rhs element protein RhsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014739.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 gene rhsD CDS 4321..4689 product YbbC/YhhH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877768.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 4689..5399 product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300714.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 5410..5640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001320180.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 5697..5870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32280 note possible pseudo, frameshifted CDS complement(6384..6755) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903287.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS complement(6871..7965) product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157938.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 gene mnmH CDS complement(8034..8960) product HTH-type transcriptional activator AllS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460145.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene allS CDS 9190..9672 product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776388.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 gene allA CDS 9795..10565 product HTH-type transcriptional repressor AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141275.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 gene allR CDS 10655..12436 product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096881.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene gcl CDS 12449..13225 product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943544.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene hyi CDS 13325..14203 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765839.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 gene glxR CDS 14372..15826 product putative allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401100.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS 15886..17247 product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006887.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 gene allB CDS 17304..18605 product uracil/xanthine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298987.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 18627..19772 product glycerate 3-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706355.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 gene glxK CDS complement(20000..20785) product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540946.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 gene allE CDS complement(20796..22031) product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310618.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 gene allC CDS complement(22053..23102) product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703914.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 gene allD CDS 23419..25086 product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580831.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS 25096..26355 product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495385.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 26366..27181 product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152519.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS 27178..28071 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855388.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(28208..29275) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815540.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 gene purK CDS complement(29272..29781) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295318.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 gene purE CDS complement(29899..30621) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212252.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 gene lpxH CDS complement(30624..31118) product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255997.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene ppiB CDS 31292..32677 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912345.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene cysS CDS complement(32713..33234) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143558.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(33342..33554) product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310620.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene ybcJ CDS complement(33556..34422) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729160.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene folD CDS 34893..35435 product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776555.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 gene fimA CDS 35655..36347 product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988364.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene fimC CDS 36378..38987 product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301865.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS 39029..40006 product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240464.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 gene fimH CDS 40017..40532 product fimbria assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255230.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 gene sfmF CDS complement(40535..41167) product fimbria biosynthesis transcriptional regulator FimZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805422.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene fimZ tRNA 41410..41486 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS complement(41502..42665) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299447.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(42864..43142) product DUF4222 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488407.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS complement(43507..43722) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386642.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS 44199..44411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS 44408..44710 product protein ren inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145915.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS 44778..45110 product SMR family multidrug efflux protein EmrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070446.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene emrE CDS 45365..46891 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709082.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS 47356..47907 product Raf kinase inhibitor-like protein YbcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306955.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 gene ybcL CDS 47917..48714 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881075.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS 48929..49384 product DNA base-flipping protein YbcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054340.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 gene ybcN CDS 49384..49554 product NinE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224907.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS 49547..49837 product DUF1364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774486.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS 49834..50196 product crossover junction endodeoxyribonuclease RusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099522.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 gene rusA CDS 50419..50802 product antitermination protein QuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204780.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 gene quuD misc_feature complement(50992..>51568) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000737271.1:porin OmpC locus_tag LOCUS_32760 sequence33 source 1..46749 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2616..3224 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779792.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS 3322..4713 product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206275.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 gene selA CDS 4710..6554 product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582468.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene selB CDS 6744..7895 product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741518.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene yiaY CDS 8060..9598 product aldehyde dehydrogenase AldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183980.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene aldB CDS complement(9817..10029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332751.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS 10143..10466 product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478195.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS 10472..11608 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364884.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(11605..12579) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164036.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS 12703..13443 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906806.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS complement(13564..15543) product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026882.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(15554..16954) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204819.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS 17180..17995 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891843.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(18027..18722) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893142.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 gene araD CDS complement(18716..19576) product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296811.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS complement(19569..20231) product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089497.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 gene ulaD CDS complement(20228..21724) product L-xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196054.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene lyxK CDS complement(21728..22714) product 2,3-diketo-L-gulonate transporter substrate-binding protein YiaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776887.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene yiaO CDS complement(22727..24004) product 2,3-diketo-L-gulonate transporter large permease YiaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279599.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 gene yiaN CDS complement(24007..24480) product 2,3-diketo-L-gulonate TRAP transporter small permease YiaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721664.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 gene yiaM CDS complement(24598..25065) product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576079.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS complement(25077..26075) product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869037.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 gene yiaK CDS 26276..27124 product IclR family transcriptional regulator YiaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514240.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 gene yiaJ CDS 27226..27699 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300918.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS complement(27850..29103) product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144361.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 gene avtA CDS complement(29281..31311) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761225.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 gene malS CDS 31883..32455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(32651..33829) product DNA-binding transcriptional regulator XylR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494484.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 gene xylR CDS complement(33907..35088) product xylose ABC transporter permease XylH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045978.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 gene xylH CDS complement(35066..35392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33060 note possible pseudo, frameshifted CDS complement(35389..36606) product D-xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146479.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 gene xylG note possible pseudo, frameshifted CDS complement(36683..37675) product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694881.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 gene xylF CDS 38041..39363 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149592.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 gene xylA CDS 39435..40889 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275334.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 gene xylB CDS 41058..41399 product inner membrane protein YiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295228.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 gene yiaB CDS 41445..41882 product inner membrane protein YiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296808.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 gene yiaA CDS complement(41924..42919) product O-acetyltransferase WecH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182641.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene wecH CDS 43181..43393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS 43488..44399 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168544.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 gene glyQ CDS 44409..46478 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291772.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 gene glyS sequence34 source 1..46347 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 263..1411 product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013588.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 gene fucO CDS complement(1466..2221) product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268232.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 gene xni CDS complement(2333..3700) product L-serine ammonia-lyase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626410.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 gene sdaB CDS complement(3758..5047) product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450476.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene sdaC CDS complement(5604..6968) product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627995.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 gene ppnN CDS complement(7080..7928) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100421.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 gene queF CDS 7996..8541 product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342431.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 gene syd CDS complement(8497..8655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS 9163..9492 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206990.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS 9492..10274 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890001.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 gene truC CDS 10292..10741 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807756.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS 11176..12528 product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097082.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 gene gudP CDS 12530..13870 product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211753.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS 13891..15231 product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098255.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 gene gudD CDS complement(15464..18220) product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186450.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 gene barA CDS 18277..19578 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046812.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 gene rlmD CDS 19626..21860 product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226815.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS 21938..22186 product type II toxin-antitoxin system antitoxin MazE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581937.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 gene mazE CDS 22186..22521 product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254738.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 gene mazF CDS 22592..23383 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071648.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 gene mazG CDS 23611..25248 product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210878.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 gene pyrG CDS 25336..26634 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036723.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 gene eno CDS complement(26694..27566) product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268460.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS complement(27580..27720) product cell envelope stress response protein YqcG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288228.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 gene yqcG CDS 27859..28530 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199973.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 gene queE repeat_region 28870..29692 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcgccagcggggataaaccg CDS complement(30331..31809) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039688.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(31836..33113) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164544.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS 33432..34217 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021321.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 34287..35741 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059307.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS 35835..37172 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098105.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS 37150..37929 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299652.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS 37926..38786 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299097.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS complement(38934..39509) product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130266.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS complement(39526..39786) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109532.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS complement(39777..41048) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301334.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(41126..41491) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987944.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 gene queD CDS 41807..43606 product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211913.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 gene cysJ CDS 43606..45318 product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290706.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 gene cysI CDS 45392..46126 product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039862.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 gene cysH sequence35 source 1..45709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(377..1051) product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272824.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 gene gltK CDS complement(1051..1791) product glutamate/aspartate ABC transporter permease GltJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020941.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 gene gltJ CDS complement(1961..2869) product glutamate/aspartate ABC transporter substrate-binding protein GltI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177085.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 gene gltI CDS 3324..5201 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276780.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS complement(5328..6866) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853024.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 gene lnt CDS complement(6891..7769) product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278605.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 gene corC CDS complement(7859..8326) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084469.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 gene ybeY CDS complement(8323..9363) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018040.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(9516..10940) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162740.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 gene miaB CDS 11086..12261 product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184541.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 gene ubiF assembly_gap 12436..12619 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA complement(12686..12762) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(12778..12852) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(12887..12961) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA complement(12985..13069) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(13078..13154) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS complement(13535..15199) product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337077.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 gene asnB CDS complement(15596..16348) product ribonucleotide monophosphatase NagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153129.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 gene nagD CDS complement(16396..17616) product DNA-binding transcriptional regulator NagC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187594.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 gene nagC CDS complement(17625..18773) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271154.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene nagA CDS complement(18833..19633) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237072.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 gene nagB CDS 19966..21912 product PTS N-acetyl glucosamine transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023115.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene nagE CDS 22115..23779 product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287154.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 gene glnS CDS 24356..25762 product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258839.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 gene chiP CDS 25812..26138 product ChiQ/YbfN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733592.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 gene chiQ CDS complement(26222..26668) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131702.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 gene fur CDS complement(26957..27487) product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018618.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 gene fldA CDS complement(27627..27989) product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291238.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 gene ybfE CDS complement(28060..28824) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773301.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 gene ybfF CDS 29009..29554 product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848387.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 gene seqA CDS 29580..31220 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297249.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 gene pgm CDS 31464..31928 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856353.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS complement(31969..32619) product DUF2625 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017803196.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS complement(32968..34287) product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075845.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 gene potE CDS complement(34284..36482) product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040195.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 gene speF CDS 36605..36862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171592.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS complement(37078..37755) product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186076.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene kdpE CDS complement(37752..40436) product two-component system sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309343.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 gene kdpD CDS complement(40429..41001) product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309344.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 gene kdpC CDS complement(41010..43058) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087964.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 gene kdpB CDS complement(43081..44754) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741129.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 gene kdpA CDS 45156..45362 product YbfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424924.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 sequence36 source 1..42742 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 225..2414 product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497400.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS complement(2464..3666) product nucleoside permease NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376337.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene nupC CDS 4065..5240 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186369.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS complement(5381..5707) product DUF2502 domain-containing protein YpeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490072.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene ypeC CDS complement(5822..7078) product ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903148.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS 7282..8247 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170346.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene glk CDS 8466..8792 product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038456.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS 8814..10061 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985359.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS 10076..11161 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173288.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 gene ypdF CDS 11161..12198 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366028.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 gene ypdE CDS 12223..14718 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955906.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene ptsP CDS complement(14721..15578) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646844.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS complement(15591..16343) product two-component system response regulator YpdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091327.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 gene ypdB CDS complement(16340..18019) product two-component system sensor histidine kinase YpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544359.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 gene ypdA CDS 18414..19652 product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785931.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 gene alaC CDS complement(20144..21064) product kdo(2)-lipid IV(A) palmitoleoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484404.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 gene lpxP CDS 21417..21659 product YfdY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639883.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS complement(21736..22011) product colanic acid biosynthesis lipoprotein YpdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867637.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 gene ypdI CDS 22307..22939 product YfdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825604.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS 23452..24702 product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106759.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 gene frc CDS 24786..26450 product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283490.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 gene oxc CDS 26520..27464 product transporter YfdV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955028.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 gene yfdV CDS 27538..28683 product CoA:oxalate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296867.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 gene yfdE CDS complement(28739..32332) product acid-sensing system histidine kinase EvgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326970.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 gene evgS CDS complement(32337..32951) product acid-sensing system DNA-binding response regulator EvgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991370.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 gene evgA CDS 33367..34530 product multidrug efflux MFS transporter periplasmic adaptor subunit EmrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435167.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 gene emrK CDS 34530..36068 product multidrug efflux MFS transporter permease subunit EmrY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018714.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 gene emrY CDS complement(36176..37504) product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426427.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 gene dsdA CDS complement(37522..38859) product D-serine transporter DsdX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556048.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 gene dsdX CDS 39077..40012 product DNA-binding transcriptional regulator DsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326971.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 gene dsdC tRNA complement(40108..40182) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 CDS complement(40258..41190) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368140.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS 41484..42239 product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776768.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 gene mlaA CDS complement(42421..42633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34240 sequence37 source 1..41211 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 332..3025 product bifunctional chitinase/lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773156.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 gene chiA CDS 3194..3388 product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289085.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene bfd CDS 3460..3936 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675504.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 gene bfr CDS complement(3965..4642) product prepilin peptidase GspO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178154.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 gene gspO CDS complement(4642..5103) product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295161.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 gene gspM CDS complement(5100..6263) product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115238.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 gene gspL CDS complement(6278..7261) product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058522.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 gene gspK CDS complement(7254..7841) product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610634.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 gene gspJ CDS complement(7834..8193) product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041743.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 gene gspI CDS complement(8208..8717) product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076046.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 gene gspH CDS complement(8725..9162) product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202874.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 gene gspG CDS complement(9172..10368) product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109573.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 gene gspF CDS complement(10365..11846) product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219894.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 gene gspE CDS complement(11856..13820) product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326512.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 gene gspD CDS complement(13792..14607) product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142708.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 gene gspC CDS 14787..16256 product type II secretion system protein GspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107576.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 gene gspA CDS 16258..16677 product putative general secretion pathway protein GspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461450.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 gene gspB CDS 16915..17226 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181004.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 gene rpsJ CDS 17259..17888 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579833.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 gene rplC CDS 17899..18504 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424395.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 gene rplD CDS 18501..18803 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617544.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 gene rplW CDS 18821..19642 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301864.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene rplB CDS 19659..19937 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138117.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 gene rpsS CDS 19952..20284 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447529.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 gene rplV CDS 20302..21003 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529945.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 gene rpsC CDS 21016..21426 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941212.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 gene rplP CDS 21426..21617 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644741.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 gene rpmC CDS 21617..21871 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130100.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 gene rpsQ CDS 22036..22407 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613955.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 gene rplN CDS 22418..22732 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729185.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 gene rplX CDS 22747..23286 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096200.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 gene rplE CDS 23301..23606 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118930.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 gene rpsN CDS 23640..24032 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062611.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 gene rpsH CDS 24045..24578 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091945.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 gene rplF CDS 24588..24941 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358960.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 gene rplR CDS 24956..25459 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940121.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 gene rpsE CDS 25463..25642 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140433.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 gene rpmD CDS 25646..26080 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238917.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 gene rplO CDS 26088..27419 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118861.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene secY CDS 27714..28070 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090775.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 gene rpsM CDS 28087..28476 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029684.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 gene rpsK CDS 28510..29130 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135224.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 gene rpsD CDS 29156..30145 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162094.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 gene rpoA CDS 30186..30569 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216368.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 gene rplQ CDS 30676..31044 product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266486.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS 31055..31480 product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285607.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 gene zntR CDS 31536..31754 product alternative ribosome-rescue factor ArfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092696.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 gene arfA CDS complement(31751..32161) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022442.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 gene mscL CDS complement(32291..33667) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691382.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene trkA CDS complement(33689..34978) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744778.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 gene rsmB CDS complement(35024..35971) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004473.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 gene fmt CDS complement(35986..36495) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114984.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 gene def CDS 36625..37749 product DNA-protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228551.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 gene dprA CDS 37721..38194 product DUF494 family protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460680.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 gene smg CDS complement(38439..38675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS 38899..39342 product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301412.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 gene tsaC CDS 39347..40165 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451243.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 gene aroE CDS 40162..40419 product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070563.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS complement(40395..40949) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286216.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 sequence38 source 1..41003 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..523 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001001729.1:glycosyltransferase locus_tag LOCUS_34840 CDS 533..1225 product lipopolysaccharide core heptose(II) kinase RfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633087.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 gene rfaY CDS 1251..2276 product UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364799.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS 2361..3344 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064007.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS 3390..4643 product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602581.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS complement(4713..5693) product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264595.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 gene rfaC CDS complement(5697..6743) product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699223.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 gene rfaF CDS complement(6753..7685) product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587764.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 gene rfaD CDS 7899..9095 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213834.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 gene kbl CDS 9105..10130 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646014.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 gene tdh CDS 10369..11403 product UDP-glucuronate:LPS(HepIII) glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982115.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 gene waaH CDS complement(11390..12349) product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483856.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS complement(12353..13534) product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196256.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 gene envC CDS complement(13646..15190) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116565.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 gene gpmM CDS 15435..15866 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156181.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 16008..16259 product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024392.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 gene grxC CDS 16322..16789 product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003377.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 gene secB CDS 16789..17808 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076194.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 gene gpsA CDS 17888..18709 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277561.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 gene cysE CDS complement(18762..19235) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932346.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 gene trmL CDS complement(19389..20579) product quinone-dependent L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586962.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 gene lldD CDS complement(20576..21352) product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636500.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 gene lldR CDS complement(21352..23007) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297977.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 gene lldP CDS complement(23375..28225) product trimeric autotransporter adhesin EhaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033221.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 gene ehaG CDS complement(28269..28952) product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049544.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS complement(29496..29858) product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665680.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS 30143..30352 product protein YibT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517100.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 gene yibT CDS complement(30364..30951) product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228269.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 gene mtlR CDS complement(30951..32099) product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645420.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 gene mtlD CDS complement(32329..34242) product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093247.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 gene mtlA CDS 34779..35141 product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479624.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS 35144..36280 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364939.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS complement(36740..37177) product Imm57 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326561.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS complement(37266..37559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS complement(37884..38345) product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642490.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS complement(38357..39295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(39343..40185) product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072850.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 misc_feature complement(40206..>41003) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000015300.1:RHS element protein RhsA locus_tag LOCUS_35210 sequence39 source 1..40443 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2..457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS complement(1031..2260) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065950.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS 2516..3697 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656030.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS 3984..4820 product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383248.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 gene kduI CDS 4850..5611 product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603518.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 gene kduD CDS 5926..7344 product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256438.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 gene araE CDS 7473..8165 product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848664.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 gene ygeA CDS complement(8152..9087) product DNA-binding transcriptional regulator LysR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741825.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 gene lysR CDS 9209..10471 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120711.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 gene lysA CDS complement(10478..11509) product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201048.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 gene galR CDS 12095..14254 product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899069.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 gene aas CDS 14247..15440 product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004616.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 gene lplT CDS complement(15472..16512) product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199295.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS complement(16620..16838) product lipoprotein YgdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758655.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 gene ygdR CDS complement(16976..17689) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895624.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS complement(17758..18447) product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082201.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 gene mutH CDS 19132..19662 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564489.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 gene rppH CDS 19675..21921 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957914.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 gene ptsP CDS 22072..22947 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204658.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 gene lgt CDS 22954..23748 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816232.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 gene thyA CDS 23933..24403 product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS 24394..24957 product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144322.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS 24954..25361 product DUF2509 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078376.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS 25346..25669 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276460.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS 25682..29050 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946938.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 gene recC CDS 29226..32114 product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138152.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 gene ptrA CDS 32107..35649 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285993.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 gene recB CDS 35649..37475 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775955.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 gene recD CDS complement(37537..38868) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237947.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 gene argA CDS 39100..40353 product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016907.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 gene amiC sequence40 source 1..40196 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(649..1773) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216257.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS complement(1773..4508) product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149156.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 gene rbbA CDS complement(4505..5572) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361458.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS complement(5938..7560) product YhiJ/YhiL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393583.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS complement(7822..9429) product DUF4049 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862346.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS 9812..10864 product DUF2776 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028905.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS complement(11179..12381) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439170.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS 12613..14112 product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902780.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 gene pitA CDS complement(14356..14691) product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626187.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 gene uspB CDS 15082..15516 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323571.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 gene uspA CDS complement(15700..15879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS 15834..17303 product dipeptide/tripeptide permease DtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098647.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 gene dtpB CDS complement(17352..18104) product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686620.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 gene rsmJ CDS complement(18112..20154) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295214.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 gene prlC CDS 20357..21199 product 23S rRNA (adenine(2030)-N(6))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954225.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 gene rlmJ CDS 21271..22623 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160808.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 gene gorA CDS complement(22677..22826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS 22788..22961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004976829.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS 23500..23853 product As(III)-sensing metalloregulatory transcriptional repressor ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008957.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 gene arsR CDS 23907..25196 product arsenite/antimonite:H(+) antiporter ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922639.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 gene arsB CDS 25209..25634 product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065769.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 gene arsC CDS 26263..27486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020611.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS 27734..28300 product outer membrane lipoprotein Slp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242917.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 gene slp CDS 28456..28986 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478619.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS complement(29028..29603) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296814.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS complement(29739..30077) product acid-activated periplasmic chaperone HdeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540805.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene hdeB CDS complement(30181..30513) product acid-activated periplasmic chaperone HdeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756550.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 gene hdeA CDS 30768..31340 product acid-resistance protein HdeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965672.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 gene hdeD CDS 32139..32666 product acid resistance transcriptional activator GadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576690.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 gene gadE CDS 33053..34162 product multidrug transporter subunit MdtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081984.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 gene mdtE CDS 34187..37300 product multidrug efflux pump RND permease MdtF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024872.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 gene mdtF CDS complement(37663..38391) product acid resistance transcriptional activator GadW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149999.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 gene gadW sequence41 source 1..37828 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 191..418 product tautomerase PptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120143.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 gene pptA CDS complement(422..991) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085912.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS 1164..2009 product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187905.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 gene nhoA CDS complement(2105..2365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35870 note possible pseudo, internal stop codon CDS complement(2432..2998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35880 note possible pseudo, internal stop codon CDS complement(3077..3757) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617115.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 gene narI CDS complement(3754..4449) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166353.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 gene narW CDS complement(4449..5993) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702560.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 gene narH CDS complement(5990..9730) product nitrate reductase Z subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040458.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 gene narZ CDS complement(9812..11200) product nitrate/nitrite transporter NarU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207905.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 gene narU CDS complement(11524..11850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35940 note possible pseudo, frameshifted CDS complement(11898..12818) product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001407592.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS complement(12878..13168) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768384.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS complement(13427..14251) product aromatic amino acid efflux DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198214.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 gene yddG CDS 14540..17587 product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602782.1 transl_table 11 codon_start 1 transl_except (pos:15125..15127,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_35980 gene fdnG CDS 17600..18484 product formate dehydrogenase N subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240582.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 gene fdnH CDS 18477..19130 product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045648.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 gene fdnI CDS complement(19325..19609) product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781370.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS complement(19755..20765) product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642433.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 gene adhP CDS complement(20899..22596) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433476.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 gene maeA CDS complement(22753..22890) product stationary-phase-induced ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841554.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 gene sra CDS complement(22992..23207) product biofilm-dependent modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495771.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 gene bdm CDS complement(23349..23552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS 23552..23983 product peroxiredoxin OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152305.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 gene osmC CDS complement(24039..24965) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285536.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(24958..25944) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193547.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS complement(25941..26837) product D,D-dipeptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979608.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(26834..27856) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145123.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS complement(27858..29408) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830550.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS complement(29422..30003) product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285833.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 gene ddpX CDS complement(30261..32660) product oxygen-sensing cyclic-di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360132.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 gene dosP CDS complement(32685..34067) product diguanylate cyclase DosC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426279.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 gene dosC CDS complement(34444..35598) product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350395.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS complement(35894..37429) product acid resistance gamma-aminobutyrate antiporter GadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246019.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 gene gadC sequence42 source 1..37186 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1119..1736) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598857.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS 2003..3502 product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300590.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 gene ansP CDS complement(3617..4678) product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550675.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS 5004..7022 product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689363.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 gene pqqU CDS complement(7058..7723) product colanic acid/biofilm transcriptional regulator McbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300742.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 gene mcbR CDS complement(7921..8958) product NADPH-dependent curcumin/dihydrocurcumin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531452.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 gene curA CDS 9139..9657 product L-methionine sulfoximine/L-methionine sulfone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027563.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 gene mddA CDS 9654..10103 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076535.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS complement(10104..10337) product DUF2526 family protein YdcY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018633.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 gene ydcY CDS complement(10423..10671) product GhoT/OrtT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732115.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS complement(10983..12407) product aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163872.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 gene patD CDS complement(12429..13223) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555471.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS complement(13213..14154) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251315.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(14155..15168) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220396.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(15186..16331) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047424.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS complement(16576..17982) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760626.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS complement(18061..18498) product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209405.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 gene hicB CDS 18921..19151 product YncJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494244.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS complement(19243..21204) product 23S rRNA 5-hydroxycytidine C2501 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301045.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 gene rlhA CDS complement(21277..21813) product DNA-binding transcriptional regulator SutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429155.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 gene sutR CDS 21905..23080 product BenE family transporter YdcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236265.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 gene ydcO CDS complement(23120..24268) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251043.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS complement(24860..25528) product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261013.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS complement(25831..26424) product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586714.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 gene tehB CDS complement(26421..27413) product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301046.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 gene tehA CDS 27537..28517 product YdcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234048.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 gene ydcK CDS complement(28509..29048) product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140873.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 gene rimL CDS complement(29111..29335) product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296778.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS complement(29475..31094) product glucan biosynthesis protein OpgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375961.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 gene opgD CDS complement(31355..32698) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013789.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS 32996..33838 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414567.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS complement(33876..35516) product methyl-accepting chemotaxis protein Trg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098559.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 gene trg CDS 35915..36064 product type I toxin-antitoxin system toxin HokB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001320773.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 gene hokB CDS complement(36136..36309) product periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731833.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS complement(36554..37084) product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954775.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 gene cybB sequence43 source 1..34549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..641 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000847144.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme locus_tag LOCUS_36530 CDS complement(793..1524) product DNA-binding transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276847.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 gene frlR CDS complement(1624..2409) product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853353.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 gene frlD CDS complement(2406..3236) product fructoselysine 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847837.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 gene frlC CDS complement(3286..4308) product fructoselysine 6-phosphate deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295163.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 gene frlB CDS complement(4329..5666) product fructoselysine/psicoselysine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535505.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 gene frlA CDS complement(5961..6128) product YhfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031834.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS complement(6375..7748) product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349855.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 gene cysG CDS complement(7767..8573) product nitrite transporter NirC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493556.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 gene nirC CDS complement(8699..9025) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084764.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 gene nirD CDS complement(9022..11565) product NADPH-nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049208.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 gene nirB CDS complement(11827..13008) product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185232.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 gene tsgA CDS 13279..13851 product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477225.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 gene ppiA CDS 13956..14123 product YhfG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736860.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS 14113..14715 product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280623.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS 14747..15310 product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601847.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 gene pabA CDS 15396..16616 product bifunctional acetylornithine/succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963792.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 gene argD CDS complement(16683..18686) product YccS/YhfK family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484349.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS complement(18824..19456) product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242755.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 gene crp CDS 19758..20162 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148908.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS complement(20217..21086) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274680.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS complement(21140..21358) product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907085.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS complement(21352..22374) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057356.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS complement(22374..24287) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634798.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS 24418..24969 product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987657.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 gene kefG CDS 24969..26774 product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399122.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 gene kefB CDS 26784..26984 product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007730.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS 27079..27669 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861334.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 gene slyD CDS complement(27718..27936) product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153615.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS 28157..28969 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838264.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 gene fkpA CDS 29136..29858 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091466.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS 29858..30244 product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209689.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 gene tusD CDS 30244..30603 product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820720.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 gene tusC CDS 30611..30898 product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903377.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 gene tusB CDS 31024..31398 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001319024.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 gene rpsL CDS 31495..31965 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138043.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 gene rpsG CDS 32062..34176 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124700.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 gene fusA sequence44 source 1..34482 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 1724..1913 estimated_length known gap_type within scaffold linkage_evidence paired-ends rRNA 3042..3152 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 3170..3245 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 rRNA 3287..3397 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 CDS complement(3631..4389) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078349.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS complement(4397..5500) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300681.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS complement(5510..6709) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019655.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS complement(6759..7784) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738579.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS complement(8215..8436) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825639.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS complement(8689..11793) product multidrug efflux RND transporter permease subunit AcrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273212.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 gene acrF CDS complement(11805..12962) product multidrug efflux RND transporter periplasmic adaptor subunit AcrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160334.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 gene acrE CDS 13361..14023 product multidrug efflux transporter transcriptional repressor AcrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129518.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 gene acrS CDS complement(14026..14205) product DUF2556 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295275.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS complement(14289..15173) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258898.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 gene yhdJ CDS complement(15259..15555) product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 gene fis CDS complement(15581..16453) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219652.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 gene dusB CDS complement(16875..17756) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145827.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 gene prmA CDS complement(17768..19219) product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175728.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 gene panF CDS complement(19209..19451) product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381173.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS complement(19560..20909) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884639.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 gene accC CDS complement(20920..21390) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354622.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 gene accB CDS complement(21363..21551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS complement(22368..23342) product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148481.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS 23494..25434 product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241469.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 gene csrD CDS 25739..26782 product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913396.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 gene mreB CDS 26848..27951 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802516.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 gene mreC CDS 27951..28439 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179409.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 gene mreD CDS 28448..29041 product nucleoside triphosphate pyrophosphatase YhdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203105.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 gene yhdE CDS 29031..30500 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123197.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 gene rng CDS 30568..34368 product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253587.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 gene yhdP sequence45 source 1..30823 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 270..653 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275702.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 gene secE CDS 655..1200 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287516.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 gene nusG CDS 1359..1787 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085926.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 gene rplK CDS 1791..2495 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096684.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 gene rplA CDS 2908..3405 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207201.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 gene rplJ CDS 3472..3837 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028878.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 gene rplL CDS 4157..8185 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263098.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 gene rpoB CDS 8262..12485 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653944.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 gene rpoC CDS 12698..13237 product heat-shock protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307500.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS complement(13647..14780) product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847445.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 gene thiH CDS complement(14777..15547) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944103.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 gene thiG CDS complement(15549..15749) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166230.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 gene thiS CDS complement(15733..16488) product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999737.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 gene thiF CDS complement(16481..17116) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284615.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 gene thiE CDS complement(17116..19011) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276909.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 gene thiC CDS complement(19245..19721) product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934302.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 gene rsd CDS 19816..20589 product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373940.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 gene nudC CDS 20629..21693 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137657.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 gene hemE CDS 21703..22374 product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362388.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 gene nfi CDS 22417..23007 product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940106.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS 23194..23466 product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044513.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 gene hupA CDS 23539..24174 product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299291.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS complement(24176..24595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 24833..26209 product two-component system sensor histidine kinase ZraS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211933.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 gene zraS CDS 26206..27531 product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148503.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 gene zraR CDS complement(27528..28817) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866828.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 gene purD CDS complement(28829..30418) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187559.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 gene purH sequence46 source 1..29982 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 510..1445 product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207520.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 gene rihA CDS 1529..3199 product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367875.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 gene hscC CDS complement(3259..4398) product co-chaperone DjlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300403.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 gene djlC note possible pseudo, frameshifted CDS complement(4706..5413) product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367041.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS 5577..6089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37470 note possible pseudo, internal stop codon, frameshifted CDS 6162..6554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37480 note possible pseudo, internal stop codon, frameshifted CDS complement(6624..7106) product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044880.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS 7341..9923 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157890.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 gene leuS CDS 9938..10519 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269673.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 gene lptE CDS 10519..11550 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620503.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 gene holA CDS 11552..12193 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838889.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 gene nadD CDS 12217..12828 product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241888.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS 13088..13405 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161664.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 gene rsfS CDS 13409..13876 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776104.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 gene rlmH CDS 13907..15808 product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776191.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 gene mrdA CDS 15811..16923 product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131719.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 gene mrdB CDS 16934..18022 product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231428.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 gene rlpA CDS 18162..19373 product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092082.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 gene dacA CDS 19483..19746 product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850550.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 gene ybeD CDS 19847..20488 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284027.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 gene lipB CDS 20747..21700 product YbeF family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378026.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS 21909..22874 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042632.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 gene lipA CDS complement(22975..23178) product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503931.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 gene tatE CDS complement(23307..24095) product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959109.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS 24188..24571 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939738.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 gene crcB CDS complement(24626..24835) product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034825.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 gene cspE CDS complement(25004..25564) product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103094.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 gene pagP CDS 26152..27537 product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955063.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 gene dcuC CDS complement(27578..28258) product two-component response regulator DpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126500.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 gene dpiA CDS complement(28227..29885) product sensor histidine kinase DpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939766.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 gene dpiB sequence47 source 1..29932 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(314..2887) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235102.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 gene clpB CDS complement(3017..3748) product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040130.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 gene yfiH CDS complement(3745..4725) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079100.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 gene rluD CDS 4860..5597 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197686.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 gene bamD CDS 5868..6209 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178456.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 gene raiA CDS 6458..7618 product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200120.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 gene pheA CDS complement(7661..8782) product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225204.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 gene tyrA CDS complement(8793..9863) product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168045.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 gene aroF CDS 10073..10438 product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976004.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS 10588..11106 product YfiR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212391.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS 11096..12322 product diguanylate cyclase DgcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969032.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 gene dgcN CDS 12338..12820 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589828.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(12896..13243) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065253.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 gene rplS CDS complement(13285..14052) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264777.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 gene trmD CDS complement(14083..14631) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043335.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 gene rimM CDS complement(14650..14898) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256450.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 gene rpsP CDS complement(15035..16396) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460035.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene ffh CDS complement(16509..16745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS 16659..17354 product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001338897.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS 17399..18661 product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723175.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS complement(18716..19309) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296310.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 gene grpE CDS 19432..20310 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059169.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 gene nadK CDS 20396..22057 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880910.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 gene recN CDS 22206..22547 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203437.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 gene bamE CDS complement(22609..22899) product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117838.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS complement(22889..23365) product type II toxin-antitoxin system toxin RatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600189.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 gene ratA CDS 23497..23979 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162574.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 gene smpB tmRNA 24194..24556 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 24723..25952 product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815743.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 CDS 26235..27791 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102959.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS 27781..28677 product plasmid partitioning protein RepB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102958.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS 28674..29570 product plasmid partitioning protein RepB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338948.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 sequence48 source 1..29646 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 375..1352 product glutarate dioxygenase GlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993087.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 gene glaH CDS 1371..2639 product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271983.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 gene lhgO CDS 2662..4110 product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772884.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 gene gabD CDS 4124..5404 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097641.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 gene gabT CDS 5715..7115 product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301367.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 gene gabP CDS 7136..7798 product DNA-binding transcriptional regulator CsiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156811.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 gene csiR CDS complement(7799..8248) product potassium binding protein Kbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522424.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 gene kbp CDS complement(8332..8490) product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508177.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS 8673..8972 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137280.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS 8982..9506 product thiosulfate sulfurtransferase YgaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229442.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 gene ygaP CDS complement(9553..9957) product DNA-binding protein StpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115383.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 gene stpA CDS 10625..11074 product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492656.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 gene alaE CDS complement(11111..11455) product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281320.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS 11607..11936 product DUF883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295174.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS 12184..12429 product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223227.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 gene nrdH CDS 12426..12836 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080947.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 gene nrdI CDS 12848..14953 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246534.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 gene nrdE CDS 14963..15922 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777969.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 gene nrdF CDS 16276..17478 product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985494.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 gene proV CDS 17471..18535 product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774978.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 gene proW CDS 18593..19585 product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216521.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 gene proX CDS 19877..21061 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165699.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS 21185..21922 product L-valine exporter subunit YgaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445651.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 gene ygaZ CDS 21912..22247 product L-valine transporter subunit YgaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119763.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 gene ygaH CDS 22338..22868 product multidrug efflux transporter EmrAB transcriptional repressor EmrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378442.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 gene emrR CDS 22995..24167 product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295175.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 gene emrA CDS 24184..25722 product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295176.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 gene emrB CDS complement(25786..26301) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130211.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 gene luxS CDS complement(26451..28007) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611804.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 gene gshA CDS complement(28080..28508) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287454.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS complement(28505..29071) product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273290.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 gene yqaB tRNA complement(29352..29428) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 sequence49 source 1..28814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 332..1630 product alpha-ketoglutarate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841103.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 gene kgtP CDS complement(1627..1899) product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300818.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS complement(1996..3354) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949265.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 gene pssA CDS complement(3465..6125) product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082964.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 gene pat CDS complement(6157..6687) product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138184.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 gene tapT CDS complement(6924..7343) product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098717.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 gene trxC CDS 7550..8587 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997403.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS complement(8635..9324) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262720.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 gene ung CDS 9629..10012 product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627807.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 gene grcA CDS complement(10068..10655) product cysteine/O-acetylserine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189207.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 gene eamB CDS 10758..11639 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300638.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS complement(11848..13182) product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219193.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 gene srmB CDS 13314..14051 product tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295363.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 gene trmN CDS complement(14036..15658) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094279.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 gene nadB CDS 16066..16641 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295364.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 gene rpoE CDS 16674..17324 product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168459.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 gene rseA CDS 17324..18280 product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812053.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 gene rseB CDS 18277..18756 product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589070.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 gene rseC CDS 18954..20753 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790168.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 gene lepA CDS 20769..21743 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002542.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 gene lepB CDS 22082..22696 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068343.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 gene rnc CDS 22693..23598 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020749.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 gene era CDS 23610..24338 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399404.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 gene recO CDS 24350..25081 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297412.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 gene pdxJ CDS 25081..25461 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986023.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 gene acpS CDS complement(26156..26341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS complement(26472..27320) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013779.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 CDS 27529..28164 product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190655.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 gene yfhb CDS 28222..28725 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297409.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 gene tadA sequence50 source 1..28424 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 677..1273 product type 1 fimbria switch DNA invertase FimE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044711.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 gene fimE CDS 1755..2303 product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695564.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 gene fimA CDS 2410..2907 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824114.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS 2944..3669 product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066560.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 gene fimC CDS 3736..6372 product fimbrial usher FimD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121002.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 gene fimD CDS 6382..6912 product type 1 fimbria minor subunit FimF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244827.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 gene fimF CDS 6925..7428 product type 1 fimbria minor subunit FimG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870592.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 gene fimG CDS 7448..8350 product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832247.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 gene fimH CDS complement(8593..9936) product gluconate permease GntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558251.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 gene gntP CDS 10276..11460 product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438562.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 gene uxuA CDS 11541..13001 product fructuronate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208205.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS 13216..13989 product Uxu operon transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833679.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 gene uxuR CDS complement(14130..14960) product YjfZ/YjiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062552.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS 15774..16025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS complement(16018..16929) product hypochlorite stress DNA-binding transcriptional regulator HypT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340740.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 gene hypT CDS complement(16994..18166) product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568432.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 gene iadA CDS complement(18179..18640) product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211971.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS complement(18637..19332) product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513390.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS 19570..20124 product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151855.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 gene kptA CDS complement(20137..21315) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141220.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS complement(21383..22243) product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350572.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS complement(22308..22565) product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657675.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS complement(22562..23329) product putative 2-hydroxyacyl-CoA dehydratase activator YjiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331745.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 gene yjiL CDS complement(23339..24490) product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300012.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS complement(24606..25769) product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037419.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS complement(25927..27159) product multidrug efflux MFS transporter MdtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137036.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS 27638..28405 product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181202.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 sequence51 source 1..27097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 51..1091 product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029814.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS 1064..1693 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502941.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS complement(1694..2854) product methionine-oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183907.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 gene ybdL CDS 2963..4051 product hydroxycarboxylate dehydrogenase HcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120449.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 gene hcxA CDS complement(4061..4258) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460431.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS complement(4440..5534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38960 note possible pseudo, frameshifted CDS complement(5513..6535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38970 note possible pseudo, frameshifted CDS complement(6716..7129) product proofreading thioesterase EntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637953.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 gene entH CDS complement(7132..7878) product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase EntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347664.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 gene entA CDS complement(7878..8735) product enterobactin biosynthesis bifunctional isochorismatase/aryl carrier protein EntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007138.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 gene entB CDS complement(8749..10359) product (2,3-dihydroxybenzoyl)adenylate synthase EntE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026805.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 gene entE CDS complement(10369..11544) product isochorismate synthase EntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295313.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 gene entC CDS 11919..12875 product Fe2+-enterobactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234314.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 gene fepB CDS complement(12879..14129) product enterobactin transporter EntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041789.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 gene entS CDS 14240..15244 product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295314.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 gene fepD CDS 15241..16233 product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640988.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 gene fepG CDS 16230..17045 product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140647.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 gene fepC CDS complement(17042..18046) product LPS O-antigen length regulator Wzz(fepE) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096715.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 gene wzz(fepE) CDS complement(18391..22272) product enterobactin non-ribosomal peptide synthetase EntF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077805.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 gene entF CDS complement(22269..22487) product enterobactin biosynthesis protein YbdZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885798.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 gene ybdZ CDS complement(22490..23692) product enterochelin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125843.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 gene fes CDS 23936..26176 product siderophore enterobactin receptor FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034943.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 gene fepA CDS 26342..26971 product enterobactin synthase subunit EntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001749708.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 gene entD sequence52 source 1..22755 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 128..1090 product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018416.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 gene tauA CDS 1103..1870 product taurine ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939394.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 gene tauB CDS 1867..2694 product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114575.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 gene tauC CDS 2691..3542 product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004024.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 gene tauD CDS complement(3649..4623) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295337.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 gene hemB CDS 5146..8052 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556441.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS 8140..8763 product hydrogen peroxide resistance inhibitor IprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295335.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 gene iprA CDS complement(8764..9921) product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830741.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 gene ampH CDS 10273..11493 product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001342332.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 gene sbmA CDS 11506..12600 product surface-exposed outer membrane lipoprotein YaiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092069.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 gene yaiW CDS complement(12659..12967) product YaiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763151.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS 13227..13439 product DUF2754 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295334.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS complement(13463..14557) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413677.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 gene ddlA CDS 15020..15280 product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792970.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 gene iraP CDS 15381..16796 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814404.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 gene phoA CDS 16915..17235 product phosphate starvation-inducible protein PsiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295332.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 gene psiF CDS 17337..18452 product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484048.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 gene adrA CDS complement(18469..19278) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295331.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 gene proC CDS 19398..19856 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158159.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS 20096..20563 product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193393.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 gene aroL CDS 20613..20804 product protein YaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142439.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 gene yaiA CDS 21062..21739 product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276420.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS 21898..22095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS 22303..22584 product DUF2773 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942006.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 sequence53 source 1..19402 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(90..491) product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174677.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 gene crl CDS complement(549..1793) product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189541.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 gene frsA CDS complement(1885..2343) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291990.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 gene gpt CDS 2604..4061 product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293009.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 gene pepD CDS complement(4118..4618) product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602135.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 gene prfH CDS complement(4587..4853) product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303804.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS complement(5087..5539) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059883.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS complement(5549..5947) product type II toxin-antitoxin system mRNA interferase toxin YafO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263491.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 gene yafO CDS complement(5950..6243) product type I toxin-antitoxin system antitoxin YafN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554757.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 gene yafN CDS complement(6295..7350) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226164.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 gene dinB CDS complement(7421..8191) product putative lateral flagellar export/assembly protein LafU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207556.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 gene lafU CDS 8151..9890 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301901.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS complement(10106..10603) product REP-associated tyrosine transposase RayT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006255.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 gene rayT CDS complement(10779..11405) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001389087.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS 11443..11610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS 11738..11998 product type II toxin-antitoxin system antitoxin DinJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729704.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 gene dinJ CDS 12001..12279 product type II toxin-antitoxin system mRNA interferase toxin YafQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615980.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 gene yafQ CDS 12435..13175 product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225679.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 gene dpaA CDS complement(13146..13913) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333379.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS complement(14119..14697) product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284050.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 gene lpcA CDS 14937..17381 product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973083.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 gene fadE CDS complement(17424..17897) product Ivy family C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532698.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 gene ivy CDS 18051..18821 product 2-oxoglutaramate amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118036.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 gene yafV misc_feature complement(18862..>19402) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000420980.1:ISAs1-like element ISEc1 family transposase locus_tag LOCUS_39610 sequence54 source 1..19145 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 258..1325 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678646.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 gene mltA CDS 1564..2370 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117728.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 gene tcdA CDS complement(2421..2864) product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184261.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 gene csdE CDS complement(2864..4069) product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300698.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 gene csdA CDS 4261..4488 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750398.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS 4839..5756 product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044401.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 gene gcvA CDS 5775..6170 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203905.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS 6163..7263 product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045520.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 gene rlmM CDS complement(7307..8038) product L-fucose operon activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642344.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 gene fucR CDS complement(8096..8518) product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920840.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 gene fucU CDS complement(8520..9938) product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808376.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 gene fucK CDS complement(10047..11822) product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724153.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 gene fucI CDS 12292..13791 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 gene gguA CDS 13795..14778 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS 14852..15802 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS 15855..17435 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210047.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS 17500..18498 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232704.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS 18631..19104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39790 sequence55 source 1..16394 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(529..963) product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300461.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 gene uspF CDS complement(1104..2237) product porin OmpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837902.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 gene ompN CDS complement(2604..6128) product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628222.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 gene nifJ CDS 6402..6668 product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295715.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS complement(6665..7087) product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298828.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 gene hslJ CDS complement(7198..8187) product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762229.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 gene ldhA CDS 8395..11034 product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900912.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS 11031..11216 product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698145.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS 11281..11550 product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296730.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS complement(11722..12627) product transcriptional regulator FeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067514.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 gene feaR CDS 12863..14362 product phenylacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138615.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 gene feaB misc_feature complement(14421..>16394) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000535469.1:primary-amine oxidase locus_tag LOCUS_39910 sequence56 source 1..16305 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 135..1136 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048667.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 gene gap CDS complement(1178..2617) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115947.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 gene aldA CDS complement(2814..3614) product DUF218 domain-containing protein YdcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027967.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 gene ydcF CDS complement(3886..7788) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139614.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 gene hrpA CDS 7989..8594 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048948.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 gene azoR CDS complement(8645..9913) product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001391902.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS complement(9951..11537) product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431845.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS complement(11724..12620) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890941.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS complement(12620..13087) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177515.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS complement(13396..15702) product DUF2773 domain-containing bactofilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471490.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 misc_feature complement(15766..>16305) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000097801.1:pyridoxine 4-dehydrogenase locus_tag LOCUS_40020 sequence57 source 1..15537 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(191..973) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082780.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS complement(990..1622) product ribulose-phosphate 3 epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600622.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS complement(1634..2065) product SgcA family PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606406.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 gene sgcA CDS complement(2196..3002) product BtpA family protein SgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118626.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 gene sgcQ CDS complement(3015..4328) product PTS sugar transporter subunit IIC SgcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460843.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 gene sgcC CDS complement(4340..4618) product PTS sugar transporter subunit IIB SgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722973.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 gene sgcB CDS complement(4615..5736) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010829.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS complement(6522..7268) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354251.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS complement(7324..7869) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309181.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS complement(7881..8138) product YjhX family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054376.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS 8924..9133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40130 note possible pseudo, internal stop codon, frameshifted CDS 9100..9276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40140 note possible pseudo, internal stop codon, frameshifted CDS 9292..10116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40150 note possible pseudo, internal stop codon, frameshifted CDS complement(10699..11706) product 9-O-acetyl-N-acetylneuraminic acid deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991438.1 transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS complement(11744..12850) product N-acetylneuraminate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309184.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 gene nanM CDS complement(12870..13586) product N-acetylneuraminic acid outer membrane channel NanC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295734.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 gene nanC sequence58 source 1..15037 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(748..2196) product Cu(+)/Ag(+) sensor histidine kinase CusS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253826.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 gene cusS CDS complement(2186..2869) product copper response regulator transcription factor CusR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770953.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 gene cusR CDS 3026..4399 product Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074237.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 gene cusC CDS 4557..4889 product Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709865.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 gene cusF CDS 4905..6128 product Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717157.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 gene cusB CDS 6140..9283 product Cu(+)/Ag(+) efflux RND transporter permease subunit CusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573945.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 gene cusA CDS 9349..10761 product phenylalanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786320.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 gene pheP CDS complement(10829..12076) product mechanosensitive ion channel YbdG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153148.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 gene ybdG CDS complement(12184..12837) product oxygen-insensitive NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351464.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 gene nfsB CDS complement(12931..13299) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360951.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS complement(13364..13564) product DUF1158 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682524.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS complement(13678..14796) product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130654.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 sequence59 source 1..14653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2412 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000290535.1:prophage tail fiber N-terminal domain-containing protein locus_tag LOCUS_40310 CDS 2409..2690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654151.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS 2700..3404 product tail fiber domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235980.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 CDS 3415..3708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640154.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 CDS 4384..5133 product DNA-binding transcriptional activator AppY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386784.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 gene appY CDS complement(5382..6335) product omptin family outer membrane protease OmpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201845.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 gene ompT CDS complement(6849..7610) product DNA-binding transcriptional regulator EnvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177464.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 gene envY CDS complement(7793..8683) product DUF4434 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224568.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS complement(8684..11656) product bacteriophage adsorption protein NfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662366.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 gene nfrA CDS complement(11643..13295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40400 note possible pseudo, internal stop codon CDS complement(13302..13880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40410 note possible pseudo, internal stop codon misc_feature complement(14151..>14653) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_097335731.1:ISAs1 family transposase locus_tag LOCUS_40420 sequence60 source 1..14212 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(35..808) product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913829.1 transl_table 11 codon_start 1 locus_tag LOCUS_40430 gene dsbG CDS 1180..1743 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052796.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 gene ahpC CDS 1988..3553 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887629.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 gene ahpF CDS complement(3674..4102) product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278509.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 gene uspG CDS 4323..5561 product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646173.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 CDS complement(5792..6202) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089731.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 gene rnk CDS complement(6432..7238) product ribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643397.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 gene rna CDS complement(7352..8815) product citrate/succinate antiporter CitT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050323.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 gene citT CDS complement(8866..9744) product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062457.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 gene citG CDS complement(9719..10270) product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550422.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 gene citX CDS complement(10274..11806) product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192245.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 gene citF CDS complement(11817..12725) product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622357.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 gene citE CDS complement(12722..13018) product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700701.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 gene citD CDS complement(13033..14091) product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467705.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 gene citC sequence61 source 1..13734 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1139..1993) product tagatose-bisphosphate aldolase subunit GatY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307281.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 gene gatY CDS complement(2293..3345) product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129551.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 gene fbaB CDS 3602..4879 product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858484.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS 4876..5880 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846217.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS 5877..6842 product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012001.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS complement(6816..7562) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434038.1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS complement(7614..8432) product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297420.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 CDS complement(8497..9297) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822274.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 gene thiD CDS complement(9294..10082) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195564.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 gene thiM CDS 10405..10650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141034.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS 10697..11128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS complement(11232..11897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS complement(11857..12021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098602.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS complement(12091..12282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40700 sequence62 source 1..9408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 183..986 product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997036.1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 gene dkgB CDS complement(983..1897) product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648586.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 gene yafC CDS 2138..2938 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230983.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS 2942..3565 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016007.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS complement(3613..4767) product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644685.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 gene mltD CDS complement(5043..5798) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052715.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 gene gloB CDS 5832..6554 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307587.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS complement(6551..7018) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917883.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 gene rnhA CDS 7083..7814 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001366128.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 gene dnaQ tRNA 7947..8023 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 CDS 8353..9138 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086141.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 sequence63 source 1..8535 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 380..1072 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131164.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS 1095..2522 product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280852.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 gene mdtD CDS complement(2488..3480) product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224470.1 transl_table 11 codon_start 1 locus_tag LOCUS_40830 gene rbsR CDS complement(3484..4428) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354235.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 gene rbsK CDS complement(4539..5429) product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056273.1 transl_table 11 codon_start 1 locus_tag LOCUS_40850 gene rbsB CDS complement(5454..6419) product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211858.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 gene rbsC CDS complement(6424..7929) product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387770.1 transl_table 11 codon_start 1 locus_tag LOCUS_40870 gene rbsA CDS complement(7937..8356) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715936.1 transl_table 11 codon_start 1 locus_tag LOCUS_40880 gene rbsD sequence64 source 1..7651 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 74..1009 product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865568.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 gene ompC CDS 1121..2176 product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406064.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 gene apbE CDS complement(2298..2516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS 2499..3314 product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710375.1 transl_table 11 codon_start 1 locus_tag LOCUS_40920 gene ada CDS 3314..3964 product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884972.1 transl_table 11 codon_start 1 locus_tag LOCUS_40930 gene alkB CDS 4040..5683 product microcin J25 efflux ABC transporter YojI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422182.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 gene yojI CDS 5901..7547 product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758086.1 transl_table 11 codon_start 1 locus_tag LOCUS_40950 gene mqo sequence65 source 1..4331 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(418..493) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA complement(500..574) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA complement(691..775) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA complement(784..859) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 CDS 1245..2171 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023081.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 gene coaA CDS complement(2200..3165) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654614.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 gene birA CDS complement(3162..4190) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016672.1 transl_table 11 codon_start 1 locus_tag LOCUS_40980 gene murB sequence66 source 1..4203 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(811..2814) product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130624425.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 gene betT CDS complement(2962..3402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS complement(3816..4118) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083824.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 sequence67 source 1..4035 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1990 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_181890839.1:prophage tail fiber N-terminal domain-containing protein locus_tag LOCUS_41020 CDS 1990..2271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654151.1 transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS 2281..2985 product tail fiber domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235984.1 transl_table 11 codon_start 1 locus_tag LOCUS_41040 assembly_gap 3259..3413 estimated_length known gap_type within scaffold linkage_evidence paired-ends