>Feature sequence01 608 321 gene locus_tag LOCUS_00010 gene yghW 608 321 CDS product DUF2623 family protein YghW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059139.1 protein_id gnl|my_center|LOCUS_00010 1614 727 gene locus_tag LOCUS_00020 gene yghX 1614 727 CDS product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005010978.1 protein_id gnl|my_center|LOCUS_00020 1771 2811 gene locus_tag LOCUS_00030 gene gpr 1771 2811 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262172.1 protein_id gnl|my_center|LOCUS_00030 3345 2851 gene locus_tag LOCUS_00040 3345 2851 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439331.1 protein_id gnl|my_center|LOCUS_00040 3536 4420 gene locus_tag LOCUS_00050 gene yghA 3536 4420 CDS product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018760.1 protein_id gnl|my_center|LOCUS_00050 5117 4692 gene locus_tag LOCUS_00060 gene exbD 5117 4692 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240712.1 protein_id gnl|my_center|LOCUS_00060 5858 5124 gene locus_tag LOCUS_00070 gene exbB 5858 5124 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527844.1 protein_id gnl|my_center|LOCUS_00070 6110 7297 gene locus_tag LOCUS_00080 gene metC 6110 7297 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001320425.1 protein_id gnl|my_center|LOCUS_00080 7437 8096 gene locus_tag LOCUS_00090 gene yghB 7437 8096 CDS product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268419.1 protein_id gnl|my_center|LOCUS_00090 9035 8136 gene locus_tag LOCUS_00100 gene yqhC 9035 8136 CDS product DNA-binding transcriptional regulator YqhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298382.1 protein_id gnl|my_center|LOCUS_00100 9229 10392 gene locus_tag LOCUS_00110 gene yqhD 9229 10392 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058802.1 protein_id gnl|my_center|LOCUS_00110 10497 11324 gene locus_tag LOCUS_00120 gene dkgA 10497 11324 CDS product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013149.1 protein_id gnl|my_center|LOCUS_00120 11524 12450 gene locus_tag LOCUS_00130 11524 12450 CDS product YbjP/YqhG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691619.1 protein_id gnl|my_center|LOCUS_00130 12501 12758 gene locus_tag LOCUS_00140 gene yqhH 12501 12758 CDS product lipoprotein YqhH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848528.1 protein_id gnl|my_center|LOCUS_00140 15020 12801 gene locus_tag LOCUS_00150 15020 12801 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095154.1 protein_id gnl|my_center|LOCUS_00150 16543 15131 gene locus_tag LOCUS_00160 gene ftsP 16543 15131 CDS product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059388.1 protein_id gnl|my_center|LOCUS_00160 17355 16618 gene locus_tag LOCUS_00170 gene plsC 17355 16618 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965712.1 protein_id gnl|my_center|LOCUS_00170 19847 17589 gene locus_tag LOCUS_00180 gene parC 19847 17589 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281881.1 protein_id gnl|my_center|LOCUS_00180 21592 19985 gene locus_tag LOCUS_00190 21592 19985 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295629.1 protein_id gnl|my_center|LOCUS_00190 22120 21725 gene locus_tag LOCUS_00200 gene mqsA 22120 21725 CDS product type II toxin-antitoxin system antitoxin MqsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650107.1 protein_id gnl|my_center|LOCUS_00200 22418 22122 gene locus_tag LOCUS_00210 gene mqsR 22418 22122 CDS product type II toxin-antitoxin system toxin MqsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415584.1 protein_id gnl|my_center|LOCUS_00210 23105 22623 gene locus_tag LOCUS_00220 23105 22623 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183505.1 protein_id gnl|my_center|LOCUS_00220 23550 23158 gene locus_tag LOCUS_00230 gene ygiW 23550 23158 CDS product OB fold stress tolerance protein YgiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712658.1 protein_id gnl|my_center|LOCUS_00230 23702 24361 gene locus_tag LOCUS_00240 gene qseB 23702 24361 CDS product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221493.1 protein_id gnl|my_center|LOCUS_00240 24358 25707 gene locus_tag LOCUS_00250 gene qseC 24358 25707 CDS product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673402.1 protein_id gnl|my_center|LOCUS_00250 26085 25753 gene locus_tag LOCUS_00260 26085 25753 CDS product DUF2645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917684.1 protein_id gnl|my_center|LOCUS_00260 26404 26985 gene locus_tag LOCUS_00270 gene mdaB 26404 26985 CDS product NADPH:quinone oxidoreductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065430.1 protein_id gnl|my_center|LOCUS_00270 27016 27330 gene locus_tag LOCUS_00280 27016 27330 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958598.1 protein_id gnl|my_center|LOCUS_00280 29270 27378 gene locus_tag LOCUS_00290 gene parE 29270 27378 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195296.1 protein_id gnl|my_center|LOCUS_00290 29880 29299 gene locus_tag LOCUS_00300 gene yqiA 29880 29299 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105733.1 protein_id gnl|my_center|LOCUS_00300 30707 29880 gene locus_tag LOCUS_00310 gene cpdA 30707 29880 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444747.1 protein_id gnl|my_center|LOCUS_00310 31154 30732 gene locus_tag LOCUS_00320 31154 30732 CDS product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833393.1 protein_id gnl|my_center|LOCUS_00320 31784 31155 gene locus_tag LOCUS_00330 gene nudF 31784 31155 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917117.1 protein_id gnl|my_center|LOCUS_00330 31989 33470 gene locus_tag LOCUS_00340 gene tolC 31989 33470 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735278.1 protein_id gnl|my_center|LOCUS_00340 33747 34289 gene locus_tag LOCUS_00350 33747 34289 CDS product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831543.1 protein_id gnl|my_center|LOCUS_00350 34295 35455 gene locus_tag LOCUS_00360 34295 35455 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442860.1 protein_id gnl|my_center|LOCUS_00360 36308 35493 gene locus_tag LOCUS_00370 gene ygiD 36308 35493 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188362.1 protein_id gnl|my_center|LOCUS_00370 36424 37197 gene locus_tag LOCUS_00380 gene zupT 36424 37197 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295627.1 protein_id gnl|my_center|LOCUS_00380 37425 37255 gene locus_tag LOCUS_00390 gene yqiD 37425 37255 CDS product protein YqiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469266.1 protein_id gnl|my_center|LOCUS_00390 38340 37687 gene locus_tag LOCUS_00400 gene ribB 38340 37687 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076997.1 protein_id gnl|my_center|LOCUS_00400 38714 39004 gene locus_tag LOCUS_00410 gene ubiK 38714 39004 CDS product ubiquinone biosynthesis accessory factor UbiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222100.1 protein_id gnl|my_center|LOCUS_00410 39288 39839 gene locus_tag LOCUS_00420 39288 39839 CDS product fimbrial-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272145.1 protein_id gnl|my_center|LOCUS_00420 39890 42403 gene locus_tag LOCUS_00430 39890 42403 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277116.1 protein_id gnl|my_center|LOCUS_00430 42419 43168 gene locus_tag LOCUS_00440 42419 43168 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269824.1 protein_id gnl|my_center|LOCUS_00440 43170 44234 gene locus_tag LOCUS_00450 43170 44234 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269802.1 protein_id gnl|my_center|LOCUS_00450 44477 44277 gene locus_tag LOCUS_00460 gene glgS 44477 44277 CDS product cell surface composition regulator GlgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350095.1 protein_id gnl|my_center|LOCUS_00460 44746 45375 gene locus_tag LOCUS_00470 44746 45375 CDS product DUF1449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599926.1 protein_id gnl|my_center|LOCUS_00470 45402 47063 gene locus_tag LOCUS_00480 45402 47063 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000341044.1 protein_id gnl|my_center|LOCUS_00480 49289 47856 gene locus_tag LOCUS_00490 gene hldE 49289 47856 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869178.1 protein_id gnl|my_center|LOCUS_00490 52177 49337 gene locus_tag LOCUS_00500 gene glnE 52177 49337 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301081.1 protein_id gnl|my_center|LOCUS_00500 53501 52200 gene locus_tag LOCUS_00510 gene ygiF 53501 52200 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046281.1 protein_id gnl|my_center|LOCUS_00510 53743 54363 gene locus_tag LOCUS_00520 53743 54363 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125331.1 protein_id gnl|my_center|LOCUS_00520 54427 55665 gene locus_tag LOCUS_00530 gene cca 54427 55665 CDS product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708487.1 protein_id gnl|my_center|LOCUS_00530 56649 55828 gene locus_tag LOCUS_00540 gene bacA 56649 55828 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281927.1 protein_id gnl|my_center|LOCUS_00540 57111 56740 gene locus_tag LOCUS_00550 gene folB 57111 56740 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295541.1 protein_id gnl|my_center|LOCUS_00550 57213 57830 gene locus_tag LOCUS_00560 gene plsY 57213 57830 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272796.1 protein_id gnl|my_center|LOCUS_00560 58775 57843 gene locus_tag LOCUS_00570 gene ttdR 58775 57843 CDS product DNA-binding transcriptional activator TtdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935206.1 protein_id gnl|my_center|LOCUS_00570 58982 59893 gene locus_tag LOCUS_00580 gene ttdA 58982 59893 CDS product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986797.1 protein_id gnl|my_center|LOCUS_00580 59890 60495 gene locus_tag LOCUS_00590 gene ttdB 59890 60495 CDS product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722957.1 protein_id gnl|my_center|LOCUS_00590 60543 62006 gene locus_tag LOCUS_00600 gene ttdT 60543 62006 CDS product L-tartrate/succinate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804973.1 protein_id gnl|my_center|LOCUS_00600 63062 62049 gene locus_tag LOCUS_00610 gene tsaD 63062 62049 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264352.1 protein_id gnl|my_center|LOCUS_00610 63300 63515 gene locus_tag LOCUS_00620 gene rpsU 63300 63515 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 protein_id gnl|my_center|LOCUS_00620 63626 65371 gene locus_tag LOCUS_00630 gene dnaG 63626 65371 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918827.1 protein_id gnl|my_center|LOCUS_00630 65566 67407 gene locus_tag LOCUS_00640 gene rpoD 65566 67407 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437371.1 protein_id gnl|my_center|LOCUS_00640 67992 67486 gene locus_tag LOCUS_00650 gene mug 67992 67486 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228937.1 protein_id gnl|my_center|LOCUS_00650 68117 68192 gene locus_tag LOCUS_t00010 68117 68192 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 69010 68246 gene locus_tag LOCUS_00660 gene nfeF 69010 68246 CDS product NADPH-dependent ferric chelate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066494.1 protein_id gnl|my_center|LOCUS_00660 69298 69921 gene locus_tag LOCUS_00670 gene nfeR 69298 69921 CDS product DNA-binding transcriptional regulator NfeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018003.1 protein_id gnl|my_center|LOCUS_00670 71595 70075 gene locus_tag LOCUS_00680 gene aer 71595 70075 CDS product aerotaxis sensor receptor Aer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094721.1 protein_id gnl|my_center|LOCUS_00680 72103 73392 gene locus_tag LOCUS_00690 gene ygjG 72103 73392 CDS product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301395.1 protein_id gnl|my_center|LOCUS_00690 73766 73434 gene locus_tag LOCUS_00700 73766 73434 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450594.1 protein_id gnl|my_center|LOCUS_00700 73985 74968 gene locus_tag LOCUS_00710 gene ebgR 73985 74968 CDS product transcriptional regulator EbgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212475.1 protein_id gnl|my_center|LOCUS_00710 75152 78244 gene locus_tag LOCUS_00720 gene ebgA 75152 78244 CDS product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082856.1 protein_id gnl|my_center|LOCUS_00720 78241 78690 gene locus_tag LOCUS_00730 78241 78690 CDS product beta-galactosidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219954.1 protein_id gnl|my_center|LOCUS_00730 78753 80186 gene locus_tag LOCUS_00740 78753 80186 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285432.1 protein_id gnl|my_center|LOCUS_00740 80320 81390 gene locus_tag LOCUS_00750 gene ygjJ 80320 81390 CDS product protein YgjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767652.1 protein_id gnl|my_center|LOCUS_00750 81407 83758 gene locus_tag LOCUS_00760 gene ygjK 81407 83758 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695487.1 protein_id gnl|my_center|LOCUS_00760 84184 86202 gene locus_tag LOCUS_00770 gene fadH 84184 86202 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121433.1 protein_id gnl|my_center|LOCUS_00770 86663 86247 gene locus_tag LOCUS_00780 gene higA 86663 86247 CDS product type II toxin-antitoxin system antitoxin HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560266.1 protein_id gnl|my_center|LOCUS_00780 86974 86660 gene locus_tag LOCUS_00790 gene higB 86974 86660 CDS product type II toxin-antitoxin system toxin HigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550189.1 protein_id gnl|my_center|LOCUS_00790 88394 87258 gene locus_tag LOCUS_00800 gene rlmG 88394 87258 CDS product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018695.1 protein_id gnl|my_center|LOCUS_00800 88479 88982 gene locus_tag LOCUS_00810 88479 88982 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295542.1 protein_id gnl|my_center|LOCUS_00810 89059 89751 gene locus_tag LOCUS_00820 89059 89751 CDS product vancomycin high temperature exclusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942548.1 protein_id gnl|my_center|LOCUS_00820 89812 90816 gene locus_tag LOCUS_00830 89812 90816 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456357.1 protein_id gnl|my_center|LOCUS_00830 91099 92064 gene locus_tag LOCUS_00840 gene alx 91099 92064 CDS product TerC family membrane protein Alx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098805.1 protein_id gnl|my_center|LOCUS_00840 92403 92245 gene locus_tag LOCUS_00850 92403 92245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 92680 93924 gene locus_tag LOCUS_00860 gene sstT 92680 93924 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211656.1 protein_id gnl|my_center|LOCUS_00860 94480 93929 gene locus_tag LOCUS_00870 94480 93929 CDS product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128136.1 protein_id gnl|my_center|LOCUS_00870 96050 94563 gene locus_tag LOCUS_00880 gene uxaA 96050 94563 CDS product altronate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199352.1 protein_id gnl|my_center|LOCUS_00880 97477 96065 gene locus_tag LOCUS_00890 gene uxaC 97477 96065 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187442.1 protein_id gnl|my_center|LOCUS_00890 97960 99258 gene locus_tag LOCUS_00900 gene exuT 97960 99258 CDS product hexuronate transporter ExuT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226465.1 protein_id gnl|my_center|LOCUS_00900 99388 100164 gene locus_tag LOCUS_00910 gene exuR 99388 100164 CDS product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406488.1 protein_id gnl|my_center|LOCUS_00910 100509 101171 gene locus_tag LOCUS_00920 gene yqjA 100509 101171 CDS product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422149.1 protein_id gnl|my_center|LOCUS_00920 101175 101558 gene locus_tag LOCUS_00930 gene mzrA 101175 101558 CDS product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166760.1 protein_id gnl|my_center|LOCUS_00930 101705 102073 gene locus_tag LOCUS_00940 gene yqjC 101705 102073 CDS product DUF1090 family protein YqjC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295543.1 protein_id gnl|my_center|LOCUS_00940 102111 102416 gene locus_tag LOCUS_00950 102111 102416 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031415.1 protein_id gnl|my_center|LOCUS_00950 102419 102823 gene locus_tag LOCUS_00960 102419 102823 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785722.1 protein_id gnl|my_center|LOCUS_00960 102813 103112 gene locus_tag LOCUS_00970 102813 103112 CDS product YqjK-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096086.1 protein_id gnl|my_center|LOCUS_00970 103298 103690 gene locus_tag LOCUS_00980 103298 103690 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732240.1 protein_id gnl|my_center|LOCUS_00980 103760 104746 gene locus_tag LOCUS_00990 gene yqjG 103760 104746 CDS product glutathionyl-hydroquinone reductase YqjG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531205.1 protein_id gnl|my_center|LOCUS_00990 105039 105404 gene locus_tag LOCUS_01000 105039 105404 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384145.1 protein_id gnl|my_center|LOCUS_01000 105646 106002 gene locus_tag LOCUS_01010 105646 106002 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198807.1 protein_id gnl|my_center|LOCUS_01010 106949 106053 gene locus_tag LOCUS_01020 gene yhaJ 106949 106053 CDS product DNA-binding transcriptional regulator YhaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041010.1 protein_id gnl|my_center|LOCUS_01020 107054 107755 gene locus_tag LOCUS_01030 107054 107755 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633576.1 protein_id gnl|my_center|LOCUS_01030 107778 107942 gene locus_tag LOCUS_01040 gene yhaL 107778 107942 CDS product protein YhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295544.1 protein_id gnl|my_center|LOCUS_01040 109386 108076 gene locus_tag LOCUS_01050 gene cyuA 109386 108076 CDS product cysteine desulfidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460514.1 protein_id gnl|my_center|LOCUS_01050 110745 109414 gene locus_tag LOCUS_01060 110745 109414 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401598.1 protein_id gnl|my_center|LOCUS_01060 112385 111021 gene locus_tag LOCUS_01070 gene tdcG 112385 111021 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622126.1 protein_id gnl|my_center|LOCUS_01070 112846 112457 gene locus_tag LOCUS_01080 112846 112457 CDS product enamine/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719990.1 protein_id gnl|my_center|LOCUS_01080 115154 112860 gene locus_tag LOCUS_01090 gene tdcE 115154 112860 CDS product 2-ketobutyrate formate-lyase/pyruvate formate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861734.1 protein_id gnl|my_center|LOCUS_01090 116396 115188 gene locus_tag LOCUS_01100 gene tdcD 116396 115188 CDS product propionate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295545.1 protein_id gnl|my_center|LOCUS_01100 117753 116422 gene locus_tag LOCUS_01110 gene tdcC 117753 116422 CDS product threonine/serine transporter TdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107723.1 protein_id gnl|my_center|LOCUS_01110 118764 117775 gene locus_tag LOCUS_01120 gene tdcB 118764 117775 CDS product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548347.1 protein_id gnl|my_center|LOCUS_01120 119801 118863 gene locus_tag LOCUS_01130 gene tdcA 119801 118863 CDS product transcriptional regulator TdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104211.1 protein_id gnl|my_center|LOCUS_01130 120590 121129 gene locus_tag LOCUS_01140 gene yhaB 120590 121129 CDS product protein YhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675733.1 protein_id gnl|my_center|LOCUS_01140 121151 122254 gene locus_tag LOCUS_01150 121151 122254 CDS product YhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484600.1 protein_id gnl|my_center|LOCUS_01150 124401 123256 gene locus_tag LOCUS_01160 gene garK 124401 123256 CDS product glycerate 2-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300387.1 protein_id gnl|my_center|LOCUS_01160 125397 124498 gene locus_tag LOCUS_01170 gene garR 125397 124498 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566608.1 protein_id gnl|my_center|LOCUS_01170 126188 125418 gene locus_tag LOCUS_01180 gene garL 126188 125418 CDS product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058209.1 protein_id gnl|my_center|LOCUS_01180 127538 126204 gene locus_tag LOCUS_01190 gene garP 127538 126204 CDS product galactarate/glucarate/glycerate transporter GarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599636.1 protein_id gnl|my_center|LOCUS_01190 127913 129484 gene locus_tag LOCUS_01200 gene garD 127913 129484 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273753.1 protein_id gnl|my_center|LOCUS_01200 129632 129967 gene locus_tag LOCUS_01210 gene prlF 129632 129967 CDS product type II toxin-antitoxin system antitoxin PrlF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296435.1 protein_id gnl|my_center|LOCUS_01210 130129 130431 gene locus_tag LOCUS_01220 130129 130431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01220 131295 130486 gene locus_tag LOCUS_01230 gene agaR 131295 130486 CDS product aga operon transcriptional regulator AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072187.1 protein_id gnl|my_center|LOCUS_01230 131544 132824 gene locus_tag LOCUS_01240 gene kbaZ 131544 132824 CDS product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681920.1 protein_id gnl|my_center|LOCUS_01240 132847 133320 gene locus_tag LOCUS_01250 gene agaV 132847 133320 CDS product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295547.1 protein_id gnl|my_center|LOCUS_01250 133331 134110 gene locus_tag LOCUS_01260 gene agaW 133331 134110 CDS product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406214.1 protein_id gnl|my_center|LOCUS_01260 134100 134978 gene locus_tag LOCUS_01270 gene agaE 134100 134978 CDS product PTS N-acetylgalactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295548.1 protein_id gnl|my_center|LOCUS_01270 134996 135430 gene locus_tag LOCUS_01280 gene agaF 134996 135430 CDS product PTS galactosamine/N-acetylgalactosamine transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948824.1 protein_id gnl|my_center|LOCUS_01280 135427 136560 gene locus_tag LOCUS_01290 gene nagA 135427 136560 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326138.1 protein_id gnl|my_center|LOCUS_01290 136911 138065 gene locus_tag LOCUS_01300 136911 138065 CDS product AgaS family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114873.1 protein_id gnl|my_center|LOCUS_01300 138078 138938 gene locus_tag LOCUS_01310 gene kbaY 138078 138938 CDS product tagatose-bisphosphate aldolase subunit KbaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022766.1 protein_id gnl|my_center|LOCUS_01310 139105 139581 gene locus_tag LOCUS_01320 gene agaB 139105 139581 CDS product PTS galactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098022.1 protein_id gnl|my_center|LOCUS_01320 139620 140423 gene locus_tag LOCUS_01330 gene agaC 139620 140423 CDS product PTS galactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544489.1 protein_id gnl|my_center|LOCUS_01330 140413 141204 gene locus_tag LOCUS_01340 gene agaD 140413 141204 CDS product PTS galactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534351.1 protein_id gnl|my_center|LOCUS_01340 141259 141960 gene locus_tag LOCUS_01350 141259 141960 CDS product galactosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311150.1 protein_id gnl|my_center|LOCUS_01350 142361 142945 gene locus_tag LOCUS_01360 142361 142945 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045442.1 protein_id gnl|my_center|LOCUS_01360 143121 143720 gene locus_tag LOCUS_01370 143121 143720 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044775.1 protein_id gnl|my_center|LOCUS_01370 143750 146266 gene locus_tag LOCUS_01380 143750 146266 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136472.1 protein_id gnl|my_center|LOCUS_01380 146409 147368 gene locus_tag LOCUS_01390 146409 147368 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816992.1 protein_id gnl|my_center|LOCUS_01390 148271 147411 gene locus_tag LOCUS_01400 gene rsmI 148271 147411 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809262.1 protein_id gnl|my_center|LOCUS_01400 148336 150372 gene locus_tag LOCUS_01410 gene lpoA 148336 150372 CDS product penicillin-binding protein activator LpoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249104.1 protein_id gnl|my_center|LOCUS_01410 150330 150725 gene locus_tag LOCUS_01420 150330 150725 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246830.1 protein_id gnl|my_center|LOCUS_01420 150745 151335 gene locus_tag LOCUS_01430 gene diaA 150745 151335 CDS product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158034.1 protein_id gnl|my_center|LOCUS_01430 151345 151920 gene locus_tag LOCUS_01440 gene dolP 151345 151920 CDS product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646033.1 protein_id gnl|my_center|LOCUS_01440 153074 152034 gene locus_tag LOCUS_01450 153074 152034 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147624.1 protein_id gnl|my_center|LOCUS_01450 153782 153147 gene locus_tag LOCUS_01460 153782 153147 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084526.1 protein_id gnl|my_center|LOCUS_01460 153910 154428 gene locus_tag LOCUS_01470 gene yhbO 153910 154428 CDS product protein/nucleic acid deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037608.1 protein_id gnl|my_center|LOCUS_01470 154851 154408 gene locus_tag LOCUS_01480 154851 154408 CDS product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449030.1 protein_id gnl|my_center|LOCUS_01480 154902 155204 gene locus_tag LOCUS_01490 gene yhbQ 154902 155204 CDS product DNA damage response exodeoxyribonuclease YhbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189314.1 protein_id gnl|my_center|LOCUS_01490 155694 155191 gene locus_tag LOCUS_01500 155694 155191 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908554.1 protein_id gnl|my_center|LOCUS_01500 156233 155688 gene locus_tag LOCUS_01510 156233 155688 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295552.1 protein_id gnl|my_center|LOCUS_01510 156421 157416 gene locus_tag LOCUS_01520 156421 157416 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421305.1 protein_id gnl|my_center|LOCUS_01520 157425 158303 gene locus_tag LOCUS_01530 157425 158303 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301318.1 protein_id gnl|my_center|LOCUS_01530 158384 159391 gene locus_tag LOCUS_01540 158384 159391 CDS product luciferase-like monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130380.1 protein_id gnl|my_center|LOCUS_01540 160753 159509 gene locus_tag LOCUS_01550 gene mtr 160753 159509 CDS product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224351.1 protein_id gnl|my_center|LOCUS_01550 162796 160907 gene locus_tag LOCUS_01560 gene deaD 162796 160907 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301504.1 protein_id gnl|my_center|LOCUS_01560 163860 162976 gene locus_tag LOCUS_01570 gene nlpI 163860 162976 CDS product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802080.1 protein_id gnl|my_center|LOCUS_01570 166104 163969 gene locus_tag LOCUS_01580 gene pnp 166104 163969 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295554.1 protein_id gnl|my_center|LOCUS_01580 166620 166351 gene locus_tag LOCUS_01590 gene rpsO 166620 166351 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059466.1 protein_id gnl|my_center|LOCUS_01590 167713 166769 gene locus_tag LOCUS_01600 gene truB 167713 166769 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089698.1 protein_id gnl|my_center|LOCUS_01600 168114 167713 gene locus_tag LOCUS_01610 gene rbfA 168114 167713 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040205.1 protein_id gnl|my_center|LOCUS_01610 170950 168278 gene locus_tag LOCUS_01620 gene infB 170950 168278 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133044.1 protein_id gnl|my_center|LOCUS_01620 172462 170975 gene locus_tag LOCUS_01630 gene nusA 172462 170975 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031057.1 protein_id gnl|my_center|LOCUS_01630 172912 172490 gene locus_tag LOCUS_01640 gene rimP 172912 172490 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296446.1 protein_id gnl|my_center|LOCUS_01640 173225 173149 gene locus_tag LOCUS_t00020 173225 173149 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 173573 174916 gene locus_tag LOCUS_01650 gene argG 173573 174916 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207680.1 protein_id gnl|my_center|LOCUS_01650 176549 174924 gene locus_tag LOCUS_01660 176549 174924 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333576.1 protein_id gnl|my_center|LOCUS_01660 177094 177008 gene locus_tag LOCUS_t00030 177094 177008 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 177441 177109 gene locus_tag LOCUS_01670 gene secG 177441 177109 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295556.1 protein_id gnl|my_center|LOCUS_01670 179006 177669 gene locus_tag LOCUS_01680 gene glmM 179006 177669 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071134.1 protein_id gnl|my_center|LOCUS_01680 179847 178999 gene locus_tag LOCUS_01690 gene folP 179847 178999 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311155.1 protein_id gnl|my_center|LOCUS_01690 181880 179937 gene locus_tag LOCUS_01700 gene ftsH 181880 179937 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107467.1 protein_id gnl|my_center|LOCUS_01700 182600 181971 gene locus_tag LOCUS_01710 gene rlmE 182600 181971 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145975.1 protein_id gnl|my_center|LOCUS_01710 182726 183019 gene locus_tag LOCUS_01720 gene yhbY 182726 183019 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054420.1 protein_id gnl|my_center|LOCUS_01720 183651 183175 gene locus_tag LOCUS_01730 gene greA 183651 183175 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148001.1 protein_id gnl|my_center|LOCUS_01730 184013 185332 gene locus_tag LOCUS_01740 gene dacB 184013 185332 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212651.1 protein_id gnl|my_center|LOCUS_01740 186690 185518 gene locus_tag LOCUS_01750 gene cgtA 186690 185518 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673561.1 protein_id gnl|my_center|LOCUS_01750 187671 186706 gene locus_tag LOCUS_01760 187671 186706 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813037.1 protein_id gnl|my_center|LOCUS_01760 188055 187798 gene locus_tag LOCUS_01770 gene rpmA 188055 187798 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940595.1 protein_id gnl|my_center|LOCUS_01770 188387 188076 gene locus_tag LOCUS_01780 gene rplU 188387 188076 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271401.1 protein_id gnl|my_center|LOCUS_01780 188646 189617 gene locus_tag LOCUS_01790 gene ispB 188646 189617 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047336.1 protein_id gnl|my_center|LOCUS_01790 189846 190124 gene locus_tag LOCUS_01800 gene sfsB 189846 190124 CDS product DNA-binding transcriptional regulator SfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445413.1 protein_id gnl|my_center|LOCUS_01800 191431 190172 gene locus_tag LOCUS_01810 gene murA 191431 190172 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357259.1 protein_id gnl|my_center|LOCUS_01810 191755 191486 gene locus_tag LOCUS_01820 gene ibaG 191755 191486 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568740.1 protein_id gnl|my_center|LOCUS_01820 192193 191900 gene locus_tag LOCUS_01830 gene mlaB 192193 191900 CDS product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004488.1 protein_id gnl|my_center|LOCUS_01830 192828 192193 gene locus_tag LOCUS_01840 gene mlaC 192828 192193 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476487.1 protein_id gnl|my_center|LOCUS_01840 193398 192847 gene locus_tag LOCUS_01850 gene mlaD 193398 192847 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296448.1 protein_id gnl|my_center|LOCUS_01850 194185 193403 gene locus_tag LOCUS_01860 gene mlaE 194185 193403 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925795.1 protein_id gnl|my_center|LOCUS_01860 195002 194193 gene locus_tag LOCUS_01870 gene mlaF 195002 194193 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438245.1 protein_id gnl|my_center|LOCUS_01870 195212 196189 gene locus_tag LOCUS_01880 195212 196189 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922901.1 protein_id gnl|my_center|LOCUS_01880 196203 197189 gene locus_tag LOCUS_01890 gene kdsD 196203 197189 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295557.1 protein_id gnl|my_center|LOCUS_01890 197210 197776 gene locus_tag LOCUS_01900 gene kdsC 197210 197776 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030016.1 protein_id gnl|my_center|LOCUS_01900 197773 198348 gene locus_tag LOCUS_01910 gene lptC 197773 198348 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030537.1 protein_id gnl|my_center|LOCUS_01910 198317 198874 gene locus_tag LOCUS_01920 gene lptA 198317 198874 CDS product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669785.1 protein_id gnl|my_center|LOCUS_01920 198881 199606 gene locus_tag LOCUS_01930 gene lptB 198881 199606 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224099.1 protein_id gnl|my_center|LOCUS_01930 199654 201087 gene locus_tag LOCUS_01940 gene rpoN 199654 201087 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809051.1 protein_id gnl|my_center|LOCUS_01940 201110 201397 gene locus_tag LOCUS_01950 gene hpf 201110 201397 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176599.1 protein_id gnl|my_center|LOCUS_01950 201515 202006 gene locus_tag LOCUS_01960 gene ptsN 201515 202006 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183676.1 protein_id gnl|my_center|LOCUS_01960 202052 202906 gene locus_tag LOCUS_01970 gene rapZ 202052 202906 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243741.1 protein_id gnl|my_center|LOCUS_01970 202903 203175 gene locus_tag LOCUS_01980 gene npr 202903 203175 CDS product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216791.1 protein_id gnl|my_center|LOCUS_01980 203389 204021 gene locus_tag LOCUS_01990 gene yrbL 203389 204021 CDS product PhoP regulatory network protein YrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620405.1 protein_id gnl|my_center|LOCUS_01990 204746 204018 gene locus_tag LOCUS_02000 gene mtgA 204746 204018 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047091.1 protein_id gnl|my_center|LOCUS_02000 205396 204743 gene locus_tag LOCUS_02010 gene elbB 205396 204743 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300411.1 protein_id gnl|my_center|LOCUS_02010 207962 205626 gene locus_tag LOCUS_02020 gene arcB 207962 205626 CDS product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809774.1 protein_id gnl|my_center|LOCUS_02020 209020 208058 gene locus_tag LOCUS_02030 209020 208058 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299745.1 protein_id gnl|my_center|LOCUS_02030 209554 214122 gene locus_tag LOCUS_02040 gene gltB 209554 214122 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213702.1 protein_id gnl|my_center|LOCUS_02040 214135 215553 gene locus_tag LOCUS_02050 gene gltD 214135 215553 CDS product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081674.1 protein_id gnl|my_center|LOCUS_02050 216233 216538 gene locus_tag LOCUS_02060 216233 216538 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639208.1 protein_id gnl|my_center|LOCUS_02060 217078 216614 gene locus_tag LOCUS_02070 gene nanQ 217078 216614 CDS product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979880.1 protein_id gnl|my_center|LOCUS_02070 217950 217075 gene locus_tag LOCUS_02080 gene nanK 217950 217075 CDS product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153624.1 protein_id gnl|my_center|LOCUS_02080 218636 217947 gene locus_tag LOCUS_02090 218636 217947 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300570.1 protein_id gnl|my_center|LOCUS_02090 220174 218684 gene locus_tag LOCUS_02100 gene nanT 220174 218684 CDS product sialic acid transporter NanT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108459.1 protein_id gnl|my_center|LOCUS_02100 221176 220283 gene locus_tag LOCUS_02110 gene nanA 221176 220283 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224714.1 protein_id gnl|my_center|LOCUS_02110 222080 221298 gene locus_tag LOCUS_02120 gene nanR 222080 221298 CDS product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523844.1 protein_id gnl|my_center|LOCUS_02120 222469 223836 gene locus_tag LOCUS_02130 gene dcuC 222469 223836 CDS product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467018.1 protein_id gnl|my_center|LOCUS_02130 224376 223879 gene locus_tag LOCUS_02140 gene sspB 224376 223879 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366129.1 protein_id gnl|my_center|LOCUS_02140 225020 224382 gene locus_tag LOCUS_02150 gene sspA 225020 224382 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257293.1 protein_id gnl|my_center|LOCUS_02150 225807 225415 gene locus_tag LOCUS_02160 gene rpsI 225807 225415 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 protein_id gnl|my_center|LOCUS_02160 226251 225823 gene locus_tag LOCUS_02170 gene rplM 226251 225823 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 protein_id gnl|my_center|LOCUS_02170 227441 226470 gene locus_tag LOCUS_02180 gene zapE 227441 226470 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192344.1 protein_id gnl|my_center|LOCUS_02180 227785 228189 gene locus_tag LOCUS_02190 gene zapG 227785 228189 CDS product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295270.1 protein_id gnl|my_center|LOCUS_02190 228343 229710 gene locus_tag LOCUS_02200 gene degQ 228343 229710 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295271.1 protein_id gnl|my_center|LOCUS_02200 229800 230867 gene locus_tag LOCUS_02210 gene degS 229800 230867 CDS product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497724.1 protein_id gnl|my_center|LOCUS_02210 231867 230929 gene locus_tag LOCUS_02220 gene mdh 231867 230929 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295272.1 protein_id gnl|my_center|LOCUS_02220 232302 232772 gene locus_tag LOCUS_02230 gene argR 232302 232772 CDS product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257846.1 protein_id gnl|my_center|LOCUS_02230 233086 233400 gene locus_tag LOCUS_02240 gene yhcN 233086 233400 CDS product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509740.1 protein_id gnl|my_center|LOCUS_02240 233728 233456 gene locus_tag LOCUS_02250 233728 233456 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029005.1 protein_id gnl|my_center|LOCUS_02250 235787 233820 gene locus_tag LOCUS_02260 gene aaeB 235787 233820 CDS product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510962.1 protein_id gnl|my_center|LOCUS_02260 236725 235793 gene locus_tag LOCUS_02270 gene aaeA 236725 235793 CDS product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854033.1 protein_id gnl|my_center|LOCUS_02270 236936 236733 gene locus_tag LOCUS_02280 236936 236733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 237119 238048 gene locus_tag LOCUS_02290 gene aaeR 237119 238048 CDS product HTH-type transcriptional activator AaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440317.1 protein_id gnl|my_center|LOCUS_02290 239621 238176 gene locus_tag LOCUS_02300 gene tldD 239621 238176 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055909.1 protein_id gnl|my_center|LOCUS_02300 >Feature sequence02 2 745 gene locus_tag LOCUS_02310 2 745 CDS product ISAs1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420862.1 protein_id gnl|my_center|LOCUS_02310 893 1402 gene locus_tag LOCUS_02320 893 1402 CDS product YbgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076004.1 protein_id gnl|my_center|LOCUS_02320 1399 2820 gene locus_tag LOCUS_02330 gene phrB 1399 2820 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628038.1 protein_id gnl|my_center|LOCUS_02330 4340 2859 gene locus_tag LOCUS_02340 gene dtpD 4340 2859 CDS product dipeptide permease DtpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032694.1 protein_id gnl|my_center|LOCUS_02340 4611 5354 gene locus_tag LOCUS_02350 gene ybgI 4611 5354 CDS product radiation resistance protein YbgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798871.1 protein_id gnl|my_center|LOCUS_02350 5377 6033 gene locus_tag LOCUS_02360 gene pxpB 5377 6033 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188343.1 protein_id gnl|my_center|LOCUS_02360 6027 6959 gene locus_tag LOCUS_02370 gene pxpC 6027 6959 CDS product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912724.1 protein_id gnl|my_center|LOCUS_02370 6949 7683 gene locus_tag LOCUS_02380 gene pxpA 6949 7683 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687142.1 protein_id gnl|my_center|LOCUS_02380 7719 8510 gene locus_tag LOCUS_02390 gene nei 7719 8510 CDS product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113989.1 protein_id gnl|my_center|LOCUS_02390 9544 8507 gene locus_tag LOCUS_02400 9544 8507 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297246.1 protein_id gnl|my_center|LOCUS_02400 10766 9705 gene locus_tag LOCUS_02410 10766 9705 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272420.1 protein_id gnl|my_center|LOCUS_02410 11494 10763 gene locus_tag LOCUS_02420 11494 10763 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143529.1 protein_id gnl|my_center|LOCUS_02420 13968 11509 gene locus_tag LOCUS_02430 13968 11509 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001316936.1 protein_id gnl|my_center|LOCUS_02430 14585 14019 gene locus_tag LOCUS_02440 14585 14019 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472422.1 protein_id gnl|my_center|LOCUS_02440 16258 14975 gene locus_tag LOCUS_02450 gene gltA 16258 14975 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785834.1 protein_id gnl|my_center|LOCUS_02450 16952 17356 gene locus_tag LOCUS_02460 gene sdhC 16952 17356 CDS product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263355.1 protein_id gnl|my_center|LOCUS_02460 17350 17697 gene locus_tag LOCUS_02470 gene sdhD 17350 17697 CDS product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254365.1 protein_id gnl|my_center|LOCUS_02470 17697 19463 gene locus_tag LOCUS_02480 gene sdhA 17697 19463 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775540.1 protein_id gnl|my_center|LOCUS_02480 19479 20195 gene locus_tag LOCUS_02490 gene sdhB 19479 20195 CDS product succinate dehydrogenase iron-sulfur subunit SdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235263.1 protein_id gnl|my_center|LOCUS_02490 20496 23297 gene locus_tag LOCUS_02500 gene sucA 20496 23297 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181473.1 protein_id gnl|my_center|LOCUS_02500 23312 24529 gene locus_tag LOCUS_02510 gene odhB 23312 24529 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099820.1 protein_id gnl|my_center|LOCUS_02510 24895 26061 gene locus_tag LOCUS_02520 gene sucC 24895 26061 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048602.1 protein_id gnl|my_center|LOCUS_02520 26061 26930 gene locus_tag LOCUS_02530 gene sucD 26061 26930 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025458.1 protein_id gnl|my_center|LOCUS_02530 27756 27034 gene locus_tag LOCUS_02540 gene mngR 27756 27034 CDS product mannosyl-D-glycerate transport/metabolism system transcriptional repressor MngR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509899.1 protein_id gnl|my_center|LOCUS_02540 27925 29841 gene locus_tag LOCUS_02550 gene mngA 27925 29841 CDS product PTS 2-O-a-mannosyl-D-glycerate transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242633.1 protein_id gnl|my_center|LOCUS_02550 29859 32492 gene locus_tag LOCUS_02560 gene mngB 29859 32492 CDS product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648976.1 protein_id gnl|my_center|LOCUS_02560 32517 32744 gene locus_tag LOCUS_02570 32517 32744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324497.1 protein_id gnl|my_center|LOCUS_02570 33339 34907 gene locus_tag LOCUS_02580 gene cydA 33339 34907 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884361.1 protein_id gnl|my_center|LOCUS_02580 34923 36062 gene locus_tag LOCUS_02590 gene cydB 34923 36062 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568275.1 protein_id gnl|my_center|LOCUS_02590 36190 36483 gene locus_tag LOCUS_02600 gene ybgE 36190 36483 CDS product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034602.1 protein_id gnl|my_center|LOCUS_02600 36633 37037 gene locus_tag LOCUS_02610 gene ybgC 36633 37037 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098384.1 protein_id gnl|my_center|LOCUS_02610 37043 37726 gene locus_tag LOCUS_02620 gene tolQ 37043 37726 CDS product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131314.1 protein_id gnl|my_center|LOCUS_02620 37730 38158 gene locus_tag LOCUS_02630 gene tolR 37730 38158 CDS product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090097.1 protein_id gnl|my_center|LOCUS_02630 38223 39488 gene locus_tag LOCUS_02640 38223 39488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 39621 40913 gene locus_tag LOCUS_02650 gene tolB 39621 40913 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295307.1 protein_id gnl|my_center|LOCUS_02650 40948 41469 gene locus_tag LOCUS_02660 gene pal 40948 41469 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295306.1 protein_id gnl|my_center|LOCUS_02660 41479 42270 gene locus_tag LOCUS_02670 gene cpoB 41479 42270 CDS product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097580.1 protein_id gnl|my_center|LOCUS_02670 42435 42510 gene locus_tag LOCUS_t00040 42435 42510 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 42646 42721 gene locus_tag LOCUS_t00050 42646 42721 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 42724 42799 gene locus_tag LOCUS_t00060 42724 42799 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 42851 42926 gene locus_tag LOCUS_t00070 42851 42926 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 42930 43005 gene locus_tag LOCUS_t00080 42930 43005 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 43152 43227 gene locus_tag LOCUS_t00090 43152 43227 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 43360 43435 gene locus_tag LOCUS_t00100 43360 43435 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 43713 44756 gene locus_tag LOCUS_02680 gene nadA 43713 44756 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115290.1 protein_id gnl|my_center|LOCUS_02680 44794 45513 gene locus_tag LOCUS_02690 gene pnuC 44794 45513 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345410.1 protein_id gnl|my_center|LOCUS_02690 46451 45510 gene locus_tag LOCUS_02700 gene zitB 46451 45510 CDS product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951276.1 protein_id gnl|my_center|LOCUS_02700 46945 46565 gene locus_tag LOCUS_02710 46945 46565 CDS product YbgS-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784351.1 protein_id gnl|my_center|LOCUS_02710 47261 48313 gene locus_tag LOCUS_02720 gene aroG 47261 48313 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109196.1 protein_id gnl|my_center|LOCUS_02720 49223 48471 gene locus_tag LOCUS_02730 gene gpmA 49223 48471 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295305.1 protein_id gnl|my_center|LOCUS_02730 50465 49425 gene locus_tag LOCUS_02740 gene galM 50465 49425 CDS product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931389.1 protein_id gnl|my_center|LOCUS_02740 51607 50459 gene locus_tag LOCUS_02750 gene galK 51607 50459 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053415.1 protein_id gnl|my_center|LOCUS_02750 52657 51611 gene locus_tag LOCUS_02760 gene galT 52657 51611 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191497.1 protein_id gnl|my_center|LOCUS_02760 53683 52667 gene locus_tag LOCUS_02770 gene galE 53683 52667 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265438.1 protein_id gnl|my_center|LOCUS_02770 55416 53944 gene locus_tag LOCUS_02780 gene modF 55416 53944 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096869.1 protein_id gnl|my_center|LOCUS_02780 56272 55484 gene locus_tag LOCUS_02790 gene modE 56272 55484 CDS product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147439.1 protein_id gnl|my_center|LOCUS_02790 56401 56550 gene locus_tag LOCUS_02800 gene acrZ 56401 56550 CDS product multidrug efflux pump accessory protein AcrZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891515.1 protein_id gnl|my_center|LOCUS_02800 56717 57490 gene locus_tag LOCUS_02810 gene modA 56717 57490 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101984.1 protein_id gnl|my_center|LOCUS_02810 57490 58179 gene locus_tag LOCUS_02820 gene modB 57490 58179 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604034.1 protein_id gnl|my_center|LOCUS_02820 58182 59240 gene locus_tag LOCUS_02830 gene modC 58182 59240 CDS product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891692.1 protein_id gnl|my_center|LOCUS_02830 60059 59241 gene locus_tag LOCUS_02840 gene ybhA 60059 59241 CDS product bifunctional pyridoxal phosphate/fructose-1,6-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300666.1 protein_id gnl|my_center|LOCUS_02840 60214 61209 gene locus_tag LOCUS_02850 gene pgl 60214 61209 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815435.1 protein_id gnl|my_center|LOCUS_02850 62008 61250 gene locus_tag LOCUS_02860 62008 61250 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643361.1 protein_id gnl|my_center|LOCUS_02860 62501 63439 gene locus_tag LOCUS_02870 62501 63439 CDS product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723652.1 protein_id gnl|my_center|LOCUS_02870 63515 64948 gene locus_tag LOCUS_02880 63515 64948 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036475.1 protein_id gnl|my_center|LOCUS_02880 65131 67392 gene locus_tag LOCUS_02890 65131 67392 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593938.1 protein_id gnl|my_center|LOCUS_02890 68816 67533 gene locus_tag LOCUS_02900 68816 67533 CDS product putative acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091569.1 protein_id gnl|my_center|LOCUS_02900 70021 68951 gene locus_tag LOCUS_02910 70021 68951 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533642.1 protein_id gnl|my_center|LOCUS_02910 70424 70257 gene locus_tag LOCUS_02920 70424 70257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545728.1 protein_id gnl|my_center|LOCUS_02920 70781 70497 gene locus_tag LOCUS_02930 70781 70497 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917774.1 protein_id gnl|my_center|LOCUS_02930 71058 70774 gene locus_tag LOCUS_02940 71058 70774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 71568 71753 gene locus_tag LOCUS_02950 71568 71753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 72434 71886 gene locus_tag LOCUS_02960 72434 71886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 72454 73005 gene locus_tag LOCUS_02970 72454 73005 CDS product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816478.1 protein_id gnl|my_center|LOCUS_02970 73008 74630 gene locus_tag LOCUS_02980 73008 74630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 74630 75391 gene locus_tag LOCUS_02990 74630 75391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 75414 75899 gene locus_tag LOCUS_03000 75414 75899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 75899 76294 gene locus_tag LOCUS_03010 75899 76294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 77754 79091 gene locus_tag LOCUS_03020 77754 79091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 80274 79129 gene locus_tag LOCUS_03030 80274 79129 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266577.1 protein_id gnl|my_center|LOCUS_03030 81534 81058 gene locus_tag LOCUS_03040 81534 81058 CDS product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767389.1 protein_id gnl|my_center|LOCUS_03040 82825 81593 gene locus_tag LOCUS_03050 gene bioA 82825 81593 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099955.1 protein_id gnl|my_center|LOCUS_03050 82969 84009 gene locus_tag LOCUS_03060 gene bioB 82969 84009 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951213.1 protein_id gnl|my_center|LOCUS_03060 84006 85160 gene locus_tag LOCUS_03070 gene bioF 84006 85160 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118818.1 protein_id gnl|my_center|LOCUS_03070 85147 85902 gene locus_tag LOCUS_03080 gene bioC 85147 85902 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246761.1 protein_id gnl|my_center|LOCUS_03080 85895 86572 gene locus_tag LOCUS_03090 gene bioD 85895 86572 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044843.1 protein_id gnl|my_center|LOCUS_03090 87151 89172 gene locus_tag LOCUS_03100 gene uvrB 87151 89172 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042533.1 protein_id gnl|my_center|LOCUS_03100 90272 89364 gene locus_tag LOCUS_03110 gene yvcK 90272 89364 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295302.1 protein_id gnl|my_center|LOCUS_03110 90669 91658 gene locus_tag LOCUS_03120 gene moaA 90669 91658 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295301.1 protein_id gnl|my_center|LOCUS_03120 91680 92192 gene locus_tag LOCUS_03130 gene moaB 91680 92192 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084639.1 protein_id gnl|my_center|LOCUS_03130 92195 92680 gene locus_tag LOCUS_03140 gene moaC 92195 92680 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080885.1 protein_id gnl|my_center|LOCUS_03140 92673 92918 gene locus_tag LOCUS_03150 gene moaD 92673 92918 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598612.1 protein_id gnl|my_center|LOCUS_03150 92920 93372 gene locus_tag LOCUS_03160 gene moaE 92920 93372 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852287.1 protein_id gnl|my_center|LOCUS_03160 93508 94212 gene locus_tag LOCUS_03170 93508 94212 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373624.1 protein_id gnl|my_center|LOCUS_03170 94417 95130 gene locus_tag LOCUS_03180 94417 95130 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446911.1 protein_id gnl|my_center|LOCUS_03180 96122 95166 gene locus_tag LOCUS_03190 96122 95166 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045450.1 protein_id gnl|my_center|LOCUS_03190 97363 96122 gene locus_tag LOCUS_03200 gene clsB 97363 96122 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650337.1 protein_id gnl|my_center|LOCUS_03200 98121 97360 gene locus_tag LOCUS_03210 98121 97360 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113348.1 protein_id gnl|my_center|LOCUS_03210 98254 98664 gene locus_tag LOCUS_03220 98254 98664 CDS product YbhQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871982.1 protein_id gnl|my_center|LOCUS_03220 99732 98626 gene locus_tag LOCUS_03230 99732 98626 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469031.1 protein_id gnl|my_center|LOCUS_03230 100876 99743 gene locus_tag LOCUS_03240 100876 99743 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070131.1 protein_id gnl|my_center|LOCUS_03240 102605 100869 gene locus_tag LOCUS_03250 102605 100869 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198117.1 protein_id gnl|my_center|LOCUS_03250 103596 102598 gene locus_tag LOCUS_03260 gene hlyD 103596 102598 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976400.1 protein_id gnl|my_center|LOCUS_03260 104267 103596 gene locus_tag LOCUS_03270 gene cecR 104267 103596 CDS product DNA-binding transcriptional regulator CecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340357.1 protein_id gnl|my_center|LOCUS_03270 104496 105860 gene locus_tag LOCUS_03280 gene rhlE 104496 105860 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007101.1 protein_id gnl|my_center|LOCUS_03280 106541 106092 gene locus_tag LOCUS_03290 gene ybiA 106541 106092 CDS product N-glycosidase YbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145126.1 protein_id gnl|my_center|LOCUS_03290 106694 108844 gene locus_tag LOCUS_03300 gene dinG 106694 108844 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340191.1 protein_id gnl|my_center|LOCUS_03300 108872 109834 gene locus_tag LOCUS_03310 gene ybiB 108872 109834 CDS product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386551.1 protein_id gnl|my_center|LOCUS_03310 109975 111060 gene locus_tag LOCUS_03320 gene hcxB 109975 111060 CDS product hydroxycarboxylate dehydrogenase HcXB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443530.1 protein_id gnl|my_center|LOCUS_03320 111549 111289 gene locus_tag LOCUS_03330 gene ybiJ 111549 111289 CDS product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849301.1 protein_id gnl|my_center|LOCUS_03330 112080 111814 gene locus_tag LOCUS_03340 gene ybiI 112080 111814 CDS product C4-type zinc finger protein YbiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146343.1 protein_id gnl|my_center|LOCUS_03340 112831 112154 gene locus_tag LOCUS_03350 gene ybiX 112831 112154 CDS product PKHD-type hydroxylase YbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990177.1 protein_id gnl|my_center|LOCUS_03350 115155 112873 gene locus_tag LOCUS_03360 115155 112873 CDS product catecholate siderophore receptor Fiu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000430000.1 protein_id gnl|my_center|LOCUS_03360 115680 115420 gene locus_tag LOCUS_03370 gene mcbA 115680 115420 CDS product DUF1471 family periplasmic protein McbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710619.1 protein_id gnl|my_center|LOCUS_03370 115956 116882 gene locus_tag LOCUS_03380 gene rlmF 115956 116882 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295299.1 protein_id gnl|my_center|LOCUS_03380 119104 116879 gene locus_tag LOCUS_03390 gene ybiO 119104 116879 CDS product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267253.1 protein_id gnl|my_center|LOCUS_03390 120087 119365 gene locus_tag LOCUS_03400 gene glnQ 120087 119365 CDS product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569083.1 protein_id gnl|my_center|LOCUS_03400 120743 120084 gene locus_tag LOCUS_03410 gene glnP 120743 120084 CDS product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159065.1 protein_id gnl|my_center|LOCUS_03410 121628 120882 gene locus_tag LOCUS_03420 gene glnH 121628 120882 CDS product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843866.1 protein_id gnl|my_center|LOCUS_03420 122535 122032 gene locus_tag LOCUS_03430 gene dps 122535 122032 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100800.1 protein_id gnl|my_center|LOCUS_03430 123721 122834 gene locus_tag LOCUS_03440 gene rhtA 123721 122834 CDS product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295297.1 protein_id gnl|my_center|LOCUS_03440 124074 124589 gene locus_tag LOCUS_03450 gene ompX 124074 124589 CDS product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295296.1 protein_id gnl|my_center|LOCUS_03450 126221 124638 gene locus_tag LOCUS_03460 gene opgE 126221 124638 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054678.1 protein_id gnl|my_center|LOCUS_03460 126621 126493 gene locus_tag LOCUS_03470 gene mntS 126621 126493 CDS product manganase accumulation protein MntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001761.1 protein_id gnl|my_center|LOCUS_03470 126807 127274 gene locus_tag LOCUS_03480 gene mntR 126807 127274 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091016.1 protein_id gnl|my_center|LOCUS_03480 127271 128389 gene locus_tag LOCUS_03490 127271 128389 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056457.1 protein_id gnl|my_center|LOCUS_03490 129368 128448 gene locus_tag LOCUS_03500 gene ldtB 129368 128448 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056384.1 protein_id gnl|my_center|LOCUS_03500 129587 131179 gene locus_tag LOCUS_03510 129587 131179 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961458.1 protein_id gnl|my_center|LOCUS_03510 132612 131347 gene locus_tag LOCUS_03520 132612 131347 CDS product DUF1479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168797.1 protein_id gnl|my_center|LOCUS_03520 133579 132764 gene locus_tag LOCUS_03530 gene ybiV 133579 132764 CDS product sugar-phosphatase YbiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114272.1 protein_id gnl|my_center|LOCUS_03530 136157 133725 gene locus_tag LOCUS_03540 136157 133725 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209345.1 protein_id gnl|my_center|LOCUS_03540 137062 136163 gene locus_tag LOCUS_03550 137062 136163 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462972.1 protein_id gnl|my_center|LOCUS_03550 137193 137855 gene locus_tag LOCUS_03560 gene fsa 137193 137855 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336208.1 protein_id gnl|my_center|LOCUS_03560 138680 137931 gene locus_tag LOCUS_03570 gene moeB 138680 137931 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829244.1 protein_id gnl|my_center|LOCUS_03570 139915 138680 gene locus_tag LOCUS_03580 gene moeA 139915 138680 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397381.1 protein_id gnl|my_center|LOCUS_03580 140119 141084 gene locus_tag LOCUS_03590 gene iaaA 140119 141084 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513775.1 protein_id gnl|my_center|LOCUS_03590 141071 142942 gene locus_tag LOCUS_03600 gene gsiA 141071 142942 CDS product glutathione ABC transporter ATP-binding protein GsiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301279.1 protein_id gnl|my_center|LOCUS_03600 142962 144500 gene locus_tag LOCUS_03610 gene gsiB 142962 144500 CDS product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090140.1 protein_id gnl|my_center|LOCUS_03610 144518 145438 gene locus_tag LOCUS_03620 gene gsiC 144518 145438 CDS product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936043.1 protein_id gnl|my_center|LOCUS_03620 145441 146352 gene locus_tag LOCUS_03630 gene gsiD 145441 146352 CDS product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236051.1 protein_id gnl|my_center|LOCUS_03630 146782 148878 gene locus_tag LOCUS_03640 146782 148878 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360263.1 protein_id gnl|my_center|LOCUS_03640 148886 150214 gene locus_tag LOCUS_03650 148886 150214 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086904.1 protein_id gnl|my_center|LOCUS_03650 151586 150261 gene locus_tag LOCUS_03660 gene rimO 151586 150261 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049367.1 protein_id gnl|my_center|LOCUS_03660 151799 152182 gene locus_tag LOCUS_03670 gene bssR 151799 152182 CDS product biofilm formation regulator BssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497137.1 protein_id gnl|my_center|LOCUS_03670 152293 153408 gene locus_tag LOCUS_03680 gene yliI 152293 153408 CDS product aldose sugar dehydrogenase YliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554959.1 protein_id gnl|my_center|LOCUS_03680 154031 153405 gene locus_tag LOCUS_03690 gene gstB 154031 153405 CDS product glutathione S-transferase GstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061831.1 protein_id gnl|my_center|LOCUS_03690 154269 155480 gene locus_tag LOCUS_03700 gene dacC 154269 155480 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300708.1 protein_id gnl|my_center|LOCUS_03700 156285 155527 gene locus_tag LOCUS_03710 gene deoR 156285 155527 CDS product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450121.1 protein_id gnl|my_center|LOCUS_03710 156939 156343 gene locus_tag LOCUS_03720 gene ybjG 156939 156343 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295291.1 protein_id gnl|my_center|LOCUS_03720 157224 158456 gene locus_tag LOCUS_03730 gene mdfA 157224 158456 CDS product multidrug efflux MFS transporter MdfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180089.1 protein_id gnl|my_center|LOCUS_03730 158775 158497 gene locus_tag LOCUS_03740 gene ybjH 158775 158497 CDS product protein YbjH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480892.1 protein_id gnl|my_center|LOCUS_03740 159682 158867 gene locus_tag LOCUS_03750 gene ybjI 159682 158867 CDS product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023565.1 protein_id gnl|my_center|LOCUS_03750 160890 159682 gene locus_tag LOCUS_03760 160890 159682 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217859.1 protein_id gnl|my_center|LOCUS_03760 160974 161510 gene locus_tag LOCUS_03770 gene rcdA 160974 161510 CDS product DNA-binding transcriptional regulator RcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295289.1 protein_id gnl|my_center|LOCUS_03770 162022 161690 gene locus_tag LOCUS_03780 162022 161690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 163147 162131 gene locus_tag LOCUS_03790 163147 162131 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290950.1 protein_id gnl|my_center|LOCUS_03790 164110 163541 gene locus_tag LOCUS_03800 164110 163541 CDS product phage repressor protein CI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047327.1 protein_id gnl|my_center|LOCUS_03800 164236 164457 gene locus_tag LOCUS_03810 164236 164457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247706.1 protein_id gnl|my_center|LOCUS_03810 164490 164999 gene locus_tag LOCUS_03820 164490 164999 CDS product phage regulatory CII family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460893.1 protein_id gnl|my_center|LOCUS_03820 165171 165512 gene locus_tag LOCUS_03830 165171 165512 CDS product DUF5347 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996717.1 protein_id gnl|my_center|LOCUS_03830 165580 165813 gene locus_tag LOCUS_03840 165580 165813 CDS product DUF2732 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244218.1 protein_id gnl|my_center|LOCUS_03840 165813 166040 gene locus_tag LOCUS_03850 165813 166040 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752613.1 protein_id gnl|my_center|LOCUS_03850 166037 166894 gene locus_tag LOCUS_03860 166037 166894 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104152.1 protein_id gnl|my_center|LOCUS_03860 166891 169305 gene locus_tag LOCUS_03870 166891 169305 CDS product replication endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017503.1 protein_id gnl|my_center|LOCUS_03870 169458 169646 gene locus_tag LOCUS_03880 169458 169646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001580533.1 protein_id gnl|my_center|LOCUS_03880 169657 169890 gene locus_tag LOCUS_03890 169657 169890 CDS product DinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217561.1 protein_id gnl|my_center|LOCUS_03890 170418 170083 gene locus_tag LOCUS_03900 170418 170083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 170891 171814 gene locus_tag LOCUS_03910 170891 171814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 171977 172939 gene locus_tag LOCUS_03920 171977 172939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 173982 172957 gene locus_tag LOCUS_03930 173982 172957 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208631010.1 protein_id gnl|my_center|LOCUS_03930 175748 173982 gene locus_tag LOCUS_03940 175748 173982 CDS product terminase ATPase subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098422.1 protein_id gnl|my_center|LOCUS_03940 175891 176643 gene locus_tag LOCUS_03950 175891 176643 CDS product GPO family capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216223.1 protein_id gnl|my_center|LOCUS_03950 176780 177208 gene locus_tag LOCUS_03960 gene lysB 176780 177208 CDS product Rz-like lysis system protein LysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162926034.1 protein_id gnl|my_center|LOCUS_03960 177304 177735 gene locus_tag LOCUS_03970 177304 177735 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039939.1 protein_id gnl|my_center|LOCUS_03970 177728 178174 gene locus_tag LOCUS_03980 177728 178174 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829122.1 protein_id gnl|my_center|LOCUS_03980 178922 178116 gene locus_tag LOCUS_03990 178922 178116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 179026 179604 gene locus_tag LOCUS_04000 179026 179604 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993775.1 protein_id gnl|my_center|LOCUS_04000 179601 179960 gene locus_tag LOCUS_04010 179601 179960 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177590.1 protein_id gnl|my_center|LOCUS_04010 179947 180855 gene locus_tag LOCUS_04020 179947 180855 CDS product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039067818.1 protein_id gnl|my_center|LOCUS_04020 180848 181453 gene locus_tag LOCUS_04030 180848 181453 CDS product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086812.1 protein_id gnl|my_center|LOCUS_04030 181450 183072 gene locus_tag LOCUS_04040 181450 183072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 183074 183511 gene locus_tag LOCUS_04050 183074 183511 CDS product tail assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344820.1 protein_id gnl|my_center|LOCUS_04050 184085 183483 gene locus_tag LOCUS_04060 184085 183483 CDS product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548498.1 protein_id gnl|my_center|LOCUS_04060 184627 184085 gene locus_tag LOCUS_04070 184627 184085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 184655 184930 gene locus_tag LOCUS_04080 184655 184930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 184927 185295 gene locus_tag LOCUS_04090 184927 185295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 187525 185840 gene locus_tag LOCUS_04100 187525 185840 CDS product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024876.1 protein_id gnl|my_center|LOCUS_04100 188459 188202 gene locus_tag LOCUS_04110 gene grxA 188459 188202 CDS product glutaredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195240.1 protein_id gnl|my_center|LOCUS_04110 188619 188906 gene locus_tag LOCUS_04120 188619 188906 CDS product DUF1418 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201560.1 protein_id gnl|my_center|LOCUS_04120 188890 189612 gene locus_tag LOCUS_04130 gene nfsA 188890 189612 CDS product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189159.1 protein_id gnl|my_center|LOCUS_04130 189673 190575 gene locus_tag LOCUS_04140 gene rimK 189673 190575 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684321.1 protein_id gnl|my_center|LOCUS_04140 190663 191139 gene locus_tag LOCUS_04150 190663 191139 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203025.1 protein_id gnl|my_center|LOCUS_04150 191490 192602 gene locus_tag LOCUS_04160 gene potF 191490 192602 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126072.1 protein_id gnl|my_center|LOCUS_04160 192697 193830 gene locus_tag LOCUS_04170 gene potG 192697 193830 CDS product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996005.1 protein_id gnl|my_center|LOCUS_04170 193840 194793 gene locus_tag LOCUS_04180 gene potH 193840 194793 CDS product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105436.1 protein_id gnl|my_center|LOCUS_04180 194790 195635 gene locus_tag LOCUS_04190 gene potI 194790 195635 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061665.1 protein_id gnl|my_center|LOCUS_04190 195695 196183 gene locus_tag LOCUS_04200 195695 196183 CDS product YbjO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389260.1 protein_id gnl|my_center|LOCUS_04200 196224 197351 gene locus_tag LOCUS_04210 gene rlmC 196224 197351 CDS product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149709.1 protein_id gnl|my_center|LOCUS_04210 198281 197550 gene locus_tag LOCUS_04220 gene artJ 198281 197550 CDS product ABC transporter substrate-binding protein ArtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295905.1 protein_id gnl|my_center|LOCUS_04220 199240 198572 gene locus_tag LOCUS_04230 gene artM 199240 198572 CDS product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464491.1 protein_id gnl|my_center|LOCUS_04230 199956 199240 gene locus_tag LOCUS_04240 gene artQ 199956 199240 CDS product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001691.1 protein_id gnl|my_center|LOCUS_04240 200694 199963 gene locus_tag LOCUS_04250 gene artJ 200694 199963 CDS product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756569.1 protein_id gnl|my_center|LOCUS_04250 201512 200712 gene locus_tag LOCUS_04260 gene artP 201512 200712 CDS product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027205.1 protein_id gnl|my_center|LOCUS_04260 202173 201658 gene locus_tag LOCUS_04270 202173 201658 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270734.1 protein_id gnl|my_center|LOCUS_04270 202299 202622 gene locus_tag LOCUS_04280 202299 202622 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160737.1 protein_id gnl|my_center|LOCUS_04280 202619 203449 gene locus_tag LOCUS_04290 gene amiD 202619 203449 CDS product N-acetylmuramoyl-L-alanine amidase AmiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255151.1 protein_id gnl|my_center|LOCUS_04290 204495 203446 gene locus_tag LOCUS_04300 204495 203446 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069300.1 protein_id gnl|my_center|LOCUS_04300 205988 204558 gene locus_tag LOCUS_04310 205988 204558 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136554.1 protein_id gnl|my_center|LOCUS_04310 207000 205999 gene locus_tag LOCUS_04320 gene ltaE 207000 205999 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566370.1 protein_id gnl|my_center|LOCUS_04320 208755 207037 gene locus_tag LOCUS_04330 gene poxB 208755 207037 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815337.1 protein_id gnl|my_center|LOCUS_04330 209856 208888 gene locus_tag LOCUS_04340 gene hcr 209856 208888 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178677.1 protein_id gnl|my_center|LOCUS_04340 211520 209868 gene locus_tag LOCUS_04350 gene hcp 211520 209868 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458809.1 protein_id gnl|my_center|LOCUS_04350 212563 211664 gene locus_tag LOCUS_04360 gene lysO 212563 211664 CDS product L-lysine exporter LysO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491142.1 protein_id gnl|my_center|LOCUS_04360 212771 212836 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 213840 213145 gene locus_tag LOCUS_04370 gene aqpZ 213840 213145 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298299.1 protein_id gnl|my_center|LOCUS_04370 214265 215923 gene locus_tag LOCUS_04380 214265 215923 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599802.1 protein_id gnl|my_center|LOCUS_04380 216912 215920 gene locus_tag LOCUS_04390 216912 215920 CDS product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241049.1 protein_id gnl|my_center|LOCUS_04390 217045 218142 gene locus_tag LOCUS_04400 gene macA 217045 218142 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746460.1 protein_id gnl|my_center|LOCUS_04400 218139 220085 gene locus_tag LOCUS_04410 gene macB 218139 220085 CDS product macrolide ABC transporter ATP-binding protein/permease MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188187.1 protein_id gnl|my_center|LOCUS_04410 220382 220158 gene locus_tag LOCUS_04420 gene cspD 220382 220158 CDS product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410785.1 protein_id gnl|my_center|LOCUS_04420 220705 221025 gene locus_tag LOCUS_04430 gene clpS 220705 221025 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520781.1 protein_id gnl|my_center|LOCUS_04430 221199 223331 gene locus_tag LOCUS_04440 gene clpA 221199 223331 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934041.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence03 366 16 gene locus_tag LOCUS_04450 366 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 1112 849 gene locus_tag LOCUS_04460 gene rpsT 1112 849 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274021.1 protein_id gnl|my_center|LOCUS_04460 1495 2382 gene locus_tag LOCUS_04470 gene ribF 1495 2382 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767329.1 protein_id gnl|my_center|LOCUS_04470 2425 5241 gene locus_tag LOCUS_04480 gene ileS 2425 5241 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286857.1 protein_id gnl|my_center|LOCUS_04480 5241 5735 gene locus_tag LOCUS_04490 gene lspA 5241 5735 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083369.1 protein_id gnl|my_center|LOCUS_04490 5860 6309 gene locus_tag LOCUS_04500 gene fkpB 5860 6309 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004655.1 protein_id gnl|my_center|LOCUS_04500 6311 7261 gene locus_tag LOCUS_04510 gene ispH 6311 7261 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166395.1 protein_id gnl|my_center|LOCUS_04510 7327 8241 gene locus_tag LOCUS_04520 gene rihC 7327 8241 CDS product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239137.1 protein_id gnl|my_center|LOCUS_04520 8408 9229 gene locus_tag LOCUS_04530 gene dapB 8408 9229 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543605.1 protein_id gnl|my_center|LOCUS_04530 9438 9271 gene locus_tag LOCUS_04540 9438 9271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 9684 10832 gene locus_tag LOCUS_04550 gene carA 9684 10832 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597260.1 protein_id gnl|my_center|LOCUS_04550 10850 14071 gene locus_tag LOCUS_04560 gene carB 10850 14071 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126376.1 protein_id gnl|my_center|LOCUS_04560 14298 14119 gene locus_tag LOCUS_04570 14298 14119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 14333 14728 gene locus_tag LOCUS_04580 gene caiF 14333 14728 CDS product carnitine metabolism transcriptional regulator CaiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333125.1 protein_id gnl|my_center|LOCUS_04580 15527 14937 gene locus_tag LOCUS_04590 gene caiE 15527 14937 CDS product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122884.1 protein_id gnl|my_center|LOCUS_04590 16318 15533 gene locus_tag LOCUS_04600 gene caiD 16318 15533 CDS product crotonobetainyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295419.1 protein_id gnl|my_center|LOCUS_04600 17980 16427 gene locus_tag LOCUS_04610 gene caiC 17980 16427 CDS product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301863.1 protein_id gnl|my_center|LOCUS_04610 18791 18054 gene locus_tag LOCUS_04620 18791 18054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04620 19270 18851 gene locus_tag LOCUS_04630 19270 18851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04630 20541 19399 gene locus_tag LOCUS_04640 gene caiA 20541 19399 CDS product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347117.1 protein_id gnl|my_center|LOCUS_04640 21912 20572 gene locus_tag LOCUS_04650 gene caiT 21912 20572 CDS product L-carnitine/gamma-butyrobetaine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787109.1 protein_id gnl|my_center|LOCUS_04650 22560 23330 gene locus_tag LOCUS_04660 22560 23330 CDS product electron transfer flavoprotein FixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692204.1 protein_id gnl|my_center|LOCUS_04660 23345 24286 gene locus_tag LOCUS_04670 23345 24286 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091499.1 protein_id gnl|my_center|LOCUS_04670 24337 25623 gene locus_tag LOCUS_04680 24337 25623 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287715.1 protein_id gnl|my_center|LOCUS_04680 25620 25907 gene locus_tag LOCUS_04690 gene fixX 25620 25907 CDS product ferredoxin-like protein FixX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203741.1 protein_id gnl|my_center|LOCUS_04690 25964 27295 gene locus_tag LOCUS_04700 25964 27295 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183198.1 protein_id gnl|my_center|LOCUS_04700 27403 27933 gene locus_tag LOCUS_04710 gene kefF 27403 27933 CDS product glutathione-regulated potassium-efflux system oxidoreductase KefF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600725.1 protein_id gnl|my_center|LOCUS_04710 27926 29788 gene locus_tag LOCUS_04720 gene kefC 27926 29788 CDS product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377194.1 protein_id gnl|my_center|LOCUS_04720 29869 30459 gene locus_tag LOCUS_04730 gene folA 29869 30459 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301983.1 protein_id gnl|my_center|LOCUS_04730 31379 30537 gene locus_tag LOCUS_04740 gene apaH 31379 30537 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257192.1 protein_id gnl|my_center|LOCUS_04740 31763 31386 gene locus_tag LOCUS_04750 gene apaG 31763 31386 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610901.1 protein_id gnl|my_center|LOCUS_04750 32587 31766 gene locus_tag LOCUS_04760 gene rsmA 32587 31766 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065381.1 protein_id gnl|my_center|LOCUS_04760 33573 32584 gene locus_tag LOCUS_04770 gene pdxA 33573 32584 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241277.1 protein_id gnl|my_center|LOCUS_04770 34859 33573 gene locus_tag LOCUS_04780 gene surA 34859 33573 CDS product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800457.1 protein_id gnl|my_center|LOCUS_04780 37266 34912 gene locus_tag LOCUS_04790 gene lptD 37266 34912 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746151.1 protein_id gnl|my_center|LOCUS_04790 37521 38336 gene locus_tag LOCUS_04800 gene djlA 37521 38336 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200579.1 protein_id gnl|my_center|LOCUS_04800 39112 38453 gene locus_tag LOCUS_04810 gene rluA 39112 38453 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525176.1 protein_id gnl|my_center|LOCUS_04810 42030 39124 gene locus_tag LOCUS_04820 gene rapA 42030 39124 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117011.1 protein_id gnl|my_center|LOCUS_04820 44546 42195 gene locus_tag LOCUS_04830 gene polB 44546 42195 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035670.1 protein_id gnl|my_center|LOCUS_04830 45316 44621 gene locus_tag LOCUS_04840 gene araD 45316 44621 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888654.1 protein_id gnl|my_center|LOCUS_04840 45391 45549 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47136 45634 gene locus_tag LOCUS_04850 gene araA 47136 45634 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151734.1 protein_id gnl|my_center|LOCUS_04850 48847 47147 gene locus_tag LOCUS_04860 gene araB 48847 47147 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951772.1 protein_id gnl|my_center|LOCUS_04860 49177 50064 gene locus_tag LOCUS_04870 gene araC 49177 50064 CDS product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300811.1 protein_id gnl|my_center|LOCUS_04870 50150 50914 gene locus_tag LOCUS_04880 50150 50914 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148403.1 protein_id gnl|my_center|LOCUS_04880 51726 51028 gene locus_tag LOCUS_04890 gene thiQ 51726 51028 CDS product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916310.1 protein_id gnl|my_center|LOCUS_04890 53320 51710 gene locus_tag LOCUS_04900 gene thiP 53320 51710 CDS product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235721.1 protein_id gnl|my_center|LOCUS_04900 54279 53296 gene locus_tag LOCUS_04910 gene thiB 54279 53296 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301364.1 protein_id gnl|my_center|LOCUS_04910 56098 54443 gene locus_tag LOCUS_04920 gene sgrR 56098 54443 CDS product DNA-binding transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297366.1 protein_id gnl|my_center|LOCUS_04920 56296 56547 gene locus_tag LOCUS_04930 56296 56547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 56438 57598 gene locus_tag LOCUS_04940 gene setA 56438 57598 CDS product sugar efflux transporter SetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637846.1 protein_id gnl|my_center|LOCUS_04940 58252 57647 gene locus_tag LOCUS_04950 gene leuD 58252 57647 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818228.1 protein_id gnl|my_center|LOCUS_04950 59663 58263 gene locus_tag LOCUS_04960 gene leuC 59663 58263 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140652.1 protein_id gnl|my_center|LOCUS_04960 60757 59666 gene locus_tag LOCUS_04970 gene leuB 60757 59666 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042353.1 protein_id gnl|my_center|LOCUS_04970 62328 60757 gene locus_tag LOCUS_04980 gene leuA 62328 60757 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082850.1 protein_id gnl|my_center|LOCUS_04980 63149 64111 gene locus_tag LOCUS_04990 gene leuO 63149 64111 CDS product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001395589.1 protein_id gnl|my_center|LOCUS_04990 64429 66153 gene locus_tag LOCUS_05000 gene ilvI 64429 66153 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295534.1 protein_id gnl|my_center|LOCUS_05000 66156 66647 gene locus_tag LOCUS_05010 gene ilvN 66156 66647 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300383.1 protein_id gnl|my_center|LOCUS_05010 66827 67831 gene locus_tag LOCUS_05020 gene cra 66827 67831 CDS product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762401.1 protein_id gnl|my_center|LOCUS_05020 68433 68891 gene locus_tag LOCUS_05030 gene mraZ 68433 68891 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295770.1 protein_id gnl|my_center|LOCUS_05030 68893 69834 gene locus_tag LOCUS_05040 gene rsmH 68893 69834 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970479.1 protein_id gnl|my_center|LOCUS_05040 69831 70196 gene locus_tag LOCUS_05050 gene ftsL 69831 70196 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625658.1 protein_id gnl|my_center|LOCUS_05050 70212 71978 gene locus_tag LOCUS_05060 gene ftsI 70212 71978 CDS product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642196.1 protein_id gnl|my_center|LOCUS_05060 71965 73452 gene locus_tag LOCUS_05070 gene murE 71965 73452 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785141.1 protein_id gnl|my_center|LOCUS_05070 73449 74807 gene locus_tag LOCUS_05080 gene murF 73449 74807 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626688.1 protein_id gnl|my_center|LOCUS_05080 74801 75883 gene locus_tag LOCUS_05090 gene mraY 74801 75883 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964131.1 protein_id gnl|my_center|LOCUS_05090 75886 77202 gene locus_tag LOCUS_05100 gene murD 75886 77202 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796481.1 protein_id gnl|my_center|LOCUS_05100 77202 78446 gene locus_tag LOCUS_05110 gene ftsW 77202 78446 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295532.1 protein_id gnl|my_center|LOCUS_05110 78443 79510 gene locus_tag LOCUS_05120 gene murG 78443 79510 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016560.1 protein_id gnl|my_center|LOCUS_05120 79564 81039 gene locus_tag LOCUS_05130 gene murC 79564 81039 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096048.1 protein_id gnl|my_center|LOCUS_05130 81032 81952 gene locus_tag LOCUS_05140 gene ddlB 81032 81952 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130056.1 protein_id gnl|my_center|LOCUS_05140 81954 82784 gene locus_tag LOCUS_05150 gene ftsQ 81954 82784 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075744.1 protein_id gnl|my_center|LOCUS_05150 82781 84043 gene locus_tag LOCUS_05160 gene ftsA 82781 84043 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588474.1 protein_id gnl|my_center|LOCUS_05160 84104 85255 gene locus_tag LOCUS_05170 gene ftsZ 84104 85255 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462776.1 protein_id gnl|my_center|LOCUS_05170 85356 86273 gene locus_tag LOCUS_05180 gene lpxC 85356 86273 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595482.1 protein_id gnl|my_center|LOCUS_05180 86429 87016 gene locus_tag LOCUS_05190 gene secM 86429 87016 CDS product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014321.1 protein_id gnl|my_center|LOCUS_05190 87078 89783 gene locus_tag LOCUS_05200 gene secA 87078 89783 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905789.1 protein_id gnl|my_center|LOCUS_05200 89843 90232 gene locus_tag LOCUS_05210 gene mutT 89843 90232 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736007.1 protein_id gnl|my_center|LOCUS_05210 90645 90448 gene locus_tag LOCUS_05220 gene yacG 90645 90448 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005042.1 protein_id gnl|my_center|LOCUS_05220 91398 90655 gene locus_tag LOCUS_05230 gene zapD 91398 90655 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194734.1 protein_id gnl|my_center|LOCUS_05230 92018 91398 gene locus_tag LOCUS_05240 gene coaE 92018 91398 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269520.1 protein_id gnl|my_center|LOCUS_05240 92243 93286 gene locus_tag LOCUS_05250 gene guaC 92243 93286 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217338.1 protein_id gnl|my_center|LOCUS_05250 94523 93321 gene locus_tag LOCUS_05260 gene hofC 94523 93321 CDS product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157266.1 protein_id gnl|my_center|LOCUS_05260 95898 94513 gene locus_tag LOCUS_05270 gene gspE 95898 94513 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025145.1 protein_id gnl|my_center|LOCUS_05270 96348 95908 gene locus_tag LOCUS_05280 gene ppdD 96348 95908 CDS product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360904.1 protein_id gnl|my_center|LOCUS_05280 97444 96551 gene locus_tag LOCUS_05290 gene nadC 97444 96551 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135174.1 protein_id gnl|my_center|LOCUS_05290 97532 98083 gene locus_tag LOCUS_05300 gene ampD 97532 98083 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923721.1 protein_id gnl|my_center|LOCUS_05300 98080 98934 gene locus_tag LOCUS_05310 gene ampE 98080 98934 CDS product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172005.1 protein_id gnl|my_center|LOCUS_05310 100350 98977 gene locus_tag LOCUS_05320 gene aroP 100350 98977 CDS product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969915.1 protein_id gnl|my_center|LOCUS_05320 100891 101655 gene locus_tag LOCUS_05330 gene pdhR 100891 101655 CDS product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331776.1 protein_id gnl|my_center|LOCUS_05330 101816 104479 gene locus_tag LOCUS_05340 gene aceE 101816 104479 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003820.1 protein_id gnl|my_center|LOCUS_05340 104494 106386 gene locus_tag LOCUS_05350 gene aceF 104494 106386 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963564.1 protein_id gnl|my_center|LOCUS_05350 106678 108135 gene locus_tag LOCUS_05360 gene lpdA 106678 108135 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102483.1 protein_id gnl|my_center|LOCUS_05360 109948 108206 gene locus_tag LOCUS_05370 109948 108206 CDS product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784470.1 protein_id gnl|my_center|LOCUS_05370 110414 113011 gene locus_tag LOCUS_05380 gene acnB 110414 113011 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307570.1 protein_id gnl|my_center|LOCUS_05380 113186 113548 gene locus_tag LOCUS_05390 gene yacL 113186 113548 CDS product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384306.1 protein_id gnl|my_center|LOCUS_05390 114380 113586 gene locus_tag LOCUS_05400 gene speD 114380 113586 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734287.1 protein_id gnl|my_center|LOCUS_05400 115262 114396 gene locus_tag LOCUS_05410 gene speE 115262 114396 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818411.1 protein_id gnl|my_center|LOCUS_05410 115676 115368 gene locus_tag LOCUS_05420 115676 115368 CDS product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295568.1 protein_id gnl|my_center|LOCUS_05420 115881 117431 gene locus_tag LOCUS_05430 gene cueO 115881 117431 CDS product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189647.1 protein_id gnl|my_center|LOCUS_05430 120023 117633 gene locus_tag LOCUS_05440 gene gcd 120023 117633 CDS product quinoprotein glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297052.1 protein_id gnl|my_center|LOCUS_05440 120229 120765 gene locus_tag LOCUS_05450 gene hpt 120229 120765 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683335.1 protein_id gnl|my_center|LOCUS_05450 121468 120806 gene locus_tag LOCUS_05460 gene can 121468 120806 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651599.1 protein_id gnl|my_center|LOCUS_05460 121577 122503 gene locus_tag LOCUS_05470 121577 122503 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150637.1 protein_id gnl|my_center|LOCUS_05470 122500 123270 gene locus_tag LOCUS_05480 122500 123270 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972203.1 protein_id gnl|my_center|LOCUS_05480 123375 123815 gene locus_tag LOCUS_05490 123375 123815 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901987.1 protein_id gnl|my_center|LOCUS_05490 123879 125108 gene locus_tag LOCUS_05500 123879 125108 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277917.1 protein_id gnl|my_center|LOCUS_05500 125492 125112 gene locus_tag LOCUS_05510 gene panD 125492 125112 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621515.1 protein_id gnl|my_center|LOCUS_05510 125766 126668 gene locus_tag LOCUS_05520 gene rpnC 125766 126668 CDS product recombination-promoting nuclease RpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339954.1 protein_id gnl|my_center|LOCUS_05520 127593 126742 gene locus_tag LOCUS_05530 gene panC 127593 126742 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905383.1 protein_id gnl|my_center|LOCUS_05530 128399 127605 gene locus_tag LOCUS_05540 gene panB 128399 127605 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805441.1 protein_id gnl|my_center|LOCUS_05540 129786 128512 gene locus_tag LOCUS_05550 129786 128512 CDS product fimbrial-like adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713138.1 protein_id gnl|my_center|LOCUS_05550 130435 129839 gene locus_tag LOCUS_05560 130435 129839 CDS product fimbrial-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553764.1 protein_id gnl|my_center|LOCUS_05560 131064 130462 gene locus_tag LOCUS_05570 gene yadL 131064 130462 CDS product fimbrial-like protein YadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143205.1 protein_id gnl|my_center|LOCUS_05570 131648 131079 gene locus_tag LOCUS_05580 131648 131079 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591057.1 protein_id gnl|my_center|LOCUS_05580 134265 131665 gene locus_tag LOCUS_05590 gene htrE 134265 131665 CDS product Yad fimbria usher protein HtrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153166.1 protein_id gnl|my_center|LOCUS_05590 135040 134300 gene locus_tag LOCUS_05600 135040 134300 CDS product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465930.1 protein_id gnl|my_center|LOCUS_05600 135729 135145 gene locus_tag LOCUS_05610 135729 135145 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038438.1 protein_id gnl|my_center|LOCUS_05610 136578 136099 gene locus_tag LOCUS_05620 gene folK 136578 136099 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215124.1 protein_id gnl|my_center|LOCUS_05620 137939 136575 gene locus_tag LOCUS_05630 gene pcnB 137939 136575 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723084.1 protein_id gnl|my_center|LOCUS_05630 138958 138032 gene locus_tag LOCUS_05640 gene gluQRS 138958 138032 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937424.1 protein_id gnl|my_center|LOCUS_05640 139450 138995 gene locus_tag LOCUS_05650 gene dksA 139450 138995 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155227.1 protein_id gnl|my_center|LOCUS_05650 140332 139628 gene locus_tag LOCUS_05660 gene sfsA 140332 139628 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000396036.1 protein_id gnl|my_center|LOCUS_05660 140877 140347 gene locus_tag LOCUS_05670 gene thpR 140877 140347 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294700.1 protein_id gnl|my_center|LOCUS_05670 140906 143380 gene locus_tag LOCUS_05680 gene hrpB 140906 143380 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938639.1 protein_id gnl|my_center|LOCUS_05680 143383 143589 gene locus_tag LOCUS_05690 143383 143589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 143576 146101 gene locus_tag LOCUS_05700 gene mrcB 143576 146101 CDS product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918166.1 protein_id gnl|my_center|LOCUS_05700 146321 148564 gene locus_tag LOCUS_05710 gene fhuA 146321 148564 CDS product ferrichrome porin FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124438.1 protein_id gnl|my_center|LOCUS_05710 148615 149412 gene locus_tag LOCUS_05720 gene fhuC 148615 149412 CDS product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158929.1 protein_id gnl|my_center|LOCUS_05720 149412 150302 gene locus_tag LOCUS_05730 gene fhuD 149412 150302 CDS product Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310529.1 protein_id gnl|my_center|LOCUS_05730 150299 152281 gene locus_tag LOCUS_05740 gene fhuB 150299 152281 CDS product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044072.1 protein_id gnl|my_center|LOCUS_05740 153719 152439 gene locus_tag LOCUS_05750 gene hemL 153719 152439 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045290.1 protein_id gnl|my_center|LOCUS_05750 153944 155365 gene locus_tag LOCUS_05760 gene clcA 153944 155365 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845394.1 protein_id gnl|my_center|LOCUS_05760 155447 155791 gene locus_tag LOCUS_05770 gene erpA 155447 155791 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295564.1 protein_id gnl|my_center|LOCUS_05770 156461 155838 gene locus_tag LOCUS_05780 156461 155838 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964221.1 protein_id gnl|my_center|LOCUS_05780 157299 156499 gene locus_tag LOCUS_05790 gene btuF 157299 156499 CDS product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129927.1 protein_id gnl|my_center|LOCUS_05790 157990 157292 gene locus_tag LOCUS_05800 gene mtnN 157990 157292 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689844.1 protein_id gnl|my_center|LOCUS_05800 158074 159591 gene locus_tag LOCUS_05810 gene dgt 158074 159591 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057067.1 protein_id gnl|my_center|LOCUS_05810 159721 161145 gene locus_tag LOCUS_05820 gene degP 159721 161145 CDS product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753946.1 protein_id gnl|my_center|LOCUS_05820 161300 162457 gene locus_tag LOCUS_05830 gene cdaR 161300 162457 CDS product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929439.1 protein_id gnl|my_center|LOCUS_05830 162932 162546 gene locus_tag LOCUS_05840 162932 162546 CDS product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272188.1 protein_id gnl|my_center|LOCUS_05840 163906 163094 gene locus_tag LOCUS_05850 gene yaeI 163906 163094 CDS product phosphodiesterase YaeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625631.1 protein_id gnl|my_center|LOCUS_05850 164784 163960 gene locus_tag LOCUS_05860 gene dapD 164784 163960 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186650.1 protein_id gnl|my_center|LOCUS_05860 167487 164815 gene locus_tag LOCUS_05870 gene glnD 167487 164815 CDS product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094571.1 protein_id gnl|my_center|LOCUS_05870 168343 167549 gene locus_tag LOCUS_05880 gene map 168343 167549 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018194.1 protein_id gnl|my_center|LOCUS_05880 168711 169436 gene locus_tag LOCUS_05890 gene rpsB 168711 169436 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246882.1 protein_id gnl|my_center|LOCUS_05890 169694 170545 gene locus_tag LOCUS_05900 gene tsf 169694 170545 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818114.1 protein_id gnl|my_center|LOCUS_05900 170692 171417 gene locus_tag LOCUS_05910 gene pyrH 170692 171417 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224573.1 protein_id gnl|my_center|LOCUS_05910 171709 172266 gene locus_tag LOCUS_05920 gene frr 171709 172266 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622418.1 protein_id gnl|my_center|LOCUS_05920 172358 173554 gene locus_tag LOCUS_05930 gene ispC 172358 173554 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811923.1 protein_id gnl|my_center|LOCUS_05930 173740 174501 gene locus_tag LOCUS_05940 gene ispU 173740 174501 CDS product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979579.1 protein_id gnl|my_center|LOCUS_05940 174622 175371 gene locus_tag LOCUS_05950 gene cdsA 174622 175371 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922446.1 protein_id gnl|my_center|LOCUS_05950 175383 176735 gene locus_tag LOCUS_05960 gene rseP 175383 176735 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295561.1 protein_id gnl|my_center|LOCUS_05960 176765 179197 gene locus_tag LOCUS_05970 gene bamA 176765 179197 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240896.1 protein_id gnl|my_center|LOCUS_05970 179319 179804 gene locus_tag LOCUS_05980 gene skp 179319 179804 CDS product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758956.1 protein_id gnl|my_center|LOCUS_05980 179808 180833 gene locus_tag LOCUS_05990 gene lpxD 179808 180833 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139279.1 protein_id gnl|my_center|LOCUS_05990 180938 181393 gene locus_tag LOCUS_06000 gene fabZ 180938 181393 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210739.1 protein_id gnl|my_center|LOCUS_06000 181397 182185 gene locus_tag LOCUS_06010 gene lpxA 181397 182185 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565966.1 protein_id gnl|my_center|LOCUS_06010 182185 183333 gene locus_tag LOCUS_06020 gene lpxB 182185 183333 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139654.1 protein_id gnl|my_center|LOCUS_06020 183330 183926 gene locus_tag LOCUS_06030 gene rnhB 183330 183926 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569423.1 protein_id gnl|my_center|LOCUS_06030 183963 187445 gene locus_tag LOCUS_06040 gene dnaE 183963 187445 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294769.1 protein_id gnl|my_center|LOCUS_06040 187458 188417 gene locus_tag LOCUS_06050 gene accA 187458 188417 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055746.1 protein_id gnl|my_center|LOCUS_06050 188516 190657 gene locus_tag LOCUS_06060 gene ldcC 188516 190657 CDS product lysine decarboxylase LdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020973.1 protein_id gnl|my_center|LOCUS_06060 190714 191103 gene locus_tag LOCUS_06070 190714 191103 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901098.1 protein_id gnl|my_center|LOCUS_06070 191168 192466 gene locus_tag LOCUS_06080 gene tilS 191168 192466 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602174.1 protein_id gnl|my_center|LOCUS_06080 192775 192515 gene locus_tag LOCUS_06090 gene rof 192775 192515 CDS product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062312.1 protein_id gnl|my_center|LOCUS_06090 192962 192762 gene locus_tag LOCUS_06100 192962 192762 CDS product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417058.1 protein_id gnl|my_center|LOCUS_06100 193128 193673 gene locus_tag LOCUS_06110 193128 193673 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185290.1 protein_id gnl|my_center|LOCUS_06110 193670 194092 gene locus_tag LOCUS_06120 gene arfB 193670 194092 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635545.1 protein_id gnl|my_center|LOCUS_06120 194106 194816 gene locus_tag LOCUS_06130 gene nlpE 194106 194816 CDS product envelope stress response activation lipoprotein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239181.1 protein_id gnl|my_center|LOCUS_06130 195840 195016 gene locus_tag LOCUS_06140 195840 195016 CDS product YaeF family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336393.1 protein_id gnl|my_center|LOCUS_06140 197611 195893 gene locus_tag LOCUS_06150 gene proS 197611 195893 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260712.1 protein_id gnl|my_center|LOCUS_06150 198429 197722 gene locus_tag LOCUS_06160 198429 197722 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094011.1 protein_id gnl|my_center|LOCUS_06160 198830 198426 gene locus_tag LOCUS_06170 gene rcsF 198830 198426 CDS product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202329.1 protein_id gnl|my_center|LOCUS_06170 199763 198948 gene locus_tag LOCUS_06180 gene metQ 199763 198948 CDS product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874224.1 protein_id gnl|my_center|LOCUS_06180 200456 199803 gene locus_tag LOCUS_06190 200456 199803 CDS product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294600.1 protein_id gnl|my_center|LOCUS_06190 201480 200449 gene locus_tag LOCUS_06200 gene metN 201480 200449 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593994.1 protein_id gnl|my_center|LOCUS_06200 201668 202240 gene locus_tag LOCUS_06210 gene gmhB 201668 202240 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140174.1 protein_id gnl|my_center|LOCUS_06210 >Feature sequence04 263 1321 gene locus_tag LOCUS_06220 gene rsxD 263 1321 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231922.1 protein_id gnl|my_center|LOCUS_06220 1325 1945 gene locus_tag LOCUS_06230 gene rsxG 1325 1945 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920799.1 protein_id gnl|my_center|LOCUS_06230 1949 2644 gene locus_tag LOCUS_06240 gene rsxE 1949 2644 CDS product electron transport complex subunit RsxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289652.1 protein_id gnl|my_center|LOCUS_06240 2644 3279 gene locus_tag LOCUS_06250 gene nth 2644 3279 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030339.1 protein_id gnl|my_center|LOCUS_06250 3890 5392 gene locus_tag LOCUS_06260 gene dtpA 3890 5392 CDS product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100932.1 protein_id gnl|my_center|LOCUS_06260 5498 6103 gene locus_tag LOCUS_06270 gene gstA 5498 6103 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765749.1 protein_id gnl|my_center|LOCUS_06270 7007 6147 gene locus_tag LOCUS_06280 gene pdxY 7007 6147 CDS product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789751.1 protein_id gnl|my_center|LOCUS_06280 8343 7069 gene locus_tag LOCUS_06290 gene tyrS 8343 7069 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295400.1 protein_id gnl|my_center|LOCUS_06290 9128 8472 gene locus_tag LOCUS_06300 gene pdxH 9128 8472 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282319.1 protein_id gnl|my_center|LOCUS_06300 9516 9187 gene locus_tag LOCUS_06310 gene mliC 9516 9187 CDS product C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178044.1 protein_id gnl|my_center|LOCUS_06310 10723 9614 gene locus_tag LOCUS_06320 gene anmK 10723 9614 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835077.1 protein_id gnl|my_center|LOCUS_06320 10997 11464 gene locus_tag LOCUS_06330 gene slyB 10997 11464 CDS product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597196.1 protein_id gnl|my_center|LOCUS_06330 11945 11511 gene locus_tag LOCUS_06340 gene slyA 11945 11511 CDS product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296943.1 protein_id gnl|my_center|LOCUS_06340 12146 12382 gene locus_tag LOCUS_06350 12146 12382 CDS product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670998.1 protein_id gnl|my_center|LOCUS_06350 12385 13242 gene locus_tag LOCUS_06360 12385 13242 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296942.1 protein_id gnl|my_center|LOCUS_06360 13242 15254 gene locus_tag LOCUS_06370 13242 15254 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994333.1 protein_id gnl|my_center|LOCUS_06370 15776 15255 gene locus_tag LOCUS_06380 gene sodC 15776 15255 CDS product superoxide dismutase [Cu-Zn] SodC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296937.1 protein_id gnl|my_center|LOCUS_06380 16753 15857 gene locus_tag LOCUS_06390 16753 15857 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250656.1 protein_id gnl|my_center|LOCUS_06390 17144 17743 gene locus_tag LOCUS_06400 gene nemR 17144 17743 CDS product DNA-binding transcriptional regulator NemR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032936.1 protein_id gnl|my_center|LOCUS_06400 17780 18877 gene locus_tag LOCUS_06410 gene nemA 17780 18877 CDS product N-ethylmaleimide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093589.1 protein_id gnl|my_center|LOCUS_06410 18958 19365 gene locus_tag LOCUS_06420 gene gloA 18958 19365 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237796.1 protein_id gnl|my_center|LOCUS_06420 19468 20115 gene locus_tag LOCUS_06430 gene rnt 19468 20115 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282281.1 protein_id gnl|my_center|LOCUS_06430 20208 24824 gene locus_tag LOCUS_06440 20208 24824 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310858.1 protein_id gnl|my_center|LOCUS_06440 25222 24875 gene locus_tag LOCUS_06450 gene grxD 25222 24875 CDS product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108172.1 protein_id gnl|my_center|LOCUS_06450 25456 25304 gene locus_tag LOCUS_06460 25456 25304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 25556 26371 gene locus_tag LOCUS_06470 gene mepH 25556 26371 CDS product peptidoglycan DD-endopeptidase MepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101193.1 protein_id gnl|my_center|LOCUS_06470 26499 27080 gene locus_tag LOCUS_06480 gene sodB 26499 27080 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007283.1 protein_id gnl|my_center|LOCUS_06480 28484 27315 gene locus_tag LOCUS_06490 28484 27315 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701040.1 protein_id gnl|my_center|LOCUS_06490 29038 30063 gene locus_tag LOCUS_06500 gene purR 29038 30063 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190982.1 protein_id gnl|my_center|LOCUS_06500 30992 30060 gene locus_tag LOCUS_06510 gene punR 30992 30060 CDS product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269493.1 protein_id gnl|my_center|LOCUS_06510 31105 32316 gene locus_tag LOCUS_06520 gene punC 31105 32316 CDS product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182363.1 protein_id gnl|my_center|LOCUS_06520 32607 33755 gene locus_tag LOCUS_06530 gene cfa 32607 33755 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098896.1 protein_id gnl|my_center|LOCUS_06530 34436 33795 gene locus_tag LOCUS_06540 gene ribE 34436 33795 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493947.1 protein_id gnl|my_center|LOCUS_06540 34651 36024 gene locus_tag LOCUS_06550 gene mdtK 34651 36024 CDS product multidrug efflux MATE transporter MdtK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174940.1 protein_id gnl|my_center|LOCUS_06550 37321 36065 gene locus_tag LOCUS_06560 37321 36065 CDS product AIDA repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534291.1 protein_id gnl|my_center|LOCUS_06560 37629 37705 gene locus_tag LOCUS_t00110 37629 37705 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 37710 37786 gene locus_tag LOCUS_t00120 37710 37786 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 37894 38199 gene locus_tag LOCUS_06570 37894 38199 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212678.1 protein_id gnl|my_center|LOCUS_06570 38325 39929 gene locus_tag LOCUS_06580 38325 39929 CDS product FAD-NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716950.1 protein_id gnl|my_center|LOCUS_06580 40705 39941 gene locus_tag LOCUS_06590 gene ydhT 40705 39941 CDS product protein YdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587525.1 protein_id gnl|my_center|LOCUS_06590 41542 40757 gene locus_tag LOCUS_06600 41542 40757 CDS product thiosulfate reductase cytochrome B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069979.1 protein_id gnl|my_center|LOCUS_06600 42093 41539 gene locus_tag LOCUS_06610 42093 41539 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310861.1 protein_id gnl|my_center|LOCUS_06610 42909 42271 gene locus_tag LOCUS_06620 42909 42271 CDS product YdhW family putative oxidoreductase system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517579.1 protein_id gnl|my_center|LOCUS_06620 45024 42922 gene locus_tag LOCUS_06630 45024 42922 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273527.1 protein_id gnl|my_center|LOCUS_06630 45671 45045 gene locus_tag LOCUS_06640 45671 45045 CDS product ferredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070230.1 protein_id gnl|my_center|LOCUS_06640 46335 46126 gene locus_tag LOCUS_06650 gene fumD 46335 46126 CDS product fumarate hydratase FumD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528342.1 protein_id gnl|my_center|LOCUS_06650 46892 48304 gene locus_tag LOCUS_06660 gene pykF 46892 48304 CDS product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295403.1 protein_id gnl|my_center|LOCUS_06660 48615 48851 gene locus_tag LOCUS_06670 gene lpp 48615 48851 CDS product murein lipoprotein Lpp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648420.1 protein_id gnl|my_center|LOCUS_06670 49919 48915 gene locus_tag LOCUS_06680 gene ldtE 49919 48915 CDS product L,D-transpeptidase LdtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817105.1 protein_id gnl|my_center|LOCUS_06680 50484 50068 gene locus_tag LOCUS_06690 gene sufE 50484 50068 CDS product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196530.1 protein_id gnl|my_center|LOCUS_06690 51717 50497 gene locus_tag LOCUS_06700 gene sufS 51717 50497 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144575.1 protein_id gnl|my_center|LOCUS_06700 52985 51714 gene locus_tag LOCUS_06710 gene sufD 52985 51714 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908012.1 protein_id gnl|my_center|LOCUS_06710 53706 52960 gene locus_tag LOCUS_06720 gene sufC 53706 52960 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948865.1 protein_id gnl|my_center|LOCUS_06720 55203 53716 gene locus_tag LOCUS_06730 gene sufB 55203 53716 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089364.1 protein_id gnl|my_center|LOCUS_06730 55580 55212 gene locus_tag LOCUS_06740 gene sufA 55580 55212 CDS product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367160.1 protein_id gnl|my_center|LOCUS_06740 56316 56128 gene locus_tag LOCUS_06750 56316 56128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 56826 56416 gene locus_tag LOCUS_06760 gene menI 56826 56416 CDS product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637982.1 protein_id gnl|my_center|LOCUS_06760 59879 56823 gene locus_tag LOCUS_06770 59879 56823 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612968.1 protein_id gnl|my_center|LOCUS_06770 60268 61380 gene locus_tag LOCUS_06780 gene ydiK 60268 61380 CDS product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248636.1 protein_id gnl|my_center|LOCUS_06780 61809 62165 gene locus_tag LOCUS_06790 61809 62165 CDS product YdiL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301287.1 protein_id gnl|my_center|LOCUS_06790 62298 62624 gene locus_tag LOCUS_06800 62298 62624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06800 62624 63478 gene locus_tag LOCUS_06810 62624 63478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06810 63705 64970 gene locus_tag LOCUS_06820 63705 64970 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081197.1 protein_id gnl|my_center|LOCUS_06820 64982 65848 gene locus_tag LOCUS_06830 gene ydiB 64982 65848 CDS product quinate/shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383469.1 protein_id gnl|my_center|LOCUS_06830 65879 66637 gene locus_tag LOCUS_06840 gene aroD 65879 66637 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860167.1 protein_id gnl|my_center|LOCUS_06840 66782 68377 gene locus_tag LOCUS_06850 66782 68377 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805700.1 protein_id gnl|my_center|LOCUS_06850 68391 69542 gene locus_tag LOCUS_06860 68391 69542 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347850.1 protein_id gnl|my_center|LOCUS_06860 70496 69585 gene locus_tag LOCUS_06870 70496 69585 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284784.1 protein_id gnl|my_center|LOCUS_06870 70812 71576 gene locus_tag LOCUS_06880 70812 71576 CDS product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692148.1 protein_id gnl|my_center|LOCUS_06880 71596 72534 gene locus_tag LOCUS_06890 71596 72534 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080700.1 protein_id gnl|my_center|LOCUS_06890 72590 73879 gene locus_tag LOCUS_06900 72590 73879 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278525.1 protein_id gnl|my_center|LOCUS_06900 73876 74169 gene locus_tag LOCUS_06910 73876 74169 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081071.1 protein_id gnl|my_center|LOCUS_06910 74172 75872 gene locus_tag LOCUS_06920 gene fadK 74172 75872 CDS product medium-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553704.1 protein_id gnl|my_center|LOCUS_06920 78307 75929 gene locus_tag LOCUS_06930 gene ppsA 78307 75929 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069375.1 protein_id gnl|my_center|LOCUS_06930 78721 79473 gene locus_tag LOCUS_06940 gene ppsR 78721 79473 CDS product posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368046.1 protein_id gnl|my_center|LOCUS_06940 79630 80676 gene locus_tag LOCUS_06950 gene aroH 79630 80676 CDS product 3-deoxy-7-phosphoheptulonate synthase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082229.1 protein_id gnl|my_center|LOCUS_06950 80781 80999 gene locus_tag LOCUS_06960 gene hemP 80781 80999 CDS product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966807.1 protein_id gnl|my_center|LOCUS_06960 82439 81003 gene locus_tag LOCUS_06970 gene selO 82439 81003 CDS product protein adenylyltransferase SelO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175576.1 protein_id gnl|my_center|LOCUS_06970 83044 82502 gene locus_tag LOCUS_06980 83044 82502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06980 83925 83461 gene locus_tag LOCUS_06990 83925 83461 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209795.1 protein_id gnl|my_center|LOCUS_06990 84752 84003 gene locus_tag LOCUS_07000 gene btuD 84752 84003 CDS product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029466.1 protein_id gnl|my_center|LOCUS_07000 85303 84752 gene locus_tag LOCUS_07010 gene btuE 85303 84752 CDS product bifunctional thioredoxin/glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154168.1 protein_id gnl|my_center|LOCUS_07010 86346 85366 gene locus_tag LOCUS_07020 gene btuC 86346 85366 CDS product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956528.1 protein_id gnl|my_center|LOCUS_07020 86746 86447 gene locus_tag LOCUS_07030 gene ihfA 86746 86447 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229265.1 protein_id gnl|my_center|LOCUS_07030 89138 86751 gene locus_tag LOCUS_07040 gene pheT 89138 86751 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672380.1 protein_id gnl|my_center|LOCUS_07040 90136 89153 gene locus_tag LOCUS_07050 gene pheS 90136 89153 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018596.1 protein_id gnl|my_center|LOCUS_07050 90943 90587 gene locus_tag LOCUS_07060 gene rplT 90943 90587 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124850.1 protein_id gnl|my_center|LOCUS_07060 91193 90996 gene locus_tag LOCUS_07070 gene rpmI 91193 90996 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124225.1 protein_id gnl|my_center|LOCUS_07070 91724 91290 gene locus_tag LOCUS_07080 gene infC 91724 91290 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058403.1 protein_id gnl|my_center|LOCUS_07080 93764 91836 gene locus_tag LOCUS_07090 gene thrS 93764 91836 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144202.1 protein_id gnl|my_center|LOCUS_07090 94286 94759 gene locus_tag LOCUS_07100 94286 94759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07100 95379 96185 gene locus_tag LOCUS_07110 95379 96185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 97227 96517 gene locus_tag LOCUS_07120 97227 96517 CDS product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771391.1 protein_id gnl|my_center|LOCUS_07120 97562 98491 gene locus_tag LOCUS_07130 gene pfkB 97562 98491 CDS product 6-phosphofructokinase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251727.1 protein_id gnl|my_center|LOCUS_07130 98592 98882 gene locus_tag LOCUS_07140 gene ghoS 98592 98882 CDS product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146159.1 protein_id gnl|my_center|LOCUS_07140 98988 99848 gene locus_tag LOCUS_07150 98988 99848 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267650.1 protein_id gnl|my_center|LOCUS_07150 100425 99889 gene locus_tag LOCUS_07160 100425 99889 CDS product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222172.1 protein_id gnl|my_center|LOCUS_07160 100572 101240 gene locus_tag LOCUS_07170 gene hxpB 100572 101240 CDS product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106833.1 protein_id gnl|my_center|LOCUS_07170 101403 101993 gene locus_tag LOCUS_07180 101403 101993 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295408.1 protein_id gnl|my_center|LOCUS_07180 102126 103517 gene locus_tag LOCUS_07190 gene tcyP 102126 103517 CDS product cystine/sulfocysteine:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010696.1 protein_id gnl|my_center|LOCUS_07190 104324 103542 gene locus_tag LOCUS_07200 gene ydjO 104324 103542 CDS product protein YdjO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310874.1 protein_id gnl|my_center|LOCUS_07200 104768 104613 gene locus_tag LOCUS_07210 104768 104613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 105059 107320 gene locus_tag LOCUS_07220 gene katE 105059 107320 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077825.1 protein_id gnl|my_center|LOCUS_07220 108327 107578 gene locus_tag LOCUS_07230 gene chbG 108327 107578 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440471.1 protein_id gnl|my_center|LOCUS_07230 109692 108340 gene locus_tag LOCUS_07240 gene celF 109692 108340 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078748.1 protein_id gnl|my_center|LOCUS_07240 110636 109797 gene locus_tag LOCUS_07250 gene chbR 110636 109797 CDS product transcriptional regulator ChbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983647.1 protein_id gnl|my_center|LOCUS_07250 110997 110647 gene locus_tag LOCUS_07260 gene chbA 110997 110647 CDS product PTS N,N'-diacetylchitobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968919.1 protein_id gnl|my_center|LOCUS_07260 112406 111048 gene locus_tag LOCUS_07270 gene chbC 112406 111048 CDS product PTS N,N'-diacetylchitobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073041.1 protein_id gnl|my_center|LOCUS_07270 112811 112491 gene locus_tag LOCUS_07280 gene chbB 112811 112491 CDS product PTS N,N'-diacetylchitobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412169.1 protein_id gnl|my_center|LOCUS_07280 113448 113110 gene locus_tag LOCUS_07290 gene osmE 113448 113110 CDS product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039044.1 protein_id gnl|my_center|LOCUS_07290 113650 114477 gene locus_tag LOCUS_07300 gene nadE 113650 114477 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175037.1 protein_id gnl|my_center|LOCUS_07300 114707 115594 gene locus_tag LOCUS_07310 gene cho 114707 115594 CDS product excinuclease Cho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252397.1 protein_id gnl|my_center|LOCUS_07310 116192 115554 gene locus_tag LOCUS_07320 gene ves 116192 115554 CDS product environmental stress-induced protein Ves inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300480.1 protein_id gnl|my_center|LOCUS_07320 116817 116332 gene locus_tag LOCUS_07330 gene spy 116817 116332 CDS product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228984.1 protein_id gnl|my_center|LOCUS_07330 118115 117147 gene locus_tag LOCUS_07340 gene astE 118115 117147 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368506.1 protein_id gnl|my_center|LOCUS_07340 119451 118108 gene locus_tag LOCUS_07350 gene astB 119451 118108 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994973.1 protein_id gnl|my_center|LOCUS_07350 120926 119448 gene locus_tag LOCUS_07360 gene astD 120926 119448 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177212.1 protein_id gnl|my_center|LOCUS_07360 121957 120923 gene locus_tag LOCUS_07370 gene astA 121957 120923 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989419.1 protein_id gnl|my_center|LOCUS_07370 123174 121954 gene locus_tag LOCUS_07380 gene astC 123174 121954 CDS product succinylornithine/acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081983.1 protein_id gnl|my_center|LOCUS_07380 123620 124426 gene locus_tag LOCUS_07390 gene xthA 123620 124426 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673918.1 protein_id gnl|my_center|LOCUS_07390 124593 125303 gene locus_tag LOCUS_07400 124593 125303 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309538.1 protein_id gnl|my_center|LOCUS_07400 125331 125948 gene locus_tag LOCUS_07410 gene ydjY 125331 125948 CDS product lipoprotein YdjY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077942.1 protein_id gnl|my_center|LOCUS_07410 125963 126670 gene locus_tag LOCUS_07420 125963 126670 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975812.1 protein_id gnl|my_center|LOCUS_07420 126670 127218 gene locus_tag LOCUS_07430 126670 127218 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524097.1 protein_id gnl|my_center|LOCUS_07430 127228 128394 gene locus_tag LOCUS_07440 127228 128394 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215339.1 protein_id gnl|my_center|LOCUS_07440 128400 129902 gene locus_tag LOCUS_07450 128400 129902 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224958.1 protein_id gnl|my_center|LOCUS_07450 129902 130555 gene locus_tag LOCUS_07460 129902 130555 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300558.1 protein_id gnl|my_center|LOCUS_07460 130622 131929 gene locus_tag LOCUS_07470 gene ynjE 130622 131929 CDS product thiosulfate sulfurtransferase YnjE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350515.1 protein_id gnl|my_center|LOCUS_07470 132558 131938 gene locus_tag LOCUS_07480 132558 131938 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295484.1 protein_id gnl|my_center|LOCUS_07480 132645 133052 gene locus_tag LOCUS_07490 gene nudG 132645 133052 CDS product CTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781888.1 protein_id gnl|my_center|LOCUS_07490 133290 133018 gene locus_tag LOCUS_07500 133290 133018 CDS product YnjH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085240.1 protein_id gnl|my_center|LOCUS_07500 133526 134869 gene locus_tag LOCUS_07510 gene gdhA 133526 134869 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373021.1 protein_id gnl|my_center|LOCUS_07510 136026 134986 gene locus_tag LOCUS_07520 136026 134986 CDS product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756910.1 protein_id gnl|my_center|LOCUS_07520 138115 136154 gene locus_tag LOCUS_07530 gene topB 138115 136154 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235800.1 protein_id gnl|my_center|LOCUS_07530 139163 138120 gene locus_tag LOCUS_07540 gene selD 139163 138120 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295485.1 protein_id gnl|my_center|LOCUS_07540 139831 139280 gene locus_tag LOCUS_07550 139831 139280 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339283.1 protein_id gnl|my_center|LOCUS_07550 139992 141848 gene locus_tag LOCUS_07560 gene sppA 139992 141848 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259810.1 protein_id gnl|my_center|LOCUS_07560 142015 143031 gene locus_tag LOCUS_07570 gene ansA 142015 143031 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170162.1 protein_id gnl|my_center|LOCUS_07570 143042 143683 gene locus_tag LOCUS_07580 143042 143683 CDS product bifunctional pyrazinamidase/nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135066.1 protein_id gnl|my_center|LOCUS_07580 145134 143776 gene locus_tag LOCUS_07590 145134 143776 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438807.1 protein_id gnl|my_center|LOCUS_07590 146010 145252 gene locus_tag LOCUS_07600 146010 145252 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719088.1 protein_id gnl|my_center|LOCUS_07600 147127 146147 gene locus_tag LOCUS_07610 gene ydjG 147127 146147 CDS product NADH-dependent methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723719.1 protein_id gnl|my_center|LOCUS_07610 148084 147137 gene locus_tag LOCUS_07620 148084 147137 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369231.1 protein_id gnl|my_center|LOCUS_07620 148925 148089 gene locus_tag LOCUS_07630 148925 148089 CDS product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878903.1 protein_id gnl|my_center|LOCUS_07630 149923 148946 gene locus_tag LOCUS_07640 149923 148946 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798110.1 protein_id gnl|my_center|LOCUS_07640 151385 150006 gene locus_tag LOCUS_07650 151385 150006 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435282.1 protein_id gnl|my_center|LOCUS_07650 152488 151412 gene locus_tag LOCUS_07660 152488 151412 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645221.1 protein_id gnl|my_center|LOCUS_07660 153130 152858 gene locus_tag LOCUS_07670 153130 152858 CDS product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046791.1 protein_id gnl|my_center|LOCUS_07670 153585 153172 gene locus_tag LOCUS_07680 gene msrB 153585 153172 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284618.1 protein_id gnl|my_center|LOCUS_07680 153927 154922 gene locus_tag LOCUS_07690 gene gapA 153927 154922 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153502.1 protein_id gnl|my_center|LOCUS_07690 155006 155890 gene locus_tag LOCUS_07700 155006 155890 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299317.1 protein_id gnl|my_center|LOCUS_07700 156792 155938 gene locus_tag LOCUS_07710 gene yeaE 156792 155938 CDS product methylglyoxal reductase YeaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186371.1 protein_id gnl|my_center|LOCUS_07710 157628 156882 gene locus_tag LOCUS_07720 gene mipA 157628 156882 CDS product scaffolding protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163771.1 protein_id gnl|my_center|LOCUS_07720 158193 159998 gene locus_tag LOCUS_07730 gene yeaG 158193 159998 CDS product protein kinase YeaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019882.1 protein_id gnl|my_center|LOCUS_07730 160111 161394 gene locus_tag LOCUS_07740 160111 161394 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219686.1 protein_id gnl|my_center|LOCUS_07740 161541 163016 gene locus_tag LOCUS_07750 161541 163016 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616433.1 protein_id gnl|my_center|LOCUS_07750 163197 164687 gene locus_tag LOCUS_07760 gene dgcJ 163197 164687 CDS product diguanylate cyclase DgcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766132.1 protein_id gnl|my_center|LOCUS_07760 164730 165233 gene locus_tag LOCUS_07770 gene yeaK 164730 165233 CDS product mischarged aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138051.1 protein_id gnl|my_center|LOCUS_07770 165508 165954 gene locus_tag LOCUS_07780 165508 165954 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460707.1 protein_id gnl|my_center|LOCUS_07780 166345 165911 gene locus_tag LOCUS_07790 166345 165911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 166829 168010 gene locus_tag LOCUS_07800 gene nimT 166829 168010 CDS product 2-nitroimidazole transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128491.1 protein_id gnl|my_center|LOCUS_07800 168065 168412 gene locus_tag LOCUS_07810 168065 168412 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297652.1 protein_id gnl|my_center|LOCUS_07810 168688 168434 gene locus_tag LOCUS_07820 gene yoaF 168688 168434 CDS product DUF333 domain-containing lipoprotein YoaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691930.1 protein_id gnl|my_center|LOCUS_07820 168871 169896 gene locus_tag LOCUS_07830 gene dgcP 168871 169896 CDS product diguanylate cyclase DgcP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306169.1 protein_id gnl|my_center|LOCUS_07830 170411 170163 gene locus_tag LOCUS_07840 170411 170163 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512153.1 protein_id gnl|my_center|LOCUS_07840 170741 170559 gene locus_tag LOCUS_07850 170741 170559 CDS product DUF1869 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513737.1 protein_id gnl|my_center|LOCUS_07850 170969 170745 gene locus_tag LOCUS_07860 170969 170745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 >Feature sequence05 1389 31 gene locus_tag LOCUS_07870 1389 31 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409873.1 protein_id gnl|my_center|LOCUS_07870 2096 4399 gene locus_tag LOCUS_07880 gene pgaA 2096 4399 CDS product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287458.1 protein_id gnl|my_center|LOCUS_07880 4408 6426 gene locus_tag LOCUS_07890 gene pgaB 4408 6426 CDS product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945561.1 protein_id gnl|my_center|LOCUS_07890 6539 7744 gene locus_tag LOCUS_07900 gene pgaC 6539 7744 CDS product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610451.1 protein_id gnl|my_center|LOCUS_07900 7746 8159 gene locus_tag LOCUS_07910 gene pgaD 7746 8159 CDS product poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061095.1 protein_id gnl|my_center|LOCUS_07910 8997 8209 gene locus_tag LOCUS_07920 8997 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 10889 9618 gene locus_tag LOCUS_07930 gene efeB 10889 9618 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199471.1 protein_id gnl|my_center|LOCUS_07930 12022 10895 gene locus_tag LOCUS_07940 gene efeO 12022 10895 CDS product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154398.1 protein_id gnl|my_center|LOCUS_07940 12910 12080 gene locus_tag LOCUS_07950 12910 12080 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497942.1 protein_id gnl|my_center|LOCUS_07950 14961 13453 gene locus_tag LOCUS_07960 gene putP 14961 13453 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018486.1 protein_id gnl|my_center|LOCUS_07960 15272 15120 gene locus_tag LOCUS_07970 15272 15120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 15384 19346 gene locus_tag LOCUS_07980 gene putA 15384 19346 CDS product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299828.1 protein_id gnl|my_center|LOCUS_07980 20024 19386 gene locus_tag LOCUS_07990 gene rutR 20024 19386 CDS product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191701.1 protein_id gnl|my_center|LOCUS_07990 20309 21403 gene locus_tag LOCUS_08000 gene rutA 20309 21403 CDS product pyrimidine utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326839.1 protein_id gnl|my_center|LOCUS_08000 21403 22095 gene locus_tag LOCUS_08010 gene rutB 21403 22095 CDS product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393558.1 protein_id gnl|my_center|LOCUS_08010 22107 22493 gene locus_tag LOCUS_08020 gene rutC 22107 22493 CDS product 3-aminoacrylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126780.1 protein_id gnl|my_center|LOCUS_08020 22501 23301 gene locus_tag LOCUS_08030 gene rutD 22501 23301 CDS product pyrimidine utilization protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777653.1 protein_id gnl|my_center|LOCUS_08030 23311 23901 gene locus_tag LOCUS_08040 23311 23901 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001189.1 protein_id gnl|my_center|LOCUS_08040 23912 24406 gene locus_tag LOCUS_08050 gene rutF 23912 24406 CDS product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028095.1 protein_id gnl|my_center|LOCUS_08050 24427 25755 gene locus_tag LOCUS_08060 gene rutG 24427 25755 CDS product pyrimidine utilization transport protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326838.1 protein_id gnl|my_center|LOCUS_08060 26186 26013 gene locus_tag LOCUS_08070 26186 26013 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273658.1 protein_id gnl|my_center|LOCUS_08070 26559 27155 gene locus_tag LOCUS_08080 gene wrbA 26559 27155 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151437.1 protein_id gnl|my_center|LOCUS_08080 27176 27403 gene locus_tag LOCUS_08090 27176 27403 CDS product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143120.1 protein_id gnl|my_center|LOCUS_08090 28682 27441 gene locus_tag LOCUS_08100 gene agp 28682 27441 CDS product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044307.1 protein_id gnl|my_center|LOCUS_08100 30224 28965 gene locus_tag LOCUS_08110 30224 28965 CDS product YccE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535353.1 protein_id gnl|my_center|LOCUS_08110 30485 31405 gene locus_tag LOCUS_08120 gene cbpA 30485 31405 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420621.1 protein_id gnl|my_center|LOCUS_08120 31405 31710 gene locus_tag LOCUS_08130 gene cbpM 31405 31710 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024560.1 protein_id gnl|my_center|LOCUS_08130 32461 31862 gene locus_tag LOCUS_08140 gene torD 32461 31862 CDS product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209869.1 protein_id gnl|my_center|LOCUS_08140 35004 32458 gene locus_tag LOCUS_08150 gene torA 35004 32458 CDS product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062091.1 protein_id gnl|my_center|LOCUS_08150 36176 35004 gene locus_tag LOCUS_08160 gene torC 36176 35004 CDS product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230242.1 protein_id gnl|my_center|LOCUS_08160 36306 36998 gene locus_tag LOCUS_08170 gene torR 36306 36998 CDS product two-component system response regulator TorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120125.1 protein_id gnl|my_center|LOCUS_08170 37999 36971 gene locus_tag LOCUS_08180 gene torT 37999 36971 CDS product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264933.1 protein_id gnl|my_center|LOCUS_08180 38112 40826 gene locus_tag LOCUS_08190 gene torS 38112 40826 CDS product TMAO reductase system sensor histidine kinase/response regulator TorS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300633.1 protein_id gnl|my_center|LOCUS_08190 40898 41971 gene locus_tag LOCUS_08200 40898 41971 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829662.1 protein_id gnl|my_center|LOCUS_08200 42192 42019 gene locus_tag LOCUS_08210 42192 42019 CDS product addiction module toxin, GnsA/GnsB family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019197.1 protein_id gnl|my_center|LOCUS_08210 42798 42586 gene locus_tag LOCUS_08220 gene cspG 42798 42586 CDS product cold shock protein CspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066490.1 protein_id gnl|my_center|LOCUS_08220 43084 43296 gene locus_tag LOCUS_08230 gene cspH 43084 43296 CDS product cold shock-like protein CspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087763.1 protein_id gnl|my_center|LOCUS_08230 43715 44020 gene locus_tag LOCUS_08240 43715 44020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032438.1 protein_id gnl|my_center|LOCUS_08240 44193 44771 gene locus_tag LOCUS_08250 gene gfcB 44193 44771 CDS product lipoprotein GfcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247610.1 protein_id gnl|my_center|LOCUS_08250 44768 45514 gene locus_tag LOCUS_08260 44768 45514 CDS product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038079.1 protein_id gnl|my_center|LOCUS_08260 45514 47610 gene locus_tag LOCUS_08270 45514 47610 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742329.1 protein_id gnl|my_center|LOCUS_08270 47635 48795 gene locus_tag LOCUS_08280 47635 48795 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295357.1 protein_id gnl|my_center|LOCUS_08280 48783 49229 gene locus_tag LOCUS_08290 gene etp 48783 49229 CDS product protein-tyrosine-phosphatase Etp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057871.1 protein_id gnl|my_center|LOCUS_08290 49249 51429 gene locus_tag LOCUS_08300 gene etk 49249 51429 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208668.1 protein_id gnl|my_center|LOCUS_08300 52842 51544 gene locus_tag LOCUS_08310 gene appA 52842 51544 CDS product bifunctional acid phosphatase/4-phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297112.1 protein_id gnl|my_center|LOCUS_08310 54163 53027 gene locus_tag LOCUS_08320 gene appB 54163 53027 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460803.1 protein_id gnl|my_center|LOCUS_08320 55719 54175 gene locus_tag LOCUS_08330 gene appC 55719 54175 CDS product cytochrome bd-II oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263582.1 protein_id gnl|my_center|LOCUS_08330 56710 55853 gene locus_tag LOCUS_08340 56710 55853 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004899.1 protein_id gnl|my_center|LOCUS_08340 57105 56707 gene locus_tag LOCUS_08350 gene hyaE 57105 56707 CDS product hydrogenase-1 operon protein HyaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063978.1 protein_id gnl|my_center|LOCUS_08350 57689 57102 gene locus_tag LOCUS_08360 57689 57102 CDS product hydrogenase 1 maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003671.1 protein_id gnl|my_center|LOCUS_08360 58393 57686 gene locus_tag LOCUS_08370 gene hyaC 58393 57686 CDS product Ni/Fe-hydrogenase b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186424.1 protein_id gnl|my_center|LOCUS_08370 60205 58412 gene locus_tag LOCUS_08380 gene hyaB 60205 58412 CDS product Ni/Fe-hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107384.1 protein_id gnl|my_center|LOCUS_08380 61320 60202 gene locus_tag LOCUS_08390 gene hyaA 61320 60202 CDS product hydrogenase 1 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058323.1 protein_id gnl|my_center|LOCUS_08390 61747 61834 gene locus_tag LOCUS_t00130 61747 61834 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 62041 62700 gene locus_tag LOCUS_08400 gene yccA 62041 62700 CDS product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375136.1 protein_id gnl|my_center|LOCUS_08400 62791 63120 gene locus_tag LOCUS_08410 gene tusE 62791 63120 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301417.1 protein_id gnl|my_center|LOCUS_08410 63395 63117 gene locus_tag LOCUS_08420 gene yccX 63395 63117 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048252.1 protein_id gnl|my_center|LOCUS_08420 63490 64680 gene locus_tag LOCUS_08430 gene rlmI 63490 64680 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116297.1 protein_id gnl|my_center|LOCUS_08430 64738 65055 gene locus_tag LOCUS_08440 gene hspQ 64738 65055 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295356.1 protein_id gnl|my_center|LOCUS_08440 65513 65100 gene locus_tag LOCUS_08450 65513 65100 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301418.1 protein_id gnl|my_center|LOCUS_08450 65686 66348 gene locus_tag LOCUS_08460 65686 66348 CDS product DUF2057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847791.1 protein_id gnl|my_center|LOCUS_08460 66435 66902 gene locus_tag LOCUS_08470 gene mgsA 66435 66902 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275684.1 protein_id gnl|my_center|LOCUS_08470 68988 66934 gene locus_tag LOCUS_08480 gene helD 68988 66934 CDS product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295354.1 protein_id gnl|my_center|LOCUS_08480 69111 69557 gene locus_tag LOCUS_08490 69111 69557 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261236.1 protein_id gnl|my_center|LOCUS_08490 69567 71729 gene locus_tag LOCUS_08500 gene yccS 69567 71729 CDS product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875023.1 protein_id gnl|my_center|LOCUS_08500 72321 71692 gene locus_tag LOCUS_08510 gene sxy 72321 71692 CDS product CRP-S regulon transcriptional coactivator Sxy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839153.1 protein_id gnl|my_center|LOCUS_08510 72534 73049 gene locus_tag LOCUS_08520 gene sulA 72534 73049 CDS product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288710.1 protein_id gnl|my_center|LOCUS_08520 73251 73033 gene locus_tag LOCUS_08530 73251 73033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 73406 74446 gene locus_tag LOCUS_08540 gene ompA 73406 74446 CDS product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750416.1 protein_id gnl|my_center|LOCUS_08540 74974 74522 gene locus_tag LOCUS_08550 gene matP 74974 74522 CDS product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877161.1 protein_id gnl|my_center|LOCUS_08550 75160 76920 gene locus_tag LOCUS_08560 75160 76920 CDS product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156526.1 protein_id gnl|my_center|LOCUS_08560 76881 77507 gene locus_tag LOCUS_08570 gene fabA 76881 77507 CDS product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018747.1 protein_id gnl|my_center|LOCUS_08570 77744 77577 gene locus_tag LOCUS_08580 gene rmf 77744 77577 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828648.1 protein_id gnl|my_center|LOCUS_08580 78563 78000 gene locus_tag LOCUS_08590 gene pqiC 78563 78000 CDS product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759120.1 protein_id gnl|my_center|LOCUS_08590 80200 78560 gene locus_tag LOCUS_08600 gene pqiB 80200 78560 CDS product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445533.1 protein_id gnl|my_center|LOCUS_08600 81458 80205 gene locus_tag LOCUS_08610 gene pqiA 81458 80205 CDS product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333176.1 protein_id gnl|my_center|LOCUS_08610 83495 81588 gene locus_tag LOCUS_08620 83495 81588 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053099.1 protein_id gnl|my_center|LOCUS_08620 85615 83507 gene locus_tag LOCUS_08630 gene rlmKL 85615 83507 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086539.1 protein_id gnl|my_center|LOCUS_08630 85859 86968 gene locus_tag LOCUS_08640 gene ycbX 85859 86968 CDS product 6-N-hydroxylaminopurine resistance protein YcbX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212426.1 protein_id gnl|my_center|LOCUS_08640 87507 86965 gene locus_tag LOCUS_08650 gene zapC 87507 86965 CDS product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295353.1 protein_id gnl|my_center|LOCUS_08650 88691 87681 gene locus_tag LOCUS_08660 gene pyrD 88691 87681 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295352.1 protein_id gnl|my_center|LOCUS_08660 89482 88802 gene locus_tag LOCUS_08670 89482 88802 CDS product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307699.1 protein_id gnl|my_center|LOCUS_08670 90020 89505 gene locus_tag LOCUS_08680 90020 89505 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919497.1 protein_id gnl|my_center|LOCUS_08680 90570 90028 gene locus_tag LOCUS_08690 90570 90028 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730614.1 protein_id gnl|my_center|LOCUS_08690 91652 90582 gene locus_tag LOCUS_08700 91652 90582 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165668.1 protein_id gnl|my_center|LOCUS_08700 94243 91643 gene locus_tag LOCUS_08710 94243 91643 CDS product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286312.1 protein_id gnl|my_center|LOCUS_08710 94969 94268 gene locus_tag LOCUS_08720 94969 94268 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295349.1 protein_id gnl|my_center|LOCUS_08720 95591 95052 gene locus_tag LOCUS_08730 95591 95052 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750293.1 protein_id gnl|my_center|LOCUS_08730 95947 96522 gene locus_tag LOCUS_08740 gene ssuE 95947 96522 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263933.1 protein_id gnl|my_center|LOCUS_08740 96515 97474 gene locus_tag LOCUS_08750 gene ssuA 96515 97474 CDS product aliphatic sulfonate ABC transporter substrate-binding protein SsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488238.1 protein_id gnl|my_center|LOCUS_08750 97471 98616 gene locus_tag LOCUS_08760 gene ssuD 97471 98616 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056006.1 protein_id gnl|my_center|LOCUS_08760 98627 99418 gene locus_tag LOCUS_08770 gene ssuC 98627 99418 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235203.1 protein_id gnl|my_center|LOCUS_08770 99415 100182 gene locus_tag LOCUS_08780 gene ssuB 99415 100182 CDS product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090506.1 protein_id gnl|my_center|LOCUS_08780 102837 100225 gene locus_tag LOCUS_08790 gene pepN 102837 100225 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193841.1 protein_id gnl|my_center|LOCUS_08790 103103 104305 gene locus_tag LOCUS_08800 gene pncB 103103 104305 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297200.1 protein_id gnl|my_center|LOCUS_08800 104474 105874 gene locus_tag LOCUS_08810 gene asnS 104474 105874 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117881.1 protein_id gnl|my_center|LOCUS_08810 106476 107564 gene locus_tag LOCUS_08820 gene ompF 106476 107564 CDS product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977920.1 protein_id gnl|my_center|LOCUS_08820 107762 107580 gene locus_tag LOCUS_08830 107762 107580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196607.1 protein_id gnl|my_center|LOCUS_08830 107749 108939 gene locus_tag LOCUS_08840 gene aspC 107749 108939 CDS product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462687.1 protein_id gnl|my_center|LOCUS_08840 109808 109161 gene locus_tag LOCUS_08850 gene gloC 109808 109161 CDS product hydroxyacylglutathione hydrolase GloC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109486.1 protein_id gnl|my_center|LOCUS_08850 110383 109835 gene locus_tag LOCUS_08860 110383 109835 CDS product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295932.1 protein_id gnl|my_center|LOCUS_08860 112411 110564 gene locus_tag LOCUS_08870 gene ldtD 112411 110564 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925969.1 protein_id gnl|my_center|LOCUS_08870 117132 112672 gene locus_tag LOCUS_08880 gene mukB 117132 112672 CDS product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572668.1 protein_id gnl|my_center|LOCUS_08880 117836 117132 gene locus_tag LOCUS_08890 gene mukE 117836 117132 CDS product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295347.1 protein_id gnl|my_center|LOCUS_08890 119139 117817 gene locus_tag LOCUS_08900 gene mukF 119139 117817 CDS product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288850.1 protein_id gnl|my_center|LOCUS_08900 119921 119136 gene locus_tag LOCUS_08910 gene cmoM 119921 119136 CDS product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298300.1 protein_id gnl|my_center|LOCUS_08910 120057 120836 gene locus_tag LOCUS_08920 gene elyC 120057 120836 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899600.1 protein_id gnl|my_center|LOCUS_08920 121706 120813 gene locus_tag LOCUS_08930 121706 120813 CDS product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436922.1 protein_id gnl|my_center|LOCUS_08930 122606 121860 gene locus_tag LOCUS_08940 gene kdsB 122606 121860 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011603.1 protein_id gnl|my_center|LOCUS_08940 122785 122603 gene locus_tag LOCUS_08950 gene ycaR 122785 122603 CDS product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350058.1 protein_id gnl|my_center|LOCUS_08950 124069 122837 gene locus_tag LOCUS_08960 124069 122837 CDS product winged helix DNA-binding protein YcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056538.1 protein_id gnl|my_center|LOCUS_08960 125092 124106 gene locus_tag LOCUS_08970 gene lpxK 125092 124106 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570539.1 protein_id gnl|my_center|LOCUS_08970 126837 125089 gene locus_tag LOCUS_08980 gene msbA 126837 125089 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551270.1 protein_id gnl|my_center|LOCUS_08980 129138 126874 gene locus_tag LOCUS_08990 129138 126874 CDS product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705764.1 protein_id gnl|my_center|LOCUS_08990 129630 129346 gene locus_tag LOCUS_09000 gene ihfB 129630 129346 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167336.1 protein_id gnl|my_center|LOCUS_09000 131463 129790 gene locus_tag LOCUS_09010 gene rpsA 131463 129790 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140327.1 protein_id gnl|my_center|LOCUS_09010 132257 131574 gene locus_tag LOCUS_09020 gene cmk 132257 131574 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125016.1 protein_id gnl|my_center|LOCUS_09020 133194 132430 gene locus_tag LOCUS_09030 gene ycaL 133194 132430 CDS product metallopeptidase YcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295345.1 protein_id gnl|my_center|LOCUS_09030 134646 133363 gene locus_tag LOCUS_09040 gene aroA 134646 133363 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445231.1 protein_id gnl|my_center|LOCUS_09040 135805 134717 gene locus_tag LOCUS_09050 gene serC 135805 134717 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057149.1 protein_id gnl|my_center|LOCUS_09050 136696 136004 gene locus_tag LOCUS_09060 136696 136004 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642849.1 protein_id gnl|my_center|LOCUS_09060 136826 138586 gene locus_tag LOCUS_09070 gene ycaO 136826 138586 CDS product 30S ribosomal protein S12 methylthiotransferase accessory factor YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295344.1 protein_id gnl|my_center|LOCUS_09070 138991 139848 gene locus_tag LOCUS_09080 gene focA 138991 139848 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642546.1 protein_id gnl|my_center|LOCUS_09080 139903 142185 gene locus_tag LOCUS_09090 gene pflB 139903 142185 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292822.1 protein_id gnl|my_center|LOCUS_09090 142377 143117 gene locus_tag LOCUS_09100 gene pflA 142377 143117 CDS product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111043.1 protein_id gnl|my_center|LOCUS_09100 143789 143199 gene locus_tag LOCUS_09110 143789 143199 CDS product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190363.1 protein_id gnl|my_center|LOCUS_09110 143889 144797 gene locus_tag LOCUS_09120 143889 144797 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242684.1 protein_id gnl|my_center|LOCUS_09120 146228 144798 gene locus_tag LOCUS_09130 146228 144798 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918506.1 protein_id gnl|my_center|LOCUS_09130 147586 146438 gene locus_tag LOCUS_09140 147586 146438 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109259.1 protein_id gnl|my_center|LOCUS_09140 147900 148526 gene locus_tag LOCUS_09150 gene ycaC 147900 148526 CDS product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165879.1 protein_id gnl|my_center|LOCUS_09150 149424 148561 gene locus_tag LOCUS_09160 gene dmsC 149424 148561 CDS product dimethyl sulfoxide reductase anchor subunit DmsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534637.1 protein_id gnl|my_center|LOCUS_09160 150043 149426 gene locus_tag LOCUS_09170 gene dmsB 150043 149426 CDS product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213098.1 protein_id gnl|my_center|LOCUS_09170 152498 150054 gene locus_tag LOCUS_09180 gene dmsA 152498 150054 CDS product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850303.1 protein_id gnl|my_center|LOCUS_09180 154029 152737 gene locus_tag LOCUS_09190 gene serS 154029 152737 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886683.1 protein_id gnl|my_center|LOCUS_09190 155463 154120 gene locus_tag LOCUS_09200 gene rarA 155463 154120 CDS product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067755.1 protein_id gnl|my_center|LOCUS_09200 156088 155474 gene locus_tag LOCUS_09210 gene lolA 156088 155474 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976047.1 protein_id gnl|my_center|LOCUS_09210 160268 156240 gene locus_tag LOCUS_09220 160268 156240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 160897 160403 gene locus_tag LOCUS_09230 gene lrp 160897 160403 CDS product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228473.1 protein_id gnl|my_center|LOCUS_09230 161442 162407 gene locus_tag LOCUS_09240 gene trxB 161442 162407 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537418.1 protein_id gnl|my_center|LOCUS_09240 162530 164296 gene locus_tag LOCUS_09250 gene cydD 162530 164296 CDS product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043574.1 protein_id gnl|my_center|LOCUS_09250 164297 166018 gene locus_tag LOCUS_09260 gene cydC 164297 166018 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202188.1 protein_id gnl|my_center|LOCUS_09260 166060 166764 gene locus_tag LOCUS_09270 gene aat 166060 166764 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241678.1 protein_id gnl|my_center|LOCUS_09270 167049 167267 gene locus_tag LOCUS_09280 gene infA 167049 167267 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 protein_id gnl|my_center|LOCUS_09280 167520 167607 gene locus_tag LOCUS_t00140 167520 167607 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence06 257 601 gene locus_tag LOCUS_09290 257 601 CDS product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472021.1 protein_id gnl|my_center|LOCUS_09290 603 995 gene locus_tag LOCUS_09300 603 995 CDS product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826503.1 protein_id gnl|my_center|LOCUS_09300 2462 1047 gene locus_tag LOCUS_09310 gene gltX 2462 1047 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695655.1 protein_id gnl|my_center|LOCUS_09310 2742 2920 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2985 3060 gene locus_tag LOCUS_t00150 2985 3060 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3065 3140 gene locus_tag LOCUS_t00160 3065 3140 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3260 3601 gene locus_tag LOCUS_09320 3260 3601 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201413.1 protein_id gnl|my_center|LOCUS_09320 4518 3592 gene locus_tag LOCUS_09330 4518 3592 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109794.1 protein_id gnl|my_center|LOCUS_09330 4608 5606 gene locus_tag LOCUS_09340 4608 5606 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765610.1 protein_id gnl|my_center|LOCUS_09340 5821 5603 gene locus_tag LOCUS_09350 5821 5603 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410201.1 protein_id gnl|my_center|LOCUS_09350 7838 5823 gene locus_tag LOCUS_09360 gene ligA 7838 5823 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443681.1 protein_id gnl|my_center|LOCUS_09360 8343 7909 gene locus_tag LOCUS_09370 8343 7909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 8434 8760 gene locus_tag LOCUS_09380 8434 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 9125 9886 gene locus_tag LOCUS_09390 gene cysZ 9125 9886 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254839.1 protein_id gnl|my_center|LOCUS_09390 10071 11042 gene locus_tag LOCUS_09400 gene cysK 10071 11042 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034402.1 protein_id gnl|my_center|LOCUS_09400 11426 11683 gene locus_tag LOCUS_09410 gene ptsH 11426 11683 CDS product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 protein_id gnl|my_center|LOCUS_09410 11728 13455 gene locus_tag LOCUS_09420 gene ptsI 11728 13455 CDS product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623136.1 protein_id gnl|my_center|LOCUS_09420 13496 14005 gene locus_tag LOCUS_09430 gene crr 13496 14005 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522247.1 protein_id gnl|my_center|LOCUS_09430 14899 14048 gene locus_tag LOCUS_09440 gene pdxK 14899 14048 CDS product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096674.1 protein_id gnl|my_center|LOCUS_09440 15004 15378 gene locus_tag LOCUS_09450 15004 15378 CDS product YfeK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719960.1 protein_id gnl|my_center|LOCUS_09450 15411 16145 gene locus_tag LOCUS_09460 15411 16145 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745534.1 protein_id gnl|my_center|LOCUS_09460 17261 16350 gene locus_tag LOCUS_09470 gene cysM 17261 16350 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309637.1 protein_id gnl|my_center|LOCUS_09470 18492 17395 gene locus_tag LOCUS_09480 gene cysA 18492 17395 CDS product sulfate/thiosulfate ABC transporter ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021036.1 protein_id gnl|my_center|LOCUS_09480 19357 18482 gene locus_tag LOCUS_09490 gene cysW 19357 18482 CDS product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852686.1 protein_id gnl|my_center|LOCUS_09490 20190 19357 gene locus_tag LOCUS_09500 gene cysT 20190 19357 CDS product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458420.1 protein_id gnl|my_center|LOCUS_09500 21206 20190 gene locus_tag LOCUS_09510 gene cysP 21206 20190 CDS product thiosulfate/sulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290236.1 protein_id gnl|my_center|LOCUS_09510 22301 21510 gene locus_tag LOCUS_09520 gene ucpA 22301 21510 CDS product SDR family oxidoreductase UcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517430.1 protein_id gnl|my_center|LOCUS_09520 23287 22430 gene locus_tag LOCUS_09530 gene murR 23287 22430 CDS product HTH-type transcriptional regulator MurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966471.1 protein_id gnl|my_center|LOCUS_09530 23451 24347 gene locus_tag LOCUS_09540 gene murQ 23451 24347 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175648.1 protein_id gnl|my_center|LOCUS_09540 24351 25775 gene locus_tag LOCUS_09550 gene murP 24351 25775 CDS product PTS N-acetylmuramic acid transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040483.1 protein_id gnl|my_center|LOCUS_09550 26854 25955 gene locus_tag LOCUS_09560 gene yfeX 26854 25955 CDS product porphyrinogen peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084590.1 protein_id gnl|my_center|LOCUS_09560 27525 26950 gene locus_tag LOCUS_09570 27525 26950 CDS product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838944.1 protein_id gnl|my_center|LOCUS_09570 28181 27732 gene locus_tag LOCUS_09580 28181 27732 CDS product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300381.1 protein_id gnl|my_center|LOCUS_09580 28593 28168 gene locus_tag LOCUS_09590 28593 28168 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406000.1 protein_id gnl|my_center|LOCUS_09590 28807 29676 gene locus_tag LOCUS_09600 gene amiA 28807 29676 CDS product N-acetylmuramoyl-L-alanine amidase AmiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102886.1 protein_id gnl|my_center|LOCUS_09600 29680 30579 gene locus_tag LOCUS_09610 gene hemF 29680 30579 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801367.1 protein_id gnl|my_center|LOCUS_09610 31637 30585 gene locus_tag LOCUS_09620 gene eutR 31637 30585 CDS product HTH-type transcriptional regulator EutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753690.1 protein_id gnl|my_center|LOCUS_09620 32183 31683 gene locus_tag LOCUS_09630 gene eutK 32183 31683 CDS product ethanolamine utilization microcompartment protein EutK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606257.1 protein_id gnl|my_center|LOCUS_09630 32855 32196 gene locus_tag LOCUS_09640 gene eutL 32855 32196 CDS product ethanolamine utilization microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111038.1 protein_id gnl|my_center|LOCUS_09640 33752 32865 gene locus_tag LOCUS_09650 gene eutC 33752 32865 CDS product ethanolamine ammonia-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372364.1 protein_id gnl|my_center|LOCUS_09650 35134 33773 gene locus_tag LOCUS_09660 gene eutB 35134 33773 CDS product ethanolamine ammonia-lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769961.1 protein_id gnl|my_center|LOCUS_09660 36549 35146 gene locus_tag LOCUS_09670 gene eutA 36549 35146 CDS product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097464.1 protein_id gnl|my_center|LOCUS_09670 37772 36546 gene locus_tag LOCUS_09680 gene eutH 37772 36546 CDS product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512385.1 protein_id gnl|my_center|LOCUS_09680 37824 38006 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39324 38137 gene locus_tag LOCUS_09690 gene eutG 39324 38137 CDS product ethanolamine utilization ethanol dehydrogenase EutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301866.1 protein_id gnl|my_center|LOCUS_09690 40150 39314 gene locus_tag LOCUS_09700 gene eutJ 40150 39314 CDS product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929729.1 protein_id gnl|my_center|LOCUS_09700 41564 40161 gene locus_tag LOCUS_09710 41564 40161 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075711.1 protein_id gnl|my_center|LOCUS_09710 41863 41576 gene locus_tag LOCUS_09720 gene eutN 41863 41576 CDS product ethanolamine utilization microcompartment protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762196.1 protein_id gnl|my_center|LOCUS_09720 42263 41970 gene locus_tag LOCUS_09730 gene eutM 42263 41970 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 protein_id gnl|my_center|LOCUS_09730 43318 42302 gene locus_tag LOCUS_09740 gene pta 43318 42302 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582977.1 protein_id gnl|my_center|LOCUS_09740 44117 43308 gene locus_tag LOCUS_09750 gene eutT 44117 43308 CDS product ethanolamine utilization cob(I)yrinic acid a,c-diamide adenosyltransferase EutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651298.1 protein_id gnl|my_center|LOCUS_09750 44815 44114 gene locus_tag LOCUS_09760 gene eutQ 44815 44114 CDS product ethanolamine utilization acetate kinase EutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733903.1 protein_id gnl|my_center|LOCUS_09760 45269 44790 gene locus_tag LOCUS_09770 gene eutP 45269 44790 CDS product ethanolamine utilization acetate kinase EutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820782.1 protein_id gnl|my_center|LOCUS_09770 45617 45282 gene locus_tag LOCUS_09780 gene eutS 45617 45282 CDS product ethanolamine utilization microcompartment protein EutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356956.1 protein_id gnl|my_center|LOCUS_09780 48189 45910 gene locus_tag LOCUS_09790 gene maeB 48189 45910 CDS product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342644.1 protein_id gnl|my_center|LOCUS_09790 48478 49428 gene locus_tag LOCUS_09800 gene tal 48478 49428 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003709.1 protein_id gnl|my_center|LOCUS_09800 49448 51451 gene locus_tag LOCUS_09810 gene tkt 49448 51451 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087280.1 protein_id gnl|my_center|LOCUS_09810 52430 51546 gene locus_tag LOCUS_09820 52430 51546 CDS product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270542.1 protein_id gnl|my_center|LOCUS_09820 53290 52715 gene locus_tag LOCUS_09830 gene nudK 53290 52715 CDS product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300814.1 protein_id gnl|my_center|LOCUS_09830 55337 53358 gene locus_tag LOCUS_09840 gene aegA 55337 53358 CDS product formate-dependent uric acid utilization protein AegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078880.1 protein_id gnl|my_center|LOCUS_09840 55528 57243 gene locus_tag LOCUS_09850 gene narQ 55528 57243 CDS product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300881.1 protein_id gnl|my_center|LOCUS_09850 57407 60520 gene locus_tag LOCUS_09860 gene acrD 57407 60520 CDS product multidrug efflux RND transporter permease AcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273151.1 protein_id gnl|my_center|LOCUS_09860 61059 61415 gene locus_tag LOCUS_09870 61059 61415 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258236.1 protein_id gnl|my_center|LOCUS_09870 61419 62546 gene locus_tag LOCUS_09880 gene dapE 61419 62546 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277801.1 protein_id gnl|my_center|LOCUS_09880 62574 62774 gene locus_tag LOCUS_09890 62574 62774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 63582 62884 gene locus_tag LOCUS_09900 gene ypfH 63582 62884 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679799.1 protein_id gnl|my_center|LOCUS_09900 65671 63656 gene locus_tag LOCUS_09910 gene tmcA 65671 63656 CDS product tRNA cytosine(34) acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829360.1 protein_id gnl|my_center|LOCUS_09910 66549 65686 gene locus_tag LOCUS_09920 66549 65686 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267498.1 protein_id gnl|my_center|LOCUS_09920 67430 66717 gene locus_tag LOCUS_09930 gene purC 67430 66717 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295467.1 protein_id gnl|my_center|LOCUS_09930 68677 67643 gene locus_tag LOCUS_09940 gene bamC 68677 67643 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297320.1 protein_id gnl|my_center|LOCUS_09940 69572 68694 gene locus_tag LOCUS_09950 gene dapA 69572 68694 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295469.1 protein_id gnl|my_center|LOCUS_09950 69718 70290 gene locus_tag LOCUS_09960 69718 70290 CDS product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176187.1 protein_id gnl|my_center|LOCUS_09960 70290 70760 gene locus_tag LOCUS_09970 gene bcp 70290 70760 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068682.1 protein_id gnl|my_center|LOCUS_09970 71013 71630 gene locus_tag LOCUS_09980 gene hyfA 71013 71630 CDS product hydrogenase 4 subunit HyfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295470.1 protein_id gnl|my_center|LOCUS_09980 71630 73648 gene locus_tag LOCUS_09990 gene hyfB 71630 73648 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339489.1 protein_id gnl|my_center|LOCUS_09990 73659 73973 gene locus_tag LOCUS_10000 73659 73973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10000 73886 74605 gene locus_tag LOCUS_10010 73886 74605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10010 74708 76057 gene locus_tag LOCUS_10020 gene hyfD 74708 76057 CDS product hydrogenase 4 subunit HyfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429104.1 protein_id gnl|my_center|LOCUS_10020 76072 76722 gene locus_tag LOCUS_10030 gene hyfE 76072 76722 CDS product hydrogenase 4 membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147991.1 protein_id gnl|my_center|LOCUS_10030 76727 78307 gene locus_tag LOCUS_10040 gene hyfF 76727 78307 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122577.1 protein_id gnl|my_center|LOCUS_10040 78297 79964 gene locus_tag LOCUS_10050 gene hyfG 78297 79964 CDS product hydrogenase 4 catalytic subunit HyfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102321.1 protein_id gnl|my_center|LOCUS_10050 79974 80513 gene locus_tag LOCUS_10060 gene hyfH 79974 80513 CDS product hydrogenase 4 subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916082.1 protein_id gnl|my_center|LOCUS_10060 80510 81268 gene locus_tag LOCUS_10070 gene hyfI 80510 81268 CDS product hydrogenase 4 catalytic subunit HyfI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075546.1 protein_id gnl|my_center|LOCUS_10070 81261 81674 gene locus_tag LOCUS_10080 gene hyfJ 81261 81674 CDS product hydrogenase 4 assembly chaperone HyfJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326580.1 protein_id gnl|my_center|LOCUS_10080 81704 83716 gene locus_tag LOCUS_10090 gene hyfR 81704 83716 CDS product DNA-binding transcriptional regulator HyfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251558.1 protein_id gnl|my_center|LOCUS_10090 83738 84586 gene locus_tag LOCUS_10100 gene focB 83738 84586 CDS product formate transporter FocB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244734.1 protein_id gnl|my_center|LOCUS_10100 85685 84624 gene locus_tag LOCUS_10110 85685 84624 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892044.1 protein_id gnl|my_center|LOCUS_10110 85898 87361 gene locus_tag LOCUS_10120 gene bepA 85898 87361 CDS product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489667.1 protein_id gnl|my_center|LOCUS_10120 87382 87741 gene locus_tag LOCUS_10130 gene arsC 87382 87741 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166449.1 protein_id gnl|my_center|LOCUS_10130 88625 87879 gene locus_tag LOCUS_10140 88625 87879 CDS product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247065.1 protein_id gnl|my_center|LOCUS_10140 89964 88675 gene locus_tag LOCUS_10150 gene uraA 89964 88675 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198328.1 protein_id gnl|my_center|LOCUS_10150 90676 90050 gene locus_tag LOCUS_10160 gene upp 90676 90050 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295473.1 protein_id gnl|my_center|LOCUS_10160 90986 92038 gene locus_tag LOCUS_10170 gene purM 90986 92038 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295474.1 protein_id gnl|my_center|LOCUS_10170 92038 92676 gene locus_tag LOCUS_10180 gene purN 92038 92676 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028614.1 protein_id gnl|my_center|LOCUS_10180 92841 94913 gene locus_tag LOCUS_10190 gene ppk1 92841 94913 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529576.1 protein_id gnl|my_center|LOCUS_10190 94918 96459 gene locus_tag LOCUS_10200 gene ppx 94918 96459 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121363.1 protein_id gnl|my_center|LOCUS_10200 98573 96498 gene locus_tag LOCUS_10210 gene pdeF 98573 96498 CDS product cyclic-guanylate-specific phosphodiesterase PdeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772731.1 protein_id gnl|my_center|LOCUS_10210 99075 98923 gene locus_tag LOCUS_10220 99075 98923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017552.1 protein_id gnl|my_center|LOCUS_10220 99093 99284 gene locus_tag LOCUS_10230 99093 99284 CDS product YfgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076001.1 protein_id gnl|my_center|LOCUS_10230 99598 100113 gene locus_tag LOCUS_10240 99598 100113 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295476.1 protein_id gnl|my_center|LOCUS_10240 100129 100668 gene locus_tag LOCUS_10250 100129 100668 CDS product DUF5384 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755173.1 protein_id gnl|my_center|LOCUS_10250 102338 100761 gene locus_tag LOCUS_10260 gene guaA 102338 100761 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138270.1 protein_id gnl|my_center|LOCUS_10260 103873 102407 gene locus_tag LOCUS_10270 gene guaB 103873 102407 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299507.1 protein_id gnl|my_center|LOCUS_10270 104035 105405 gene locus_tag LOCUS_10280 gene xseA 104035 105405 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937912.1 protein_id gnl|my_center|LOCUS_10280 105617 105402 gene locus_tag LOCUS_10290 105617 105402 CDS product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301158.1 protein_id gnl|my_center|LOCUS_10290 107159 105687 gene locus_tag LOCUS_10300 gene der 107159 105687 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249410.1 protein_id gnl|my_center|LOCUS_10300 108455 107277 gene locus_tag LOCUS_10310 gene bamB 108455 107277 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177048.1 protein_id gnl|my_center|LOCUS_10310 109086 108466 gene locus_tag LOCUS_10320 gene yfgM 109086 108466 CDS product ancillary SecYEG translocon subunit YfgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409205.1 protein_id gnl|my_center|LOCUS_10320 110378 109104 gene locus_tag LOCUS_10330 gene hisS 110378 109104 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107167.1 protein_id gnl|my_center|LOCUS_10330 111607 110489 gene locus_tag LOCUS_10340 gene ispG 111607 110489 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551807.1 protein_id gnl|my_center|LOCUS_10340 112647 111634 gene locus_tag LOCUS_10350 gene rodZ 112647 111634 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090858.1 protein_id gnl|my_center|LOCUS_10350 114086 112932 gene locus_tag LOCUS_10360 114086 112932 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003317.1 protein_id gnl|my_center|LOCUS_10360 114667 114236 gene locus_tag LOCUS_10370 gene ndk 114667 114236 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963837.1 protein_id gnl|my_center|LOCUS_10370 116993 114816 gene locus_tag LOCUS_10380 gene pbpC 116993 114816 CDS product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137675.1 protein_id gnl|my_center|LOCUS_10380 122090 117129 gene locus_tag LOCUS_10390 gene yfhM 122090 117129 CDS product alpha2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736312.1 protein_id gnl|my_center|LOCUS_10390 122297 123142 gene locus_tag LOCUS_10400 gene sseA 122297 123142 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108626.1 protein_id gnl|my_center|LOCUS_10400 124736 123960 gene locus_tag LOCUS_10410 gene sseB 124736 123960 CDS product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295479.1 protein_id gnl|my_center|LOCUS_10410 126161 124878 gene locus_tag LOCUS_10420 gene pepB 126161 124878 CDS product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133582.1 protein_id gnl|my_center|LOCUS_10420 126419 126219 gene locus_tag LOCUS_10430 gene iscX 126419 126219 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523616.1 protein_id gnl|my_center|LOCUS_10430 126766 126431 gene locus_tag LOCUS_10440 gene fdx 126766 126431 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124469.1 protein_id gnl|my_center|LOCUS_10440 128618 126768 gene locus_tag LOCUS_10450 gene hscA 128618 126768 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196613.1 protein_id gnl|my_center|LOCUS_10450 129150 128635 gene locus_tag LOCUS_10460 gene hscB 129150 128635 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384413.1 protein_id gnl|my_center|LOCUS_10460 129569 129246 gene locus_tag LOCUS_10470 gene iscA 129569 129246 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028953.1 protein_id gnl|my_center|LOCUS_10470 129972 129586 gene locus_tag LOCUS_10480 gene iscU 129972 129586 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331707.1 protein_id gnl|my_center|LOCUS_10480 131214 130000 gene locus_tag LOCUS_10490 gene iscS 131214 130000 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295373.1 protein_id gnl|my_center|LOCUS_10490 131814 131326 gene locus_tag LOCUS_10500 gene iscR 131814 131326 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241357.1 protein_id gnl|my_center|LOCUS_10500 132915 132175 gene locus_tag LOCUS_10510 gene trmJ 132915 132175 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940019.1 protein_id gnl|my_center|LOCUS_10510 133034 133837 gene locus_tag LOCUS_10520 gene suhB 133034 133837 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553451.1 protein_id gnl|my_center|LOCUS_10520 133982 134836 gene locus_tag LOCUS_10530 133982 134836 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299515.1 protein_id gnl|my_center|LOCUS_10530 135123 136307 gene locus_tag LOCUS_10540 gene csiE 135123 136307 CDS product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982994.1 protein_id gnl|my_center|LOCUS_10540 137438 136299 gene locus_tag LOCUS_10550 137438 136299 CDS product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244193.1 protein_id gnl|my_center|LOCUS_10550 138488 137598 gene locus_tag LOCUS_10560 gene hcaR 138488 137598 CDS product DNA-binding transcriptional regulator HcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423257.1 protein_id gnl|my_center|LOCUS_10560 138624 139985 gene locus_tag LOCUS_10570 138624 139985 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211172.1 protein_id gnl|my_center|LOCUS_10570 139982 140500 gene locus_tag LOCUS_10580 139982 140500 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276076.1 protein_id gnl|my_center|LOCUS_10580 140500 140820 gene locus_tag LOCUS_10590 140500 140820 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080102.1 protein_id gnl|my_center|LOCUS_10590 140817 141629 gene locus_tag LOCUS_10600 gene hcaB 140817 141629 CDS product 3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281372.1 protein_id gnl|my_center|LOCUS_10600 141639 142841 gene locus_tag LOCUS_10610 141639 142841 CDS product phenylpropionate dioxygenase ferredoxin reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660788.1 protein_id gnl|my_center|LOCUS_10610 142938 143360 gene locus_tag LOCUS_10620 142938 143360 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094726.1 protein_id gnl|my_center|LOCUS_10620 144280 143408 gene locus_tag LOCUS_10630 144280 143408 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158547.1 protein_id gnl|my_center|LOCUS_10630 145353 144292 gene locus_tag LOCUS_10640 145353 144292 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700809.1 protein_id gnl|my_center|LOCUS_10640 146417 145419 gene locus_tag LOCUS_10650 146417 145419 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276670.1 protein_id gnl|my_center|LOCUS_10650 147953 146442 gene locus_tag LOCUS_10660 147953 146442 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493470.1 protein_id gnl|my_center|LOCUS_10660 148959 147976 gene locus_tag LOCUS_10670 148959 147976 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124894.1 protein_id gnl|my_center|LOCUS_10670 152337 149056 gene locus_tag LOCUS_10680 152337 149056 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386984.1 protein_id gnl|my_center|LOCUS_10680 152455 153648 gene locus_tag LOCUS_10690 152455 153648 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299519.1 protein_id gnl|my_center|LOCUS_10690 155099 153846 gene locus_tag LOCUS_10700 gene glyA 155099 153846 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919159.1 protein_id gnl|my_center|LOCUS_10700 155427 156617 gene locus_tag LOCUS_10710 gene hmpA 155427 156617 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883122.1 protein_id gnl|my_center|LOCUS_10710 157000 156662 gene locus_tag LOCUS_10720 gene glnB 157000 156662 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914032.1 protein_id gnl|my_center|LOCUS_10720 158395 157061 gene locus_tag LOCUS_10730 gene glrR 158395 157061 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295369.1 protein_id gnl|my_center|LOCUS_10730 159032 158385 gene locus_tag LOCUS_10740 gene qseG 159032 158385 CDS product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215861.1 protein_id gnl|my_center|LOCUS_10740 159032 159196 gene locus_tag LOCUS_10750 159032 159196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 160645 159263 gene locus_tag LOCUS_10760 gene qseE 160645 159263 CDS product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297612.1 protein_id gnl|my_center|LOCUS_10760 165153 161266 gene locus_tag LOCUS_10770 gene purL 165153 161266 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970122.1 protein_id gnl|my_center|LOCUS_10770 165411 166943 gene locus_tag LOCUS_10780 gene mltF 165411 166943 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734212.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence07 1897 29 gene locus_tag LOCUS_10790 gene kup 1897 29 CDS product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102319.1 protein_id gnl|my_center|LOCUS_10790 2120 3616 gene locus_tag LOCUS_10800 gene ravA 2120 3616 CDS product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315921.1 protein_id gnl|my_center|LOCUS_10800 3610 5061 gene locus_tag LOCUS_10810 gene viaA 3610 5061 CDS product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956642.1 protein_id gnl|my_center|LOCUS_10810 6058 5066 gene locus_tag LOCUS_10820 gene asnA 6058 5066 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845133.1 protein_id gnl|my_center|LOCUS_10820 6210 6668 gene locus_tag LOCUS_10830 gene asnC 6210 6668 CDS product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432970.1 protein_id gnl|my_center|LOCUS_10830 6758 7201 gene locus_tag LOCUS_10840 gene mioC 6758 7201 CDS product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763731.1 protein_id gnl|my_center|LOCUS_10840 7580 9469 gene locus_tag LOCUS_10850 gene mnmG 7580 9469 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499788.1 protein_id gnl|my_center|LOCUS_10850 9533 9928 gene locus_tag LOCUS_10860 9533 9928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10860 9966 10151 gene locus_tag LOCUS_10870 9966 10151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10870 10768 11148 gene locus_tag LOCUS_10880 gene atpI 10768 11148 CDS product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116695.1 protein_id gnl|my_center|LOCUS_10880 11157 11972 gene locus_tag LOCUS_10890 gene atpB 11157 11972 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135625.1 protein_id gnl|my_center|LOCUS_10890 12019 12258 gene locus_tag LOCUS_10900 gene atpE 12019 12258 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 protein_id gnl|my_center|LOCUS_10900 12320 12790 gene locus_tag LOCUS_10910 gene atpF 12320 12790 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052217.1 protein_id gnl|my_center|LOCUS_10910 12805 13338 gene locus_tag LOCUS_10920 gene atpH 12805 13338 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288587.1 protein_id gnl|my_center|LOCUS_10920 13351 14892 gene locus_tag LOCUS_10930 gene atpA 13351 14892 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176745.1 protein_id gnl|my_center|LOCUS_10930 14943 15806 gene locus_tag LOCUS_10940 gene atpG 14943 15806 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896498.1 protein_id gnl|my_center|LOCUS_10940 15833 17215 gene locus_tag LOCUS_10950 gene atpD 15833 17215 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190506.1 protein_id gnl|my_center|LOCUS_10950 17236 17655 gene locus_tag LOCUS_10960 17236 17655 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251965.1 protein_id gnl|my_center|LOCUS_10960 18008 19378 gene locus_tag LOCUS_10970 gene glmU 18008 19378 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933736.1 protein_id gnl|my_center|LOCUS_10970 19540 21369 gene locus_tag LOCUS_10980 gene glmS 19540 21369 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334099.1 protein_id gnl|my_center|LOCUS_10980 21683 22723 gene locus_tag LOCUS_10990 gene pstS 21683 22723 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867146.1 protein_id gnl|my_center|LOCUS_10990 22809 23768 gene locus_tag LOCUS_11000 gene pstC 22809 23768 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741620.1 protein_id gnl|my_center|LOCUS_11000 23768 24658 gene locus_tag LOCUS_11010 gene pstA 23768 24658 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251991.1 protein_id gnl|my_center|LOCUS_11010 24841 25614 gene locus_tag LOCUS_11020 gene pstB 24841 25614 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063125.1 protein_id gnl|my_center|LOCUS_11020 25629 26354 gene locus_tag LOCUS_11030 gene phoU 25629 26354 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377786.1 protein_id gnl|my_center|LOCUS_11030 26640 27476 gene locus_tag LOCUS_11040 gene bglG 26640 27476 CDS product transcriptional antiterminator BglG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295251.1 protein_id gnl|my_center|LOCUS_11040 27609 29486 gene locus_tag LOCUS_11050 gene bglF 27609 29486 CDS product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137312.1 protein_id gnl|my_center|LOCUS_11050 29505 30899 gene locus_tag LOCUS_11060 gene bglB 29505 30899 CDS product 6-phospho-beta-glucosidase BglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643228.1 protein_id gnl|my_center|LOCUS_11060 30985 32601 gene locus_tag LOCUS_11070 gene bglH 30985 32601 CDS product carbohydrate-specific porin BglH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489881.1 protein_id gnl|my_center|LOCUS_11070 32628 33797 gene locus_tag LOCUS_11080 32628 33797 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295249.1 protein_id gnl|my_center|LOCUS_11080 33812 34534 gene locus_tag LOCUS_11090 33812 34534 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766900.1 protein_id gnl|my_center|LOCUS_11090 35183 34596 gene locus_tag LOCUS_11100 gene cbrC 35183 34596 CDS product PF03691 family colicin E2 tolerance protein CbrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193070.1 protein_id gnl|my_center|LOCUS_11100 35714 35232 gene locus_tag LOCUS_11110 35714 35232 CDS product protein CbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116772.1 protein_id gnl|my_center|LOCUS_11110 36437 35772 gene locus_tag LOCUS_11120 gene yieH 36437 35772 CDS product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078043.1 protein_id gnl|my_center|LOCUS_11120 36604 37941 gene locus_tag LOCUS_11130 gene adeP 36604 37941 CDS product adenine permease AdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082693.1 protein_id gnl|my_center|LOCUS_11130 38561 37995 gene locus_tag LOCUS_11140 gene yieF 38561 37995 CDS product class I chromate reductase YieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291268.1 protein_id gnl|my_center|LOCUS_11140 39332 38583 gene locus_tag LOCUS_11150 39332 38583 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190670.1 protein_id gnl|my_center|LOCUS_11150 40457 39489 gene locus_tag LOCUS_11160 gene yidZ 40457 39489 CDS product HTH-type transcriptional regulator YidZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748502.1 protein_id gnl|my_center|LOCUS_11160 41598 40423 gene locus_tag LOCUS_11170 gene mdtL 41598 40423 CDS product multidrug efflux MFS transporter MdtL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085982.1 protein_id gnl|my_center|LOCUS_11170 42977 41730 gene locus_tag LOCUS_11180 gene tnaB 42977 41730 CDS product low affinity tryptophan permease TnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131911.1 protein_id gnl|my_center|LOCUS_11180 44483 43068 gene locus_tag LOCUS_11190 gene tnaA 44483 43068 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295247.1 protein_id gnl|my_center|LOCUS_11190 46385 45021 gene locus_tag LOCUS_11200 gene mnmE 46385 45021 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282347.1 protein_id gnl|my_center|LOCUS_11200 48137 46491 gene locus_tag LOCUS_11210 gene yidC 48137 46491 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378258.1 protein_id gnl|my_center|LOCUS_11210 48687 48361 gene locus_tag LOCUS_11220 gene rnpA 48687 48361 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239730.1 protein_id gnl|my_center|LOCUS_11220 48877 48737 gene locus_tag LOCUS_11230 gene rpmH 48877 48737 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831330.1 protein_id gnl|my_center|LOCUS_11230 49553 50887 gene locus_tag LOCUS_11240 gene dnaA 49553 50887 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059111.1 protein_id gnl|my_center|LOCUS_11240 50892 51992 gene locus_tag LOCUS_11250 gene dnaN 50892 51992 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673464.1 protein_id gnl|my_center|LOCUS_11250 51992 53065 gene locus_tag LOCUS_11260 gene recF 51992 53065 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060112.1 protein_id gnl|my_center|LOCUS_11260 53094 55508 gene locus_tag LOCUS_11270 gene gyrB 53094 55508 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072067.1 protein_id gnl|my_center|LOCUS_11270 55748 56146 gene locus_tag LOCUS_11280 55748 56146 CDS product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522208.1 protein_id gnl|my_center|LOCUS_11280 56261 57073 gene locus_tag LOCUS_11290 gene yidA 56261 57073 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985549.1 protein_id gnl|my_center|LOCUS_11290 57775 57119 gene locus_tag LOCUS_11300 gene yidX 57775 57119 CDS product protein YidX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772934.1 protein_id gnl|my_center|LOCUS_11300 58053 58742 gene locus_tag LOCUS_11310 gene dgoR 58053 58742 CDS product D-galactonate utilization transcriptional regulator DgoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174305.1 protein_id gnl|my_center|LOCUS_11310 58739 59617 gene locus_tag LOCUS_11320 gene dgoK 58739 59617 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127112.1 protein_id gnl|my_center|LOCUS_11320 59601 60218 gene locus_tag LOCUS_11330 gene dgoA 59601 60218 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198722.1 protein_id gnl|my_center|LOCUS_11330 60215 61363 gene locus_tag LOCUS_11340 gene dgoD 60215 61363 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705001.1 protein_id gnl|my_center|LOCUS_11340 61483 62775 gene locus_tag LOCUS_11350 61483 62775 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354284.1 protein_id gnl|my_center|LOCUS_11350 63836 62772 gene locus_tag LOCUS_11360 gene cbrA 63836 62772 CDS product colicin M resistance lipid reductase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387166.1 protein_id gnl|my_center|LOCUS_11360 63937 65151 gene locus_tag LOCUS_11370 63937 65151 CDS product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295245.1 protein_id gnl|my_center|LOCUS_11370 65413 65153 gene locus_tag LOCUS_11380 65413 65153 CDS product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313407.1 protein_id gnl|my_center|LOCUS_11380 65791 66204 gene locus_tag LOCUS_11390 gene ibpA 65791 66204 CDS product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243437.1 protein_id gnl|my_center|LOCUS_11390 66316 66744 gene locus_tag LOCUS_11400 gene ibpB 66316 66744 CDS product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243431.1 protein_id gnl|my_center|LOCUS_11400 66940 68601 gene locus_tag LOCUS_11410 66940 68601 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279763.1 protein_id gnl|my_center|LOCUS_11410 69083 68598 gene locus_tag LOCUS_11420 69083 68598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 69531 71147 gene locus_tag LOCUS_11430 69531 71147 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952127.1 protein_id gnl|my_center|LOCUS_11430 71147 72469 gene locus_tag LOCUS_11440 71147 72469 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160113.1 protein_id gnl|my_center|LOCUS_11440 73359 72466 gene locus_tag LOCUS_11450 73359 72466 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013540.1 protein_id gnl|my_center|LOCUS_11450 73526 75241 gene locus_tag LOCUS_11460 73526 75241 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087145.1 protein_id gnl|my_center|LOCUS_11460 75238 76731 gene locus_tag LOCUS_11470 75238 76731 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828527.1 protein_id gnl|my_center|LOCUS_11470 77227 76778 gene locus_tag LOCUS_11480 gene yidI 77227 76778 CDS product protein YidI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511289.1 protein_id gnl|my_center|LOCUS_11480 77336 77683 gene locus_tag LOCUS_11490 77336 77683 CDS product YidH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703959.1 protein_id gnl|my_center|LOCUS_11490 77673 78035 gene locus_tag LOCUS_11500 77673 78035 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113432.1 protein_id gnl|my_center|LOCUS_11500 78032 78529 gene locus_tag LOCUS_11510 78032 78529 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148063.1 protein_id gnl|my_center|LOCUS_11510 79697 78537 gene locus_tag LOCUS_11520 gene emrD 79697 78537 CDS product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306726.1 protein_id gnl|my_center|LOCUS_11520 80859 82547 gene locus_tag LOCUS_11530 gene ilvB 80859 82547 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168475.1 protein_id gnl|my_center|LOCUS_11530 82551 82841 gene locus_tag LOCUS_11540 gene ilvN 82551 82841 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181706.1 protein_id gnl|my_center|LOCUS_11540 82916 83506 gene locus_tag LOCUS_11550 gene uhpA 82916 83506 CDS product transcriptional regulator UhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633668.1 protein_id gnl|my_center|LOCUS_11550 83506 85008 gene locus_tag LOCUS_11560 gene uhpB 83506 85008 CDS product signal transduction histidine-protein kinase/phosphatase UhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295243.1 protein_id gnl|my_center|LOCUS_11560 85018 86337 gene locus_tag LOCUS_11570 gene uhpC 85018 86337 CDS product MFS transporter family glucose-6-phosphate receptor UhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936566.1 protein_id gnl|my_center|LOCUS_11570 86475 87866 gene locus_tag LOCUS_11580 gene uhpT 86475 87866 CDS product hexose-6-phosphate:phosphate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879194.1 protein_id gnl|my_center|LOCUS_11580 89678 87912 gene locus_tag LOCUS_11590 gene adeD 89678 87912 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065718.1 protein_id gnl|my_center|LOCUS_11590 89853 91187 gene locus_tag LOCUS_11600 gene adeQ 89853 91187 CDS product adenine permease AdeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001403836.1 protein_id gnl|my_center|LOCUS_11600 91240 91692 gene locus_tag LOCUS_11610 91240 91692 CDS product DUF1198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295241.1 protein_id gnl|my_center|LOCUS_11610 91903 93093 gene locus_tag LOCUS_11620 gene nepI 91903 93093 CDS product purine ribonucleoside efflux pump NepI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288549.1 protein_id gnl|my_center|LOCUS_11620 93427 93134 gene locus_tag LOCUS_11630 gene yicS 93427 93134 CDS product protein YicS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805509.1 protein_id gnl|my_center|LOCUS_11630 93649 94467 gene locus_tag LOCUS_11640 gene nlpA 93649 94467 CDS product lipoprotein NlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779426.1 protein_id gnl|my_center|LOCUS_11640 95394 94471 gene locus_tag LOCUS_11650 95394 94471 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535960.1 protein_id gnl|my_center|LOCUS_11650 96689 95505 gene locus_tag LOCUS_11660 96689 95505 CDS product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172876.1 protein_id gnl|my_center|LOCUS_11660 98324 97479 gene locus_tag LOCUS_11670 98324 97479 CDS product DUF4942 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280513.1 protein_id gnl|my_center|LOCUS_11670 98606 98409 gene locus_tag LOCUS_11680 98606 98409 CDS product DUF957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772029.1 protein_id gnl|my_center|LOCUS_11680 99106 98618 gene locus_tag LOCUS_11690 99106 98618 CDS product DUF5983 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761715.1 protein_id gnl|my_center|LOCUS_11690 99468 99103 gene locus_tag LOCUS_11700 99468 99103 CDS product TA system toxin CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094437.1 protein_id gnl|my_center|LOCUS_11700 100803 100447 gene locus_tag LOCUS_11710 100803 100447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 101502 101266 gene locus_tag LOCUS_11720 101502 101266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 105333 101836 gene locus_tag LOCUS_11730 105333 101836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 105797 105612 gene locus_tag LOCUS_11740 105797 105612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11740 106612 106767 gene locus_tag LOCUS_11750 106612 106767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 106816 107190 gene locus_tag LOCUS_11760 106816 107190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 108664 107501 gene locus_tag LOCUS_11770 108664 107501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 109203 108718 gene locus_tag LOCUS_11780 gene ssb1 109203 108718 CDS product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168305.1 protein_id gnl|my_center|LOCUS_11780 112232 109851 gene locus_tag LOCUS_11790 112232 109851 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065355591.1 protein_id gnl|my_center|LOCUS_11790 113185 112247 gene locus_tag LOCUS_11800 113185 112247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 113786 114880 gene locus_tag LOCUS_11810 113786 114880 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065355593.1 protein_id gnl|my_center|LOCUS_11810 116321 115278 gene locus_tag LOCUS_11820 116321 115278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999840.1 protein_id gnl|my_center|LOCUS_11820 117916 116732 gene locus_tag LOCUS_11830 117916 116732 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218908.1 protein_id gnl|my_center|LOCUS_11830 118310 118216 gene locus_tag LOCUS_t00170 118310 118216 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 118603 119985 gene locus_tag LOCUS_11840 118603 119985 CDS product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834439.1 protein_id gnl|my_center|LOCUS_11840 119995 122313 gene locus_tag LOCUS_11850 gene yicI 119995 122313 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702898.1 protein_id gnl|my_center|LOCUS_11850 124075 122366 gene locus_tag LOCUS_11860 124075 122366 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300954.1 protein_id gnl|my_center|LOCUS_11860 125587 124196 gene locus_tag LOCUS_11870 gene xanP 125587 124196 CDS product xanthine/proton symporter XanP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295238.1 protein_id gnl|my_center|LOCUS_11870 125867 127072 gene locus_tag LOCUS_11880 gene gltS 125867 127072 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468833.1 protein_id gnl|my_center|LOCUS_11880 127075 127941 gene locus_tag LOCUS_11890 127075 127941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 130007 127926 gene locus_tag LOCUS_11900 gene recG 130007 127926 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678419.1 protein_id gnl|my_center|LOCUS_11900 130702 130013 gene locus_tag LOCUS_11910 gene trmH 130702 130013 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070177.1 protein_id gnl|my_center|LOCUS_11910 132817 130709 gene locus_tag LOCUS_11920 gene spoT 132817 130709 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280488.1 protein_id gnl|my_center|LOCUS_11920 133111 132836 gene locus_tag LOCUS_11930 gene rpoZ 133111 132836 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 protein_id gnl|my_center|LOCUS_11930 133789 133166 gene locus_tag LOCUS_11940 gene gmk 133789 133166 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295237.1 protein_id gnl|my_center|LOCUS_11940 134212 135729 gene locus_tag LOCUS_11950 gene ligB 134212 135729 CDS product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870036.1 protein_id gnl|my_center|LOCUS_11950 136343 135726 gene locus_tag LOCUS_11960 136343 135726 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924289.1 protein_id gnl|my_center|LOCUS_11960 137458 136634 gene locus_tag LOCUS_11970 gene dinD 137458 136634 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297973.1 protein_id gnl|my_center|LOCUS_11970 138542 137679 gene locus_tag LOCUS_11980 138542 137679 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621336.1 protein_id gnl|my_center|LOCUS_11980 138669 139385 gene locus_tag LOCUS_11990 gene rph 138669 139385 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247089.1 protein_id gnl|my_center|LOCUS_11990 139451 140092 gene locus_tag LOCUS_12000 gene pyrE 139451 140092 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806177.1 protein_id gnl|my_center|LOCUS_12000 140725 140129 gene locus_tag LOCUS_12010 gene slmA 140725 140129 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311223.1 protein_id gnl|my_center|LOCUS_12010 141290 140832 gene locus_tag LOCUS_12020 gene dut 141290 140832 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976070.1 protein_id gnl|my_center|LOCUS_12020 142488 141268 gene locus_tag LOCUS_12030 gene coaBC 142488 141268 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050139.1 protein_id gnl|my_center|LOCUS_12030 142660 143328 gene locus_tag LOCUS_12040 gene radC 142660 143328 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297375.1 protein_id gnl|my_center|LOCUS_12040 143545 143781 gene locus_tag LOCUS_12050 gene rpmB 143545 143781 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091955.1 protein_id gnl|my_center|LOCUS_12050 143802 143969 gene locus_tag LOCUS_12060 gene rpmG 143802 143969 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051798.1 protein_id gnl|my_center|LOCUS_12060 144067 144876 gene locus_tag LOCUS_12070 gene mutM 144067 144876 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114543.1 protein_id gnl|my_center|LOCUS_12070 145394 144915 gene locus_tag LOCUS_12080 gene coaD 145394 144915 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171866.1 protein_id gnl|my_center|LOCUS_12080 146679 145402 gene locus_tag LOCUS_12090 gene waaA 146679 145402 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891574.1 protein_id gnl|my_center|LOCUS_12090 147146 148150 gene locus_tag LOCUS_12100 gene rfaQ 147146 148150 CDS product lipopolysaccharide core heptosyltransferase RfaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303718.1 protein_id gnl|my_center|LOCUS_12100 148147 149271 gene locus_tag LOCUS_12110 148147 149271 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634246.1 protein_id gnl|my_center|LOCUS_12110 149264 150061 gene locus_tag LOCUS_12120 gene rfaP 149264 150061 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001357918.1 protein_id gnl|my_center|LOCUS_12120 150077 151093 gene locus_tag LOCUS_12130 gene waaO 150077 151093 CDS product lipopolysaccharide 3-alpha-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272734.1 protein_id gnl|my_center|LOCUS_12130 151110 151613 gene locus_tag LOCUS_12140 151110 151613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence08 446 48 gene locus_tag LOCUS_12150 446 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12150 2537 1197 gene locus_tag LOCUS_12160 gene fadL 2537 1197 CDS product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295701.1 protein_id gnl|my_center|LOCUS_12160 2909 3193 gene locus_tag LOCUS_12170 2909 3193 CDS product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296261.1 protein_id gnl|my_center|LOCUS_12170 3374 4684 gene locus_tag LOCUS_12180 gene fadI 3374 4684 CDS product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531952.1 protein_id gnl|my_center|LOCUS_12180 4684 6828 gene locus_tag LOCUS_12190 gene fadJ 4684 6828 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426176.1 protein_id gnl|my_center|LOCUS_12190 7031 7516 gene locus_tag LOCUS_12200 gene sixA 7031 7516 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195819.1 protein_id gnl|my_center|LOCUS_12200 8196 8759 gene locus_tag LOCUS_12210 8196 8759 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033316.1 protein_id gnl|my_center|LOCUS_12210 8899 11487 gene locus_tag LOCUS_12220 gene yfcU 8899 11487 CDS product fimbrial usher protein YfcU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112832.1 protein_id gnl|my_center|LOCUS_12220 11507 12259 gene locus_tag LOCUS_12230 11507 12259 CDS product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281606.1 protein_id gnl|my_center|LOCUS_12230 12276 12782 gene locus_tag LOCUS_12240 12276 12782 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642898.1 protein_id gnl|my_center|LOCUS_12240 12779 13258 gene locus_tag LOCUS_12250 12779 13258 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738798.1 protein_id gnl|my_center|LOCUS_12250 13255 13806 gene locus_tag LOCUS_12260 13255 13806 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054808.1 protein_id gnl|my_center|LOCUS_12260 13835 14632 gene locus_tag LOCUS_12270 13835 14632 CDS product StfH/YfcO family fimbrial adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301548.1 protein_id gnl|my_center|LOCUS_12270 15309 14758 gene locus_tag LOCUS_12280 gene smrB 15309 14758 CDS product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730805.1 protein_id gnl|my_center|LOCUS_12280 15475 16407 gene locus_tag LOCUS_12290 gene prmB 15475 16407 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295704.1 protein_id gnl|my_center|LOCUS_12290 16442 17527 gene locus_tag LOCUS_12300 gene aroC 16442 17527 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297933.1 protein_id gnl|my_center|LOCUS_12300 17531 18355 gene locus_tag LOCUS_12310 gene mepA 17531 18355 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043825.1 protein_id gnl|my_center|LOCUS_12310 18355 19164 gene locus_tag LOCUS_12320 18355 19164 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447361.1 protein_id gnl|my_center|LOCUS_12320 19164 19712 gene locus_tag LOCUS_12330 gene epmC 19164 19712 CDS product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089222.1 protein_id gnl|my_center|LOCUS_12330 19746 20024 gene locus_tag LOCUS_12340 19746 20024 CDS product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559764.1 protein_id gnl|my_center|LOCUS_12340 22151 20145 gene locus_tag LOCUS_12350 gene mnmC 22151 20145 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683799.1 protein_id gnl|my_center|LOCUS_12350 22310 23530 gene locus_tag LOCUS_12360 gene fabB 22310 23530 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817178.1 protein_id gnl|my_center|LOCUS_12360 23795 24973 gene locus_tag LOCUS_12370 23795 24973 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127753.1 protein_id gnl|my_center|LOCUS_12370 25845 24970 gene locus_tag LOCUS_12380 gene flk 25845 24970 CDS product flagella biosynthesis regulator Flk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615834.1 protein_id gnl|my_center|LOCUS_12380 26064 27200 gene locus_tag LOCUS_12390 gene pdxB 26064 27200 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699148.1 protein_id gnl|my_center|LOCUS_12390 27266 28279 gene locus_tag LOCUS_12400 27266 28279 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289167.1 protein_id gnl|my_center|LOCUS_12400 28279 29091 gene locus_tag LOCUS_12410 gene truA 28279 29091 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283586.1 protein_id gnl|my_center|LOCUS_12410 29174 29833 gene locus_tag LOCUS_12420 29174 29833 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364335.1 protein_id gnl|my_center|LOCUS_12420 29989 30903 gene locus_tag LOCUS_12430 gene accD 29989 30903 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118404.1 protein_id gnl|my_center|LOCUS_12430 30973 32241 gene locus_tag LOCUS_12440 gene folC 30973 32241 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584546.1 protein_id gnl|my_center|LOCUS_12440 32231 32893 gene locus_tag LOCUS_12450 gene dedD 32231 32893 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146992.1 protein_id gnl|my_center|LOCUS_12450 33152 33640 gene locus_tag LOCUS_12460 gene cvpA 33152 33640 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262113.1 protein_id gnl|my_center|LOCUS_12460 33677 35194 gene locus_tag LOCUS_12470 gene purF 33677 35194 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334220.1 protein_id gnl|my_center|LOCUS_12470 35289 35858 gene locus_tag LOCUS_12480 gene ubiX 35289 35858 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825700.1 protein_id gnl|my_center|LOCUS_12480 36124 36906 gene locus_tag LOCUS_12490 gene argT 36124 36906 CDS product lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748271.1 protein_id gnl|my_center|LOCUS_12490 37127 37909 gene locus_tag LOCUS_12500 gene hisJ 37127 37909 CDS product histidine ABC transporter substrate-binding protein HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737621.1 protein_id gnl|my_center|LOCUS_12500 37999 38685 gene locus_tag LOCUS_12510 gene hisQ 37999 38685 CDS product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965522.1 protein_id gnl|my_center|LOCUS_12510 38682 39398 gene locus_tag LOCUS_12520 38682 39398 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569958.1 protein_id gnl|my_center|LOCUS_12520 39406 40179 gene locus_tag LOCUS_12530 gene hisP 39406 40179 CDS product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293613.1 protein_id gnl|my_center|LOCUS_12530 40376 41266 gene locus_tag LOCUS_12540 gene rpnB 40376 41266 CDS product recombination-promoting nuclease RpnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156149.1 protein_id gnl|my_center|LOCUS_12540 42207 41314 gene locus_tag LOCUS_12550 42207 41314 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028341.1 protein_id gnl|my_center|LOCUS_12550 42590 42228 gene locus_tag LOCUS_12560 gene folX 42590 42228 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068457.1 protein_id gnl|my_center|LOCUS_12560 43294 42647 gene locus_tag LOCUS_12570 gene yfcG 43294 42647 CDS product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566471.1 protein_id gnl|my_center|LOCUS_12570 43430 44074 gene locus_tag LOCUS_12580 gene yfcF 43430 44074 CDS product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042440.1 protein_id gnl|my_center|LOCUS_12580 44130 44681 gene locus_tag LOCUS_12590 gene yfcE 44130 44681 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977007.1 protein_id gnl|my_center|LOCUS_12590 44739 45281 gene locus_tag LOCUS_12600 gene yfcD 44739 45281 CDS product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437935.1 protein_id gnl|my_center|LOCUS_12600 46792 45314 gene locus_tag LOCUS_12610 gene yfcC 46792 45314 CDS product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274493.1 protein_id gnl|my_center|LOCUS_12610 49168 47024 gene locus_tag LOCUS_12620 gene pta 49168 47024 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086722.1 protein_id gnl|my_center|LOCUS_12620 50445 49243 gene locus_tag LOCUS_12630 gene ackA 50445 49243 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095707.1 protein_id gnl|my_center|LOCUS_12630 50784 51239 gene locus_tag LOCUS_12640 gene yfbV 50784 51239 CDS product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106627.1 protein_id gnl|my_center|LOCUS_12640 51322 51816 gene locus_tag LOCUS_12650 51322 51816 CDS product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426124.1 protein_id gnl|my_center|LOCUS_12650 51827 52477 gene locus_tag LOCUS_12660 gene hxpA 51827 52477 CDS product hexitol phosphatase HxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203392.1 protein_id gnl|my_center|LOCUS_12660 52564 54396 gene locus_tag LOCUS_12670 52564 54396 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012899.1 protein_id gnl|my_center|LOCUS_12670 55054 54455 gene locus_tag LOCUS_12680 gene yfbR 55054 54455 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813860.1 protein_id gnl|my_center|LOCUS_12680 56355 55138 gene locus_tag LOCUS_12690 gene alaA 56355 55138 CDS product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074527.1 protein_id gnl|my_center|LOCUS_12690 57275 58213 gene locus_tag LOCUS_12700 gene lrhA 57275 58213 CDS product transcriptional regulator LrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622290.1 protein_id gnl|my_center|LOCUS_12700 58844 59287 gene locus_tag LOCUS_12710 gene nuoA 58844 59287 CDS product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062997.1 protein_id gnl|my_center|LOCUS_12710 59303 59965 gene locus_tag LOCUS_12720 gene nuoB 59303 59965 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386733.1 protein_id gnl|my_center|LOCUS_12720 60059 61861 gene locus_tag LOCUS_12730 gene nuoC 60059 61861 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247878.1 protein_id gnl|my_center|LOCUS_12730 61864 62364 gene locus_tag LOCUS_12740 gene nuoE 61864 62364 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545042.1 protein_id gnl|my_center|LOCUS_12740 62361 63698 gene locus_tag LOCUS_12750 gene nuoF 62361 63698 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789500.1 protein_id gnl|my_center|LOCUS_12750 63751 66477 gene locus_tag LOCUS_12760 gene nuoG 63751 66477 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301902.1 protein_id gnl|my_center|LOCUS_12760 66474 67451 gene locus_tag LOCUS_12770 gene nuoH 66474 67451 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118512.1 protein_id gnl|my_center|LOCUS_12770 67466 68008 gene locus_tag LOCUS_12780 gene nuoI 67466 68008 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172749.1 protein_id gnl|my_center|LOCUS_12780 68020 68574 gene locus_tag LOCUS_12790 gene nuoJ 68020 68574 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393511.1 protein_id gnl|my_center|LOCUS_12790 68571 68873 gene locus_tag LOCUS_12800 gene nuoK 68571 68873 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612644.1 protein_id gnl|my_center|LOCUS_12800 68870 70711 gene locus_tag LOCUS_12810 gene nuoL 68870 70711 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056643.1 protein_id gnl|my_center|LOCUS_12810 70942 72471 gene locus_tag LOCUS_12820 gene nuoM 70942 72471 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926441.1 protein_id gnl|my_center|LOCUS_12820 72478 73935 gene locus_tag LOCUS_12830 gene nuoN 72478 73935 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156701.1 protein_id gnl|my_center|LOCUS_12830 74521 74003 gene locus_tag LOCUS_12840 74521 74003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 75360 74839 gene locus_tag LOCUS_12850 75360 74839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12850 75950 75447 gene locus_tag LOCUS_12860 75950 75447 CDS product YfbM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525365.1 protein_id gnl|my_center|LOCUS_12860 78278 77070 gene locus_tag LOCUS_12870 gene elaD 78278 77070 CDS product deubiquitinase ElaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393504.1 protein_id gnl|my_center|LOCUS_12870 79386 78469 gene locus_tag LOCUS_12880 gene rbn 79386 78469 CDS product ribonuclease BN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300687.1 protein_id gnl|my_center|LOCUS_12880 79451 79912 gene locus_tag LOCUS_12890 79451 79912 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574091.1 protein_id gnl|my_center|LOCUS_12890 79967 80272 gene locus_tag LOCUS_12900 gene elaB 79967 80272 CDS product stress response protein ElaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070621.1 protein_id gnl|my_center|LOCUS_12900 80351 81646 gene locus_tag LOCUS_12910 gene menF 80351 81646 CDS product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191419.1 protein_id gnl|my_center|LOCUS_12910 81735 83405 gene locus_tag LOCUS_12920 gene menD 81735 83405 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295284.1 protein_id gnl|my_center|LOCUS_12920 83402 84160 gene locus_tag LOCUS_12930 gene menH 83402 84160 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600499.1 protein_id gnl|my_center|LOCUS_12930 84175 85032 gene locus_tag LOCUS_12940 gene menB 84175 85032 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639996.1 protein_id gnl|my_center|LOCUS_12940 85032 85994 gene locus_tag LOCUS_12950 gene menC 85032 85994 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255628.1 protein_id gnl|my_center|LOCUS_12950 85991 87346 gene locus_tag LOCUS_12960 gene menE 85991 87346 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577625.1 protein_id gnl|my_center|LOCUS_12960 87456 87722 gene locus_tag LOCUS_12970 gene pmrD 87456 87722 CDS product signal transduction protein PmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295285.1 protein_id gnl|my_center|LOCUS_12970 88102 87716 gene locus_tag LOCUS_12980 gene arnF 88102 87716 CDS product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523880.1 protein_id gnl|my_center|LOCUS_12980 88437 88102 gene locus_tag LOCUS_12990 gene arnE 88437 88102 CDS product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638031.1 protein_id gnl|my_center|LOCUS_12990 90086 88434 gene locus_tag LOCUS_13000 gene arnT 90086 88434 CDS product lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844057.1 protein_id gnl|my_center|LOCUS_13000 90976 90086 gene locus_tag LOCUS_13010 gene arnD 90976 90086 CDS product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169728.1 protein_id gnl|my_center|LOCUS_13010 92955 90973 gene locus_tag LOCUS_13020 gene arnA 92955 90973 CDS product bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860273.1 protein_id gnl|my_center|LOCUS_13020 93923 92955 gene locus_tag LOCUS_13030 gene arnC 93923 92955 CDS product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461657.1 protein_id gnl|my_center|LOCUS_13030 95066 93927 gene locus_tag LOCUS_13040 gene arnB 95066 93927 CDS product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807509.1 protein_id gnl|my_center|LOCUS_13040 95374 95976 gene locus_tag LOCUS_13050 gene ais 95374 95976 CDS product lipopolysaccharide core heptose(II)-phosphate phosphatase Ais inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879112.1 protein_id gnl|my_center|LOCUS_13050 96440 96015 gene locus_tag LOCUS_13060 gene nudI 96440 96015 CDS product nucleoside triphosphatase NudI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300564.1 protein_id gnl|my_center|LOCUS_13060 96719 97261 gene locus_tag LOCUS_13070 96719 97261 CDS product YfaZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300392.1 protein_id gnl|my_center|LOCUS_13070 97361 98563 gene locus_tag LOCUS_13080 97361 98563 CDS product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921621.1 protein_id gnl|my_center|LOCUS_13080 98783 99565 gene locus_tag LOCUS_13090 98783 99565 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894185.1 protein_id gnl|my_center|LOCUS_13090 99580 100785 gene locus_tag LOCUS_13100 gene rhmD 99580 100785 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001319848.1 protein_id gnl|my_center|LOCUS_13100 100842 102131 gene locus_tag LOCUS_13110 100842 102131 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100890.1 protein_id gnl|my_center|LOCUS_13110 102149 102952 gene locus_tag LOCUS_13120 gene yfaU 102149 102952 CDS product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992954.1 protein_id gnl|my_center|LOCUS_13120 103895 102993 gene locus_tag LOCUS_13130 103895 102993 CDS product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140553.1 protein_id gnl|my_center|LOCUS_13130 105278 104088 gene locus_tag LOCUS_13140 gene glpC 105278 104088 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000377.1 protein_id gnl|my_center|LOCUS_13140 106534 105275 gene locus_tag LOCUS_13150 gene glpB 106534 105275 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209898.1 protein_id gnl|my_center|LOCUS_13150 108152 106524 gene locus_tag LOCUS_13160 gene glpA 108152 106524 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857257.1 protein_id gnl|my_center|LOCUS_13160 108425 109783 gene locus_tag LOCUS_13170 gene glpT 108425 109783 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948732.1 protein_id gnl|my_center|LOCUS_13170 109788 110864 gene locus_tag LOCUS_13180 gene glpQ 109788 110864 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779084.1 protein_id gnl|my_center|LOCUS_13180 111112 110906 gene locus_tag LOCUS_13190 111112 110906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009396.1 protein_id gnl|my_center|LOCUS_13190 111327 111977 gene locus_tag LOCUS_13200 gene inaA 111327 111977 CDS product lipopolysaccharide kinase InaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301050.1 protein_id gnl|my_center|LOCUS_13200 112285 112031 gene locus_tag LOCUS_13210 gene yfaE 112285 112031 CDS product ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135040.1 protein_id gnl|my_center|LOCUS_13210 113454 112285 gene locus_tag LOCUS_13220 gene nrdB 113454 112285 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299501.1 protein_id gnl|my_center|LOCUS_13220 115942 113657 gene locus_tag LOCUS_13230 gene nrdA 115942 113657 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075164.1 protein_id gnl|my_center|LOCUS_13230 116926 120390 gene locus_tag LOCUS_13240 gene yfaL 116926 120390 CDS product AIDA-I family autotransporter adhesin YfaL/EhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220077.1 protein_id gnl|my_center|LOCUS_13240 121240 120518 gene locus_tag LOCUS_13250 121240 120518 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990754.1 protein_id gnl|my_center|LOCUS_13250 121387 124014 gene locus_tag LOCUS_13260 gene gyrA 121387 124014 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281251.1 protein_id gnl|my_center|LOCUS_13260 124163 125851 gene locus_tag LOCUS_13270 124163 125851 CDS product DUF2138 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012305.1 protein_id gnl|my_center|LOCUS_13270 125848 126471 gene locus_tag LOCUS_13280 125848 126471 CDS product DUF1175 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295211.1 protein_id gnl|my_center|LOCUS_13280 126615 131009 gene locus_tag LOCUS_13290 126615 131009 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001442934.1 protein_id gnl|my_center|LOCUS_13290 131010 132659 gene locus_tag LOCUS_13300 131010 132659 CDS product YfaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104549.1 protein_id gnl|my_center|LOCUS_13300 132664 133440 gene locus_tag LOCUS_13310 132664 133440 CDS product YfaP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225852.1 protein_id gnl|my_center|LOCUS_13310 134698 133514 gene locus_tag LOCUS_13320 gene atoB 134698 133514 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786547.1 protein_id gnl|my_center|LOCUS_13320 136051 134729 gene locus_tag LOCUS_13330 136051 134729 CDS product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580275.1 protein_id gnl|my_center|LOCUS_13330 136698 136048 gene locus_tag LOCUS_13340 gene atoA 136698 136048 CDS product acetate CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339065.1 protein_id gnl|my_center|LOCUS_13340 137360 136698 gene locus_tag LOCUS_13350 gene atoD 137360 136698 CDS product acetate CoA-transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850540.1 protein_id gnl|my_center|LOCUS_13350 138941 137556 gene locus_tag LOCUS_13360 gene atoC 138941 137556 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125282.1 protein_id gnl|my_center|LOCUS_13360 140710 138938 gene locus_tag LOCUS_13370 gene atoS 140710 138938 CDS product two-component system sensor histidine kinase AtoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559125.1 protein_id gnl|my_center|LOCUS_13370 140931 143780 gene locus_tag LOCUS_13380 gene rcsC 140931 143780 CDS product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876011.1 protein_id gnl|my_center|LOCUS_13380 >Feature sequence09 589 38 gene locus_tag LOCUS_13390 589 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 900 827 gene locus_tag LOCUS_t00180 900 827 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1734 979 gene locus_tag LOCUS_13400 gene actS 1734 979 CDS product amidase activator ActS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272558.1 protein_id gnl|my_center|LOCUS_13400 2149 4446 gene locus_tag LOCUS_13410 gene xdhA 2149 4446 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388150.1 protein_id gnl|my_center|LOCUS_13410 4457 5335 gene locus_tag LOCUS_13420 gene xdhB 4457 5335 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459182.1 protein_id gnl|my_center|LOCUS_13420 5332 5811 gene locus_tag LOCUS_13430 gene xdhC 5332 5811 CDS product xanthine dehydrogenase iron sulfur-binding subunit XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016605.1 protein_id gnl|my_center|LOCUS_13430 7629 5851 gene locus_tag LOCUS_13440 7629 5851 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417808.1 protein_id gnl|my_center|LOCUS_13440 8105 9295 gene locus_tag LOCUS_13450 gene ygeW 8105 9295 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978544.1 protein_id gnl|my_center|LOCUS_13450 9353 10549 gene locus_tag LOCUS_13460 gene dpaL 9353 10549 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110493.1 protein_id gnl|my_center|LOCUS_13460 10607 11818 gene locus_tag LOCUS_13470 10607 11818 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107125.1 protein_id gnl|my_center|LOCUS_13470 11871 13256 gene locus_tag LOCUS_13480 gene hyuA 11871 13256 CDS product D-phenylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264452.1 protein_id gnl|my_center|LOCUS_13480 13304 14236 gene locus_tag LOCUS_13490 gene arcC 13304 14236 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037992.1 protein_id gnl|my_center|LOCUS_13490 16082 14457 gene locus_tag LOCUS_13500 gene yqeB 16082 14457 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020381.1 protein_id gnl|my_center|LOCUS_13500 16609 16130 gene locus_tag LOCUS_13510 16609 16130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 17003 17581 gene locus_tag LOCUS_13520 gene mocA 17003 17581 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272860.1 protein_id gnl|my_center|LOCUS_13520 17902 21000 gene locus_tag LOCUS_13530 gene ygfK 17902 21000 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502395.1 protein_id gnl|my_center|LOCUS_13530 21003 22331 gene locus_tag LOCUS_13540 gene ssnA 21003 22331 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906252.1 protein_id gnl|my_center|LOCUS_13540 22382 23161 gene locus_tag LOCUS_13550 gene ygfM 22382 23161 CDS product molybdopterin-dependent oxidoreductase FAD-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572462.1 protein_id gnl|my_center|LOCUS_13550 23158 26028 gene locus_tag LOCUS_13560 23158 26028 CDS product molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583615.1 protein_id gnl|my_center|LOCUS_13560 26193 27593 gene locus_tag LOCUS_13570 gene xanQ 26193 27593 CDS product xanthine/proton symporter XanQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280192.1 protein_id gnl|my_center|LOCUS_13570 27611 28927 gene locus_tag LOCUS_13580 gene guaD 27611 28927 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311109.1 protein_id gnl|my_center|LOCUS_13580 28963 30330 gene locus_tag LOCUS_13590 gene ghxQ 28963 30330 CDS product guanine/hypoxanthine transporter GhxQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012163.1 protein_id gnl|my_center|LOCUS_13590 30854 30366 gene locus_tag LOCUS_13600 30854 30366 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838428.1 protein_id gnl|my_center|LOCUS_13600 32788 30854 gene locus_tag LOCUS_13610 gene ygfT 32788 30854 CDS product formate-dependent uric acid utilization protein YgfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350545.1 protein_id gnl|my_center|LOCUS_13610 33209 34657 gene locus_tag LOCUS_13620 gene uacT 33209 34657 CDS product urate/proton symporter UacT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295374.1 protein_id gnl|my_center|LOCUS_13620 34907 35455 gene locus_tag LOCUS_13630 gene idi 34907 35455 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192814.1 protein_id gnl|my_center|LOCUS_13630 37015 35498 gene locus_tag LOCUS_13640 gene lysS 37015 35498 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003071.1 protein_id gnl|my_center|LOCUS_13640 37906 37025 gene locus_tag LOCUS_13650 gene prfB 37906 37025 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001701073.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13650 39947 38214 gene locus_tag LOCUS_13660 gene recJ 39947 38214 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813185.1 protein_id gnl|my_center|LOCUS_13660 40663 39953 gene locus_tag LOCUS_13670 gene dsbC 40663 39953 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715214.1 protein_id gnl|my_center|LOCUS_13670 41584 40688 gene locus_tag LOCUS_13680 gene xerD 41584 40688 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806638.1 protein_id gnl|my_center|LOCUS_13680 41696 42217 gene locus_tag LOCUS_13690 gene fldB 41696 42217 CDS product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055874.1 protein_id gnl|my_center|LOCUS_13690 42664 42257 gene locus_tag LOCUS_13700 42664 42257 CDS product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244777.1 protein_id gnl|my_center|LOCUS_13700 42911 42645 gene locus_tag LOCUS_13710 gene sdhE 42911 42645 CDS product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354046.1 protein_id gnl|my_center|LOCUS_13710 43154 44134 gene locus_tag LOCUS_13720 gene ygfZ 43154 44134 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886062.1 protein_id gnl|my_center|LOCUS_13720 44989 44330 gene locus_tag LOCUS_13730 44989 44330 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250274.1 protein_id gnl|my_center|LOCUS_13730 45464 45153 gene locus_tag LOCUS_13740 gene yqfB 45464 45153 CDS product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182954.1 protein_id gnl|my_center|LOCUS_13740 45509 46942 gene locus_tag LOCUS_13750 gene bglA 45509 46942 CDS product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295376.1 protein_id gnl|my_center|LOCUS_13750 47742 46999 gene locus_tag LOCUS_13760 47742 46999 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951964.1 protein_id gnl|my_center|LOCUS_13760 50881 48008 gene locus_tag LOCUS_13770 gene gcvP 50881 48008 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195023.1 protein_id gnl|my_center|LOCUS_13770 51389 51000 gene locus_tag LOCUS_13780 gene gcvH 51389 51000 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295377.1 protein_id gnl|my_center|LOCUS_13780 52507 51413 gene locus_tag LOCUS_13790 gene gcvT 52507 51413 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068701.1 protein_id gnl|my_center|LOCUS_13790 54156 52954 gene locus_tag LOCUS_13800 gene ubiI 54156 52954 CDS product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192185.1 protein_id gnl|my_center|LOCUS_13800 55357 54179 gene locus_tag LOCUS_13810 gene ubiH 55357 54179 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111195.1 protein_id gnl|my_center|LOCUS_13810 56679 55354 gene locus_tag LOCUS_13820 gene pepP 56679 55354 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290122.1 protein_id gnl|my_center|LOCUS_13820 57283 56705 gene locus_tag LOCUS_13830 gene ygfB 57283 56705 CDS product UPF0149 family protein YgfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295378.1 protein_id gnl|my_center|LOCUS_13830 57451 57780 gene locus_tag LOCUS_13840 gene zapA 57451 57780 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276008.1 protein_id gnl|my_center|LOCUS_13840 58080 58628 gene locus_tag LOCUS_13850 58080 58628 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192742.1 protein_id gnl|my_center|LOCUS_13850 60249 59017 gene locus_tag LOCUS_13860 gene serA 60249 59017 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151604.1 protein_id gnl|my_center|LOCUS_13860 61164 60505 gene locus_tag LOCUS_13870 gene rpiA 61164 60505 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189743.1 protein_id gnl|my_center|LOCUS_13870 61450 61220 gene locus_tag LOCUS_13880 61450 61220 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545308.1 protein_id gnl|my_center|LOCUS_13880 61592 62485 gene locus_tag LOCUS_13890 gene argP 61592 62485 CDS product DNA-binding transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828351.1 protein_id gnl|my_center|LOCUS_13890 62689 64833 gene locus_tag LOCUS_13900 gene scpA 62689 64833 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073223.1 protein_id gnl|my_center|LOCUS_13900 64826 65821 gene locus_tag LOCUS_13910 gene meaB 64826 65821 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606525.1 protein_id gnl|my_center|LOCUS_13910 65832 66617 gene locus_tag LOCUS_13920 gene scpB 65832 66617 CDS product methylmalonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122080.1 protein_id gnl|my_center|LOCUS_13920 66641 68119 gene locus_tag LOCUS_13930 gene scpC 66641 68119 CDS product propionyl-CoA:succinate CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449965.1 protein_id gnl|my_center|LOCUS_13930 69012 68116 gene locus_tag LOCUS_13940 69012 68116 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350807.1 protein_id gnl|my_center|LOCUS_13940 69919 69179 gene locus_tag LOCUS_13950 69919 69179 CDS product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669834.1 protein_id gnl|my_center|LOCUS_13950 70647 70012 gene locus_tag LOCUS_13960 gene argO 70647 70012 CDS product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493352.1 protein_id gnl|my_center|LOCUS_13960 71646 70786 gene locus_tag LOCUS_13970 gene mscS 71646 70786 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389818.1 protein_id gnl|my_center|LOCUS_13970 73083 72004 gene locus_tag LOCUS_13980 gene fbaA 73083 72004 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034372.1 protein_id gnl|my_center|LOCUS_13980 74461 73298 gene locus_tag LOCUS_13990 gene pgk 74461 73298 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111269.1 protein_id gnl|my_center|LOCUS_13990 75530 74511 gene locus_tag LOCUS_14000 gene epd 75530 74511 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218480.1 protein_id gnl|my_center|LOCUS_14000 76528 75815 gene locus_tag LOCUS_14010 76528 75815 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687705.1 protein_id gnl|my_center|LOCUS_14010 77034 76525 gene locus_tag LOCUS_14020 gene fumE 77034 76525 CDS product fumarase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224147.1 protein_id gnl|my_center|LOCUS_14020 78021 77056 gene locus_tag LOCUS_14030 gene glpX 78021 77056 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987283.1 protein_id gnl|my_center|LOCUS_14030 79295 78018 gene locus_tag LOCUS_14040 79295 78018 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853247.1 protein_id gnl|my_center|LOCUS_14040 80698 79310 gene locus_tag LOCUS_14050 gene cmtA 80698 79310 CDS product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428805.1 protein_id gnl|my_center|LOCUS_14050 81085 80753 gene locus_tag LOCUS_14060 81085 80753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14060 83474 81483 gene locus_tag LOCUS_14070 gene tkt 83474 81483 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098614.1 protein_id gnl|my_center|LOCUS_14070 83752 84510 gene locus_tag LOCUS_14080 gene loiP 83752 84510 CDS product metalloprotease LoiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326497.1 protein_id gnl|my_center|LOCUS_14080 85636 84716 gene locus_tag LOCUS_14090 gene speB 85636 84716 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105566.1 protein_id gnl|my_center|LOCUS_14090 87672 85774 gene locus_tag LOCUS_14100 gene speA 87672 85774 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300904.1 protein_id gnl|my_center|LOCUS_14100 88026 88241 gene locus_tag LOCUS_14110 gene yqgC 88026 88241 CDS product protein YqgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303650.1 protein_id gnl|my_center|LOCUS_14110 88545 89699 gene locus_tag LOCUS_14120 gene metK 88545 89699 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062128.1 protein_id gnl|my_center|LOCUS_14120 90123 91517 gene locus_tag LOCUS_14130 gene galP 90123 91517 CDS product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112301.1 protein_id gnl|my_center|LOCUS_14130 91636 92091 gene locus_tag LOCUS_14140 91636 92091 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300769.1 protein_id gnl|my_center|LOCUS_14140 92186 92893 gene locus_tag LOCUS_14150 gene endA 92186 92893 CDS product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286500.1 protein_id gnl|my_center|LOCUS_14150 92973 93704 gene locus_tag LOCUS_14160 gene rsmE 92973 93704 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300912.1 protein_id gnl|my_center|LOCUS_14160 93717 94667 gene locus_tag LOCUS_14170 gene gshB 93717 94667 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593273.1 protein_id gnl|my_center|LOCUS_14170 94776 95339 gene locus_tag LOCUS_14180 94776 95339 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053178.1 protein_id gnl|my_center|LOCUS_14180 95339 95755 gene locus_tag LOCUS_14190 gene ruvX 95339 95755 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017106.1 protein_id gnl|my_center|LOCUS_14190 96919 95939 gene locus_tag LOCUS_14200 96919 95939 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326494.1 protein_id gnl|my_center|LOCUS_14200 96937 97641 gene locus_tag LOCUS_14210 gene yggS 96937 97641 CDS product pyridoxal phosphate homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997795.1 protein_id gnl|my_center|LOCUS_14210 97659 98225 gene locus_tag LOCUS_14220 gene yggT 97659 98225 CDS product osmotic shock tolerance protein YggT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094831.1 protein_id gnl|my_center|LOCUS_14220 98222 98512 gene locus_tag LOCUS_14230 gene yggU 98222 98512 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313260.1 protein_id gnl|my_center|LOCUS_14230 98520 99113 gene locus_tag LOCUS_14240 gene rdgB 98520 99113 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174737.1 protein_id gnl|my_center|LOCUS_14240 99106 100242 gene locus_tag LOCUS_14250 gene hemW 99106 100242 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239976.1 protein_id gnl|my_center|LOCUS_14250 101314 100307 gene locus_tag LOCUS_14260 101314 100307 CDS product DUF1202 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745184.1 protein_id gnl|my_center|LOCUS_14260 102477 101431 gene locus_tag LOCUS_14270 gene ansB 102477 101431 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394107.1 protein_id gnl|my_center|LOCUS_14270 103372 102653 gene locus_tag LOCUS_14280 103372 102653 CDS product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984796.1 protein_id gnl|my_center|LOCUS_14280 103882 103556 gene locus_tag LOCUS_14290 103882 103556 CDS product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107564.1 protein_id gnl|my_center|LOCUS_14290 104601 103882 gene locus_tag LOCUS_14300 gene trmB 104601 103882 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786911.1 protein_id gnl|my_center|LOCUS_14300 104762 105814 gene locus_tag LOCUS_14310 gene mutY 104762 105814 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001321419.1 protein_id gnl|my_center|LOCUS_14310 105842 106117 gene locus_tag LOCUS_14320 105842 106117 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091700.1 protein_id gnl|my_center|LOCUS_14320 106179 107261 gene locus_tag LOCUS_14330 gene mltC 106179 107261 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298916.1 protein_id gnl|my_center|LOCUS_14330 107463 108719 gene locus_tag LOCUS_14340 gene nupG 107463 108719 CDS product nucleoside permease NupG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333541.1 protein_id gnl|my_center|LOCUS_14340 110894 108768 gene locus_tag LOCUS_14350 gene speC 110894 108768 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839789.1 protein_id gnl|my_center|LOCUS_14350 111275 112003 gene locus_tag LOCUS_14360 111275 112003 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234526.1 protein_id gnl|my_center|LOCUS_14360 112109 112184 gene locus_tag LOCUS_t00190 112109 112184 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 112382 113341 gene locus_tag LOCUS_14370 112382 113341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 113406 114323 gene locus_tag LOCUS_14380 113406 114323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250228.1 protein_id gnl|my_center|LOCUS_14380 114408 115280 gene locus_tag LOCUS_14390 114408 115280 CDS product GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001322100.1 protein_id gnl|my_center|LOCUS_14390 115652 118498 gene locus_tag LOCUS_14400 115652 118498 CDS product Ag43/Cah family autotransporter adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820574.1 protein_id gnl|my_center|LOCUS_14400 118619 121135 gene locus_tag LOCUS_14410 118619 121135 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387066.1 protein_id gnl|my_center|LOCUS_14410 121212 121667 gene locus_tag LOCUS_14420 121212 121667 CDS product IrmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005051844.1 protein_id gnl|my_center|LOCUS_14420 121746 121979 gene locus_tag LOCUS_14430 121746 121979 CDS product DUF905 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119729.1 protein_id gnl|my_center|LOCUS_14430 122079 122897 gene locus_tag LOCUS_14440 122079 122897 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234716.1 protein_id gnl|my_center|LOCUS_14440 122952 123437 gene locus_tag LOCUS_14450 122952 123437 CDS product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214398.1 protein_id gnl|my_center|LOCUS_14450 123453 123929 gene locus_tag LOCUS_14460 123453 123929 CDS product RadC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602267.1 protein_id gnl|my_center|LOCUS_14460 123992 124213 gene locus_tag LOCUS_14470 123992 124213 CDS product DUF987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692300.1 protein_id gnl|my_center|LOCUS_14470 124232 125293 gene locus_tag LOCUS_14480 124232 125293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 125383 125757 gene locus_tag LOCUS_14490 125383 125757 CDS product TA system toxin CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854712.1 protein_id gnl|my_center|LOCUS_14490 125754 126242 gene locus_tag LOCUS_14500 125754 126242 CDS product DUF5983 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976853.1 protein_id gnl|my_center|LOCUS_14500 126254 126451 gene locus_tag LOCUS_14510 126254 126451 CDS product DUF957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839270.1 protein_id gnl|my_center|LOCUS_14510 126548 127117 gene locus_tag LOCUS_14520 126548 127117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 127475 127630 gene locus_tag LOCUS_14530 127475 127630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 128441 129424 gene locus_tag LOCUS_14540 128441 129424 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298261.1 protein_id gnl|my_center|LOCUS_14540 129496 130644 gene locus_tag LOCUS_14550 129496 130644 CDS product capsule polysaccharide export inner-membrane protein KpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905920.1 protein_id gnl|my_center|LOCUS_14550 130668 132344 gene locus_tag LOCUS_14560 130668 132344 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001331697.1 protein_id gnl|my_center|LOCUS_14560 132354 133094 gene locus_tag LOCUS_14570 gene kdsB 132354 133094 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030761.1 protein_id gnl|my_center|LOCUS_14570 133091 135118 gene locus_tag LOCUS_14580 133091 135118 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579521.1 protein_id gnl|my_center|LOCUS_14580 135153 136385 gene locus_tag LOCUS_14590 135153 136385 CDS product capsular biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161827.1 protein_id gnl|my_center|LOCUS_14590 137598 136639 gene locus_tag LOCUS_14600 137598 136639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120131349.1 protein_id gnl|my_center|LOCUS_14600 138772 137633 gene locus_tag LOCUS_14610 138772 137633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 139936 139346 gene locus_tag LOCUS_14620 139936 139346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence10 <1 512 gene locus_tag LOCUS_14630 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000291288.1:N-acetylglucosamine kinase 528 1367 gene locus_tag LOCUS_14640 gene cobB 528 1367 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952737.1 protein_id gnl|my_center|LOCUS_14640 2274 1486 gene locus_tag LOCUS_14650 2274 1486 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713462.1 protein_id gnl|my_center|LOCUS_14650 2731 2324 gene locus_tag LOCUS_14660 2731 2324 CDS product DUF3592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076376.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14660 3835 2789 gene locus_tag LOCUS_14670 gene potD 3835 2789 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759317.1 protein_id gnl|my_center|LOCUS_14670 4626 3832 gene locus_tag LOCUS_14680 gene potC 4626 3832 CDS product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580316.1 protein_id gnl|my_center|LOCUS_14680 5480 4623 gene locus_tag LOCUS_14690 gene potB 5480 4623 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799401.1 protein_id gnl|my_center|LOCUS_14690 6600 5464 gene locus_tag LOCUS_14700 gene potA 6600 5464 CDS product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531594.1 protein_id gnl|my_center|LOCUS_14700 6850 8076 gene locus_tag LOCUS_14710 gene pepT 6850 8076 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359446.1 protein_id gnl|my_center|LOCUS_14710 9246 8125 gene locus_tag LOCUS_14720 gene roxA 9246 8125 CDS product [50S ribosomal protein L16]-arginine 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933638.1 protein_id gnl|my_center|LOCUS_14720 10782 9322 gene locus_tag LOCUS_14730 gene phoQ 10782 9322 CDS product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735404.1 protein_id gnl|my_center|LOCUS_14730 11453 10782 gene locus_tag LOCUS_14740 gene phoP 11453 10782 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265481.1 protein_id gnl|my_center|LOCUS_14740 12991 11621 gene locus_tag LOCUS_14750 gene purB 12991 11621 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423729.1 protein_id gnl|my_center|LOCUS_14750 13642 12995 gene locus_tag LOCUS_14760 gene hflD 13642 12995 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297479.1 protein_id gnl|my_center|LOCUS_14760 14823 13672 gene locus_tag LOCUS_14770 14823 13672 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297484.1 protein_id gnl|my_center|LOCUS_14770 15293 14832 gene locus_tag LOCUS_14780 gene nudJ 15293 14832 CDS product phosphatase NudJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476093.1 protein_id gnl|my_center|LOCUS_14780 15836 15303 gene locus_tag LOCUS_14790 gene rluE 15836 15303 CDS product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248690.1 protein_id gnl|my_center|LOCUS_14790 16128 17378 gene locus_tag LOCUS_14800 gene icd 16128 17378 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444487.1 protein_id gnl|my_center|LOCUS_14800 18904 18500 gene locus_tag LOCUS_14810 18904 18500 CDS product DUF1398 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373101.1 protein_id gnl|my_center|LOCUS_14810 19856 19125 gene locus_tag LOCUS_14820 gene bluR 19856 19125 CDS product DNA-binding transcriptional repressor BluR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332300.1 protein_id gnl|my_center|LOCUS_14820 21272 20061 gene locus_tag LOCUS_14830 gene bluF 21272 20061 CDS product blue light-responsive regulator BluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297681.1 protein_id gnl|my_center|LOCUS_14830 21586 21822 gene locus_tag LOCUS_14840 gene ycgZ 21586 21822 CDS product regulatory protein YcgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554140.1 protein_id gnl|my_center|LOCUS_14840 21865 22137 gene locus_tag LOCUS_14850 21865 22137 CDS product two-component-system connector protein YmgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858002.1 protein_id gnl|my_center|LOCUS_14850 22166 22432 gene locus_tag LOCUS_14860 gene ariR 22166 22432 CDS product biofilm/acid-resistance regulator AriR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888772.1 protein_id gnl|my_center|LOCUS_14860 22617 22793 gene locus_tag LOCUS_14870 22617 22793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 23083 24648 gene locus_tag LOCUS_14880 23083 24648 CDS product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246498.1 protein_id gnl|my_center|LOCUS_14880 25398 26918 gene locus_tag LOCUS_14890 25398 26918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 26985 28019 gene locus_tag LOCUS_14900 26985 28019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14900 28431 28102 gene locus_tag LOCUS_14910 28431 28102 CDS product YmgD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295611.1 protein_id gnl|my_center|LOCUS_14910 28725 28441 gene locus_tag LOCUS_14920 28725 28441 CDS product glycine zipper family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304448.1 protein_id gnl|my_center|LOCUS_14920 29295 29483 gene locus_tag LOCUS_14930 29295 29483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14930 29492 29704 gene locus_tag LOCUS_14940 29492 29704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14940 30342 30076 gene locus_tag LOCUS_14950 gene minE 30342 30076 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185665.1 protein_id gnl|my_center|LOCUS_14950 31158 30346 gene locus_tag LOCUS_14960 gene minD 31158 30346 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101055.1 protein_id gnl|my_center|LOCUS_14960 31877 31182 gene locus_tag LOCUS_14970 gene minC 31877 31182 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072536.1 protein_id gnl|my_center|LOCUS_14970 32397 32765 gene locus_tag LOCUS_14980 32397 32765 CDS product YcgJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056840.1 protein_id gnl|my_center|LOCUS_14980 33269 32868 gene locus_tag LOCUS_14990 33269 32868 CDS product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695220.1 protein_id gnl|my_center|LOCUS_14990 33511 33804 gene locus_tag LOCUS_15000 33511 33804 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125718.1 protein_id gnl|my_center|LOCUS_15000 33876 34535 gene locus_tag LOCUS_15010 33876 34535 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284277.1 protein_id gnl|my_center|LOCUS_15010 34612 35073 gene locus_tag LOCUS_15020 34612 35073 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807626.1 protein_id gnl|my_center|LOCUS_15020 35711 35280 gene locus_tag LOCUS_15030 35711 35280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15030 36324 35665 gene locus_tag LOCUS_15040 36324 35665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15040 36553 36972 gene locus_tag LOCUS_15050 36553 36972 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897378.1 protein_id gnl|my_center|LOCUS_15050 36972 38240 gene locus_tag LOCUS_15060 gene umuC 36972 38240 CDS product DNA polymerase V catalytic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457616.1 protein_id gnl|my_center|LOCUS_15060 38765 38286 gene locus_tag LOCUS_15070 gene dsbB 38765 38286 CDS product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943459.1 protein_id gnl|my_center|LOCUS_15070 40503 38962 gene locus_tag LOCUS_15080 gene nhaB 40503 38962 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406391.1 protein_id gnl|my_center|LOCUS_15080 40724 41443 gene locus_tag LOCUS_15090 gene fadR 40724 41443 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234823.1 protein_id gnl|my_center|LOCUS_15090 43027 41495 gene locus_tag LOCUS_15100 43027 41495 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190854.1 protein_id gnl|my_center|LOCUS_15100 43357 44655 gene locus_tag LOCUS_15110 gene dadA 43357 44655 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266908.1 protein_id gnl|my_center|LOCUS_15110 44665 45735 gene locus_tag LOCUS_15120 gene dadX 44665 45735 CDS product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197881.1 protein_id gnl|my_center|LOCUS_15120 47857 46121 gene locus_tag LOCUS_15130 47857 46121 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340194.1 protein_id gnl|my_center|LOCUS_15130 48866 47952 gene locus_tag LOCUS_15140 gene ldcA 48866 47952 CDS product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051560.1 protein_id gnl|my_center|LOCUS_15140 48839 49027 gene locus_tag LOCUS_15150 48839 49027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 48966 49577 gene locus_tag LOCUS_15160 gene emtA 48966 49577 CDS product membrane-bound lytic murein transglycosylase EmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301104.1 protein_id gnl|my_center|LOCUS_15160 50313 49579 gene locus_tag LOCUS_15170 50313 49579 CDS product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020169.1 protein_id gnl|my_center|LOCUS_15170 50514 50768 gene locus_tag LOCUS_15180 50514 50768 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511315.1 protein_id gnl|my_center|LOCUS_15180 50946 51386 gene locus_tag LOCUS_15190 gene ycgY 50946 51386 CDS product protein YcgY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615067.1 protein_id gnl|my_center|LOCUS_15190 53162 51465 gene locus_tag LOCUS_15200 gene treA 53162 51465 CDS product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841714.1 protein_id gnl|my_center|LOCUS_15200 54900 53482 gene locus_tag LOCUS_15210 gene dhaM 54900 53482 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301101.1 protein_id gnl|my_center|LOCUS_15210 55543 54911 gene locus_tag LOCUS_15220 gene dhaL 55543 54911 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059411.1 protein_id gnl|my_center|LOCUS_15220 56624 55554 gene locus_tag LOCUS_15230 gene dhaK 56624 55554 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733715.1 protein_id gnl|my_center|LOCUS_15230 56930 58771 gene locus_tag LOCUS_15240 gene dhaR 56930 58771 CDS product dihydroxyacetone kinase operon transcriptional regulator DhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350505.1 protein_id gnl|my_center|LOCUS_15240 61738 58871 gene locus_tag LOCUS_15250 61738 58871 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001334788.1 protein_id gnl|my_center|LOCUS_15250 63598 62507 gene locus_tag LOCUS_15260 gene ychF 63598 62507 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505866.1 protein_id gnl|my_center|LOCUS_15260 64299 63715 gene locus_tag LOCUS_15270 gene pth 64299 63715 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152933.1 protein_id gnl|my_center|LOCUS_15270 64577 64855 gene locus_tag LOCUS_15280 gene ychH 64577 64855 CDS product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823885.1 protein_id gnl|my_center|LOCUS_15280 66589 64910 gene locus_tag LOCUS_15290 gene dauA 66589 64910 CDS product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033352.1 protein_id gnl|my_center|LOCUS_15290 67727 66714 gene locus_tag LOCUS_15300 gene prs 67727 66714 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119392.1 protein_id gnl|my_center|LOCUS_15300 68663 67812 gene locus_tag LOCUS_15310 gene ispE 68663 67812 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260333.1 protein_id gnl|my_center|LOCUS_15310 69286 68663 gene locus_tag LOCUS_15320 gene lolB 69286 68663 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130692.1 protein_id gnl|my_center|LOCUS_15320 69500 70756 gene locus_tag LOCUS_15330 gene hemA 69500 70756 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299679.1 protein_id gnl|my_center|LOCUS_15330 70798 71880 gene locus_tag LOCUS_15340 gene prfA 70798 71880 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804726.1 protein_id gnl|my_center|LOCUS_15340 71880 72713 gene locus_tag LOCUS_15350 gene prmC 71880 72713 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456476.1 protein_id gnl|my_center|LOCUS_15350 72710 73102 gene locus_tag LOCUS_15360 gene sirB2 72710 73102 CDS product invasion regulator SirB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200374.1 protein_id gnl|my_center|LOCUS_15360 73106 73915 gene locus_tag LOCUS_15370 gene sirB1 73106 73915 CDS product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257044.1 protein_id gnl|my_center|LOCUS_15370 73951 74805 gene locus_tag LOCUS_15380 gene kdsA 73951 74805 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811065.1 protein_id gnl|my_center|LOCUS_15380 75086 74952 gene locus_tag LOCUS_15390 75086 74952 CDS product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517635.1 protein_id gnl|my_center|LOCUS_15390 75621 75487 gene locus_tag LOCUS_15400 75621 75487 CDS product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517635.1 protein_id gnl|my_center|LOCUS_15400 76156 76022 gene locus_tag LOCUS_15410 76156 76022 CDS product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517635.1 protein_id gnl|my_center|LOCUS_15410 77634 76534 gene locus_tag LOCUS_15420 gene chaA 77634 76534 CDS product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295620.1 protein_id gnl|my_center|LOCUS_15420 77904 78134 gene locus_tag LOCUS_15430 gene chaB 77904 78134 CDS product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146444.1 protein_id gnl|my_center|LOCUS_15430 78313 78987 gene locus_tag LOCUS_15440 gene chaC 78313 78987 CDS product glutathione-specific gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386742.1 protein_id gnl|my_center|LOCUS_15440 79384 79031 gene locus_tag LOCUS_15450 gene ychN 79384 79031 CDS product DsrE/F sulfur relay family protein YchN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169669.1 protein_id gnl|my_center|LOCUS_15450 79534 80964 gene locus_tag LOCUS_15460 gene ychO 79534 80964 CDS product inverse autotransporter invasin YchO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464994.1 protein_id gnl|my_center|LOCUS_15460 81615 80965 gene locus_tag LOCUS_15470 gene narL 81615 80965 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070491.1 protein_id gnl|my_center|LOCUS_15470 83404 81608 gene locus_tag LOCUS_15480 gene narX 83404 81608 CDS product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918073.1 protein_id gnl|my_center|LOCUS_15480 83430 83648 gene locus_tag LOCUS_15490 83430 83648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069498.1 protein_id gnl|my_center|LOCUS_15490 83899 85134 gene locus_tag LOCUS_15500 gene narK 83899 85134 CDS product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019827.1 protein_id gnl|my_center|LOCUS_15500 85650 89393 gene locus_tag LOCUS_15510 85650 89393 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032935.1 protein_id gnl|my_center|LOCUS_15510 89390 90928 gene locus_tag LOCUS_15520 gene narH 89390 90928 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702660.1 protein_id gnl|my_center|LOCUS_15520 90925 91635 gene locus_tag LOCUS_15530 gene narJ 90925 91635 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571699.1 protein_id gnl|my_center|LOCUS_15530 91635 92312 gene locus_tag LOCUS_15540 gene narI 91635 92312 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160110.1 protein_id gnl|my_center|LOCUS_15540 92758 92674 gene locus_tag LOCUS_t00200 92758 92674 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 93052 92968 gene locus_tag LOCUS_t00210 93052 92968 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 94054 93212 gene locus_tag LOCUS_15550 gene purU 94054 93212 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555849.1 protein_id gnl|my_center|LOCUS_15550 94562 94104 gene locus_tag LOCUS_15560 94562 94104 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001362540.1 protein_id gnl|my_center|LOCUS_15560 94636 95580 gene locus_tag LOCUS_15570 gene rssA 94636 95580 CDS product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190792.1 protein_id gnl|my_center|LOCUS_15570 95672 96685 gene locus_tag LOCUS_15580 gene rssB 95672 96685 CDS product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193447.1 protein_id gnl|my_center|LOCUS_15580 96887 97795 gene locus_tag LOCUS_15590 gene galU 96887 97795 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718995.1 protein_id gnl|my_center|LOCUS_15590 98352 97939 gene locus_tag LOCUS_15600 gene hns 98352 97939 CDS product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287378.1 protein_id gnl|my_center|LOCUS_15600 99046 99573 gene locus_tag LOCUS_15610 gene tdk 99046 99573 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068079.1 protein_id gnl|my_center|LOCUS_15610 102550 99875 gene locus_tag LOCUS_15620 gene adhE 102550 99875 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301653.1 protein_id gnl|my_center|LOCUS_15620 103027 103674 gene locus_tag LOCUS_15630 gene ychE 103027 103674 CDS product NAAT family transporter YchE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616554.1 protein_id gnl|my_center|LOCUS_15630 104412 106043 gene locus_tag LOCUS_15640 gene oppA 104412 106043 CDS product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295623.1 protein_id gnl|my_center|LOCUS_15640 106129 107049 gene locus_tag LOCUS_15650 gene oppB 106129 107049 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911112.1 protein_id gnl|my_center|LOCUS_15650 107064 107972 gene locus_tag LOCUS_15660 gene oppC 107064 107972 CDS product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979661.1 protein_id gnl|my_center|LOCUS_15660 107984 108997 gene locus_tag LOCUS_15670 gene oppD 107984 108997 CDS product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110945.1 protein_id gnl|my_center|LOCUS_15670 108994 109998 gene locus_tag LOCUS_15680 gene oppF 108994 109998 CDS product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994905.1 protein_id gnl|my_center|LOCUS_15680 110380 110051 gene locus_tag LOCUS_15690 110380 110051 CDS product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366959.1 protein_id gnl|my_center|LOCUS_15690 111875 110415 gene locus_tag LOCUS_15700 gene cls 111875 110415 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214516.1 protein_id gnl|my_center|LOCUS_15700 113379 112246 gene locus_tag LOCUS_15710 gene kch 113379 112246 CDS product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020078.1 protein_id gnl|my_center|LOCUS_15710 114095 113799 gene locus_tag LOCUS_15720 114095 113799 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967595.1 protein_id gnl|my_center|LOCUS_15720 114319 115038 gene locus_tag LOCUS_15730 114319 115038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 115476 115078 gene locus_tag LOCUS_15740 gene yciA 115476 115078 CDS product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108160.1 protein_id gnl|my_center|LOCUS_15740 116120 115581 gene locus_tag LOCUS_15750 116120 115581 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808667.1 protein_id gnl|my_center|LOCUS_15750 116893 116150 gene locus_tag LOCUS_15760 116893 116150 CDS product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028540.1 protein_id gnl|my_center|LOCUS_15760 117250 117888 gene locus_tag LOCUS_15770 gene ompW 117250 117888 CDS product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737226.1 protein_id gnl|my_center|LOCUS_15770 118454 117948 gene locus_tag LOCUS_15780 118454 117948 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079505.1 protein_id gnl|my_center|LOCUS_15780 119000 118500 gene locus_tag LOCUS_15790 119000 118500 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056490.1 protein_id gnl|my_center|LOCUS_15790 119289 119086 gene locus_tag LOCUS_15800 119289 119086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 120452 119646 gene locus_tag LOCUS_15810 gene trpA 120452 119646 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443067.1 protein_id gnl|my_center|LOCUS_15810 121645 120452 gene locus_tag LOCUS_15820 gene trpB 121645 120452 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209520.1 protein_id gnl|my_center|LOCUS_15820 123018 121657 gene locus_tag LOCUS_15830 gene trpCF 123018 121657 CDS product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001344826.1 protein_id gnl|my_center|LOCUS_15830 124614 123019 gene locus_tag LOCUS_15840 gene trpD 124614 123019 CDS product bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763511.1 protein_id gnl|my_center|LOCUS_15840 126176 124614 gene locus_tag LOCUS_15850 gene trpE 126176 124614 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194582.1 protein_id gnl|my_center|LOCUS_15850 126471 127331 gene locus_tag LOCUS_15860 gene rnm 126471 127331 CDS product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285667.1 protein_id gnl|my_center|LOCUS_15860 127328 127948 gene locus_tag LOCUS_15870 127328 127948 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295575.1 protein_id gnl|my_center|LOCUS_15870 127976 128374 gene locus_tag LOCUS_15880 127976 128374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence11 985 128 gene locus_tag LOCUS_15890 gene murI 985 128 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201820.1 protein_id gnl|my_center|LOCUS_15890 2774 930 gene locus_tag LOCUS_15900 gene btuB 2774 930 CDS product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591359.1 protein_id gnl|my_center|LOCUS_15900 3143 4243 gene locus_tag LOCUS_15910 gene trmA 3143 4243 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187022.1 protein_id gnl|my_center|LOCUS_15910 4642 4283 gene locus_tag LOCUS_15920 4642 4283 CDS product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806411.1 protein_id gnl|my_center|LOCUS_15920 5346 4642 gene locus_tag LOCUS_15930 gene fabR 5346 4642 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470429.1 protein_id gnl|my_center|LOCUS_15930 5623 7023 gene locus_tag LOCUS_15940 gene sthA 5623 7023 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120810.1 protein_id gnl|my_center|LOCUS_15940 7923 7006 gene locus_tag LOCUS_15950 gene oxyR 7923 7006 CDS product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025939.1 protein_id gnl|my_center|LOCUS_15950 9563 8190 gene locus_tag LOCUS_15960 gene argH 9563 8190 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230087.1 protein_id gnl|my_center|LOCUS_15960 10397 9624 gene locus_tag LOCUS_15970 gene argB 10397 9624 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295507.1 protein_id gnl|my_center|LOCUS_15970 11412 10408 gene locus_tag LOCUS_15980 gene argC 11412 10408 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935370.1 protein_id gnl|my_center|LOCUS_15980 11566 12717 gene locus_tag LOCUS_15990 gene argE 11566 12717 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298964.1 protein_id gnl|my_center|LOCUS_15990 13069 15720 gene locus_tag LOCUS_16000 gene ppc 13069 15720 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005579.1 protein_id gnl|my_center|LOCUS_16000 15902 17635 gene locus_tag LOCUS_16010 15902 17635 CDS product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556273.1 protein_id gnl|my_center|LOCUS_16010 17850 18701 gene locus_tag LOCUS_16020 17850 18701 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274623.1 protein_id gnl|my_center|LOCUS_16020 19029 18688 gene locus_tag LOCUS_16030 19029 18688 CDS product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323846.1 protein_id gnl|my_center|LOCUS_16030 19909 19031 gene locus_tag LOCUS_16040 19909 19031 CDS product [formate-C-acetyltransferase]-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204139.1 protein_id gnl|my_center|LOCUS_16040 22172 19875 gene locus_tag LOCUS_16050 22172 19875 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184831.1 protein_id gnl|my_center|LOCUS_16050 22543 22223 gene locus_tag LOCUS_16060 22543 22223 CDS product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161265.1 protein_id gnl|my_center|LOCUS_16060 23658 22558 gene locus_tag LOCUS_16070 23658 22558 CDS product PTS fructose transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004446.1 protein_id gnl|my_center|LOCUS_16070 23946 26447 gene locus_tag LOCUS_16080 gene ptsP 23946 26447 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185128.1 protein_id gnl|my_center|LOCUS_16080 26459 27121 gene locus_tag LOCUS_16090 gene fsa 26459 27121 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424840.1 protein_id gnl|my_center|LOCUS_16090 27132 28235 gene locus_tag LOCUS_16100 gene gldA 27132 28235 CDS product bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374004.1 protein_id gnl|my_center|LOCUS_16100 28510 29127 gene locus_tag LOCUS_16110 28510 29127 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647891.1 protein_id gnl|my_center|LOCUS_16110 30059 29154 gene locus_tag LOCUS_16120 gene yijE 30059 29154 CDS product cystine transporter YijE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271242.1 protein_id gnl|my_center|LOCUS_16120 32332 30152 gene locus_tag LOCUS_16130 gene katG 32332 30152 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295695.1 protein_id gnl|my_center|LOCUS_16130 33551 32661 gene locus_tag LOCUS_16140 gene metF 33551 32661 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007523.1 protein_id gnl|my_center|LOCUS_16140 36332 33900 gene locus_tag LOCUS_16150 gene metL 36332 33900 CDS product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110772.1 protein_id gnl|my_center|LOCUS_16150 37495 36335 gene locus_tag LOCUS_16160 gene metB 37495 36335 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295694.1 protein_id gnl|my_center|LOCUS_16160 37772 38089 gene locus_tag LOCUS_16170 gene metJ 37772 38089 CDS product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852812.1 protein_id gnl|my_center|LOCUS_16170 38273 38881 gene locus_tag LOCUS_16180 38273 38881 CDS product YiiX family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797352.1 protein_id gnl|my_center|LOCUS_16180 38885 39511 gene locus_tag LOCUS_16190 38885 39511 CDS product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792797.1 protein_id gnl|my_center|LOCUS_16190 39778 39566 gene locus_tag LOCUS_16200 gene rpmE 39778 39566 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710769.1 protein_id gnl|my_center|LOCUS_16200 39981 42179 gene locus_tag LOCUS_16210 gene priA 39981 42179 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301269.1 protein_id gnl|my_center|LOCUS_16210 42335 43360 gene locus_tag LOCUS_16220 gene cytR 42335 43360 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644904.1 protein_id gnl|my_center|LOCUS_16220 43557 44411 gene locus_tag LOCUS_16230 gene ftsN 43557 44411 CDS product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068828.1 protein_id gnl|my_center|LOCUS_16230 44504 45034 gene locus_tag LOCUS_16240 gene hslV 44504 45034 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208242.1 protein_id gnl|my_center|LOCUS_16240 45044 46375 gene locus_tag LOCUS_16250 gene hslU 45044 46375 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293341.1 protein_id gnl|my_center|LOCUS_16250 46442 47368 gene locus_tag LOCUS_16260 gene menA 46442 47368 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139496.1 protein_id gnl|my_center|LOCUS_16260 47461 47946 gene locus_tag LOCUS_16270 gene rraA 47461 47946 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872908.1 protein_id gnl|my_center|LOCUS_16270 48270 48031 gene locus_tag LOCUS_16280 gene zapB 48270 48031 CDS product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295521.1 protein_id gnl|my_center|LOCUS_16280 48702 49547 gene locus_tag LOCUS_16290 gene glpF 48702 49547 CDS product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084268.1 protein_id gnl|my_center|LOCUS_16290 49570 51078 gene locus_tag LOCUS_16300 gene glpK 49570 51078 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136788.1 protein_id gnl|my_center|LOCUS_16300 51084 52223 gene locus_tag LOCUS_16310 gene glpX 51084 52223 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250644.1 protein_id gnl|my_center|LOCUS_16310 52320 53066 gene locus_tag LOCUS_16320 gene fpr 52320 53066 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796310.1 protein_id gnl|my_center|LOCUS_16320 53499 53071 gene locus_tag LOCUS_16330 gene uspD 53499 53071 CDS product universal stress protein UspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323556.1 protein_id gnl|my_center|LOCUS_16330 53825 53526 gene locus_tag LOCUS_16340 53825 53526 CDS product DUF406 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655986.1 protein_id gnl|my_center|LOCUS_16340 54477 54037 gene locus_tag LOCUS_16350 54477 54037 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155257.1 protein_id gnl|my_center|LOCUS_16350 54578 55177 gene locus_tag LOCUS_16360 54578 55177 CDS product YiiQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802226.1 protein_id gnl|my_center|LOCUS_16360 55285 56052 gene locus_tag LOCUS_16370 gene tpiA 55285 56052 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216325.1 protein_id gnl|my_center|LOCUS_16370 56862 56107 gene locus_tag LOCUS_16380 gene cdh 56862 56107 CDS product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005050421.1 protein_id gnl|my_center|LOCUS_16380 57958 56969 gene locus_tag LOCUS_16390 gene sbp 57958 56969 CDS product sulfate/thiosulfate ABC transporter substrate-binding protein Sbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045689.1 protein_id gnl|my_center|LOCUS_16390 59240 58278 gene locus_tag LOCUS_16400 gene pfkA 59240 58278 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591795.1 protein_id gnl|my_center|LOCUS_16400 60323 59421 gene locus_tag LOCUS_16410 gene fieF 60323 59421 CDS product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076742.1 protein_id gnl|my_center|LOCUS_16410 60972 60472 gene locus_tag LOCUS_16420 gene cpxP 60972 60472 CDS product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223800.1 protein_id gnl|my_center|LOCUS_16420 61122 61820 gene locus_tag LOCUS_16430 gene cpxR 61122 61820 CDS product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033722.1 protein_id gnl|my_center|LOCUS_16430 61817 63190 gene locus_tag LOCUS_16440 gene cpxA 61817 63190 CDS product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580417.1 protein_id gnl|my_center|LOCUS_16440 63970 63296 gene locus_tag LOCUS_16450 gene yiiM 63970 63296 CDS product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270260.1 protein_id gnl|my_center|LOCUS_16450 65102 64119 gene locus_tag LOCUS_16460 gene kdgT 65102 64119 CDS product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166063.1 protein_id gnl|my_center|LOCUS_16460 65982 65362 gene locus_tag LOCUS_16470 gene sodA 65982 65362 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297064.1 protein_id gnl|my_center|LOCUS_16470 66267 67301 gene locus_tag LOCUS_16480 gene rhaT 66267 67301 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063507.1 protein_id gnl|my_center|LOCUS_16480 68236 67298 gene locus_tag LOCUS_16490 gene rhaR 68236 67298 CDS product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297062.1 protein_id gnl|my_center|LOCUS_16490 69056 68220 gene locus_tag LOCUS_16500 gene rhaS 69056 68220 CDS product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217137.1 protein_id gnl|my_center|LOCUS_16500 69344 70813 gene locus_tag LOCUS_16510 gene rhaB 69344 70813 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144081.1 protein_id gnl|my_center|LOCUS_16510 70810 72069 gene locus_tag LOCUS_16520 gene rhaA 70810 72069 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001325794.1 protein_id gnl|my_center|LOCUS_16520 72244 73068 gene locus_tag LOCUS_16530 gene rhaD 72244 73068 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179764.1 protein_id gnl|my_center|LOCUS_16530 73078 73392 gene locus_tag LOCUS_16540 gene rhaM 73078 73392 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619496.1 protein_id gnl|my_center|LOCUS_16540 74827 73433 gene locus_tag LOCUS_16550 74827 73433 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749944.1 protein_id gnl|my_center|LOCUS_16550 75304 75750 gene locus_tag LOCUS_16560 75304 75750 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729595.1 protein_id gnl|my_center|LOCUS_16560 75761 77212 gene locus_tag LOCUS_16570 75761 77212 CDS product PTS fructose-like transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446023.1 protein_id gnl|my_center|LOCUS_16570 77202 78272 gene locus_tag LOCUS_16580 77202 78272 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019484.1 protein_id gnl|my_center|LOCUS_16580 78272 80020 gene locus_tag LOCUS_16590 78272 80020 CDS product putative frv operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931299.1 protein_id gnl|my_center|LOCUS_16590 81125 80070 gene locus_tag LOCUS_16600 81125 80070 CDS product YiiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295677.1 protein_id gnl|my_center|LOCUS_16600 82111 81278 gene locus_tag LOCUS_16610 gene fdhD 82111 81278 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753617.1 protein_id gnl|my_center|LOCUS_16610 82305 85355 gene locus_tag LOCUS_16620 gene fdnG 82305 85355 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723259.1 transl_except (pos:82890..82892,aa:Sec) note codon on position 196 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_16620 85368 86270 gene locus_tag LOCUS_16630 gene fdoH 85368 86270 CDS product formate dehydrogenase O subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331377.1 protein_id gnl|my_center|LOCUS_16630 86267 86902 gene locus_tag LOCUS_16640 gene fdoI 86267 86902 CDS product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829013.1 protein_id gnl|my_center|LOCUS_16640 86899 87828 gene locus_tag LOCUS_16650 gene fdhE 86899 87828 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027708.1 protein_id gnl|my_center|LOCUS_16650 88400 88158 gene locus_tag LOCUS_16660 gene yiiF 88400 88158 CDS product protein YiiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087409.1 protein_id gnl|my_center|LOCUS_16660 88836 88618 gene locus_tag LOCUS_16670 88836 88618 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295676.1 protein_id gnl|my_center|LOCUS_16670 90108 89689 gene locus_tag LOCUS_16680 90108 89689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16680 90630 90133 gene locus_tag LOCUS_16690 90630 90133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16690 91112 90675 gene locus_tag LOCUS_16700 gene dtd 91112 90675 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560983.1 protein_id gnl|my_center|LOCUS_16700 91981 91109 gene locus_tag LOCUS_16710 91981 91109 CDS product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920762.1 protein_id gnl|my_center|LOCUS_16710 92574 91975 gene locus_tag LOCUS_16720 gene yihX 92574 91975 CDS product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295269.1 protein_id gnl|my_center|LOCUS_16720 93458 92673 gene locus_tag LOCUS_16730 93458 92673 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059678.1 protein_id gnl|my_center|LOCUS_16730 94388 93492 gene locus_tag LOCUS_16740 gene yihV 94388 93492 CDS product sulfofructose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621656.1 protein_id gnl|my_center|LOCUS_16740 94556 95452 gene locus_tag LOCUS_16750 gene yihU 94556 95452 CDS product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718893.1 protein_id gnl|my_center|LOCUS_16750 95476 96354 gene locus_tag LOCUS_16760 gene yihT 95476 96354 CDS product sulfofructosephosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046453.1 protein_id gnl|my_center|LOCUS_16760 96371 97612 gene locus_tag LOCUS_16770 gene yihS 96371 97612 CDS product sulfoquinovose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870916.1 protein_id gnl|my_center|LOCUS_16770 97750 98652 gene locus_tag LOCUS_16780 97750 98652 CDS product aldose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052655.1 protein_id gnl|my_center|LOCUS_16780 98891 100780 gene locus_tag LOCUS_16790 gene yihQ 98891 100780 CDS product sulfoquinovosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380843.1 protein_id gnl|my_center|LOCUS_16790 100826 102211 gene locus_tag LOCUS_16800 100826 102211 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018380.1 protein_id gnl|my_center|LOCUS_16800 102251 103654 gene locus_tag LOCUS_16810 102251 103654 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279692.1 protein_id gnl|my_center|LOCUS_16810 103655 104413 gene locus_tag LOCUS_16820 gene ompL 103655 104413 CDS product porin OmpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723465.1 protein_id gnl|my_center|LOCUS_16820 105769 104504 gene locus_tag LOCUS_16830 105769 104504 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956312.1 protein_id gnl|my_center|LOCUS_16830 106851 105871 gene locus_tag LOCUS_16840 106851 105871 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256396.1 protein_id gnl|my_center|LOCUS_16840 107569 106859 gene locus_tag LOCUS_16850 107569 106859 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829798.1 protein_id gnl|my_center|LOCUS_16850 109609 107786 gene locus_tag LOCUS_16860 gene typA 109609 107786 CDS product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570668.1 protein_id gnl|my_center|LOCUS_16860 109982 111391 gene locus_tag LOCUS_16870 gene glnA 109982 111391 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271717.1 protein_id gnl|my_center|LOCUS_16870 111677 112726 gene locus_tag LOCUS_16880 gene glnL 111677 112726 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190577.1 protein_id gnl|my_center|LOCUS_16880 112738 114147 gene locus_tag LOCUS_16890 gene glnG 112738 114147 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188776.1 protein_id gnl|my_center|LOCUS_16890 115932 114559 gene locus_tag LOCUS_16900 gene hemN 115932 114559 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116090.1 protein_id gnl|my_center|LOCUS_16900 116630 116121 gene locus_tag LOCUS_16910 gene yihI 116630 116121 CDS product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295266.1 protein_id gnl|my_center|LOCUS_16910 117212 117844 gene locus_tag LOCUS_16920 gene yihA 117212 117844 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183349.1 protein_id gnl|my_center|LOCUS_16920 118253 118089 gene locus_tag LOCUS_16930 118253 118089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 121011 118225 gene locus_tag LOCUS_16940 gene polA 121011 118225 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250006.1 protein_id gnl|my_center|LOCUS_16940 121529 121311 gene locus_tag LOCUS_16950 121529 121311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 121564 122307 gene locus_tag LOCUS_16960 121564 122307 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306659.1 protein_id gnl|my_center|LOCUS_16960 123778 122348 gene locus_tag LOCUS_16970 123778 122348 CDS product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354487.1 protein_id gnl|my_center|LOCUS_16970 124559 123933 gene locus_tag LOCUS_16980 gene dsbA 124559 123933 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725337.1 protein_id gnl|my_center|LOCUS_16980 125562 124576 gene locus_tag LOCUS_16990 gene srkA 125562 124576 CDS product stress response kinase SrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065497.1 protein_id gnl|my_center|LOCUS_16990 125908 125639 gene locus_tag LOCUS_17000 125908 125639 CDS product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295263.1 protein_id gnl|my_center|LOCUS_17000 125978 126562 gene locus_tag LOCUS_17010 gene mobA 125978 126562 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052181.1 protein_id gnl|my_center|LOCUS_17010 126544 127071 gene locus_tag LOCUS_17020 gene mobB 126544 127071 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907622.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence12 401 129 gene locus_tag LOCUS_17030 401 129 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001530485.1 protein_id gnl|my_center|LOCUS_17030 737 489 gene locus_tag LOCUS_17040 737 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 622 972 gene locus_tag LOCUS_17050 622 972 CDS product surface-adhesin E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602903.1 protein_id gnl|my_center|LOCUS_17050 2311 1193 gene locus_tag LOCUS_17060 gene nanY 2311 1193 CDS product 2,7-anhydro-N-acetylneuraminate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611568.1 protein_id gnl|my_center|LOCUS_17060 3540 2323 gene locus_tag LOCUS_17070 3540 2323 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179691.1 protein_id gnl|my_center|LOCUS_17070 4167 5495 gene locus_tag LOCUS_17080 4167 5495 CDS product IS4-like element IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547191.1 protein_id gnl|my_center|LOCUS_17080 7124 7555 gene locus_tag LOCUS_17090 7124 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17090 7679 7921 gene locus_tag LOCUS_17100 7679 7921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17100 9512 8322 gene locus_tag LOCUS_17110 9512 8322 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032666220.1 protein_id gnl|my_center|LOCUS_17110 9857 9773 gene locus_tag LOCUS_t00220 9857 9773 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10053 11072 gene locus_tag LOCUS_17120 gene ahr 10053 11072 CDS product NADPH-dependent aldehyde reductase Ahr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309160.1 protein_id gnl|my_center|LOCUS_17120 11639 11076 gene locus_tag LOCUS_17130 gene idnK 11639 11076 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896738.1 protein_id gnl|my_center|LOCUS_17130 11856 12887 gene locus_tag LOCUS_17140 gene idnD 11856 12887 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197411.1 protein_id gnl|my_center|LOCUS_17140 12911 13675 gene locus_tag LOCUS_17150 gene idnO 12911 13675 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998695.1 protein_id gnl|my_center|LOCUS_17150 13738 15057 gene locus_tag LOCUS_17160 gene idnT 13738 15057 CDS product gnt-II system L-idonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128335.1 protein_id gnl|my_center|LOCUS_17160 15124 16122 gene locus_tag LOCUS_17170 gene idnR 15124 16122 CDS product DNA-binding transcriptional regulator IdnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309159.1 protein_id gnl|my_center|LOCUS_17170 16200 17702 gene locus_tag LOCUS_17180 16200 17702 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294573.1 protein_id gnl|my_center|LOCUS_17180 18945 17863 gene locus_tag LOCUS_17190 gene lptG 18945 17863 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295681.1 protein_id gnl|my_center|LOCUS_17190 19952 18945 gene locus_tag LOCUS_17200 gene lptF 19952 18945 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584114.1 protein_id gnl|my_center|LOCUS_17200 20312 21823 gene locus_tag LOCUS_17210 gene pepA 20312 21823 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397144.1 protein_id gnl|my_center|LOCUS_17210 22177 22620 gene locus_tag LOCUS_17220 gene holC 22177 22620 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786399.1 protein_id gnl|my_center|LOCUS_17220 22620 25475 gene locus_tag LOCUS_17230 gene valS 22620 25475 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416407.1 protein_id gnl|my_center|LOCUS_17230 26727 25531 gene locus_tag LOCUS_17240 26727 25531 CDS product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079623.1 protein_id gnl|my_center|LOCUS_17240 26920 27423 gene locus_tag LOCUS_17250 26920 27423 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059397.1 protein_id gnl|my_center|LOCUS_17250 27885 27469 gene locus_tag LOCUS_17260 gene rraB 27885 27469 CDS product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002952.1 protein_id gnl|my_center|LOCUS_17260 28047 29051 gene locus_tag LOCUS_17270 gene argF 28047 29051 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012907.1 protein_id gnl|my_center|LOCUS_17270 30776 29124 gene locus_tag LOCUS_17280 gene yjgL 30776 29124 CDS product protein YjgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036434.1 protein_id gnl|my_center|LOCUS_17280 31351 30899 gene locus_tag LOCUS_17290 gene tabA 31351 30899 CDS product toxin-antitoxin biofilm protein TabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583470.1 protein_id gnl|my_center|LOCUS_17290 32089 31496 gene locus_tag LOCUS_17300 32089 31496 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023602305.1 protein_id gnl|my_center|LOCUS_17300 32160 32873 gene locus_tag LOCUS_17310 gene bdcA 32160 32873 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500691.1 protein_id gnl|my_center|LOCUS_17310 33004 33399 gene locus_tag LOCUS_17320 33004 33399 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230281.1 protein_id gnl|my_center|LOCUS_17320 33818 34753 gene locus_tag LOCUS_17330 gene pyrB 33818 34753 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013046.1 protein_id gnl|my_center|LOCUS_17330 34766 35227 gene locus_tag LOCUS_17340 gene pyrI 34766 35227 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148581.1 protein_id gnl|my_center|LOCUS_17340 35300 35686 gene locus_tag LOCUS_17350 gene ridA 35300 35686 CDS product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298042.1 protein_id gnl|my_center|LOCUS_17350 38588 35892 gene locus_tag LOCUS_17360 gene mgtA 38588 35892 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471889.1 protein_id gnl|my_center|LOCUS_17360 38967 39914 gene locus_tag LOCUS_17370 gene treR 38967 39914 CDS product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181324.1 protein_id gnl|my_center|LOCUS_17370 40033 41454 gene locus_tag LOCUS_17380 gene treB 40033 41454 CDS product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297258.1 protein_id gnl|my_center|LOCUS_17380 41504 43159 gene locus_tag LOCUS_17390 gene treC 41504 43159 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183355.1 protein_id gnl|my_center|LOCUS_17390 43553 45691 gene locus_tag LOCUS_17400 gene nrdD 43553 45691 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187778.1 protein_id gnl|my_center|LOCUS_17400 45850 46314 gene locus_tag LOCUS_17410 gene nrdG 45850 46314 CDS product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106233.1 protein_id gnl|my_center|LOCUS_17410 46745 46359 gene locus_tag LOCUS_17420 gene cybC 46745 46359 CDS product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232240.1 protein_id gnl|my_center|LOCUS_17420 48280 46928 gene locus_tag LOCUS_17430 gene pmbA 48280 46928 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162171.1 protein_id gnl|my_center|LOCUS_17430 48375 48926 gene locus_tag LOCUS_17440 gene yjgA 48375 48926 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166270.1 protein_id gnl|my_center|LOCUS_17440 50455 49082 gene locus_tag LOCUS_17450 gene mpl 50455 49082 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219792.1 protein_id gnl|my_center|LOCUS_17450 50631 51629 gene locus_tag LOCUS_17460 gene fbp 50631 51629 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853753.1 protein_id gnl|my_center|LOCUS_17460 52657 51662 gene locus_tag LOCUS_17470 gene yjfF 52657 51662 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000596015.1 protein_id gnl|my_center|LOCUS_17470 53666 52644 gene locus_tag LOCUS_17480 53666 52644 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301928.1 protein_id gnl|my_center|LOCUS_17480 55182 53680 gene locus_tag LOCUS_17490 55182 53680 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205805.1 protein_id gnl|my_center|LOCUS_17490 56278 55322 gene locus_tag LOCUS_17500 gene ytfQ 56278 55322 CDS product galactofuranose ABC transporter substrate-binding protein YtfQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265933.1 protein_id gnl|my_center|LOCUS_17500 56588 57118 gene locus_tag LOCUS_17510 gene ppa 56588 57118 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055072.1 protein_id gnl|my_center|LOCUS_17510 57839 57498 gene locus_tag LOCUS_17520 57839 57498 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219160.1 protein_id gnl|my_center|LOCUS_17520 61621 57842 gene locus_tag LOCUS_17530 gene tamB 61621 57842 CDS product autotransporter assembly complex protein TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060946.1 protein_id gnl|my_center|LOCUS_17530 63351 61618 gene locus_tag LOCUS_17540 gene tamA 63351 61618 CDS product autotransporter assembly complex protein TamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269316.1 protein_id gnl|my_center|LOCUS_17540 63500 63321 gene locus_tag LOCUS_17550 63500 63321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 63557 64195 gene locus_tag LOCUS_17560 gene msrA 63557 64195 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295196.1 protein_id gnl|my_center|LOCUS_17560 64518 65861 gene locus_tag LOCUS_17570 64518 65861 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935036.1 protein_id gnl|my_center|LOCUS_17570 66129 65923 gene locus_tag LOCUS_17580 66129 65923 CDS product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689228.1 protein_id gnl|my_center|LOCUS_17580 66454 67011 gene locus_tag LOCUS_17590 66454 67011 CDS product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175289.1 protein_id gnl|my_center|LOCUS_17590 67741 67001 gene locus_tag LOCUS_17600 gene cysQ 67741 67001 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886909.1 protein_id gnl|my_center|LOCUS_17600 67931 69874 gene locus_tag LOCUS_17610 gene cpdB 67931 69874 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589431.1 protein_id gnl|my_center|LOCUS_17610 70377 69997 gene locus_tag LOCUS_17620 70377 69997 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084622.1 protein_id gnl|my_center|LOCUS_17620 70466 71326 gene locus_tag LOCUS_17630 gene qorB 70466 71326 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560631.1 protein_id gnl|my_center|LOCUS_17630 71435 72400 gene locus_tag LOCUS_17640 71435 72400 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296686.1 protein_id gnl|my_center|LOCUS_17640 72508 73170 gene locus_tag LOCUS_17650 gene ytfE 72508 73170 CDS product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331456.1 protein_id gnl|my_center|LOCUS_17650 74627 73215 gene locus_tag LOCUS_17660 gene cycA 74627 73215 CDS product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228371.1 protein_id gnl|my_center|LOCUS_17660 75556 74936 gene locus_tag LOCUS_17670 gene fklB 75556 74936 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211225.1 protein_id gnl|my_center|LOCUS_17670 75775 76413 gene locus_tag LOCUS_17680 gene ytfB 75775 76413 CDS product cell division protein YtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119478.1 protein_id gnl|my_center|LOCUS_17680 77044 76397 gene locus_tag LOCUS_17690 77044 76397 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317442.1 protein_id gnl|my_center|LOCUS_17690 77257 78048 gene locus_tag LOCUS_17700 77257 78048 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843394.1 protein_id gnl|my_center|LOCUS_17700 78058 78900 gene locus_tag LOCUS_17710 78058 78900 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205251.1 protein_id gnl|my_center|LOCUS_17710 78910 79686 gene locus_tag LOCUS_17720 78910 79686 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283536.1 protein_id gnl|my_center|LOCUS_17720 79696 81237 gene locus_tag LOCUS_17730 79696 81237 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226977.1 protein_id gnl|my_center|LOCUS_17730 81234 83306 gene locus_tag LOCUS_17740 81234 83306 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080380.1 protein_id gnl|my_center|LOCUS_17740 83429 84676 gene locus_tag LOCUS_17750 83429 84676 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033605.1 protein_id gnl|my_center|LOCUS_17750 85227 84778 gene locus_tag LOCUS_17760 gene rplI 85227 84778 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196062.1 protein_id gnl|my_center|LOCUS_17760 85496 85269 gene locus_tag LOCUS_17770 gene rpsR 85496 85269 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 protein_id gnl|my_center|LOCUS_17770 85815 85501 gene locus_tag LOCUS_17780 gene priB 85815 85501 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296681.1 protein_id gnl|my_center|LOCUS_17780 86217 85822 gene locus_tag LOCUS_17790 gene rpsF 86217 85822 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216676.1 protein_id gnl|my_center|LOCUS_17790 86545 86820 gene locus_tag LOCUS_17800 86545 86820 CDS product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324306.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17800 87635 86949 gene locus_tag LOCUS_17810 gene ulaF 87635 86949 CDS product L-ribulose-5-phosphate 4-epimerase UlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170847.1 protein_id gnl|my_center|LOCUS_17810 88489 87635 gene locus_tag LOCUS_17820 gene ulaE 88489 87635 CDS product L-ribulose-5-phosphate 3-epimerase UlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949511.1 protein_id gnl|my_center|LOCUS_17820 89149 88499 gene locus_tag LOCUS_17830 gene ulaD 89149 88499 CDS product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056760.1 protein_id gnl|my_center|LOCUS_17830 89627 89163 gene locus_tag LOCUS_17840 gene ulaC 89627 89163 CDS product PTS ascorbate transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776505.1 protein_id gnl|my_center|LOCUS_17840 89942 89637 gene locus_tag LOCUS_17850 gene ulaB 89942 89637 CDS product PTS ascorbate transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218362.1 protein_id gnl|my_center|LOCUS_17850 91355 89958 gene locus_tag LOCUS_17860 gene ulaA 91355 89958 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300695.1 protein_id gnl|my_center|LOCUS_17860 91704 92774 gene locus_tag LOCUS_17870 gene ulaG 91704 92774 CDS product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295191.1 protein_id gnl|my_center|LOCUS_17870 92882 93637 gene locus_tag LOCUS_17880 gene ulaR 92882 93637 CDS product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133631.1 protein_id gnl|my_center|LOCUS_17880 94383 93634 gene locus_tag LOCUS_17890 gene yjfP 94383 93634 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569708.1 protein_id gnl|my_center|LOCUS_17890 94625 94894 gene locus_tag LOCUS_17900 94625 94894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 95043 95318 gene locus_tag LOCUS_17910 gene yjfN 95043 95318 CDS product DUF1471 family protease activator YjfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811566.1 protein_id gnl|my_center|LOCUS_17910 97060 95435 gene locus_tag LOCUS_17920 97060 95435 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350567.1 protein_id gnl|my_center|LOCUS_17920 98307 97144 gene locus_tag LOCUS_17930 98307 97144 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943963.1 protein_id gnl|my_center|LOCUS_17930 98948 98310 gene locus_tag LOCUS_17940 98948 98310 CDS product DUF1190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101658.1 protein_id gnl|my_center|LOCUS_17940 99356 98958 gene locus_tag LOCUS_17950 99356 98958 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547760.1 protein_id gnl|my_center|LOCUS_17950 100033 99374 gene locus_tag LOCUS_17960 100033 99374 CDS product YjfK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012550.1 protein_id gnl|my_center|LOCUS_17960 100782 100084 gene locus_tag LOCUS_17970 100782 100084 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511955.1 protein_id gnl|my_center|LOCUS_17970 101202 100801 gene locus_tag LOCUS_17980 101202 100801 CDS product DUF2170 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220128.1 protein_id gnl|my_center|LOCUS_17980 102060 101329 gene locus_tag LOCUS_17990 gene rlmB 102060 101329 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293282.1 protein_id gnl|my_center|LOCUS_17990 104681 102240 gene locus_tag LOCUS_18000 gene rnr 104681 102240 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076332.1 protein_id gnl|my_center|LOCUS_18000 105145 104720 gene locus_tag LOCUS_18010 gene nsrR 105145 104720 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177639.1 protein_id gnl|my_center|LOCUS_18010 106648 105350 gene locus_tag LOCUS_18020 gene purA 106648 105350 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527955.1 protein_id gnl|my_center|LOCUS_18020 106949 106752 gene locus_tag LOCUS_18030 106949 106752 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089295.1 protein_id gnl|my_center|LOCUS_18030 108035 107031 gene locus_tag LOCUS_18040 gene hflC 108035 107031 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232412.1 protein_id gnl|my_center|LOCUS_18040 109297 108038 gene locus_tag LOCUS_18050 gene hflK 109297 108038 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312488.1 protein_id gnl|my_center|LOCUS_18050 110663 109383 gene locus_tag LOCUS_18060 gene hflX 110663 109383 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460360.1 protein_id gnl|my_center|LOCUS_18060 111047 110739 gene locus_tag LOCUS_18070 gene hfq 111047 110739 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051883.1 protein_id gnl|my_center|LOCUS_18070 112083 111133 gene locus_tag LOCUS_18080 112083 111133 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280345.1 protein_id gnl|my_center|LOCUS_18080 113923 112076 gene locus_tag LOCUS_18090 gene mutL 113923 112076 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122505.1 protein_id gnl|my_center|LOCUS_18090 115270 113933 gene locus_tag LOCUS_18100 gene amiB 115270 113933 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990333.1 protein_id gnl|my_center|LOCUS_18100 115750 115289 gene locus_tag LOCUS_18110 gene tsaE 115750 115289 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981977.1 protein_id gnl|my_center|LOCUS_18110 117254 115722 gene locus_tag LOCUS_18120 gene nnr 117254 115722 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307537.1 protein_id gnl|my_center|LOCUS_18120 117268 118407 gene locus_tag LOCUS_18130 gene queG 117268 118407 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294219.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence13 609 115 gene locus_tag LOCUS_18140 609 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 1925 621 gene locus_tag LOCUS_18150 1925 621 CDS product YhfT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366862.1 protein_id gnl|my_center|LOCUS_18150 2290 1937 gene locus_tag LOCUS_18160 2290 1937 CDS product DUF2620 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719728.1 protein_id gnl|my_center|LOCUS_18160 3179 2301 gene locus_tag LOCUS_18170 3179 2301 CDS product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007010.1 protein_id gnl|my_center|LOCUS_18170 4402 3176 gene locus_tag LOCUS_18180 4402 3176 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090644.1 protein_id gnl|my_center|LOCUS_18180 5565 4402 gene locus_tag LOCUS_18190 5565 4402 CDS product YhfX family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497341.1 protein_id gnl|my_center|LOCUS_18190 6011 5649 gene locus_tag LOCUS_18200 6011 5649 CDS product PRD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295165.1 protein_id gnl|my_center|LOCUS_18200 6933 6028 gene locus_tag LOCUS_18210 gene yhfZ 6933 6028 CDS product GntR family transcriptional regulator YhfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254790.1 protein_id gnl|my_center|LOCUS_18210 8227 7223 gene locus_tag LOCUS_18220 gene trpS 8227 7223 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165552.1 protein_id gnl|my_center|LOCUS_18220 8978 8220 gene locus_tag LOCUS_18230 gene gph 8978 8220 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031729.1 protein_id gnl|my_center|LOCUS_18230 9648 8971 gene locus_tag LOCUS_18240 gene rpe 9648 8971 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816280.1 protein_id gnl|my_center|LOCUS_18240 10382 9666 gene locus_tag LOCUS_18250 gene dam 10382 9666 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742143.1 protein_id gnl|my_center|LOCUS_18250 11895 10609 gene locus_tag LOCUS_18260 gene damX 11895 10609 CDS product cell division protein DamX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343178.1 protein_id gnl|my_center|LOCUS_18260 13075 11987 gene locus_tag LOCUS_18270 gene aroB 13075 11987 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439846.1 protein_id gnl|my_center|LOCUS_18270 13617 13132 gene locus_tag LOCUS_18280 13617 13132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 15292 14054 gene locus_tag LOCUS_18290 gene hofQ 15292 14054 CDS product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815987.1 protein_id gnl|my_center|LOCUS_18290 15608 15204 gene locus_tag LOCUS_18300 gene hofP 15608 15204 CDS product DNA utilization protein HofP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264141.1 protein_id gnl|my_center|LOCUS_18300 16038 15598 gene locus_tag LOCUS_18310 gene hofO 16038 15598 CDS product DNA utilization protein HofO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055760.1 protein_id gnl|my_center|LOCUS_18310 16561 16022 gene locus_tag LOCUS_18320 gene hofN 16561 16022 CDS product DNA utilization protein HofN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069315.1 protein_id gnl|my_center|LOCUS_18320 17340 16561 gene locus_tag LOCUS_18330 gene hofM 17340 16561 CDS product DNA utilization protein HofM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295166.1 protein_id gnl|my_center|LOCUS_18330 17481 20012 gene locus_tag LOCUS_18340 gene mrcA 17481 20012 CDS product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301905.1 protein_id gnl|my_center|LOCUS_18340 20740 20180 gene locus_tag LOCUS_18350 gene nudE 20740 20180 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045744.1 protein_id gnl|my_center|LOCUS_18350 21060 23195 gene locus_tag LOCUS_18360 gene igaA 21060 23195 CDS product intracellular growth attenuator protein IgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104533.1 protein_id gnl|my_center|LOCUS_18360 23260 23928 gene locus_tag LOCUS_18370 gene yrfG 23260 23928 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295168.1 protein_id gnl|my_center|LOCUS_18370 23939 24340 gene locus_tag LOCUS_18380 gene hslR 23939 24340 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660483.1 protein_id gnl|my_center|LOCUS_18380 24365 25243 gene locus_tag LOCUS_18390 gene hslO 24365 25243 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135574.1 protein_id gnl|my_center|LOCUS_18390 27030 25306 gene locus_tag LOCUS_18400 27030 25306 CDS product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370879.1 protein_id gnl|my_center|LOCUS_18400 27409 29031 gene locus_tag LOCUS_18410 gene pckA 27409 29031 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265681.1 protein_id gnl|my_center|LOCUS_18410 30450 29107 gene locus_tag LOCUS_18420 gene envZ 30450 29107 CDS product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253696.1 protein_id gnl|my_center|LOCUS_18420 31175 30456 gene locus_tag LOCUS_18430 gene ompR 31175 30456 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 protein_id gnl|my_center|LOCUS_18430 31403 31879 gene locus_tag LOCUS_18440 gene greB 31403 31879 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856737.1 protein_id gnl|my_center|LOCUS_18440 31976 34297 gene locus_tag LOCUS_18450 31976 34297 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980724.1 protein_id gnl|my_center|LOCUS_18450 34735 34962 gene locus_tag LOCUS_18460 gene feoA 34735 34962 CDS product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200455.1 protein_id gnl|my_center|LOCUS_18460 34979 37300 gene locus_tag LOCUS_18470 gene feoB 34979 37300 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737007.1 protein_id gnl|my_center|LOCUS_18470 37300 37536 gene locus_tag LOCUS_18480 gene feoC 37300 37536 CDS product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295699.1 protein_id gnl|my_center|LOCUS_18480 37739 38617 gene locus_tag LOCUS_18490 gene rpnA 37739 38617 CDS product recombination-promoting nuclease RpnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039062.1 protein_id gnl|my_center|LOCUS_18490 39416 38646 gene locus_tag LOCUS_18500 gene bioH 39416 38646 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060072.1 protein_id gnl|my_center|LOCUS_18500 40196 40771 gene locus_tag LOCUS_18510 gene nfuA 40196 40771 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619389.1 protein_id gnl|my_center|LOCUS_18510 41132 42448 gene locus_tag LOCUS_18520 gene gntT 41132 42448 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131758.1 protein_id gnl|my_center|LOCUS_18520 44577 42493 gene locus_tag LOCUS_18530 gene malQ 44577 42493 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444321.1 protein_id gnl|my_center|LOCUS_18530 46980 44587 gene locus_tag LOCUS_18540 gene malP 46980 44587 CDS product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081903.1 protein_id gnl|my_center|LOCUS_18540 47592 50297 gene locus_tag LOCUS_18550 gene malT 47592 50297 CDS product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906961.1 protein_id gnl|my_center|LOCUS_18550 51356 50340 gene locus_tag LOCUS_18560 gene rtcA 51356 50340 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335950.1 protein_id gnl|my_center|LOCUS_18560 52586 51360 gene locus_tag LOCUS_18570 gene rtcB 52586 51360 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105467.1 protein_id gnl|my_center|LOCUS_18570 52775 54373 gene locus_tag LOCUS_18580 gene rtcR 52775 54373 CDS product DNA-binding transcriptional regulator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232948.1 protein_id gnl|my_center|LOCUS_18580 55113 54355 gene locus_tag LOCUS_18590 55113 54355 CDS product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815099.1 protein_id gnl|my_center|LOCUS_18590 55960 55130 gene locus_tag LOCUS_18600 gene glpG 55960 55130 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928723.1 protein_id gnl|my_center|LOCUS_18600 56331 56005 gene locus_tag LOCUS_18610 gene glpE 56331 56005 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371928.1 protein_id gnl|my_center|LOCUS_18610 56521 58026 gene locus_tag LOCUS_18620 gene glpD 56521 58026 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448136.1 protein_id gnl|my_center|LOCUS_18620 59836 58844 gene locus_tag LOCUS_18630 59836 58844 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032214.1 protein_id gnl|my_center|LOCUS_18630 61367 59862 gene locus_tag LOCUS_18640 61367 59862 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181201.1 protein_id gnl|my_center|LOCUS_18640 63942 61495 gene locus_tag LOCUS_18650 gene glgP 63942 61495 CDS product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993449.1 protein_id gnl|my_center|LOCUS_18650 65394 63961 gene locus_tag LOCUS_18660 gene glgA 65394 63961 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197646.1 protein_id gnl|my_center|LOCUS_18660 66689 65394 gene locus_tag LOCUS_18670 gene glgC 66689 65394 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253975.1 protein_id gnl|my_center|LOCUS_18670 68680 66707 gene locus_tag LOCUS_18680 gene glgX 68680 66707 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192540.1 protein_id gnl|my_center|LOCUS_18680 70863 68677 gene locus_tag LOCUS_18690 gene glgB 70863 68677 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283723.1 protein_id gnl|my_center|LOCUS_18690 72239 71136 gene locus_tag LOCUS_18700 gene asd 72239 71136 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799956.1 protein_id gnl|my_center|LOCUS_18700 72431 73024 gene locus_tag LOCUS_18710 gene yhgN 72431 73024 CDS product NAAT family transporter YhgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002544.1 protein_id gnl|my_center|LOCUS_18710 74421 73081 gene locus_tag LOCUS_18720 gene gntU 74421 73081 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210111.1 protein_id gnl|my_center|LOCUS_18720 74913 74425 gene locus_tag LOCUS_18730 gene gntK 74913 74425 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108330.1 protein_id gnl|my_center|LOCUS_18730 76029 75091 gene locus_tag LOCUS_18740 gene gntR 76029 75091 CDS product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730252.1 protein_id gnl|my_center|LOCUS_18740 77020 76310 gene locus_tag LOCUS_18750 gene yhhW 77020 76310 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639811.1 protein_id gnl|my_center|LOCUS_18750 78165 77128 gene locus_tag LOCUS_18760 78165 77128 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236293.1 protein_id gnl|my_center|LOCUS_18760 78067 78264 gene locus_tag LOCUS_18770 78067 78264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 78498 78986 gene locus_tag LOCUS_18780 gene yhhY 78498 78986 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295206.1 protein_id gnl|my_center|LOCUS_18780 79223 80401 gene locus_tag LOCUS_18790 79223 80401 CDS product Hcp1 family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065894.1 protein_id gnl|my_center|LOCUS_18790 80398 80892 gene locus_tag LOCUS_18800 gene yrhA 80398 80892 CDS product protein YrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988501.1 protein_id gnl|my_center|LOCUS_18800 80987 81142 gene locus_tag LOCUS_18810 80987 81142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 81342 81626 gene locus_tag LOCUS_18820 81342 81626 CDS product YrhB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634159.1 protein_id gnl|my_center|LOCUS_18820 83406 81664 gene locus_tag LOCUS_18830 gene ggt 83406 81664 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595082.1 protein_id gnl|my_center|LOCUS_18830 83526 83966 gene locus_tag LOCUS_18840 83526 83966 CDS product DUF2756 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825996.1 protein_id gnl|my_center|LOCUS_18840 84696 83953 gene locus_tag LOCUS_18850 gene ugpQ 84696 83953 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073575.1 protein_id gnl|my_center|LOCUS_18850 85763 84693 gene locus_tag LOCUS_18860 gene ugpC 85763 84693 CDS product sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907792.1 protein_id gnl|my_center|LOCUS_18860 86610 85765 gene locus_tag LOCUS_18870 gene ugpE 86610 85765 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572176.1 protein_id gnl|my_center|LOCUS_18870 87494 86607 gene locus_tag LOCUS_18880 gene ugpA 87494 86607 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099289.1 protein_id gnl|my_center|LOCUS_18880 88908 87592 gene locus_tag LOCUS_18890 gene ugpB 88908 87592 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803190.1 protein_id gnl|my_center|LOCUS_18890 90018 89305 gene locus_tag LOCUS_18900 gene livF 90018 89305 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416895.1 protein_id gnl|my_center|LOCUS_18900 90787 90020 gene locus_tag LOCUS_18910 gene livG 90787 90020 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082101.1 protein_id gnl|my_center|LOCUS_18910 92061 90784 gene locus_tag LOCUS_18920 gene livM 92061 90784 CDS product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803797.1 protein_id gnl|my_center|LOCUS_18920 92984 92058 gene locus_tag LOCUS_18930 gene livH 92984 92058 CDS product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295111.1 protein_id gnl|my_center|LOCUS_18930 94195 93032 gene locus_tag LOCUS_18940 gene livK 94195 93032 CDS product high-affinity branched-chain amino acid ABC transporter substrate-binding protein LivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827696.1 protein_id gnl|my_center|LOCUS_18940 94565 94948 gene locus_tag LOCUS_18950 gene panM 94565 94948 CDS product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778795.1 protein_id gnl|my_center|LOCUS_18950 96250 95147 gene locus_tag LOCUS_18960 gene livJ 96250 95147 CDS product branched chain amino acid ABC transporter substrate-binding protein LivJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021996.1 protein_id gnl|my_center|LOCUS_18960 97375 96521 gene locus_tag LOCUS_18970 gene rpoH 97375 96521 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130217.1 protein_id gnl|my_center|LOCUS_18970 98678 97620 gene locus_tag LOCUS_18980 gene ftsX 98678 97620 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042003.1 protein_id gnl|my_center|LOCUS_18980 99339 98671 gene locus_tag LOCUS_18990 gene ftsE 99339 98671 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617723.1 protein_id gnl|my_center|LOCUS_18990 100838 99342 gene locus_tag LOCUS_19000 gene ftsY 100838 99342 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040676.1 protein_id gnl|my_center|LOCUS_19000 100988 101584 gene locus_tag LOCUS_19010 gene rsmD 100988 101584 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743193.1 protein_id gnl|my_center|LOCUS_19010 101574 101843 gene locus_tag LOCUS_19020 101574 101843 CDS product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295207.1 protein_id gnl|my_center|LOCUS_19020 102205 101846 gene locus_tag LOCUS_19030 102205 101846 CDS product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042886.1 protein_id gnl|my_center|LOCUS_19030 102346 102972 gene locus_tag LOCUS_19040 102346 102972 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964718.1 protein_id gnl|my_center|LOCUS_19040 103046 105244 gene locus_tag LOCUS_19050 gene zntA 103046 105244 CDS product Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106562.1 protein_id gnl|my_center|LOCUS_19050 105591 105346 gene locus_tag LOCUS_19060 gene tusA 105591 105346 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130621.1 protein_id gnl|my_center|LOCUS_19060 105812 106477 gene locus_tag LOCUS_19070 105812 106477 CDS product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100469.1 protein_id gnl|my_center|LOCUS_19070 106550 107107 gene locus_tag LOCUS_19080 gene dcrB 106550 107107 CDS product phage sensitivity protein DcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245295.1 protein_id gnl|my_center|LOCUS_19080 108361 107111 gene locus_tag LOCUS_19090 108361 107111 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240225.1 protein_id gnl|my_center|LOCUS_19090 108460 109509 gene locus_tag LOCUS_19100 108460 109509 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300885.1 protein_id gnl|my_center|LOCUS_19100 109564 110151 gene locus_tag LOCUS_19110 gene acpT 109564 110151 CDS product 4'-phosphopantetheinyl transferase AcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285774.1 protein_id gnl|my_center|LOCUS_19110 110262 111836 gene locus_tag LOCUS_19120 gene nikA 110262 111836 CDS product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953353.1 protein_id gnl|my_center|LOCUS_19120 111836 112780 gene locus_tag LOCUS_19130 gene nikB 111836 112780 CDS product nickel ABC transporter permease subunit NikB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947068.1 protein_id gnl|my_center|LOCUS_19130 112777 113610 gene locus_tag LOCUS_19140 gene nikC 112777 113610 CDS product nickel ABC transporter permease subunit NikC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008963.1 protein_id gnl|my_center|LOCUS_19140 113610 114374 gene locus_tag LOCUS_19150 gene nikD 113610 114374 CDS product nickel import ATP-binding protein NikD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136229.1 protein_id gnl|my_center|LOCUS_19150 114371 115177 gene locus_tag LOCUS_19160 gene nikE 114371 115177 CDS product nickel import ATP-binding protein NikE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173630.1 protein_id gnl|my_center|LOCUS_19160 115183 115584 gene locus_tag LOCUS_19170 gene nikR 115183 115584 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190062.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence14 950 312 gene locus_tag LOCUS_19180 gene leuE 950 312 CDS product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457202.1 protein_id gnl|my_center|LOCUS_19180 2000 1077 gene locus_tag LOCUS_19190 gene dmlR 2000 1077 CDS product DNA-binding transcriptional regulator DmlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061578.1 protein_id gnl|my_center|LOCUS_19190 2103 3188 gene locus_tag LOCUS_19200 gene dmlA 2103 3188 CDS product multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978494.1 protein_id gnl|my_center|LOCUS_19200 3385 4824 gene locus_tag LOCUS_19210 3385 4824 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301380.1 protein_id gnl|my_center|LOCUS_19210 4856 5980 gene locus_tag LOCUS_19220 gene yeaW 4856 5980 CDS product carnitine monooxygenase subunit YeaW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067822.1 protein_id gnl|my_center|LOCUS_19220 6036 7001 gene locus_tag LOCUS_19230 gene yeaX 6036 7001 CDS product carnitine monooxygenase subunit YeaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287005.1 protein_id gnl|my_center|LOCUS_19230 8182 7055 gene locus_tag LOCUS_19240 gene rnd 8182 7055 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109156.1 protein_id gnl|my_center|LOCUS_19240 10003 8252 gene locus_tag LOCUS_19250 gene fadD 10003 8252 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954305.1 protein_id gnl|my_center|LOCUS_19250 10723 10142 gene locus_tag LOCUS_19260 gene yeaY 10723 10142 CDS product Slp family lipoprotein YeaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290576.1 protein_id gnl|my_center|LOCUS_19260 11458 10763 gene locus_tag LOCUS_19270 gene tsaB 11458 10763 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220981.1 protein_id gnl|my_center|LOCUS_19270 13426 11516 gene locus_tag LOCUS_19280 13426 11516 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128847.1 protein_id gnl|my_center|LOCUS_19280 13555 13902 gene locus_tag LOCUS_19290 13555 13902 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310311.1 protein_id gnl|my_center|LOCUS_19290 14074 13880 gene locus_tag LOCUS_19300 14074 13880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 14265 14624 gene locus_tag LOCUS_19310 14265 14624 CDS product DUF1889 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307845.1 protein_id gnl|my_center|LOCUS_19310 14923 14744 gene locus_tag LOCUS_19320 14923 14744 CDS product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457334.1 protein_id gnl|my_center|LOCUS_19320 14997 16358 gene locus_tag LOCUS_19330 gene pabB 14997 16358 CDS product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854972.1 protein_id gnl|my_center|LOCUS_19330 16362 16940 gene locus_tag LOCUS_19340 16362 16940 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456725.1 protein_id gnl|my_center|LOCUS_19340 17124 18488 gene locus_tag LOCUS_19350 gene sdaA 17124 18488 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624298.1 protein_id gnl|my_center|LOCUS_19350 18619 20217 gene locus_tag LOCUS_19360 18619 20217 CDS product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295494.1 protein_id gnl|my_center|LOCUS_19360 21777 20221 gene locus_tag LOCUS_19370 gene yoaE 21777 20221 CDS product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394983.1 protein_id gnl|my_center|LOCUS_19370 22240 23211 gene locus_tag LOCUS_19380 gene manX 22240 23211 CDS product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150543.1 protein_id gnl|my_center|LOCUS_19380 23274 24074 gene locus_tag LOCUS_19390 gene manY 23274 24074 CDS product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406926.1 protein_id gnl|my_center|LOCUS_19390 24087 24938 gene locus_tag LOCUS_19400 gene manZ 24087 24938 CDS product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228655.1 protein_id gnl|my_center|LOCUS_19400 24993 25451 gene locus_tag LOCUS_19410 24993 25451 CDS product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156255.1 protein_id gnl|my_center|LOCUS_19410 25880 26446 gene locus_tag LOCUS_19420 gene mntP 25880 26446 CDS product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296134.1 protein_id gnl|my_center|LOCUS_19420 27252 26443 gene locus_tag LOCUS_19430 gene rlmA 27252 26443 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010128.1 protein_id gnl|my_center|LOCUS_19430 27627 27418 gene locus_tag LOCUS_19440 gene cspE 27627 27418 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062678.1 protein_id gnl|my_center|LOCUS_19440 28739 28452 gene locus_tag LOCUS_19450 28739 28452 CDS product YebO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006866.1 protein_id gnl|my_center|LOCUS_19450 29116 29355 gene locus_tag LOCUS_19460 29116 29355 CDS product YobH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211011.1 protein_id gnl|my_center|LOCUS_19460 30289 29498 gene locus_tag LOCUS_19470 gene kdgR 30289 29498 CDS product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262182.1 protein_id gnl|my_center|LOCUS_19470 30466 31839 gene locus_tag LOCUS_19480 30466 31839 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127216.1 protein_id gnl|my_center|LOCUS_19480 32766 31885 gene locus_tag LOCUS_19490 gene htpX 32766 31885 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984517.1 protein_id gnl|my_center|LOCUS_19490 35006 32958 gene locus_tag LOCUS_19500 gene prc 35006 32958 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315679.1 protein_id gnl|my_center|LOCUS_19500 35724 35026 gene locus_tag LOCUS_19510 gene proQ 35724 35026 CDS product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431370.1 protein_id gnl|my_center|LOCUS_19510 36318 35821 gene locus_tag LOCUS_19520 gene msrC 36318 35821 CDS product L-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299249.1 protein_id gnl|my_center|LOCUS_19520 36553 37731 gene locus_tag LOCUS_19530 gene yebS 36553 37731 CDS product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207283.1 protein_id gnl|my_center|LOCUS_19530 37700 40333 gene locus_tag LOCUS_19540 gene yebT 37700 40333 CDS product lipid-binding membrane homeostasis protein YebT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297532.1 protein_id gnl|my_center|LOCUS_19540 40407 41852 gene locus_tag LOCUS_19550 gene rsmF 40407 41852 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057022.1 protein_id gnl|my_center|LOCUS_19550 41970 42206 gene locus_tag LOCUS_19560 41970 42206 CDS product YebV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295499.1 protein_id gnl|my_center|LOCUS_19560 42227 42502 gene locus_tag LOCUS_19570 42227 42502 CDS product YebW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929530.1 protein_id gnl|my_center|LOCUS_19570 43159 42503 gene locus_tag LOCUS_19580 gene pphA 43159 42503 CDS product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812724.1 protein_id gnl|my_center|LOCUS_19580 43895 43554 gene locus_tag LOCUS_19590 43895 43554 CDS product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976472.1 protein_id gnl|my_center|LOCUS_19590 44780 43908 gene locus_tag LOCUS_19600 gene copD 44780 43908 CDS product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879289.1 protein_id gnl|my_center|LOCUS_19600 45158 44784 gene locus_tag LOCUS_19610 gene yobA 45158 44784 CDS product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168747.1 protein_id gnl|my_center|LOCUS_19610 45297 45527 gene locus_tag LOCUS_19620 gene holE 45297 45527 CDS product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916763.1 protein_id gnl|my_center|LOCUS_19620 45629 46285 gene locus_tag LOCUS_19630 gene yobB 45629 46285 CDS product carbon-nitrogen hydrolase family protein YobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011658.1 protein_id gnl|my_center|LOCUS_19630 46309 46971 gene locus_tag LOCUS_19640 gene exoX 46309 46971 CDS product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944256.1 protein_id gnl|my_center|LOCUS_19640 49028 46968 gene locus_tag LOCUS_19650 gene ptrB 49028 46968 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936951.1 protein_id gnl|my_center|LOCUS_19650 49896 49237 gene locus_tag LOCUS_19660 49896 49237 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024745.1 protein_id gnl|my_center|LOCUS_19660 50579 50223 gene locus_tag LOCUS_19670 gene yebF 50579 50223 CDS product protein YebF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295500.1 protein_id gnl|my_center|LOCUS_19670 50936 50646 gene locus_tag LOCUS_19680 gene yebG 50936 50646 CDS product DNA damage-inducible protein YebG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257738.1 protein_id gnl|my_center|LOCUS_19680 51070 52248 gene locus_tag LOCUS_19690 gene purT 51070 52248 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173474.1 protein_id gnl|my_center|LOCUS_19690 52945 52304 gene locus_tag LOCUS_19700 gene kdgA 52945 52304 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800512.1 protein_id gnl|my_center|LOCUS_19700 54793 52982 gene locus_tag LOCUS_19710 gene edd 54793 52982 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069467.1 protein_id gnl|my_center|LOCUS_19710 56503 55028 gene locus_tag LOCUS_19720 gene zwf 56503 55028 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301720.1 protein_id gnl|my_center|LOCUS_19720 56818 56669 gene locus_tag LOCUS_19730 56818 56669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155622.1 protein_id gnl|my_center|LOCUS_19730 56841 57710 gene locus_tag LOCUS_19740 gene hexR 56841 57710 CDS product DNA-binding transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056706.1 protein_id gnl|my_center|LOCUS_19740 57838 59280 gene locus_tag LOCUS_19750 gene pyk 57838 59280 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091148.1 protein_id gnl|my_center|LOCUS_19750 60382 59411 gene locus_tag LOCUS_19760 gene lpxM 60382 59411 CDS product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448381.1 protein_id gnl|my_center|LOCUS_19760 61824 60502 gene locus_tag LOCUS_19770 gene mepM 61824 60502 CDS product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001184045.1 protein_id gnl|my_center|LOCUS_19770 62508 61840 gene locus_tag LOCUS_19780 62508 61840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 62851 63606 gene locus_tag LOCUS_19790 gene znuC 62851 63606 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202996.1 protein_id gnl|my_center|LOCUS_19790 63603 64388 gene locus_tag LOCUS_19800 gene znuB 63603 64388 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571465.1 protein_id gnl|my_center|LOCUS_19800 65739 64729 gene locus_tag LOCUS_19810 gene ruvB 65739 64729 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568519.1 protein_id gnl|my_center|LOCUS_19810 66359 65748 gene locus_tag LOCUS_19820 gene ruvA 66359 65748 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580323.1 protein_id gnl|my_center|LOCUS_19820 66634 67236 gene locus_tag LOCUS_19830 66634 67236 CDS product YebB family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024929.1 protein_id gnl|my_center|LOCUS_19830 67759 67238 gene locus_tag LOCUS_19840 gene ruvC 67759 67238 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295503.1 protein_id gnl|my_center|LOCUS_19840 68534 67794 gene locus_tag LOCUS_19850 68534 67794 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907234.1 protein_id gnl|my_center|LOCUS_19850 69072 68563 gene locus_tag LOCUS_19860 gene nudB 69072 68563 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300367.1 protein_id gnl|my_center|LOCUS_19860 70905 69133 gene locus_tag LOCUS_19870 gene aspS 70905 69133 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258678.1 protein_id gnl|my_center|LOCUS_19870 71215 71781 gene locus_tag LOCUS_19880 71215 71781 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891621.1 protein_id gnl|my_center|LOCUS_19880 71778 72596 gene locus_tag LOCUS_19890 71778 72596 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639274.1 protein_id gnl|my_center|LOCUS_19890 72649 73044 gene locus_tag LOCUS_19900 72649 73044 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252980.1 protein_id gnl|my_center|LOCUS_19900 73085 73828 gene locus_tag LOCUS_19910 gene cmoA 73085 73828 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019588.1 protein_id gnl|my_center|LOCUS_19910 73825 74796 gene locus_tag LOCUS_19920 gene cmoB 73825 74796 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564726.1 protein_id gnl|my_center|LOCUS_19920 77390 74961 gene locus_tag LOCUS_19930 gene torZ 77390 74961 CDS product trimethylamine N-oxide reductase TorZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176787.1 protein_id gnl|my_center|LOCUS_19930 78515 77415 gene locus_tag LOCUS_19940 78515 77415 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214304.1 protein_id gnl|my_center|LOCUS_19940 79649 78903 gene locus_tag LOCUS_19950 gene cutC 79649 78903 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185734.1 protein_id gnl|my_center|LOCUS_19950 80229 79663 gene locus_tag LOCUS_19960 80229 79663 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326063.1 protein_id gnl|my_center|LOCUS_19960 80445 82178 gene locus_tag LOCUS_19970 gene argS 80445 82178 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025322.1 protein_id gnl|my_center|LOCUS_19970 82355 82843 gene locus_tag LOCUS_19980 82355 82843 CDS product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299676.1 protein_id gnl|my_center|LOCUS_19980 83355 82963 gene locus_tag LOCUS_19990 gene flhe 83355 82963 CDS product flagellar protein FlhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259583.1 protein_id gnl|my_center|LOCUS_19990 85433 83355 gene locus_tag LOCUS_20000 gene flhA 85433 83355 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066983.1 protein_id gnl|my_center|LOCUS_20000 86574 85426 gene locus_tag LOCUS_20010 gene flhB 86574 85426 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278936.1 protein_id gnl|my_center|LOCUS_20010 87420 86776 gene locus_tag LOCUS_20020 gene cheZ 87420 86776 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983609.1 protein_id gnl|my_center|LOCUS_20020 87820 87431 gene locus_tag LOCUS_20030 gene cheY 87820 87431 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763867.1 protein_id gnl|my_center|LOCUS_20030 88884 87835 gene locus_tag LOCUS_20040 gene cheB 88884 87835 CDS product protein-glutamate methylesterase/protein glutamine deamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036371.1 protein_id gnl|my_center|LOCUS_20040 89747 88887 gene locus_tag LOCUS_20050 gene cheR 89747 88887 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204335.1 protein_id gnl|my_center|LOCUS_20050 91367 89766 gene locus_tag LOCUS_20060 gene tap 91367 89766 CDS product methyl-accepting chemotaxis protein IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483239.1 protein_id gnl|my_center|LOCUS_20060 93074 91413 gene locus_tag LOCUS_20070 gene tar 93074 91413 CDS product methyl-accepting chemotaxis protein II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297437.1 protein_id gnl|my_center|LOCUS_20070 93722 93219 gene locus_tag LOCUS_20080 gene cheW 93722 93219 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147302.1 protein_id gnl|my_center|LOCUS_20080 95701 93743 gene locus_tag LOCUS_20090 gene cheA 95701 93743 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300654.1 protein_id gnl|my_center|LOCUS_20090 96638 95712 gene locus_tag LOCUS_20100 gene motB 96638 95712 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795630.1 protein_id gnl|my_center|LOCUS_20100 97522 96635 gene locus_tag LOCUS_20110 gene motA 97522 96635 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906340.1 protein_id gnl|my_center|LOCUS_20110 98227 97649 gene locus_tag LOCUS_20120 gene flhC 98227 97649 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291603.1 protein_id gnl|my_center|LOCUS_20120 98580 98230 gene locus_tag LOCUS_20130 gene flhD 98580 98230 CDS product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295647.1 protein_id gnl|my_center|LOCUS_20130 99360 99788 gene locus_tag LOCUS_20140 gene uspC 99360 99788 CDS product universal stress protein UspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122437.1 protein_id gnl|my_center|LOCUS_20140 101219 99795 gene locus_tag LOCUS_20150 gene otsA 101219 99795 CDS product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295646.1 protein_id gnl|my_center|LOCUS_20150 101994 101194 gene locus_tag LOCUS_20160 gene otsB 101994 101194 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295645.1 protein_id gnl|my_center|LOCUS_20160 103147 102161 gene locus_tag LOCUS_20170 gene araH 103147 102161 CDS product arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100205.1 protein_id gnl|my_center|LOCUS_20170 104676 103162 gene locus_tag LOCUS_20180 gene araG 104676 103162 CDS product arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187819.1 protein_id gnl|my_center|LOCUS_20180 105735 104746 gene locus_tag LOCUS_20190 gene araF 105735 104746 CDS product arabinose ABC transporter substrate-binding protein AraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548675.1 protein_id gnl|my_center|LOCUS_20190 106532 107035 gene locus_tag LOCUS_20200 106532 107035 CDS product non-heme ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179469.1 protein_id gnl|my_center|LOCUS_20200 107365 107114 gene locus_tag LOCUS_20210 gene yecJ 107365 107114 CDS product DUF2766 family protein YecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082127.1 protein_id gnl|my_center|LOCUS_20210 108032 107856 gene locus_tag LOCUS_20220 108032 107856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 108324 108821 gene locus_tag LOCUS_20230 gene ftnA 108324 108821 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917208.1 protein_id gnl|my_center|LOCUS_20230 109098 108859 gene locus_tag LOCUS_20240 109098 108859 CDS product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377224.1 protein_id gnl|my_center|LOCUS_20240 109288 110499 gene locus_tag LOCUS_20250 gene tyrP 109288 110499 CDS product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797573.1 protein_id gnl|my_center|LOCUS_20250 111226 110561 gene locus_tag LOCUS_20260 gene yecA 111226 110561 CDS product UPF0149 family protein YecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847882.1 protein_id gnl|my_center|LOCUS_20260 111508 111422 gene locus_tag LOCUS_t00230 111508 111422 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 111594 111521 gene locus_tag LOCUS_t00240 111594 111521 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 111723 111648 gene locus_tag LOCUS_t00250 111723 111648 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 112423 111875 gene locus_tag LOCUS_20270 gene pgsA 112423 111875 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160187.1 protein_id gnl|my_center|LOCUS_20270 114246 112480 gene locus_tag LOCUS_20280 gene uvrC 114246 112480 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283421.1 protein_id gnl|my_center|LOCUS_20280 114797 114309 gene locus_tag LOCUS_20290 114797 114309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence15 749 306 gene locus_tag LOCUS_20300 749 306 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237004.1 protein_id gnl|my_center|LOCUS_20300 906 1835 gene locus_tag LOCUS_20310 gene metA 906 1835 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122779.1 protein_id gnl|my_center|LOCUS_20310 2104 3705 gene locus_tag LOCUS_20320 gene aceB 2104 3705 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138905.1 protein_id gnl|my_center|LOCUS_20320 3735 5039 gene locus_tag LOCUS_20330 gene aceA 3735 5039 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857856.1 protein_id gnl|my_center|LOCUS_20330 5222 6958 gene locus_tag LOCUS_20340 gene aceK 5222 6958 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137214.1 protein_id gnl|my_center|LOCUS_20340 7523 6927 gene locus_tag LOCUS_20350 7523 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20350 8501 7590 gene locus_tag LOCUS_20360 8501 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20360 9642 8818 gene locus_tag LOCUS_20370 gene iclR 9642 8818 CDS product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226403.1 protein_id gnl|my_center|LOCUS_20370 9842 13525 gene locus_tag LOCUS_20380 gene metH 9842 13525 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096011.1 protein_id gnl|my_center|LOCUS_20380 13745 15376 gene locus_tag LOCUS_20390 13745 15376 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956830.1 protein_id gnl|my_center|LOCUS_20390 16156 15467 gene locus_tag LOCUS_20400 gene pepE 16156 15467 CDS product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421763.1 protein_id gnl|my_center|LOCUS_20400 16368 17240 gene locus_tag LOCUS_20410 gene rluF 16368 17240 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936377.1 protein_id gnl|my_center|LOCUS_20410 17645 17373 gene locus_tag LOCUS_20420 17645 17373 CDS product DUF3811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207634.1 protein_id gnl|my_center|LOCUS_20420 19247 17898 gene locus_tag LOCUS_20430 gene lysC 19247 17898 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290310.1 protein_id gnl|my_center|LOCUS_20430 19772 21421 gene locus_tag LOCUS_20440 gene pgi 19772 21421 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789986.1 protein_id gnl|my_center|LOCUS_20440 21920 22162 gene locus_tag LOCUS_20450 21920 22162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 22277 22915 gene locus_tag LOCUS_20460 22277 22915 CDS product YjbF family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296632.1 protein_id gnl|my_center|LOCUS_20460 22912 23649 gene locus_tag LOCUS_20470 22912 23649 CDS product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595531.1 protein_id gnl|my_center|LOCUS_20470 23649 25745 gene locus_tag LOCUS_20480 23649 25745 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745776.1 protein_id gnl|my_center|LOCUS_20480 26340 26750 gene locus_tag LOCUS_20490 gene psiE 26340 26750 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202902.1 protein_id gnl|my_center|LOCUS_20490 28269 26794 gene locus_tag LOCUS_20500 gene xylE 28269 26794 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097274.1 protein_id gnl|my_center|LOCUS_20500 29531 28641 gene locus_tag LOCUS_20510 gene malG 29531 28641 CDS product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252058.1 protein_id gnl|my_center|LOCUS_20510 31090 29546 gene locus_tag LOCUS_20520 gene malF 31090 29546 CDS product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297290.1 protein_id gnl|my_center|LOCUS_20520 32434 31244 gene locus_tag LOCUS_20530 gene malE 32434 31244 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695387.1 protein_id gnl|my_center|LOCUS_20530 32799 33914 gene locus_tag LOCUS_20540 gene malK 32799 33914 CDS product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179165.1 protein_id gnl|my_center|LOCUS_20540 33986 35326 gene locus_tag LOCUS_20550 gene lamB 33986 35326 CDS product maltoporin LamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973663.1 protein_id gnl|my_center|LOCUS_20550 35569 36489 gene locus_tag LOCUS_20560 gene malM 35569 36489 CDS product maltose operon protein MalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326641.1 protein_id gnl|my_center|LOCUS_20560 36718 36912 gene locus_tag LOCUS_20570 36718 36912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623309.1 protein_id gnl|my_center|LOCUS_20570 37003 38298 gene locus_tag LOCUS_20580 37003 38298 CDS product SopA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900533.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20580 38521 39018 gene locus_tag LOCUS_20590 gene ubiC 38521 39018 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326644.1 protein_id gnl|my_center|LOCUS_20590 39031 39903 gene locus_tag LOCUS_20600 gene ubiA 39031 39903 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455227.1 protein_id gnl|my_center|LOCUS_20600 42481 40058 gene locus_tag LOCUS_20610 gene plsB 42481 40058 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017354.1 protein_id gnl|my_center|LOCUS_20610 42652 43020 gene locus_tag LOCUS_20620 gene dgkA 42652 43020 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002907.1 protein_id gnl|my_center|LOCUS_20620 43130 43738 gene locus_tag LOCUS_20630 gene lexA 43130 43738 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646078.1 protein_id gnl|my_center|LOCUS_20630 43811 45136 gene locus_tag LOCUS_20640 gene dinF 43811 45136 CDS product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134731.1 protein_id gnl|my_center|LOCUS_20640 45252 45461 gene locus_tag LOCUS_20650 45252 45461 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030593.1 protein_id gnl|my_center|LOCUS_20650 46018 45503 gene locus_tag LOCUS_20660 gene zur 46018 45503 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295691.1 protein_id gnl|my_center|LOCUS_20660 46336 46590 gene locus_tag LOCUS_20670 gene yjbL 46336 46590 CDS product protein YjbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912571.1 protein_id gnl|my_center|LOCUS_20670 46614 47321 gene locus_tag LOCUS_20680 46614 47321 CDS product DUF2713 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311303.1 protein_id gnl|my_center|LOCUS_20680 47780 48721 gene locus_tag LOCUS_20690 gene dusA 47780 48721 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298868.1 protein_id gnl|my_center|LOCUS_20690 48855 49097 gene locus_tag LOCUS_20700 gene pspG 48855 49097 CDS product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891404.1 protein_id gnl|my_center|LOCUS_20700 50246 49263 gene locus_tag LOCUS_20710 50246 49263 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235508.1 protein_id gnl|my_center|LOCUS_20710 50329 51744 gene locus_tag LOCUS_20720 gene dnaB 50329 51744 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918363.1 protein_id gnl|my_center|LOCUS_20720 51797 52876 gene locus_tag LOCUS_20730 gene alr 51797 52876 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147328.1 protein_id gnl|my_center|LOCUS_20730 53129 54322 gene locus_tag LOCUS_20740 gene tyrB 53129 54322 CDS product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486985.1 protein_id gnl|my_center|LOCUS_20740 54441 54620 gene locus_tag LOCUS_20750 54441 54620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 55066 54824 gene locus_tag LOCUS_20760 gene yjbS 55066 54824 CDS product protein YjbS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001321562.1 protein_id gnl|my_center|LOCUS_20760 55429 56142 gene locus_tag LOCUS_20770 gene aphA 55429 56142 CDS product acid phosphatase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226928.1 protein_id gnl|my_center|LOCUS_20770 56253 56669 gene locus_tag LOCUS_20780 56253 56669 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270375.1 protein_id gnl|my_center|LOCUS_20780 56673 57029 gene locus_tag LOCUS_20790 56673 57029 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155657.1 protein_id gnl|my_center|LOCUS_20790 59886 57064 gene locus_tag LOCUS_20800 gene uvrA 59886 57064 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357740.1 protein_id gnl|my_center|LOCUS_20800 60141 60677 gene locus_tag LOCUS_20810 gene ssb1 60141 60677 CDS product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168299.1 protein_id gnl|my_center|LOCUS_20810 61057 60776 gene locus_tag LOCUS_20820 61057 60776 CDS product YjcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295689.1 protein_id gnl|my_center|LOCUS_20820 61487 62422 gene locus_tag LOCUS_20830 61487 62422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20830 62432 63073 gene locus_tag LOCUS_20840 62432 63073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20840 63399 63076 gene locus_tag LOCUS_20850 gene soxS 63399 63076 CDS product superoxide response transcriptional regulator SoxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019358.1 protein_id gnl|my_center|LOCUS_20850 63485 63949 gene locus_tag LOCUS_20860 gene soxR 63485 63949 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412428.1 protein_id gnl|my_center|LOCUS_20860 64495 65844 gene locus_tag LOCUS_20870 gene ghxP 64495 65844 CDS product guanine/hypoxanthine transporter GhxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106882.1 protein_id gnl|my_center|LOCUS_20870 65996 67645 gene locus_tag LOCUS_20880 65996 67645 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402207.1 protein_id gnl|my_center|LOCUS_20880 69091 67799 gene locus_tag LOCUS_20890 gene espX5 69091 67799 CDS product T3SS effector pentapeptide repeat protein EspX5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270094.1 protein_id gnl|my_center|LOCUS_20890 70918 69269 gene locus_tag LOCUS_20900 gene actP 70918 69269 CDS product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832573.1 protein_id gnl|my_center|LOCUS_20900 71229 70915 gene locus_tag LOCUS_20910 71229 70915 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296646.1 protein_id gnl|my_center|LOCUS_20910 73387 71429 gene locus_tag LOCUS_20920 gene acs 73387 71429 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078239.1 protein_id gnl|my_center|LOCUS_20920 73780 75216 gene locus_tag LOCUS_20930 gene nrfA 73780 75216 CDS product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196875.1 protein_id gnl|my_center|LOCUS_20930 75261 75827 gene locus_tag LOCUS_20940 gene nrfB 75261 75827 CDS product cytochrome c nitrite reductase pentaheme subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295391.1 protein_id gnl|my_center|LOCUS_20940 75824 76495 gene locus_tag LOCUS_20950 gene nrfC 75824 76495 CDS product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220281.1 protein_id gnl|my_center|LOCUS_20950 76492 77448 gene locus_tag LOCUS_20960 gene nrfD 76492 77448 CDS product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195171.1 protein_id gnl|my_center|LOCUS_20960 77504 79186 gene locus_tag LOCUS_20970 77504 79186 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071524619.1 protein_id gnl|my_center|LOCUS_20970 79179 79562 gene locus_tag LOCUS_20980 gene nrfF 79179 79562 CDS product heme lyase NrfEFG subunit NrfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032546.1 protein_id gnl|my_center|LOCUS_20980 79559 80155 gene locus_tag LOCUS_20990 gene nrfG 79559 80155 CDS product heme lyase NrfEFG subunit NrfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812982.1 protein_id gnl|my_center|LOCUS_20990 80497 81810 gene locus_tag LOCUS_21000 gene gltP 80497 81810 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789592.1 protein_id gnl|my_center|LOCUS_21000 82804 82115 gene locus_tag LOCUS_21010 gene yjcO 82804 82115 CDS product Sel1 family TPR-like repeat protein YjcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719886.1 protein_id gnl|my_center|LOCUS_21010 85045 82898 gene locus_tag LOCUS_21020 gene fdhF 85045 82898 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300547.1 transl_except (pos:complement(84626..84628),aa:Sec) note codon on position 140 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_21020 86709 85243 gene locus_tag LOCUS_21030 gene mdtP 86709 85243 CDS product multidrug efflux transporter outer membrane subunit MdtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610601.1 protein_id gnl|my_center|LOCUS_21030 88757 86706 gene locus_tag LOCUS_21040 gene mdtO 88757 86706 CDS product multidrug efflux transporter permease subunit MdtO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275207.1 protein_id gnl|my_center|LOCUS_21040 89788 88757 gene locus_tag LOCUS_21050 gene mdtN 89788 88757 CDS product multidrug efflux transporter periplasmic adaptor subunit MdtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446378.1 protein_id gnl|my_center|LOCUS_21050 90082 89807 gene locus_tag LOCUS_21060 90082 89807 CDS product YtcA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295389.1 protein_id gnl|my_center|LOCUS_21060 92276 90291 gene locus_tag LOCUS_21070 gene yjcS 92276 90291 CDS product alkyl sulfatase YjcS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066019.1 protein_id gnl|my_center|LOCUS_21070 93478 92549 gene locus_tag LOCUS_21080 gene alsK 93478 92549 CDS product allose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171687.1 protein_id gnl|my_center|LOCUS_21080 94157 93462 gene locus_tag LOCUS_21090 gene alsE 94157 93462 CDS product D-allulose-6-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311314.1 protein_id gnl|my_center|LOCUS_21090 95148 94168 gene locus_tag LOCUS_21100 gene alsC 95148 94168 CDS product D-allose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000507106.1 protein_id gnl|my_center|LOCUS_21100 96659 95127 gene locus_tag LOCUS_21110 gene alsA 96659 95127 CDS product D-allose ABC transporter ATP-binding protein AlsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235257.1 protein_id gnl|my_center|LOCUS_21110 97721 96786 gene locus_tag LOCUS_21120 gene alsB 97721 96786 CDS product D-allose transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046187.1 protein_id gnl|my_center|LOCUS_21120 98670 97780 gene locus_tag LOCUS_21130 gene alsR 98670 97780 CDS product als operon DNA-binding transcriptional repressor AlsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083216.1 protein_id gnl|my_center|LOCUS_21130 99029 99478 gene locus_tag LOCUS_21140 gene rpiB 99029 99478 CDS product bifunctional allose-6-phosphate isomerase/ribose-5-phosphate isomerase RpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716794.1 protein_id gnl|my_center|LOCUS_21140 99547 99876 gene locus_tag LOCUS_21150 99547 99876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 100781 100023 gene locus_tag LOCUS_21160 gene phnP 100781 100023 CDS product phosphonate metabolism protein PhnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059908.1 protein_id gnl|my_center|LOCUS_21160 101217 100783 gene locus_tag LOCUS_21170 gene phnO 101217 100783 CDS product aminoalkylphosphonate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110490.1 protein_id gnl|my_center|LOCUS_21170 101761 101204 gene locus_tag LOCUS_21180 gene phnN 101761 101204 CDS product ribose 1,5-bisphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971886.1 protein_id gnl|my_center|LOCUS_21180 102897 101761 gene locus_tag LOCUS_21190 gene phnM 102897 101761 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586325.1 protein_id gnl|my_center|LOCUS_21190 103574 102894 gene locus_tag LOCUS_21200 gene phnL 103574 102894 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611405.1 protein_id gnl|my_center|LOCUS_21200 104443 103685 gene locus_tag LOCUS_21210 gene phnK 104443 103685 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075514.1 protein_id gnl|my_center|LOCUS_21210 105285 104440 gene locus_tag LOCUS_21220 gene phnJ 105285 104440 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002283.1 protein_id gnl|my_center|LOCUS_21220 106342 105278 gene locus_tag LOCUS_21230 gene phnI 106342 105278 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295388.1 protein_id gnl|my_center|LOCUS_21230 106926 106342 gene locus_tag LOCUS_21240 gene phnH 106926 106342 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171628.1 protein_id gnl|my_center|LOCUS_21240 107375 106923 gene locus_tag LOCUS_21250 gene phnG 107375 106923 CDS product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542786.1 protein_id gnl|my_center|LOCUS_21250 108101 107376 gene locus_tag LOCUS_21260 gene phnF 108101 107376 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295387.1 protein_id gnl|my_center|LOCUS_21260 108952 108122 gene locus_tag LOCUS_21270 gene phnE 108952 108122 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193500.1 protein_id gnl|my_center|LOCUS_21270 110023 109007 gene locus_tag LOCUS_21280 gene phnD 110023 109007 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992000.1 protein_id gnl|my_center|LOCUS_21280 110836 110048 gene locus_tag LOCUS_21290 gene phnC 110836 110048 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193391.1 protein_id gnl|my_center|LOCUS_21290 111412 110969 gene locus_tag LOCUS_21300 gene yjdN 111412 110969 CDS product VOC family metalloprotein YjdN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131339.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence16 573 85 gene locus_tag LOCUS_21310 gene eco 573 85 CDS product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849209.1 protein_id gnl|my_center|LOCUS_21310 872 708 gene locus_tag LOCUS_21320 gene yojO 872 708 CDS product protein YojO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296837.1 protein_id gnl|my_center|LOCUS_21320 1465 1728 gene locus_tag LOCUS_21330 gene napD 1465 1728 CDS product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557378.1 protein_id gnl|my_center|LOCUS_21330 1725 4211 gene locus_tag LOCUS_21340 gene napA 1725 4211 CDS product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778067.1 protein_id gnl|my_center|LOCUS_21340 4218 4913 gene locus_tag LOCUS_21350 gene napG 4218 4913 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091291.1 protein_id gnl|my_center|LOCUS_21350 4900 5763 gene locus_tag LOCUS_21360 gene napH 4900 5763 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013515.1 protein_id gnl|my_center|LOCUS_21360 5760 6209 gene locus_tag LOCUS_21370 gene napB 5760 6209 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835177.1 protein_id gnl|my_center|LOCUS_21370 6219 6821 gene locus_tag LOCUS_21380 gene napC 6219 6821 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528376.1 protein_id gnl|my_center|LOCUS_21380 6834 7457 gene locus_tag LOCUS_21390 gene ccmA 6834 7457 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525587.1 protein_id gnl|my_center|LOCUS_21390 7454 8116 gene locus_tag LOCUS_21400 gene ccmB 7454 8116 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971730.1 protein_id gnl|my_center|LOCUS_21400 8134 8895 gene locus_tag LOCUS_21410 gene ccmC 8134 8895 CDS product heme exporter protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295447.1 protein_id gnl|my_center|LOCUS_21410 8892 9101 gene locus_tag LOCUS_21420 8892 9101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 9098 9577 gene locus_tag LOCUS_21430 gene ccmE 9098 9577 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026418.1 protein_id gnl|my_center|LOCUS_21430 9574 11517 gene locus_tag LOCUS_21440 gene ccmF 9574 11517 CDS product cytochrome c-type biogenesis heme lyase CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982447.1 protein_id gnl|my_center|LOCUS_21440 11514 12071 gene locus_tag LOCUS_21450 gene dsbE 11514 12071 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824439.1 protein_id gnl|my_center|LOCUS_21450 12068 13120 gene locus_tag LOCUS_21460 gene ccmH 12068 13120 CDS product cytochrome c-type biogenesis thiol:disulfide oxidoreductase CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211587.1 protein_id gnl|my_center|LOCUS_21460 13978 13331 gene locus_tag LOCUS_21470 gene narP 13978 13331 CDS product nitrate/nitrite response regulator protein NarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113637.1 protein_id gnl|my_center|LOCUS_21470 14298 16889 gene locus_tag LOCUS_21480 gene yejO 14298 16889 CDS product autotransporter YejO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554226.1 protein_id gnl|my_center|LOCUS_21480 17068 16992 gene locus_tag LOCUS_t00260 17068 16992 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 18903 17143 gene locus_tag LOCUS_21490 gene yejM 18903 17143 CDS product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256203.1 protein_id gnl|my_center|LOCUS_21490 19150 18923 gene locus_tag LOCUS_21500 19150 18923 CDS product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135667.1 protein_id gnl|my_center|LOCUS_21500 19332 20339 gene locus_tag LOCUS_21510 gene yejK 19332 20339 CDS product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050793.1 protein_id gnl|my_center|LOCUS_21510 20762 20478 gene locus_tag LOCUS_21520 gene rplY 20762 20478 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494183.1 protein_id gnl|my_center|LOCUS_21520 22647 20887 gene locus_tag LOCUS_21530 22647 20887 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578061.1 protein_id gnl|my_center|LOCUS_21530 22796 23491 gene locus_tag LOCUS_21540 gene rsuA 22796 23491 CDS product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234850.1 protein_id gnl|my_center|LOCUS_21540 23519 24709 gene locus_tag LOCUS_21550 gene bcr 23519 24709 CDS product multidrug efflux MFS transporter Bcr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213371.1 protein_id gnl|my_center|LOCUS_21550 25042 25386 gene locus_tag LOCUS_21560 25042 25386 CDS product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202798.1 protein_id gnl|my_center|LOCUS_21560 26979 25390 gene locus_tag LOCUS_21570 gene yejF 26979 25390 CDS product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194927.1 protein_id gnl|my_center|LOCUS_21570 28006 26981 gene locus_tag LOCUS_21580 28006 26981 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088916.1 protein_id gnl|my_center|LOCUS_21580 29100 28006 gene locus_tag LOCUS_21590 29100 28006 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501604.1 protein_id gnl|my_center|LOCUS_21590 30921 29101 gene locus_tag LOCUS_21600 30921 29101 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001349933.1 protein_id gnl|my_center|LOCUS_21600 32490 30997 gene locus_tag LOCUS_21610 32490 30997 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470560.1 protein_id gnl|my_center|LOCUS_21610 33300 32734 gene locus_tag LOCUS_21620 gene mepS 33300 32734 CDS product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241011.1 protein_id gnl|my_center|LOCUS_21620 34425 33712 gene locus_tag LOCUS_21630 gene lpxT 34425 33712 CDS product Kdo(2)-lipid A phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594599.1 protein_id gnl|my_center|LOCUS_21630 35450 34464 gene locus_tag LOCUS_21640 gene yeiR 35450 34464 CDS product zinc-binding GTPase YeiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198822.1 protein_id gnl|my_center|LOCUS_21640 37034 35568 gene locus_tag LOCUS_21650 37034 35568 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091940.1 protein_id gnl|my_center|LOCUS_21650 37829 37257 gene locus_tag LOCUS_21660 gene yeiP 37829 37257 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136827.1 protein_id gnl|my_center|LOCUS_21660 37984 38238 gene locus_tag LOCUS_21670 37984 38238 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389030.1 protein_id gnl|my_center|LOCUS_21670 39416 38235 gene locus_tag LOCUS_21680 gene setB 39416 38235 CDS product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551969.1 protein_id gnl|my_center|LOCUS_21680 39784 40914 gene locus_tag LOCUS_21690 gene fruB 39784 40914 CDS product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487246.1 protein_id gnl|my_center|LOCUS_21690 40914 41852 gene locus_tag LOCUS_21700 gene fruK 40914 41852 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091263.1 protein_id gnl|my_center|LOCUS_21700 41869 43560 gene locus_tag LOCUS_21710 gene fruA 41869 43560 CDS product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854472.1 protein_id gnl|my_center|LOCUS_21710 43984 44925 gene locus_tag LOCUS_21720 43984 44925 CDS product pseudouridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208134.1 protein_id gnl|my_center|LOCUS_21720 44913 45851 gene locus_tag LOCUS_21730 gene psuG 44913 45851 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292468.1 protein_id gnl|my_center|LOCUS_21730 45966 47195 gene locus_tag LOCUS_21740 45966 47195 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353878.1 protein_id gnl|my_center|LOCUS_21740 47925 47266 gene locus_tag LOCUS_21750 gene yeiL 47925 47266 CDS product transcriptional regulator YeiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310375.1 protein_id gnl|my_center|LOCUS_21750 48094 49035 gene locus_tag LOCUS_21760 gene rihB 48094 49035 CDS product ribosylpyrimidine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415455.1 protein_id gnl|my_center|LOCUS_21760 49135 50385 gene locus_tag LOCUS_21770 49135 50385 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382966.1 protein_id gnl|my_center|LOCUS_21770 51529 50441 gene locus_tag LOCUS_21780 51529 50441 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065016.1 protein_id gnl|my_center|LOCUS_21780 52389 51532 gene locus_tag LOCUS_21790 gene nfo 52389 51532 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873880.1 protein_id gnl|my_center|LOCUS_21790 53512 52463 gene locus_tag LOCUS_21800 53512 52463 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182053.1 protein_id gnl|my_center|LOCUS_21800 53686 54492 gene locus_tag LOCUS_21810 gene yieE 53686 54492 CDS product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548294.1 protein_id gnl|my_center|LOCUS_21810 54697 56166 gene locus_tag LOCUS_21820 gene lysP 54697 56166 CDS product lysine-specific permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253273.1 protein_id gnl|my_center|LOCUS_21820 56556 58451 gene locus_tag LOCUS_21830 gene cirA 56556 58451 CDS product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489247.1 protein_id gnl|my_center|LOCUS_21830 59319 58483 gene locus_tag LOCUS_21840 gene yeiG 59319 58483 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425438.1 protein_id gnl|my_center|LOCUS_21840 59577 60245 gene locus_tag LOCUS_21850 gene folE 59577 60245 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139613.1 protein_id gnl|my_center|LOCUS_21850 60262 61419 gene locus_tag LOCUS_21860 gene yeiB 60262 61419 CDS product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440895.1 protein_id gnl|my_center|LOCUS_21860 61571 61368 gene locus_tag LOCUS_21870 61571 61368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 61561 62601 gene locus_tag LOCUS_21880 gene galS 61561 62601 CDS product HTH-type transcriptional regulator GalS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628659.1 protein_id gnl|my_center|LOCUS_21880 62881 63879 gene locus_tag LOCUS_21890 gene mglB 62881 63879 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036964.1 protein_id gnl|my_center|LOCUS_21890 63940 65460 gene locus_tag LOCUS_21900 gene mglA 63940 65460 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255032.1 protein_id gnl|my_center|LOCUS_21900 65476 66486 gene locus_tag LOCUS_21910 gene mglC 65476 66486 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275118.1 protein_id gnl|my_center|LOCUS_21910 67964 66729 gene locus_tag LOCUS_21920 gene preA 67964 66729 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956071.1 protein_id gnl|my_center|LOCUS_21920 69196 67958 gene locus_tag LOCUS_21930 gene preT 69196 67958 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136389.1 protein_id gnl|my_center|LOCUS_21930 69629 69390 gene locus_tag LOCUS_21940 69629 69390 CDS product DUF2542 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383096.1 protein_id gnl|my_center|LOCUS_21940 70351 69632 gene locus_tag LOCUS_21950 gene sanA 70351 69632 CDS product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920064.1 protein_id gnl|my_center|LOCUS_21950 71385 70501 gene locus_tag LOCUS_21960 gene cdd 71385 70501 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553555.1 protein_id gnl|my_center|LOCUS_21960 72210 71515 gene locus_tag LOCUS_21970 72210 71515 CDS product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968208.1 protein_id gnl|my_center|LOCUS_21970 72605 72207 gene locus_tag LOCUS_21980 72605 72207 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295452.1 protein_id gnl|my_center|LOCUS_21980 72843 73790 gene locus_tag LOCUS_21990 gene dusC 72843 73790 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264861.1 protein_id gnl|my_center|LOCUS_21990 74542 75906 gene locus_tag LOCUS_22000 gene mdtQ 74542 75906 CDS product multidrug resistance outer membrane protein MdtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078114.1 protein_id gnl|my_center|LOCUS_22000 75959 76720 gene locus_tag LOCUS_22010 75959 76720 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079538.1 protein_id gnl|my_center|LOCUS_22010 77428 76850 gene locus_tag LOCUS_22020 77428 76850 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296821.1 protein_id gnl|my_center|LOCUS_22020 77598 78185 gene locus_tag LOCUS_22030 77598 78185 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295454.1 protein_id gnl|my_center|LOCUS_22030 78359 79291 gene locus_tag LOCUS_22040 gene pbpG 78359 79291 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001319943.1 protein_id gnl|my_center|LOCUS_22040 81044 79329 gene locus_tag LOCUS_22050 gene dld 81044 79329 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097403.1 protein_id gnl|my_center|LOCUS_22050 81240 83537 gene locus_tag LOCUS_22060 gene bglX 81240 83537 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871517.1 protein_id gnl|my_center|LOCUS_22060 83789 84706 gene locus_tag LOCUS_22070 gene osmF 83789 84706 CDS product glycine betaine ABC transporter substrate-binding protein OsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130308.1 protein_id gnl|my_center|LOCUS_22070 84713 85870 gene locus_tag LOCUS_22080 gene yehY 84713 85870 CDS product glycine betaine ABC transporter permease YehY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220837.1 protein_id gnl|my_center|LOCUS_22080 85863 86789 gene locus_tag LOCUS_22090 gene yehX 85863 86789 CDS product glycine betaine ABC transporter ATP binding protein YehX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569315.1 protein_id gnl|my_center|LOCUS_22090 86794 87525 gene locus_tag LOCUS_22100 gene yehW 86794 87525 CDS product glycine betaine ABC transporter permease YehW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783120.1 protein_id gnl|my_center|LOCUS_22100 88404 87673 gene locus_tag LOCUS_22110 gene mlrA 88404 87673 CDS product HTH-type transcriptional regulator MlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240401.1 protein_id gnl|my_center|LOCUS_22110 88611 90311 gene locus_tag LOCUS_22120 gene btsS 88611 90311 CDS product two-component regulatory system sensor histidine kinase BtsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295431.1 protein_id gnl|my_center|LOCUS_22120 90308 91027 gene locus_tag LOCUS_22130 gene btsR 90308 91027 CDS product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598641.1 protein_id gnl|my_center|LOCUS_22130 91074 91544 gene locus_tag LOCUS_22140 91074 91544 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295430.1 protein_id gnl|my_center|LOCUS_22140 92046 91585 gene locus_tag LOCUS_22150 92046 91585 CDS product YehR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296231.1 protein_id gnl|my_center|LOCUS_22150 94171 92171 gene locus_tag LOCUS_22160 94171 92171 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351453.1 protein_id gnl|my_center|LOCUS_22160 95304 94168 gene locus_tag LOCUS_22170 95304 94168 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333512.1 protein_id gnl|my_center|LOCUS_22170 97576 95297 gene locus_tag LOCUS_22180 97576 95297 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294387.1 protein_id gnl|my_center|LOCUS_22180 98675 97587 gene locus_tag LOCUS_22190 98675 97587 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350535.1 protein_id gnl|my_center|LOCUS_22190 99299 98982 gene locus_tag LOCUS_22200 gene yehK 99299 98982 CDS product protein YehK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636925.1 protein_id gnl|my_center|LOCUS_22200 102992 99360 gene locus_tag LOCUS_22210 gene yehI 102992 99360 CDS product DUF4132 domain-containing protein YehI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356817.1 protein_id gnl|my_center|LOCUS_22210 106796 103002 gene locus_tag LOCUS_22220 106796 103002 CDS product WGR and DUF4132 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215613.1 protein_id gnl|my_center|LOCUS_22220 108979 106937 gene locus_tag LOCUS_22230 gene metG 108979 106937 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295427.1 protein_id gnl|my_center|LOCUS_22230 109102 110211 gene locus_tag LOCUS_22240 gene apbC 109102 110211 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005448.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence17 29 104 gene locus_tag LOCUS_t00270 29 104 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1039 200 gene locus_tag LOCUS_22250 gene hdfR 1039 200 CDS product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379245.1 protein_id gnl|my_center|LOCUS_22250 1158 1496 gene locus_tag LOCUS_22260 gene maoP 1158 1496 CDS product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841001.1 protein_id gnl|my_center|LOCUS_22260 3041 1521 gene locus_tag LOCUS_22270 3041 1521 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058964.1 protein_id gnl|my_center|LOCUS_22270 3632 5278 gene locus_tag LOCUS_22280 gene ilvG 3632 5278 CDS product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012613.1 protein_id gnl|my_center|LOCUS_22280 5275 5538 gene locus_tag LOCUS_22290 gene ilvM 5275 5538 CDS product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983255.1 protein_id gnl|my_center|LOCUS_22290 5558 6487 gene locus_tag LOCUS_22300 gene ilvE 5558 6487 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208520.1 protein_id gnl|my_center|LOCUS_22300 6552 8402 gene locus_tag LOCUS_22310 gene ilvD 6552 8402 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127391.1 protein_id gnl|my_center|LOCUS_22310 8402 9949 gene locus_tag LOCUS_22320 gene ilvA 8402 9949 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785596.1 protein_id gnl|my_center|LOCUS_22320 10894 10001 gene locus_tag LOCUS_22330 gene ilvY 10894 10001 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365791.1 protein_id gnl|my_center|LOCUS_22330 11044 12519 gene locus_tag LOCUS_22340 gene ilvC 11044 12519 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024939.1 protein_id gnl|my_center|LOCUS_22340 12887 12606 gene locus_tag LOCUS_22350 gene ppiC 12887 12606 CDS product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140251.1 protein_id gnl|my_center|LOCUS_22350 13534 13316 gene locus_tag LOCUS_22360 13534 13316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22360 13751 15772 gene locus_tag LOCUS_22370 gene rep 13751 15772 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238899.1 protein_id gnl|my_center|LOCUS_22370 17303 15819 gene locus_tag LOCUS_22380 gene gppA 17303 15819 CDS product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640241.1 protein_id gnl|my_center|LOCUS_22380 18702 17437 gene locus_tag LOCUS_22390 gene rhlB 18702 17437 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047499.1 protein_id gnl|my_center|LOCUS_22390 18833 19162 gene locus_tag LOCUS_22400 gene trxA 18833 19162 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305383.1 protein_id gnl|my_center|LOCUS_22400 19489 20748 gene locus_tag LOCUS_22410 gene rho 19489 20748 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054527.1 protein_id gnl|my_center|LOCUS_22410 20758 20976 gene locus_tag LOCUS_22420 20758 20976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127070.1 protein_id gnl|my_center|LOCUS_22420 20988 22091 gene locus_tag LOCUS_22430 gene wecA 20988 22091 CDS product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050960.1 protein_id gnl|my_center|LOCUS_22430 22103 23149 gene locus_tag LOCUS_22440 gene wzzE 22103 23149 CDS product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295256.1 protein_id gnl|my_center|LOCUS_22440 23205 24335 gene locus_tag LOCUS_22450 gene wecB 23205 24335 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866670.1 protein_id gnl|my_center|LOCUS_22450 24332 25594 gene locus_tag LOCUS_22460 gene wecC 24332 25594 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006621.1 protein_id gnl|my_center|LOCUS_22460 25594 26661 gene locus_tag LOCUS_22470 gene rffG 25594 26661 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226601.1 protein_id gnl|my_center|LOCUS_22470 26680 27561 gene locus_tag LOCUS_22480 gene rfbA 26680 27561 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676056.1 protein_id gnl|my_center|LOCUS_22480 27539 28213 gene locus_tag LOCUS_22490 gene rffC 27539 28213 CDS product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145183.1 protein_id gnl|my_center|LOCUS_22490 28218 29348 gene locus_tag LOCUS_22500 gene rffA 28218 29348 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612043.1 protein_id gnl|my_center|LOCUS_22500 29350 30600 gene locus_tag LOCUS_22510 gene wzxE 29350 30600 CDS product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050260.1 protein_id gnl|my_center|LOCUS_22510 30597 31676 gene locus_tag LOCUS_22520 gene rffT 30597 31676 CDS product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217284.1 protein_id gnl|my_center|LOCUS_22520 31673 33025 gene locus_tag LOCUS_22530 gene wzyE 31673 33025 CDS product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055132.1 protein_id gnl|my_center|LOCUS_22530 33028 33768 gene locus_tag LOCUS_22540 gene wecG 33028 33768 CDS product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064038.1 protein_id gnl|my_center|LOCUS_22540 33959 35344 gene locus_tag LOCUS_22550 33959 35344 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774731.1 protein_id gnl|my_center|LOCUS_22550 35447 35523 gene locus_tag LOCUS_t00280 35447 35523 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 35582 35657 gene locus_tag LOCUS_t00290 35582 35657 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 35678 35764 gene locus_tag LOCUS_t00300 35678 35764 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 35807 35883 gene locus_tag LOCUS_t00310 35807 35883 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 36030 37265 gene locus_tag LOCUS_22560 36030 37265 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941553.1 protein_id gnl|my_center|LOCUS_22560 39018 37423 gene locus_tag LOCUS_22570 gene aslA 39018 37423 CDS product arylsulfatase AslA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395844.1 protein_id gnl|my_center|LOCUS_22570 40960 39764 gene locus_tag LOCUS_22580 gene hemY 40960 39764 CDS product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921791.1 protein_id gnl|my_center|LOCUS_22580 42168 40963 gene locus_tag LOCUS_22590 gene hemX 42168 40963 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139085.1 protein_id gnl|my_center|LOCUS_22590 42930 42190 gene locus_tag LOCUS_22600 gene hemD 42930 42190 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026063.1 protein_id gnl|my_center|LOCUS_22600 43889 42927 gene locus_tag LOCUS_22610 gene hemC 43889 42927 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606154.1 protein_id gnl|my_center|LOCUS_22610 44255 46801 gene locus_tag LOCUS_22620 gene cyaA 44255 46801 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281696.1 protein_id gnl|my_center|LOCUS_22620 47161 46841 gene locus_tag LOCUS_22630 gene cyaY 47161 46841 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999947.1 protein_id gnl|my_center|LOCUS_22630 47631 47834 gene locus_tag LOCUS_22640 47631 47834 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799889.1 protein_id gnl|my_center|LOCUS_22640 47871 48695 gene locus_tag LOCUS_22650 gene dapF 47871 48695 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160654.1 protein_id gnl|my_center|LOCUS_22650 48692 49399 gene locus_tag LOCUS_22660 48692 49399 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812796.1 protein_id gnl|my_center|LOCUS_22660 49396 50292 gene locus_tag LOCUS_22670 gene xerC 49396 50292 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130686.1 protein_id gnl|my_center|LOCUS_22670 50292 51008 gene locus_tag LOCUS_22680 gene yigB 50292 51008 CDS product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213584.1 protein_id gnl|my_center|LOCUS_22680 51092 53254 gene locus_tag LOCUS_22690 gene uvrD 51092 53254 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383407.1 protein_id gnl|my_center|LOCUS_22690 54211 53309 gene locus_tag LOCUS_22700 54211 53309 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751607.1 protein_id gnl|my_center|LOCUS_22700 55058 54294 gene locus_tag LOCUS_22710 55058 54294 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951184.1 protein_id gnl|my_center|LOCUS_22710 55428 56378 gene locus_tag LOCUS_22720 gene corA 55428 56378 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947159.1 protein_id gnl|my_center|LOCUS_22720 56842 56420 gene locus_tag LOCUS_22730 56842 56420 CDS product DUF943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837563.1 protein_id gnl|my_center|LOCUS_22730 57756 56908 gene locus_tag LOCUS_22740 57756 56908 CDS product DUF3289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066403.1 protein_id gnl|my_center|LOCUS_22740 57909 58085 gene locus_tag LOCUS_22750 57909 58085 CDS product CorA family divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315926.1 protein_id gnl|my_center|LOCUS_22750 58506 58126 gene locus_tag LOCUS_22760 58506 58126 CDS product DUF2628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032581.1 protein_id gnl|my_center|LOCUS_22760 59885 58995 gene locus_tag LOCUS_22770 gene rarD 59885 58995 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339104.1 protein_id gnl|my_center|LOCUS_22770 60404 59937 gene locus_tag LOCUS_22780 gene yigI 60404 59937 CDS product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277142.1 protein_id gnl|my_center|LOCUS_22780 60569 61438 gene locus_tag LOCUS_22790 gene pldA 60569 61438 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259692.1 protein_id gnl|my_center|LOCUS_22790 61557 63392 gene locus_tag LOCUS_22800 gene recQ 61557 63392 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099855.1 protein_id gnl|my_center|LOCUS_22800 63456 64076 gene locus_tag LOCUS_22810 gene rhtC 63456 64076 CDS product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928828.1 protein_id gnl|my_center|LOCUS_22810 64758 64138 gene locus_tag LOCUS_22820 gene rhtB 64758 64138 CDS product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171707.1 protein_id gnl|my_center|LOCUS_22820 64869 65891 gene locus_tag LOCUS_22830 gene pldB 64869 65891 CDS product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487654.1 protein_id gnl|my_center|LOCUS_22830 65899 66699 gene locus_tag LOCUS_22840 gene yigL 65899 66699 CDS product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285349.1 protein_id gnl|my_center|LOCUS_22840 66775 67674 gene locus_tag LOCUS_22850 gene bioP 66775 67674 CDS product biotin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196238.1 protein_id gnl|my_center|LOCUS_22850 68515 67562 gene locus_tag LOCUS_22860 gene metR 68515 67562 CDS product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573618.1 protein_id gnl|my_center|LOCUS_22860 68752 71013 gene locus_tag LOCUS_22870 gene metE 68752 71013 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153907.1 protein_id gnl|my_center|LOCUS_22870 72003 71107 gene locus_tag LOCUS_22880 72003 71107 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470719.1 protein_id gnl|my_center|LOCUS_22880 73304 72081 gene locus_tag LOCUS_22890 73304 72081 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227356.1 protein_id gnl|my_center|LOCUS_22890 73719 73330 gene locus_tag LOCUS_22900 73719 73330 CDS product glutamyl-tRNA amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214035.1 protein_id gnl|my_center|LOCUS_22900 74692 73736 gene locus_tag LOCUS_22910 gene arcC 74692 73736 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240546.1 protein_id gnl|my_center|LOCUS_22910 76109 74685 gene locus_tag LOCUS_22920 76109 74685 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093933.1 protein_id gnl|my_center|LOCUS_22920 77665 76106 gene locus_tag LOCUS_22930 gene fdrA 77665 76106 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865648.1 protein_id gnl|my_center|LOCUS_22930 78620 77760 gene locus_tag LOCUS_22940 78620 77760 CDS product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314263.1 protein_id gnl|my_center|LOCUS_22940 79294 78626 gene locus_tag LOCUS_22950 79294 78626 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194414.1 protein_id gnl|my_center|LOCUS_22950 80360 79551 gene locus_tag LOCUS_22960 80360 79551 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298606.1 protein_id gnl|my_center|LOCUS_22960 80622 81386 gene locus_tag LOCUS_22970 gene udp 80622 81386 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045178.1 protein_id gnl|my_center|LOCUS_22970 82910 81420 gene locus_tag LOCUS_22980 82910 81420 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463030.1 protein_id gnl|my_center|LOCUS_22980 83429 82923 gene locus_tag LOCUS_22990 83429 82923 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093393.1 protein_id gnl|my_center|LOCUS_22990 84420 83446 gene locus_tag LOCUS_23000 84420 83446 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589798.1 protein_id gnl|my_center|LOCUS_23000 85074 84445 gene locus_tag LOCUS_23010 85074 84445 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116472.1 protein_id gnl|my_center|LOCUS_23010 86068 85064 gene locus_tag LOCUS_23020 86068 85064 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117529.1 protein_id gnl|my_center|LOCUS_23020 86859 86092 gene locus_tag LOCUS_23030 86859 86092 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852398.1 protein_id gnl|my_center|LOCUS_23030 87076 88503 gene locus_tag LOCUS_23040 gene rmuC 87076 88503 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347714.1 protein_id gnl|my_center|LOCUS_23040 88598 89353 gene locus_tag LOCUS_23050 gene ubiE 88598 89353 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227958.1 protein_id gnl|my_center|LOCUS_23050 89367 89972 gene locus_tag LOCUS_23060 gene ubiJ 89367 89972 CDS product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295259.1 protein_id gnl|my_center|LOCUS_23060 89969 91609 gene locus_tag LOCUS_23070 gene ubiB 89969 91609 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187530.1 protein_id gnl|my_center|LOCUS_23070 91688 91957 gene locus_tag LOCUS_23080 gene tatA 91688 91957 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295260.1 protein_id gnl|my_center|LOCUS_23080 91961 92476 gene locus_tag LOCUS_23090 gene tatB 91961 92476 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459594.1 protein_id gnl|my_center|LOCUS_23090 92479 93255 gene locus_tag LOCUS_23100 gene tatC 92479 93255 CDS product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109942.1 protein_id gnl|my_center|LOCUS_23100 93297 94079 gene locus_tag LOCUS_23110 gene tatD 93297 94079 CDS product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301305.1 protein_id gnl|my_center|LOCUS_23110 94564 94076 gene locus_tag LOCUS_23120 gene rfaH 94564 94076 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192396.1 protein_id gnl|my_center|LOCUS_23120 94731 96224 gene locus_tag LOCUS_23130 gene ubiD 94731 96224 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339804.1 protein_id gnl|my_center|LOCUS_23130 96270 96971 gene locus_tag LOCUS_23140 gene fre 96270 96971 CDS product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209826.1 protein_id gnl|my_center|LOCUS_23140 98417 97254 gene locus_tag LOCUS_23150 gene fadA 98417 97254 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438700.1 protein_id gnl|my_center|LOCUS_23150 100616 98427 gene locus_tag LOCUS_23160 gene fadB 100616 98427 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965936.1 protein_id gnl|my_center|LOCUS_23160 100806 102137 gene locus_tag LOCUS_23170 gene pepQ 100806 102137 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444561.1 protein_id gnl|my_center|LOCUS_23170 102137 102751 gene locus_tag LOCUS_23180 102137 102751 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001308167.1 protein_id gnl|my_center|LOCUS_23180 102790 104241 gene locus_tag LOCUS_23190 gene trkH 102790 104241 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545677.1 protein_id gnl|my_center|LOCUS_23190 104253 104798 gene locus_tag LOCUS_23200 gene hemG 104253 104798 CDS product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853959.1 protein_id gnl|my_center|LOCUS_23200 >Feature sequence18 920 387 gene locus_tag LOCUS_23210 920 387 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092910.1 protein_id gnl|my_center|LOCUS_23210 1026 1298 gene locus_tag LOCUS_23220 1026 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 1608 1264 gene locus_tag LOCUS_23230 1608 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 1824 1958 gene locus_tag LOCUS_23240 1824 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 1969 2124 gene locus_tag LOCUS_23250 1969 2124 CDS product YdaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169151.1 protein_id gnl|my_center|LOCUS_23250 2732 2121 gene locus_tag LOCUS_23260 2732 2121 CDS product superinfection exclusion B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001312793.1 protein_id gnl|my_center|LOCUS_23260 3051 3272 gene locus_tag LOCUS_23270 gene kilR 3051 3272 CDS product killing protein KilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560223.1 protein_id gnl|my_center|LOCUS_23270 3266 3442 gene locus_tag LOCUS_23280 3266 3442 CDS product YdaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001352098.1 protein_id gnl|my_center|LOCUS_23280 3517 3792 gene locus_tag LOCUS_23290 3517 3792 CDS product protein RacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632297.1 protein_id gnl|my_center|LOCUS_23290 3894 6494 gene locus_tag LOCUS_23300 gene recE 3894 6494 CDS product exodeoxyribonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105143.1 protein_id gnl|my_center|LOCUS_23300 6487 7296 gene locus_tag LOCUS_23310 gene recT 6487 7296 CDS product recombination protein RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166319.1 protein_id gnl|my_center|LOCUS_23310 7314 7547 gene locus_tag LOCUS_23320 gene ralR 7314 7547 CDS product type I toxin-antitoxin system endodeoxyribonuclease toxin RalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317028.1 protein_id gnl|my_center|LOCUS_23320 7540 7749 gene locus_tag LOCUS_23330 gene rcbA 7540 7749 CDS product double-strand break reduction protein RcbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276809.1 protein_id gnl|my_center|LOCUS_23330 7828 8043 gene locus_tag LOCUS_23340 gene xisR 7828 8043 CDS product excisionase XisR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079604.1 protein_id gnl|my_center|LOCUS_23340 8516 9280 gene locus_tag LOCUS_23350 8516 9280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 9332 10267 gene locus_tag LOCUS_23360 gene ttcA 9332 10267 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157407.1 protein_id gnl|my_center|LOCUS_23360 11769 10396 gene locus_tag LOCUS_23370 gene dbpA 11769 10396 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123737.1 protein_id gnl|my_center|LOCUS_23370 13230 12247 gene locus_tag LOCUS_23380 gene zntB 13230 12247 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387388.1 protein_id gnl|my_center|LOCUS_23380 13485 14717 gene locus_tag LOCUS_23390 gene dgcM 13485 14717 CDS product diguanylate cyclase DgcM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628058.1 protein_id gnl|my_center|LOCUS_23390 15301 14738 gene locus_tag LOCUS_23400 gene smrA 15301 14738 CDS product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046829.1 protein_id gnl|my_center|LOCUS_23400 16539 15631 gene locus_tag LOCUS_23410 16539 15631 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885454.1 protein_id gnl|my_center|LOCUS_23410 16715 18025 gene locus_tag LOCUS_23420 gene abgA 16715 18025 CDS product p-aminobenzoyl-glutamate hydrolase subunit AbgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444929.1 protein_id gnl|my_center|LOCUS_23420 18025 19470 gene locus_tag LOCUS_23430 gene abgB 18025 19470 CDS product p-aminobenzoyl-glutamate hydrolase subunit AbgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156451.1 protein_id gnl|my_center|LOCUS_23430 19507 21033 gene locus_tag LOCUS_23440 gene abgT 19507 21033 CDS product p-aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062973.1 protein_id gnl|my_center|LOCUS_23440 21044 21559 gene locus_tag LOCUS_23450 gene ogt 21044 21559 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945011.1 protein_id gnl|my_center|LOCUS_23450 21754 22506 gene locus_tag LOCUS_23460 gene fnr 21754 22506 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611911.1 protein_id gnl|my_center|LOCUS_23460 22658 23608 gene locus_tag LOCUS_23470 gene uspE 22658 23608 CDS product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262123.1 protein_id gnl|my_center|LOCUS_23470 23915 23658 gene locus_tag LOCUS_23480 23915 23658 CDS product DUF2534 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605090.1 protein_id gnl|my_center|LOCUS_23480 24159 25190 gene locus_tag LOCUS_23490 gene ynaI 24159 25190 CDS product low conductance mechanosensitive channel YnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559900.1 protein_id gnl|my_center|LOCUS_23490 26854 25241 gene locus_tag LOCUS_23500 gene mppA 26854 25241 CDS product murein tripeptide ABC transporter substrate-binding protein MppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683020.1 protein_id gnl|my_center|LOCUS_23500 28090 27191 gene locus_tag LOCUS_23510 gene pgrR 28090 27191 CDS product DNA-binding transcriptional regulator PgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817708.1 protein_id gnl|my_center|LOCUS_23510 28228 29148 gene locus_tag LOCUS_23520 28228 29148 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300523.1 protein_id gnl|my_center|LOCUS_23520 29219 29401 gene locus_tag LOCUS_23530 gene ymjC 29219 29401 CDS product protein YmjC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800171.1 protein_id gnl|my_center|LOCUS_23530 29483 30211 gene locus_tag LOCUS_23540 gene mpaA 29483 30211 CDS product murein tripeptide amidase MpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219122.1 protein_id gnl|my_center|LOCUS_23540 31151 30186 gene locus_tag LOCUS_23550 gene ycjG 31151 30186 CDS product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261211.1 protein_id gnl|my_center|LOCUS_23550 31270 31776 gene locus_tag LOCUS_23560 gene tpx 31270 31776 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084387.1 protein_id gnl|my_center|LOCUS_23560 33361 31820 gene locus_tag LOCUS_23570 gene tyrR 33361 31820 CDS product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300658.1 protein_id gnl|my_center|LOCUS_23570 34570 33509 gene locus_tag LOCUS_23580 34570 33509 CDS product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138728.1 protein_id gnl|my_center|LOCUS_23580 35964 34567 gene locus_tag LOCUS_23590 35964 34567 CDS product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825775.1 protein_id gnl|my_center|LOCUS_23590 36120 37118 gene locus_tag LOCUS_23600 36120 37118 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075375.1 protein_id gnl|my_center|LOCUS_23600 38134 37229 gene locus_tag LOCUS_23610 gene ompG 38134 37229 CDS product monomeric porin OmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735257.1 protein_id gnl|my_center|LOCUS_23610 39261 38179 gene locus_tag LOCUS_23620 39261 38179 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057985.1 protein_id gnl|my_center|LOCUS_23620 39934 39275 gene locus_tag LOCUS_23630 gene pgmB 39934 39275 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775794.1 protein_id gnl|my_center|LOCUS_23630 42129 39931 gene locus_tag LOCUS_23640 gene ycjT 42129 39931 CDS product kojibiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198036.1 protein_id gnl|my_center|LOCUS_23640 43250 42195 gene locus_tag LOCUS_23650 43250 42195 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001395397.1 protein_id gnl|my_center|LOCUS_23650 44048 43260 gene locus_tag LOCUS_23660 44048 43260 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690229.1 protein_id gnl|my_center|LOCUS_23660 45119 44067 gene locus_tag LOCUS_23670 45119 44067 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737347.1 protein_id gnl|my_center|LOCUS_23670 45992 45150 gene locus_tag LOCUS_23680 45992 45150 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224659.1 protein_id gnl|my_center|LOCUS_23680 46860 45979 gene locus_tag LOCUS_23690 46860 45979 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080790.1 protein_id gnl|my_center|LOCUS_23690 48173 46881 gene locus_tag LOCUS_23700 48173 46881 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597466.1 protein_id gnl|my_center|LOCUS_23700 49866 48187 gene locus_tag LOCUS_23710 gene ycjM 49866 48187 CDS product glucosylglycerate phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810500.1 protein_id gnl|my_center|LOCUS_23710 50393 50079 gene locus_tag LOCUS_23720 gene pspE 50393 50079 CDS product thiosulfate sulfurtransferase PspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473109.1 protein_id gnl|my_center|LOCUS_23720 50689 50468 gene locus_tag LOCUS_23730 gene pspD 50689 50468 CDS product phage shock protein PspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295585.1 protein_id gnl|my_center|LOCUS_23730 51057 50698 gene locus_tag LOCUS_23740 gene pspC 51057 50698 CDS product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907385.1 protein_id gnl|my_center|LOCUS_23740 51281 51057 gene locus_tag LOCUS_23750 gene pspB 51281 51057 CDS product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274963.1 protein_id gnl|my_center|LOCUS_23750 52003 51335 gene locus_tag LOCUS_23760 gene pspA 52003 51335 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511025.1 protein_id gnl|my_center|LOCUS_23760 52170 53147 gene locus_tag LOCUS_23770 gene pspF 52170 53147 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301108.1 protein_id gnl|my_center|LOCUS_23770 54532 53267 gene locus_tag LOCUS_23780 gene puuE 54532 53267 CDS product 4-aminobutyrate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069229.1 protein_id gnl|my_center|LOCUS_23780 55850 54570 gene locus_tag LOCUS_23790 gene puuB 55850 54570 CDS product gamma-glutamylputrescine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134870.1 protein_id gnl|my_center|LOCUS_23790 57339 55852 gene locus_tag LOCUS_23800 gene puuC 57339 55852 CDS product aldehyde dehydrogenase PuuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009090.1 protein_id gnl|my_center|LOCUS_23800 58171 57614 gene locus_tag LOCUS_23810 gene puuR 58171 57614 CDS product HTH-type transcriptional regulator PuuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278727.1 protein_id gnl|my_center|LOCUS_23810 58950 58198 gene locus_tag LOCUS_23820 gene puuD 58950 58198 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300506.1 protein_id gnl|my_center|LOCUS_23820 59174 60592 gene locus_tag LOCUS_23830 gene puuA 59174 60592 CDS product glutamate-putrescine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296746.1 protein_id gnl|my_center|LOCUS_23830 60895 62280 gene locus_tag LOCUS_23840 gene puuP 60895 62280 CDS product putrescine/proton symporter PuuP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302119.1 protein_id gnl|my_center|LOCUS_23840 62414 62659 gene locus_tag LOCUS_23850 62414 62659 CDS product DUF2543 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015099.1 protein_id gnl|my_center|LOCUS_23850 63013 64614 gene locus_tag LOCUS_23860 gene sapA 63013 64614 CDS product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250216.1 protein_id gnl|my_center|LOCUS_23860 64611 65576 gene locus_tag LOCUS_23870 gene sapB 64611 65576 CDS product putrescine ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583277.1 protein_id gnl|my_center|LOCUS_23870 65563 66453 gene locus_tag LOCUS_23880 gene sapC 65563 66453 CDS product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146163.1 protein_id gnl|my_center|LOCUS_23880 66453 67445 gene locus_tag LOCUS_23890 gene sapD 66453 67445 CDS product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128858.1 protein_id gnl|my_center|LOCUS_23890 67447 68253 gene locus_tag LOCUS_23900 gene sapF 67447 68253 CDS product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573407.1 protein_id gnl|my_center|LOCUS_23900 68518 68354 gene locus_tag LOCUS_23910 68518 68354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 68447 68674 gene locus_tag LOCUS_23920 68447 68674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 69042 69830 gene locus_tag LOCUS_23930 gene fabI 69042 69830 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506490.1 protein_id gnl|my_center|LOCUS_23930 69974 71101 gene locus_tag LOCUS_23940 69974 71101 CDS product CMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602331.1 protein_id gnl|my_center|LOCUS_23940 71169 73103 gene locus_tag LOCUS_23950 gene rnb 71169 73103 CDS product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484984.1 protein_id gnl|my_center|LOCUS_23950 73338 75323 gene locus_tag LOCUS_23960 gene pdeR 73338 75323 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859953.1 protein_id gnl|my_center|LOCUS_23960 75470 75643 gene locus_tag LOCUS_23970 gene yciZ 75470 75643 CDS product protein YciZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288368.1 protein_id gnl|my_center|LOCUS_23970 75733 76482 gene locus_tag LOCUS_23980 75733 76482 CDS product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088621.1 protein_id gnl|my_center|LOCUS_23980 76751 76969 gene locus_tag LOCUS_23990 gene osmB 76751 76969 CDS product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498253.1 protein_id gnl|my_center|LOCUS_23990 77424 77095 gene locus_tag LOCUS_24000 gene yciH 77424 77095 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295580.1 protein_id gnl|my_center|LOCUS_24000 78158 77421 gene locus_tag LOCUS_24010 gene pyrF 78158 77421 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176278.1 protein_id gnl|my_center|LOCUS_24010 79520 78351 gene locus_tag LOCUS_24020 gene lapB 79520 78351 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891353.1 protein_id gnl|my_center|LOCUS_24020 79835 79527 gene locus_tag LOCUS_24030 gene lapA 79835 79527 CDS product lipopolysaccharide assembly protein LapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876286.1 protein_id gnl|my_center|LOCUS_24030 80748 79984 gene locus_tag LOCUS_24040 gene pgpB 80748 79984 CDS product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256538.1 protein_id gnl|my_center|LOCUS_24040 80918 81508 gene locus_tag LOCUS_24050 gene ribA 80918 81508 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176295.1 protein_id gnl|my_center|LOCUS_24050 84247 81572 gene locus_tag LOCUS_24060 gene acnA 84247 81572 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099535.1 protein_id gnl|my_center|LOCUS_24060 84787 84620 gene locus_tag LOCUS_24070 gene yciX 84787 84620 CDS product protein YciX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297116.1 protein_id gnl|my_center|LOCUS_24070 84918 84790 gene locus_tag LOCUS_24080 84918 84790 CDS product YmiA family putative membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908596.1 protein_id gnl|my_center|LOCUS_24080 86223 85249 gene locus_tag LOCUS_24090 gene cysB 86223 85249 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776253.1 protein_id gnl|my_center|LOCUS_24090 89030 86433 gene locus_tag LOCUS_24100 gene topA 89030 86433 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297122.1 protein_id gnl|my_center|LOCUS_24100 89410 89661 gene locus_tag LOCUS_24110 89410 89661 CDS product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031530.1 protein_id gnl|my_center|LOCUS_24110 90746 89697 gene locus_tag LOCUS_24120 gene sohB 90746 89697 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422045.1 protein_id gnl|my_center|LOCUS_24120 90966 91724 gene locus_tag LOCUS_24130 90966 91724 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559286.1 protein_id gnl|my_center|LOCUS_24130 91721 92311 gene locus_tag LOCUS_24140 gene cobO 91721 92311 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278906.1 protein_id gnl|my_center|LOCUS_24140 93226 92351 gene locus_tag LOCUS_24150 gene rluB 93226 92351 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291216.1 protein_id gnl|my_center|LOCUS_24150 94878 93439 gene locus_tag LOCUS_24160 94878 93439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 >Feature sequence19 120 3374 gene locus_tag LOCUS_24170 120 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 4477 3431 gene locus_tag LOCUS_24180 gene mcrC 4477 3431 CDS product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437621.1 protein_id gnl|my_center|LOCUS_24180 5856 4477 gene locus_tag LOCUS_24190 gene mcrB 5856 4477 CDS product 5-methylcytosine-specific restriction endonuclease subunit McrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443951.1 protein_id gnl|my_center|LOCUS_24190 6359 6018 gene locus_tag LOCUS_24200 gene symE 6359 6018 CDS product endoribonuclease SymE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132601.1 protein_id gnl|my_center|LOCUS_24200 8011 6587 gene locus_tag LOCUS_24210 8011 6587 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073935.1 protein_id gnl|my_center|LOCUS_24210 9597 8008 gene locus_tag LOCUS_24220 gene hsdM 9597 8008 CDS product type I restriction-modification system methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063200.1 protein_id gnl|my_center|LOCUS_24220 13310 9798 gene locus_tag LOCUS_24230 gene hsdR 13310 9798 CDS product type I restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981385.1 protein_id gnl|my_center|LOCUS_24230 13498 14412 gene locus_tag LOCUS_24240 gene mrr 13498 14412 CDS product adenine/cytosine-specific restriction endonuclease Mrr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217934.1 protein_id gnl|my_center|LOCUS_24240 15414 14458 gene locus_tag LOCUS_24250 gene yjiA 15414 14458 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297640.1 protein_id gnl|my_center|LOCUS_24250 15628 15425 gene locus_tag LOCUS_24260 15628 15425 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467859.1 protein_id gnl|my_center|LOCUS_24260 17843 15678 gene locus_tag LOCUS_24270 gene btsT 17843 15678 CDS product pyruvate/proton symporter BtsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117680.1 protein_id gnl|my_center|LOCUS_24270 18733 18221 gene locus_tag LOCUS_24280 18733 18221 CDS product 4-hydroxyphenylacetate 3-monooxygenase reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175460.1 protein_id gnl|my_center|LOCUS_24280 20313 18751 gene locus_tag LOCUS_24290 gene hpaB 20313 18751 CDS product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801481.1 protein_id gnl|my_center|LOCUS_24290 21454 20564 gene locus_tag LOCUS_24300 gene hpaA 21454 20564 CDS product 4-hydroxyphenylacetate catabolism regulatory protein HpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205639.1 protein_id gnl|my_center|LOCUS_24300 22840 21464 gene locus_tag LOCUS_24310 gene hpaX 22840 21464 CDS product 4-hydroxyphenylacetate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285769.1 protein_id gnl|my_center|LOCUS_24310 23752 22964 gene locus_tag LOCUS_24320 gene hpaI 23752 22964 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431692.1 protein_id gnl|my_center|LOCUS_24320 24566 23763 gene locus_tag LOCUS_24330 gene hpaH 24566 23763 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459750.1 protein_id gnl|my_center|LOCUS_24330 25014 24634 gene locus_tag LOCUS_24340 25014 24634 CDS product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119872.1 protein_id gnl|my_center|LOCUS_24340 25875 25024 gene locus_tag LOCUS_24350 gene hpaD 25875 25024 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516990.1 protein_id gnl|my_center|LOCUS_24350 27343 25877 gene locus_tag LOCUS_24360 gene hpaE 27343 25877 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723530.1 protein_id gnl|my_center|LOCUS_24360 28629 27340 gene locus_tag LOCUS_24370 gene hpaG 28629 27340 CDS product 4-hydroxyphenylacetate degradation bifunctional isomerase/decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679076.1 protein_id gnl|my_center|LOCUS_24370 28901 29347 gene locus_tag LOCUS_24380 gene hpaR 28901 29347 CDS product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543916.1 protein_id gnl|my_center|LOCUS_24380 29466 31121 gene locus_tag LOCUS_24390 gene tsr 29466 31121 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919536.1 protein_id gnl|my_center|LOCUS_24390 32531 31170 gene locus_tag LOCUS_24400 32531 31170 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410113.1 protein_id gnl|my_center|LOCUS_24400 33369 32746 gene locus_tag LOCUS_24410 33369 32746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24410 33659 33366 gene locus_tag LOCUS_24420 33659 33366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24420 33798 34820 gene locus_tag LOCUS_24430 gene lgoD 33798 34820 CDS product L-galactonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106030.1 protein_id gnl|my_center|LOCUS_24430 37249 34958 gene locus_tag LOCUS_24440 gene opgB 37249 34958 CDS product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292679.1 protein_id gnl|my_center|LOCUS_24440 37997 37503 gene locus_tag LOCUS_24450 gene yjjA 37997 37503 CDS product DUF2501 domain-containing protein YjjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001308243.1 protein_id gnl|my_center|LOCUS_24450 38783 38046 gene locus_tag LOCUS_24460 gene dnaC 38783 38046 CDS product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799911.1 protein_id gnl|my_center|LOCUS_24460 39325 38786 gene locus_tag LOCUS_24470 gene dnaT 39325 38786 CDS product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098818.1 protein_id gnl|my_center|LOCUS_24470 39905 39432 gene locus_tag LOCUS_24480 39905 39432 CDS product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538191.1 protein_id gnl|my_center|LOCUS_24480 40729 39896 gene locus_tag LOCUS_24490 40729 39896 CDS product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307560.1 protein_id gnl|my_center|LOCUS_24490 41285 42010 gene locus_tag LOCUS_24500 41285 42010 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936635.1 protein_id gnl|my_center|LOCUS_24500 42022 42645 gene locus_tag LOCUS_24510 gene bglJ 42022 42645 CDS product DNA-binding transcriptional activator BglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094869.1 protein_id gnl|my_center|LOCUS_24510 43471 42683 gene locus_tag LOCUS_24520 gene fhuF 43471 42683 CDS product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331618.1 protein_id gnl|my_center|LOCUS_24520 43612 43848 gene locus_tag LOCUS_24530 43612 43848 CDS product DUF1435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393508.1 protein_id gnl|my_center|LOCUS_24530 43973 43887 gene locus_tag LOCUS_t00320 43973 43887 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 44094 44008 gene locus_tag LOCUS_t00330 44094 44008 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 44209 44123 gene locus_tag LOCUS_t00340 44209 44123 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 45508 44477 gene locus_tag LOCUS_24540 gene rsmC 45508 44477 CDS product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272330.1 protein_id gnl|my_center|LOCUS_24540 45611 46024 gene locus_tag LOCUS_24550 gene holD 45611 46024 CDS product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204012.1 protein_id gnl|my_center|LOCUS_24550 45993 46439 gene locus_tag LOCUS_24560 gene rimI 45993 46439 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092461.1 protein_id gnl|my_center|LOCUS_24560 46454 47131 gene locus_tag LOCUS_24570 gene yjjG 46454 47131 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870710.1 protein_id gnl|my_center|LOCUS_24570 47222 48811 gene locus_tag LOCUS_24580 gene prfC 47222 48811 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175940.1 protein_id gnl|my_center|LOCUS_24580 49204 49809 gene locus_tag LOCUS_24590 gene osmY 49204 49809 CDS product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295748.1 protein_id gnl|my_center|LOCUS_24590 49936 50097 gene locus_tag LOCUS_24600 49936 50097 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176651.1 protein_id gnl|my_center|LOCUS_24600 50219 51292 gene locus_tag LOCUS_24610 50219 51292 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299799.1 protein_id gnl|my_center|LOCUS_24610 51289 52068 gene locus_tag LOCUS_24620 51289 52068 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000563040.1 protein_id gnl|my_center|LOCUS_24620 53063 52488 gene locus_tag LOCUS_24630 53063 52488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 54873 53323 gene locus_tag LOCUS_24640 54873 53323 CDS product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143253.1 protein_id gnl|my_center|LOCUS_24640 55131 55910 gene locus_tag LOCUS_24650 gene deoC 55131 55910 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295412.1 protein_id gnl|my_center|LOCUS_24650 56037 57359 gene locus_tag LOCUS_24660 gene deoA 56037 57359 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477811.1 protein_id gnl|my_center|LOCUS_24660 57411 58634 gene locus_tag LOCUS_24670 gene deoB 57411 58634 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816471.1 protein_id gnl|my_center|LOCUS_24670 58714 59433 gene locus_tag LOCUS_24680 gene deoD 58714 59433 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224879.1 protein_id gnl|my_center|LOCUS_24680 59857 59594 gene locus_tag LOCUS_24690 59857 59594 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566150.1 protein_id gnl|my_center|LOCUS_24690 60905 59889 gene locus_tag LOCUS_24700 gene lplA 60905 59889 CDS product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105865.1 protein_id gnl|my_center|LOCUS_24700 61577 60933 gene locus_tag LOCUS_24710 61577 60933 CDS product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124615.1 protein_id gnl|my_center|LOCUS_24710 61683 62651 gene locus_tag LOCUS_24720 gene serB 61683 62651 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132955.1 protein_id gnl|my_center|LOCUS_24720 62700 64082 gene locus_tag LOCUS_24730 gene radA 62700 64082 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029698.1 protein_id gnl|my_center|LOCUS_24730 64103 65335 gene locus_tag LOCUS_24740 gene nadR 64103 65335 CDS product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093810.1 protein_id gnl|my_center|LOCUS_24740 67309 65642 gene locus_tag LOCUS_24750 gene ettA 67309 65642 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046749.1 protein_id gnl|my_center|LOCUS_24750 67520 69457 gene locus_tag LOCUS_24760 gene sltY 67520 69457 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409451.1 protein_id gnl|my_center|LOCUS_24760 69547 69873 gene locus_tag LOCUS_24770 gene trpR 69547 69873 CDS product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068679.1 protein_id gnl|my_center|LOCUS_24770 70488 69958 gene locus_tag LOCUS_24780 gene yjjX 70488 69958 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001341279.1 protein_id gnl|my_center|LOCUS_24780 70531 71178 gene locus_tag LOCUS_24790 gene gpmB 70531 71178 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942344.1 protein_id gnl|my_center|LOCUS_24790 72044 71175 gene locus_tag LOCUS_24800 gene robA 72044 71175 CDS product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371666.1 protein_id gnl|my_center|LOCUS_24800 72255 72728 gene locus_tag LOCUS_24810 gene creA 72255 72728 CDS product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875487.1 protein_id gnl|my_center|LOCUS_24810 72741 73430 gene locus_tag LOCUS_24820 gene creB 72741 73430 CDS product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188664.1 protein_id gnl|my_center|LOCUS_24820 73430 74854 gene locus_tag LOCUS_24830 gene creC 73430 74854 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219596.1 protein_id gnl|my_center|LOCUS_24830 74912 75481 gene locus_tag LOCUS_24840 74912 75481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24840 75506 76264 gene locus_tag LOCUS_24850 75506 76264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24850 77040 76324 gene locus_tag LOCUS_24860 gene arcA 77040 76324 CDS product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194358.1 protein_id gnl|my_center|LOCUS_24860 77676 78362 gene locus_tag LOCUS_24870 77676 78362 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223164.1 protein_id gnl|my_center|LOCUS_24870 78722 81184 gene locus_tag LOCUS_24880 gene thrA 78722 81184 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264697.1 protein_id gnl|my_center|LOCUS_24880 81186 82118 gene locus_tag LOCUS_24890 gene thrB 81186 82118 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241660.1 protein_id gnl|my_center|LOCUS_24890 82119 83405 gene locus_tag LOCUS_24900 gene thrC 82119 83405 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781063.1 protein_id gnl|my_center|LOCUS_24900 83733 83918 gene locus_tag LOCUS_24910 83733 83918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 84843 84067 gene locus_tag LOCUS_24920 gene yaaA 84843 84067 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906203.1 protein_id gnl|my_center|LOCUS_24920 86343 84913 gene locus_tag LOCUS_24930 86343 84913 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112597.1 protein_id gnl|my_center|LOCUS_24930 86622 87575 gene locus_tag LOCUS_24940 gene tal 86622 87575 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130189.1 protein_id gnl|my_center|LOCUS_24940 87690 88277 gene locus_tag LOCUS_24950 gene mog 87690 88277 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094682.1 protein_id gnl|my_center|LOCUS_24950 88878 88312 gene locus_tag LOCUS_24960 gene satP 88878 88312 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528538.1 protein_id gnl|my_center|LOCUS_24960 89740 89027 gene locus_tag LOCUS_24970 gene msyB 89740 89027 CDS product acidic protein MsyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102379.1 protein_id gnl|my_center|LOCUS_24970 90170 89766 gene locus_tag LOCUS_24980 90170 89766 CDS product DUF2541 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843568.1 protein_id gnl|my_center|LOCUS_24980 90547 92463 gene locus_tag LOCUS_24990 gene dnaK 90547 92463 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516135.1 protein_id gnl|my_center|LOCUS_24990 92552 93682 gene locus_tag LOCUS_25000 gene dnaJ 92552 93682 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118464.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence20 210 662 gene locus_tag LOCUS_25010 gene gatA 210 662 CDS product PTS galactitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182899.1 protein_id gnl|my_center|LOCUS_25010 693 977 gene locus_tag LOCUS_25020 gene gatB 693 977 CDS product PTS galactitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823270.1 protein_id gnl|my_center|LOCUS_25020 981 2336 gene locus_tag LOCUS_25030 981 2336 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490679.1 protein_id gnl|my_center|LOCUS_25030 2384 3424 gene locus_tag LOCUS_25040 gene gatD 2384 3424 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844219.1 protein_id gnl|my_center|LOCUS_25040 3530 4303 gene locus_tag LOCUS_25050 3530 4303 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295426.1 protein_id gnl|my_center|LOCUS_25050 5284 4385 gene locus_tag LOCUS_25060 gene yegS 5284 4385 CDS product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807362.1 protein_id gnl|my_center|LOCUS_25060 5629 6006 gene locus_tag LOCUS_25070 5629 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130399.1 protein_id gnl|my_center|LOCUS_25070 7285 6272 gene locus_tag LOCUS_25080 7285 6272 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815648.1 protein_id gnl|my_center|LOCUS_25080 7700 7401 gene locus_tag LOCUS_25090 7700 7401 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815649.1 protein_id gnl|my_center|LOCUS_25090 7822 8097 gene locus_tag LOCUS_25100 7822 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 8108 8278 gene locus_tag LOCUS_25110 8108 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 8275 8775 gene locus_tag LOCUS_25120 8275 8775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 8839 9063 gene locus_tag LOCUS_25130 8839 9063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 9063 9362 gene locus_tag LOCUS_25140 9063 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 9365 9589 gene locus_tag LOCUS_25150 9365 9589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 9586 9861 gene locus_tag LOCUS_25160 9586 9861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 9851 12133 gene locus_tag LOCUS_25170 9851 12133 CDS product replication endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816116.1 protein_id gnl|my_center|LOCUS_25170 12228 13445 gene locus_tag LOCUS_25180 12228 13445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 13432 13584 gene locus_tag LOCUS_25190 13432 13584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 13581 13946 gene locus_tag LOCUS_25200 13581 13946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 13946 15913 gene locus_tag LOCUS_25210 13946 15913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 16960 16229 gene locus_tag LOCUS_25220 16960 16229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 17006 17143 gene locus_tag LOCUS_25230 17006 17143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 18000 17215 gene locus_tag LOCUS_25240 18000 17215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 18084 18719 gene locus_tag LOCUS_25250 18084 18719 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048619997.1 protein_id gnl|my_center|LOCUS_25250 18716 19063 gene locus_tag LOCUS_25260 18716 19063 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098787.1 protein_id gnl|my_center|LOCUS_25260 19068 19976 gene locus_tag LOCUS_25270 19068 19976 CDS product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816096.1 protein_id gnl|my_center|LOCUS_25270 19969 20499 gene locus_tag LOCUS_25280 19969 20499 CDS product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816095.1 protein_id gnl|my_center|LOCUS_25280 20510 23368 gene locus_tag LOCUS_25290 20510 23368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 24692 23580 gene locus_tag LOCUS_25300 24692 23580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 24885 24670 gene locus_tag LOCUS_25310 24885 24670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 25928 27118 gene locus_tag LOCUS_25320 25928 27118 CDS product phage tail sheath protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046120.1 protein_id gnl|my_center|LOCUS_25320 27131 27910 gene locus_tag LOCUS_25330 27131 27910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 29844 28483 gene locus_tag LOCUS_25340 gene yegQ 29844 28483 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476014.1 protein_id gnl|my_center|LOCUS_25340 30322 29990 gene locus_tag LOCUS_25350 30322 29990 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929408.1 protein_id gnl|my_center|LOCUS_25350 31235 30513 gene locus_tag LOCUS_25360 gene baeR 31235 30513 CDS product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137877.1 protein_id gnl|my_center|LOCUS_25360 32635 31232 gene locus_tag LOCUS_25370 gene baeS 32635 31232 CDS product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675150.1 protein_id gnl|my_center|LOCUS_25370 34047 32632 gene locus_tag LOCUS_25380 34047 32632 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130850.1 protein_id gnl|my_center|LOCUS_25380 37125 34048 gene locus_tag LOCUS_25390 gene mdtC 37125 34048 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667481.1 protein_id gnl|my_center|LOCUS_25390 40248 37126 gene locus_tag LOCUS_25400 gene mdtB 40248 37126 CDS product multidrug efflux RND transporter permease subunit MdtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197875.1 protein_id gnl|my_center|LOCUS_25400 41495 40248 gene locus_tag LOCUS_25410 gene mdtA 41495 40248 CDS product multidrug efflux RND transporter subunit MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678969.1 protein_id gnl|my_center|LOCUS_25410 43040 43699 gene locus_tag LOCUS_25420 43040 43699 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003151.1 protein_id gnl|my_center|LOCUS_25420 43777 44457 gene locus_tag LOCUS_25430 43777 44457 CDS product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119071.1 protein_id gnl|my_center|LOCUS_25430 44454 46394 gene locus_tag LOCUS_25440 gene yegI 44454 46394 CDS product protein kinase YegI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640171.1 protein_id gnl|my_center|LOCUS_25440 47759 46407 gene locus_tag LOCUS_25450 gene yegD 47759 46407 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469740.1 protein_id gnl|my_center|LOCUS_25450 47893 48741 gene locus_tag LOCUS_25460 gene alkA 47893 48741 CDS product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275665.1 protein_id gnl|my_center|LOCUS_25460 52147 48842 gene locus_tag LOCUS_25470 52147 48842 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043761.1 protein_id gnl|my_center|LOCUS_25470 52465 53106 gene locus_tag LOCUS_25480 gene udk 52465 53106 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295424.1 protein_id gnl|my_center|LOCUS_25480 53198 53779 gene locus_tag LOCUS_25490 gene dcd 53198 53779 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234777.1 protein_id gnl|my_center|LOCUS_25490 53801 55654 gene locus_tag LOCUS_25500 gene asmA 53801 55654 CDS product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252360.1 protein_id gnl|my_center|LOCUS_25500 57511 55928 gene locus_tag LOCUS_25510 57511 55928 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300971.1 protein_id gnl|my_center|LOCUS_25510 58263 59309 gene locus_tag LOCUS_25520 gene wza 58263 59309 CDS product polysaccharide export protein Wza inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978094.1 protein_id gnl|my_center|LOCUS_25520 59315 59758 gene locus_tag LOCUS_25530 gene wzb 59315 59758 CDS product low molecular weight protein-tyrosine-phosphatase Wzb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482901.1 protein_id gnl|my_center|LOCUS_25530 59761 61923 gene locus_tag LOCUS_25540 gene wzc 59761 61923 CDS product tyrosine-protein kinase Wzc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137113.1 protein_id gnl|my_center|LOCUS_25540 62016 62855 gene locus_tag LOCUS_25550 gene wcaA 62016 62855 CDS product colanic acid biosynthesis glycosyltransferase WcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654503.1 protein_id gnl|my_center|LOCUS_25550 62858 63346 gene locus_tag LOCUS_25560 gene wcaB 62858 63346 CDS product colanic acid biosynthesis acetyltransferase WcaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888740.1 protein_id gnl|my_center|LOCUS_25560 63343 64560 gene locus_tag LOCUS_25570 gene wcaC 63343 64560 CDS product colanic acid biosynthesis glycosyltransferase WcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023915.1 protein_id gnl|my_center|LOCUS_25570 64535 65752 gene locus_tag LOCUS_25580 gene wcaD 64535 65752 CDS product colanic acid polymerase WcaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107816.1 protein_id gnl|my_center|LOCUS_25580 65763 66509 gene locus_tag LOCUS_25590 gene wcaE 65763 66509 CDS product colanic acid biosynthesis glycosyltransferase WcaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927066.1 protein_id gnl|my_center|LOCUS_25590 66525 67073 gene locus_tag LOCUS_25600 gene wcaF 66525 67073 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153547.1 protein_id gnl|my_center|LOCUS_25600 67100 68221 gene locus_tag LOCUS_25610 gene gmd 67100 68221 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048190.1 protein_id gnl|my_center|LOCUS_25610 68224 69189 gene locus_tag LOCUS_25620 gene fcl 68224 69189 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043654.1 protein_id gnl|my_center|LOCUS_25620 69192 69671 gene locus_tag LOCUS_25630 gene gmm 69192 69671 CDS product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309580.1 protein_id gnl|my_center|LOCUS_25630 69668 70891 gene locus_tag LOCUS_25640 gene wcaI 69668 70891 CDS product colanic acid biosynthesis fucosyltransferase WcaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699727.1 protein_id gnl|my_center|LOCUS_25640 70894 72330 gene locus_tag LOCUS_25650 gene cpsB 70894 72330 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079285.1 protein_id gnl|my_center|LOCUS_25650 72523 73893 gene locus_tag LOCUS_25660 gene cpsG 72523 73893 CDS product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350528.1 protein_id gnl|my_center|LOCUS_25660 73948 75342 gene locus_tag LOCUS_25670 gene wcaJ 73948 75342 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183124.1 protein_id gnl|my_center|LOCUS_25670 75344 76822 gene locus_tag LOCUS_25680 gene wzxC 75344 76822 CDS product colanic acid undecaprenyl disphosphate flippase WzxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058490.1 protein_id gnl|my_center|LOCUS_25680 76984 78264 gene locus_tag LOCUS_25690 gene wcaK 76984 78264 CDS product colanic acid biosynthesis pyruvyl transferase WcaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602263.1 protein_id gnl|my_center|LOCUS_25690 78261 79481 gene locus_tag LOCUS_25700 gene wcaL 78261 79481 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862652.1 protein_id gnl|my_center|LOCUS_25700 79492 80886 gene locus_tag LOCUS_25710 gene wcaM 79492 80886 CDS product colanic acid biosynthesis protein WcaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116062.1 protein_id gnl|my_center|LOCUS_25710 81061 81954 gene locus_tag LOCUS_25720 gene galF 81061 81954 CDS product UTP--glucose-1-phosphate uridylyltransferase GalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183060.1 protein_id gnl|my_center|LOCUS_25720 82258 83412 gene locus_tag LOCUS_25730 gene rfbB 82258 83412 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699450.1 protein_id gnl|my_center|LOCUS_25730 83412 84311 gene locus_tag LOCUS_25740 gene rfbD 83412 84311 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023616.1 protein_id gnl|my_center|LOCUS_25740 84370 85248 gene locus_tag LOCUS_25750 gene rfbA 84370 85248 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 protein_id gnl|my_center|LOCUS_25750 85253 85798 gene locus_tag LOCUS_25760 gene rfbC 85253 85798 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100801.1 protein_id gnl|my_center|LOCUS_25760 85802 87226 gene locus_tag LOCUS_25770 gene wzx 85802 87226 CDS product O7 family O-antigen flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060533.1 protein_id gnl|my_center|LOCUS_25770 87236 88348 gene locus_tag LOCUS_25780 gene vioA 87236 88348 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998544.1 protein_id gnl|my_center|LOCUS_25780 88350 88928 gene locus_tag LOCUS_25790 gene vioB 88350 88928 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose acetyltransferase VioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323726.1 protein_id gnl|my_center|LOCUS_25790 88925 89671 gene locus_tag LOCUS_25800 88925 89671 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690820.1 protein_id gnl|my_center|LOCUS_25800 89671 90492 gene locus_tag LOCUS_25810 89671 90492 CDS product sugar polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340445.1 protein_id gnl|my_center|LOCUS_25810 90489 91664 gene locus_tag LOCUS_25820 gene wzy 90489 91664 CDS product O7 family O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230642.1 protein_id gnl|my_center|LOCUS_25820 91661 92773 gene locus_tag LOCUS_25830 91661 92773 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161786.1 protein_id gnl|my_center|LOCUS_25830 92763 93530 gene locus_tag LOCUS_25840 gene wbbD 92763 93530 CDS product UDP-Gal:alpha-D-GlcNAc-diphosphoundecaprenol beta-1,3-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278665.1 protein_id gnl|my_center|LOCUS_25840 >Feature sequence21 85 858 gene locus_tag LOCUS_25850 85 858 CDS product YaiO family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000596085.1 protein_id gnl|my_center|LOCUS_25850 1044 1319 gene locus_tag LOCUS_25860 gene frmR 1044 1319 CDS product formaldehyde-responsive transcriptional repressor FrmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141271.1 protein_id gnl|my_center|LOCUS_25860 1354 2463 gene locus_tag LOCUS_25870 gene frmA 1354 2463 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842102.1 protein_id gnl|my_center|LOCUS_25870 2556 3389 gene locus_tag LOCUS_25880 gene fghA 2556 3389 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000419081.1 protein_id gnl|my_center|LOCUS_25880 4154 3615 gene locus_tag LOCUS_25890 4154 3615 CDS product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096705.1 protein_id gnl|my_center|LOCUS_25890 5467 4256 gene locus_tag LOCUS_25900 5467 4256 CDS product 3-(3-hydroxy-phenyl)propionate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107627.1 protein_id gnl|my_center|LOCUS_25900 6858 5845 gene locus_tag LOCUS_25910 gene dmpG 6858 5845 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013510.1 protein_id gnl|my_center|LOCUS_25910 7805 6855 gene locus_tag LOCUS_25920 gene mhpF 7805 6855 CDS product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044314.1 protein_id gnl|my_center|LOCUS_25920 8611 7802 gene locus_tag LOCUS_25930 gene mhpD 8611 7802 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160710.1 protein_id gnl|my_center|LOCUS_25930 9487 8621 gene locus_tag LOCUS_25940 gene mhpC 9487 8621 CDS product 2-hydroxy-6-oxonona-2,4-dienedioate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121898.1 protein_id gnl|my_center|LOCUS_25940 10449 9505 gene locus_tag LOCUS_25950 gene mhpB 10449 9505 CDS product 3-carboxyethylcatechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543457.1 protein_id gnl|my_center|LOCUS_25950 12115 10451 gene locus_tag LOCUS_25960 12115 10451 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007409.1 protein_id gnl|my_center|LOCUS_25960 12306 13139 gene locus_tag LOCUS_25970 12306 13139 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301325.1 protein_id gnl|my_center|LOCUS_25970 13207 14298 gene locus_tag LOCUS_25980 gene lacI 13207 14298 CDS product DNA-binding transcriptional repressor LacI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307621.1 protein_id gnl|my_center|LOCUS_25980 14421 17495 gene locus_tag LOCUS_25990 gene lacZ 14421 17495 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177906.1 protein_id gnl|my_center|LOCUS_25990 17547 18800 gene locus_tag LOCUS_26000 gene lacY 17547 18800 CDS product lactose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291549.1 protein_id gnl|my_center|LOCUS_26000 18857 19477 gene locus_tag LOCUS_26010 gene lacA 18857 19477 CDS product galactoside O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335915.1 protein_id gnl|my_center|LOCUS_26010 20734 19580 gene locus_tag LOCUS_26020 gene cynX 20734 19580 CDS product cyanate transporter CynX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927953.1 protein_id gnl|my_center|LOCUS_26020 21237 20767 gene locus_tag LOCUS_26030 gene cynS 21237 20767 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616243.1 protein_id gnl|my_center|LOCUS_26030 21927 21268 gene locus_tag LOCUS_26040 gene cynT 21927 21268 CDS product carbonic anhydrase CynT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658652.1 protein_id gnl|my_center|LOCUS_26040 22036 22935 gene locus_tag LOCUS_26050 gene cynR 22036 22935 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952503.1 protein_id gnl|my_center|LOCUS_26050 24555 23272 gene locus_tag LOCUS_26060 gene codA 24555 23272 CDS product cytosine/isoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301240.1 protein_id gnl|my_center|LOCUS_26060 25804 24545 gene locus_tag LOCUS_26070 gene codB 25804 24545 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076233.1 protein_id gnl|my_center|LOCUS_26070 27926 26040 gene locus_tag LOCUS_26080 gene prpE 27926 26040 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010288.1 protein_id gnl|my_center|LOCUS_26080 29417 27966 gene locus_tag LOCUS_26090 gene prpD 29417 27966 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275859.1 protein_id gnl|my_center|LOCUS_26090 30620 29451 gene locus_tag LOCUS_26100 gene prpC 30620 29451 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285908.1 protein_id gnl|my_center|LOCUS_26100 31857 30967 gene locus_tag LOCUS_26110 gene prpB 31857 30967 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052206.1 protein_id gnl|my_center|LOCUS_26110 32096 33682 gene locus_tag LOCUS_26120 gene prpR 32096 33682 CDS product propionate catabolism operon regulatory protein PrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941052.1 protein_id gnl|my_center|LOCUS_26120 34055 33780 gene locus_tag LOCUS_26130 gene yahO 34055 33780 CDS product DUF1471 family periplasmic protein YahO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691956.1 protein_id gnl|my_center|LOCUS_26130 34241 34873 gene locus_tag LOCUS_26140 34241 34873 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976975.1 protein_id gnl|my_center|LOCUS_26140 35205 35125 gene locus_tag LOCUS_t00350 35205 35125 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 36363 35548 gene locus_tag LOCUS_26150 gene yahL 36363 35548 CDS product protein YahL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301260.1 protein_id gnl|my_center|LOCUS_26150 37656 36607 gene locus_tag LOCUS_26160 gene yahK 37656 36607 CDS product NADPH-dependent aldehyde reductase YahK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692754.1 protein_id gnl|my_center|LOCUS_26160 39415 38033 gene locus_tag LOCUS_26170 39415 38033 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665120.1 protein_id gnl|my_center|LOCUS_26170 40375 39425 gene locus_tag LOCUS_26180 40375 39425 CDS product carbamate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661672.1 protein_id gnl|my_center|LOCUS_26180 40626 40771 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42217 40799 gene locus_tag LOCUS_26190 42217 40799 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083455.1 protein_id gnl|my_center|LOCUS_26190 43764 42217 gene locus_tag LOCUS_26200 gene fdrA 43764 42217 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111784.1 protein_id gnl|my_center|LOCUS_26200 44617 43754 gene locus_tag LOCUS_26210 44617 43754 CDS product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001316891.1 protein_id gnl|my_center|LOCUS_26210 45262 44657 gene locus_tag LOCUS_26220 45262 44657 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023635.1 protein_id gnl|my_center|LOCUS_26220 45520 46017 gene locus_tag LOCUS_26230 45520 46017 CDS product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013880.1 protein_id gnl|my_center|LOCUS_26230 46109 47041 gene locus_tag LOCUS_26240 46109 47041 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084394.1 protein_id gnl|my_center|LOCUS_26240 48171 47083 gene locus_tag LOCUS_26250 gene pdeL 48171 47083 CDS product DNA-binding transcriptional activator/c-di-GMP phosphodiesterase PdeL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301264.1 protein_id gnl|my_center|LOCUS_26250 48491 48676 gene locus_tag LOCUS_26260 48491 48676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001328114.1 protein_id gnl|my_center|LOCUS_26260 51034 49046 gene locus_tag LOCUS_26270 gene betT 51034 49046 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131044.1 protein_id gnl|my_center|LOCUS_26270 51208 51795 gene locus_tag LOCUS_26280 gene betI 51208 51795 CDS product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301903.1 protein_id gnl|my_center|LOCUS_26280 51809 53281 gene locus_tag LOCUS_26290 gene betB 51809 53281 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089077.1 protein_id gnl|my_center|LOCUS_26290 53295 54965 gene locus_tag LOCUS_26300 gene betA 53295 54965 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159094.1 protein_id gnl|my_center|LOCUS_26300 55178 55846 gene locus_tag LOCUS_26310 gene ykgH 55178 55846 CDS product protein YkgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209100.1 protein_id gnl|my_center|LOCUS_26310 56784 56089 gene locus_tag LOCUS_26320 56784 56089 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370307.1 protein_id gnl|my_center|LOCUS_26320 58204 56777 gene locus_tag LOCUS_26330 58204 56777 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023927.1 protein_id gnl|my_center|LOCUS_26330 58934 58215 gene locus_tag LOCUS_26340 58934 58215 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102108.1 protein_id gnl|my_center|LOCUS_26340 60315 59461 gene locus_tag LOCUS_26350 gene rclR 60315 59461 CDS product reactive chlorine-specific transcriptional regulator RclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339594.1 protein_id gnl|my_center|LOCUS_26350 60541 61866 gene locus_tag LOCUS_26360 gene rclA 60541 61866 CDS product reactive chlorine resistance oxidoreductase RclA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046307.1 protein_id gnl|my_center|LOCUS_26360 61975 62211 gene locus_tag LOCUS_26370 gene rclB 61975 62211 CDS product reactive chlorine resistance periplasmic protein RclB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000474077.1 protein_id gnl|my_center|LOCUS_26370 62223 62816 gene locus_tag LOCUS_26380 gene rclC 62223 62816 CDS product reactive chlorine species resistance protein RclC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299021.1 protein_id gnl|my_center|LOCUS_26380 63407 64258 gene locus_tag LOCUS_26390 63407 64258 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306920.1 protein_id gnl|my_center|LOCUS_26390 68654 64398 gene locus_tag LOCUS_26400 gene fdeC 68654 64398 CDS product inverse autotransporter adhesin FdeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092539.1 protein_id gnl|my_center|LOCUS_26400 70231 70497 gene locus_tag LOCUS_26410 70231 70497 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803998.1 protein_id gnl|my_center|LOCUS_26410 70497 70637 gene locus_tag LOCUS_26420 gene ykgO 70497 70637 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866436.1 protein_id gnl|my_center|LOCUS_26420 70839 70672 gene locus_tag LOCUS_26430 70839 70672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 71722 72264 gene locus_tag LOCUS_26440 gene ecpR 71722 72264 CDS product ECP biosynthesis operon DNA-binding transcriptional regulator EcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220247.1 protein_id gnl|my_center|LOCUS_26440 72290 72925 gene locus_tag LOCUS_26450 gene ecpA 72290 72925 CDS product common pilus major fimbrillin subunit EcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730972.1 protein_id gnl|my_center|LOCUS_26450 72983 73651 gene locus_tag LOCUS_26460 gene ecpB 72983 73651 CDS product fimbrial chaperone EcpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716398.1 protein_id gnl|my_center|LOCUS_26460 73677 76202 gene locus_tag LOCUS_26470 gene ecpC 73677 76202 CDS product fimbrial usher EcpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131063.1 protein_id gnl|my_center|LOCUS_26470 76192 77835 gene locus_tag LOCUS_26480 gene ecpD 76192 77835 CDS product fimbrial adhesin EcpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310578.1 protein_id gnl|my_center|LOCUS_26480 77804 78514 gene locus_tag LOCUS_26490 gene ecpE 77804 78514 CDS product fimbrial chaperone EcpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305432.1 protein_id gnl|my_center|LOCUS_26490 79398 79186 gene locus_tag LOCUS_26500 79398 79186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 80017 79403 gene locus_tag LOCUS_26510 80017 79403 CDS product YagU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019920.1 protein_id gnl|my_center|LOCUS_26510 80434 81123 gene locus_tag LOCUS_26520 gene paoA 80434 81123 CDS product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070694.1 protein_id gnl|my_center|LOCUS_26520 81120 82076 gene locus_tag LOCUS_26530 gene paoB 81120 82076 CDS product aldehyde oxidoreductase FAD-binding subunit PaoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643333.1 protein_id gnl|my_center|LOCUS_26530 82073 84271 gene locus_tag LOCUS_26540 gene paoC 82073 84271 CDS product aldehyde oxidoreductase molybdenum-binding subunit PaoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667043.1 protein_id gnl|my_center|LOCUS_26540 84281 85237 gene locus_tag LOCUS_26550 gene paoD 84281 85237 CDS product molybdenum cofactor insertion chaperone PaoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121321.1 protein_id gnl|my_center|LOCUS_26550 85216 85626 gene locus_tag LOCUS_26560 85216 85626 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111342.1 protein_id gnl|my_center|LOCUS_26560 85828 85753 gene locus_tag LOCUS_t00360 85828 85753 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 87196 85943 gene locus_tag LOCUS_26570 gene proA 87196 85943 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893267.1 protein_id gnl|my_center|LOCUS_26570 88311 87208 gene locus_tag LOCUS_26580 gene proB 88311 87208 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285288.1 protein_id gnl|my_center|LOCUS_26580 88599 89636 gene locus_tag LOCUS_26590 gene phoE 88599 89636 CDS product phosphoporin PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749881.1 protein_id gnl|my_center|LOCUS_26590 >Feature sequence22 96 9 gene locus_tag LOCUS_t00370 96 9 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 331 1269 gene locus_tag LOCUS_26600 gene ghrA 331 1269 CDS product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351317.1 protein_id gnl|my_center|LOCUS_26600 1324 2061 gene locus_tag LOCUS_26610 gene ycdX 1324 2061 CDS product zinc-binding phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283664.1 protein_id gnl|my_center|LOCUS_26610 2085 2639 gene locus_tag LOCUS_26620 gene ycdY 2085 2639 CDS product molecular chaperone YcdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001902.1 protein_id gnl|my_center|LOCUS_26620 2711 3232 gene locus_tag LOCUS_26630 2711 3232 CDS product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307110.1 protein_id gnl|my_center|LOCUS_26630 4129 3296 gene locus_tag LOCUS_26640 gene csgG 4129 3296 CDS product curli production assembly/transport protein CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189321.1 protein_id gnl|my_center|LOCUS_26640 4572 4156 gene locus_tag LOCUS_26650 gene csgF 4572 4156 CDS product curli production assembly/transport protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264088.1 protein_id gnl|my_center|LOCUS_26650 4986 4597 gene locus_tag LOCUS_26660 gene csgE 4986 4597 CDS product curli production assembly/transport protein CsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833288.1 protein_id gnl|my_center|LOCUS_26660 5641 4991 gene locus_tag LOCUS_26670 gene csgD 5641 4991 CDS product biofilm master transcriptional regulator CsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481500.1 protein_id gnl|my_center|LOCUS_26670 6369 6851 gene locus_tag LOCUS_26680 gene csgB 6369 6851 CDS product curli minor subunit CsgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791650.1 protein_id gnl|my_center|LOCUS_26680 6892 7347 gene locus_tag LOCUS_26690 gene csgA 6892 7347 CDS product curli major subunit CsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771437.1 protein_id gnl|my_center|LOCUS_26690 7406 7738 gene locus_tag LOCUS_26700 gene csgC 7406 7738 CDS product curli assembly chaperone CsgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094300.1 protein_id gnl|my_center|LOCUS_26700 7859 8170 gene locus_tag LOCUS_26710 gene ymdA 7859 8170 CDS product protein YmdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489587.1 protein_id gnl|my_center|LOCUS_26710 8265 8798 gene locus_tag LOCUS_26720 gene ymdB 8265 8798 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857405.1 protein_id gnl|my_center|LOCUS_26720 8800 10221 gene locus_tag LOCUS_26730 gene clsC 8800 10221 CDS product cardiolipin synthase ClsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299031.1 protein_id gnl|my_center|LOCUS_26730 11386 10229 gene locus_tag LOCUS_26740 gene mdoC 11386 10229 CDS product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070375.1 protein_id gnl|my_center|LOCUS_26740 11762 13315 gene locus_tag LOCUS_26750 gene mdoG 11762 13315 CDS product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001343212.1 protein_id gnl|my_center|LOCUS_26750 13308 15851 gene locus_tag LOCUS_26760 gene mdoH 13308 15851 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295445.1 protein_id gnl|my_center|LOCUS_26760 16024 16251 gene locus_tag LOCUS_26770 16024 16251 CDS product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237205.1 protein_id gnl|my_center|LOCUS_26770 16626 16252 gene locus_tag LOCUS_26780 16626 16252 CDS product acidic protein MsyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180056.1 protein_id gnl|my_center|LOCUS_26780 17935 16709 gene locus_tag LOCUS_26790 gene mdtG 17935 16709 CDS product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074172.1 protein_id gnl|my_center|LOCUS_26790 19027 18107 gene locus_tag LOCUS_26800 gene lpxL 19027 18107 CDS product kdo(2)-lipid IV(A) lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183364.1 protein_id gnl|my_center|LOCUS_26800 19252 20304 gene locus_tag LOCUS_26810 19252 20304 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144615.1 protein_id gnl|my_center|LOCUS_26810 20921 20346 gene locus_tag LOCUS_26820 20921 20346 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749261.1 protein_id gnl|my_center|LOCUS_26820 21491 20925 gene locus_tag LOCUS_26830 21491 20925 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011114.1 protein_id gnl|my_center|LOCUS_26830 23031 21913 gene locus_tag LOCUS_26840 gene solA 23031 21913 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872833.1 protein_id gnl|my_center|LOCUS_26840 23400 23146 gene locus_tag LOCUS_26850 gene bssS 23400 23146 CDS product biofilm formation regulator BssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414437.1 protein_id gnl|my_center|LOCUS_26850 23935 23690 gene locus_tag LOCUS_26860 gene dinI 23935 23690 CDS product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217754.1 protein_id gnl|my_center|LOCUS_26860 24929 24009 gene locus_tag LOCUS_26870 gene pyrC 24929 24009 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126540.1 protein_id gnl|my_center|LOCUS_26870 25721 25161 gene locus_tag LOCUS_26880 25721 25161 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295443.1 protein_id gnl|my_center|LOCUS_26880 26502 25855 gene locus_tag LOCUS_26890 gene grxB 26502 25855 CDS product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780912.1 protein_id gnl|my_center|LOCUS_26890 27774 26566 gene locus_tag LOCUS_26900 gene mdtH 27774 26566 CDS product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092206.1 protein_id gnl|my_center|LOCUS_26900 28010 28594 gene locus_tag LOCUS_26910 gene rimJ 28010 28594 CDS product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468186.1 protein_id gnl|my_center|LOCUS_26910 28605 29252 gene locus_tag LOCUS_26920 28605 29252 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877107.1 protein_id gnl|my_center|LOCUS_26920 29254 30177 gene locus_tag LOCUS_26930 29254 30177 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736158.1 protein_id gnl|my_center|LOCUS_26930 30287 31822 gene locus_tag LOCUS_26940 gene murJ 30287 31822 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050683.1 protein_id gnl|my_center|LOCUS_26940 32278 31862 gene locus_tag LOCUS_26950 gene flgN 32278 31862 CDS product flagella biosynthesis chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197363.1 protein_id gnl|my_center|LOCUS_26950 32576 32283 gene locus_tag LOCUS_26960 gene flgM 32576 32283 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020880.1 protein_id gnl|my_center|LOCUS_26960 33311 32652 gene locus_tag LOCUS_26970 gene flgA 33311 32652 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905458.1 protein_id gnl|my_center|LOCUS_26970 33466 33882 gene locus_tag LOCUS_26980 gene flgB 33466 33882 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884702.1 protein_id gnl|my_center|LOCUS_26980 33886 34290 gene locus_tag LOCUS_26990 gene flgC 33886 34290 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196460.1 protein_id gnl|my_center|LOCUS_26990 34302 34997 gene locus_tag LOCUS_27000 gene flgD 34302 34997 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020486.1 protein_id gnl|my_center|LOCUS_27000 35022 36227 gene locus_tag LOCUS_27010 gene flgE 35022 36227 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885878.1 protein_id gnl|my_center|LOCUS_27010 36247 37002 gene locus_tag LOCUS_27020 gene flgF 36247 37002 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349316.1 protein_id gnl|my_center|LOCUS_27020 37174 37956 gene locus_tag LOCUS_27030 gene flgG 37174 37956 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625837.1 protein_id gnl|my_center|LOCUS_27030 38009 38707 gene locus_tag LOCUS_27040 gene flgH 38009 38707 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295442.1 protein_id gnl|my_center|LOCUS_27040 38716 39816 gene locus_tag LOCUS_27050 gene flgI 38716 39816 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589326.1 protein_id gnl|my_center|LOCUS_27050 39816 40757 gene locus_tag LOCUS_27060 gene flgJ 39816 40757 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295441.1 protein_id gnl|my_center|LOCUS_27060 40823 42466 gene locus_tag LOCUS_27070 gene flgK 40823 42466 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096479.1 protein_id gnl|my_center|LOCUS_27070 42478 43431 gene locus_tag LOCUS_27080 gene flgL 42478 43431 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212764.1 protein_id gnl|my_center|LOCUS_27080 46812 43627 gene locus_tag LOCUS_27090 gene rne 46812 43627 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827370.1 protein_id gnl|my_center|LOCUS_27090 47385 48344 gene locus_tag LOCUS_27100 gene rluC 47385 48344 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846343.1 protein_id gnl|my_center|LOCUS_27100 49079 48456 gene locus_tag LOCUS_27110 gene yceF 49079 48456 CDS product 7-methyl-GTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974786.1 protein_id gnl|my_center|LOCUS_27110 49239 49760 gene locus_tag LOCUS_27120 gene yceD 49239 49760 CDS product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174481.1 protein_id gnl|my_center|LOCUS_27120 49812 49985 gene locus_tag LOCUS_27130 gene rpmF 49812 49985 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290727.1 protein_id gnl|my_center|LOCUS_27130 50066 51136 gene locus_tag LOCUS_27140 gene plsX 50066 51136 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197578.1 protein_id gnl|my_center|LOCUS_27140 51204 52157 gene locus_tag LOCUS_27150 gene fabH 51204 52157 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288132.1 protein_id gnl|my_center|LOCUS_27150 52173 53102 gene locus_tag LOCUS_27160 gene fabD 52173 53102 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191372.1 protein_id gnl|my_center|LOCUS_27160 53115 53849 gene locus_tag LOCUS_27170 gene fabG 53115 53849 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008535.1 protein_id gnl|my_center|LOCUS_27170 54060 54296 gene locus_tag LOCUS_27180 gene acpP 54060 54296 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103754.1 protein_id gnl|my_center|LOCUS_27180 54384 55625 gene locus_tag LOCUS_27190 gene fabF 54384 55625 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044679.1 protein_id gnl|my_center|LOCUS_27190 55745 56554 gene locus_tag LOCUS_27200 gene pabC 55745 56554 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478706.1 protein_id gnl|my_center|LOCUS_27200 56557 57579 gene locus_tag LOCUS_27210 gene yceG 56557 57579 CDS product cell division protein YceG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756838.1 protein_id gnl|my_center|LOCUS_27210 57569 58210 gene locus_tag LOCUS_27220 gene tmk 57569 58210 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257000.1 protein_id gnl|my_center|LOCUS_27220 58207 59211 gene locus_tag LOCUS_27230 gene holB 58207 59211 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267941.1 protein_id gnl|my_center|LOCUS_27230 59222 60019 gene locus_tag LOCUS_27240 59222 60019 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480245.1 protein_id gnl|my_center|LOCUS_27240 60314 61747 gene locus_tag LOCUS_27250 gene ptsG 60314 61747 CDS product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475719.1 protein_id gnl|my_center|LOCUS_27250 63996 61807 gene locus_tag LOCUS_27260 gene fhuE 63996 61807 CDS product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953450.1 protein_id gnl|my_center|LOCUS_27260 64330 64689 gene locus_tag LOCUS_27270 gene hinT 64330 64689 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807125.1 protein_id gnl|my_center|LOCUS_27270 64692 65069 gene locus_tag LOCUS_27280 64692 65069 CDS product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225281.1 protein_id gnl|my_center|LOCUS_27280 65083 65724 gene locus_tag LOCUS_27290 gene lpoB 65083 65724 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164439.1 protein_id gnl|my_center|LOCUS_27290 65705 66529 gene locus_tag LOCUS_27300 gene thiK 65705 66529 CDS product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116592.1 protein_id gnl|my_center|LOCUS_27300 66540 67565 gene locus_tag LOCUS_27310 gene nagZ 66540 67565 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529331.1 protein_id gnl|my_center|LOCUS_27310 67588 68130 gene locus_tag LOCUS_27320 gene ycfP 67588 68130 CDS product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587933.1 protein_id gnl|my_center|LOCUS_27320 68538 69842 gene locus_tag LOCUS_27330 gene ndh 68538 69842 CDS product NADH-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211045.1 protein_id gnl|my_center|LOCUS_27330 70069 70608 gene locus_tag LOCUS_27340 70069 70608 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043459.1 protein_id gnl|my_center|LOCUS_27340 71302 70670 gene locus_tag LOCUS_27350 gene comR 71302 70670 CDS product TetR family copper-responsive transcriptional repressor ComR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179805.1 protein_id gnl|my_center|LOCUS_27350 71543 71800 gene locus_tag LOCUS_27360 gene bhsA 71543 71800 CDS product multiple stress resistance protein BhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800153.1 protein_id gnl|my_center|LOCUS_27360 72842 71883 gene locus_tag LOCUS_27370 gene ldtC 72842 71883 CDS product L,D-transpeptidase LdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300895.1 protein_id gnl|my_center|LOCUS_27370 76435 72989 gene locus_tag LOCUS_27380 gene mfd 76435 72989 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297549.1 protein_id gnl|my_center|LOCUS_27380 77636 76563 gene locus_tag LOCUS_27390 77636 76563 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810253.1 protein_id gnl|my_center|LOCUS_27390 77898 79097 gene locus_tag LOCUS_27400 gene lolC 77898 79097 CDS product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284714.1 protein_id gnl|my_center|LOCUS_27400 79090 79791 gene locus_tag LOCUS_27410 gene lolD 79090 79791 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033695.1 protein_id gnl|my_center|LOCUS_27410 79791 81035 gene locus_tag LOCUS_27420 gene lolE 79791 81035 CDS product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251389.1 protein_id gnl|my_center|LOCUS_27420 81064 81495 gene locus_tag LOCUS_27430 81064 81495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 >Feature sequence23 2336 1758 gene locus_tag LOCUS_27440 gene rsxB 2336 1758 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991805.1 protein_id gnl|my_center|LOCUS_27440 2917 2336 gene locus_tag LOCUS_27450 gene rsxA 2917 2336 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133193.1 protein_id gnl|my_center|LOCUS_27450 3434 2994 gene locus_tag LOCUS_27460 3434 2994 CDS product DUF2569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214176.1 protein_id gnl|my_center|LOCUS_27460 3735 3520 gene locus_tag LOCUS_27470 gene ydgT 3735 3520 CDS product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217950.1 protein_id gnl|my_center|LOCUS_27470 4376 5416 gene locus_tag LOCUS_27480 4376 5416 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300538.1 protein_id gnl|my_center|LOCUS_27480 6451 5450 gene locus_tag LOCUS_27490 gene add 6451 5450 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567490.1 protein_id gnl|my_center|LOCUS_27490 7727 6555 gene locus_tag LOCUS_27500 gene malY 7727 6555 CDS product bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459374.1 protein_id gnl|my_center|LOCUS_27500 9329 7737 gene locus_tag LOCUS_27510 gene malX 9329 7737 CDS product PTS maltose transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125609.1 protein_id gnl|my_center|LOCUS_27510 9504 10532 gene locus_tag LOCUS_27520 gene malI 9504 10532 CDS product mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179510.1 protein_id gnl|my_center|LOCUS_27520 10643 11410 gene locus_tag LOCUS_27530 gene hdhA 10643 11410 CDS product 7-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483353.1 protein_id gnl|my_center|LOCUS_27530 11631 12221 gene locus_tag LOCUS_27540 gene uidR 11631 12221 CDS product DNA-binding transcriptional regulator UidR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969092.1 protein_id gnl|my_center|LOCUS_27540 12612 14423 gene locus_tag LOCUS_27550 gene uidA 12612 14423 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945913.1 protein_id gnl|my_center|LOCUS_27550 14420 15793 gene locus_tag LOCUS_27560 gene uidB 14420 15793 CDS product glucuronide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075893.1 protein_id gnl|my_center|LOCUS_27560 15844 17097 gene locus_tag LOCUS_27570 gene uidC 15844 17097 CDS product glucuronide uptake porin UidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227015.1 protein_id gnl|my_center|LOCUS_27570 18831 17323 gene locus_tag LOCUS_27580 18831 17323 CDS product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043339.1 protein_id gnl|my_center|LOCUS_27580 20107 18932 gene locus_tag LOCUS_27590 gene manA 20107 18932 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170664.1 protein_id gnl|my_center|LOCUS_27590 20306 21952 gene locus_tag LOCUS_27600 gene fumB 20306 21952 CDS product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066639.1 protein_id gnl|my_center|LOCUS_27600 22095 23498 gene locus_tag LOCUS_27610 gene fumC 22095 23498 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099085.1 protein_id gnl|my_center|LOCUS_27610 24436 23495 gene locus_tag LOCUS_27620 gene tus 24436 23495 CDS product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135186.1 protein_id gnl|my_center|LOCUS_27620 25801 24500 gene locus_tag LOCUS_27630 gene rstB 25801 24500 CDS product two-component system sensor histidine kinase RstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732491.1 protein_id gnl|my_center|LOCUS_27630 26524 25805 gene locus_tag LOCUS_27640 gene rstA 26524 25805 CDS product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092508.1 protein_id gnl|my_center|LOCUS_27640 26653 26988 gene locus_tag LOCUS_27650 26653 26988 CDS product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524868.1 protein_id gnl|my_center|LOCUS_27650 27707 26985 gene locus_tag LOCUS_27660 gene folM 27707 26985 CDS product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520804.1 protein_id gnl|my_center|LOCUS_27660 29126 27744 gene locus_tag LOCUS_27670 29126 27744 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412379.1 protein_id gnl|my_center|LOCUS_27670 30256 29312 gene locus_tag LOCUS_27680 gene ydgH 30256 29312 CDS product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769322.1 protein_id gnl|my_center|LOCUS_27680 30780 32312 gene locus_tag LOCUS_27690 gene pntA 30780 32312 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300486.1 protein_id gnl|my_center|LOCUS_27690 32323 33711 gene locus_tag LOCUS_27700 gene pntB 32323 33711 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014036.1 protein_id gnl|my_center|LOCUS_27700 34770 33736 gene locus_tag LOCUS_27710 gene tqsA 34770 33736 CDS product AI-2 transporter TqsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118241.1 protein_id gnl|my_center|LOCUS_27710 35182 35547 gene locus_tag LOCUS_27720 gene mdtJ 35182 35547 CDS product multidrug/spermidine efflux SMR transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276149.1 protein_id gnl|my_center|LOCUS_27720 35534 35863 gene locus_tag LOCUS_27730 gene mdtI 35534 35863 CDS product multidrug/spermidine efflux SMR transporter subunit MdtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046661.1 protein_id gnl|my_center|LOCUS_27730 36723 35902 gene locus_tag LOCUS_27740 36723 35902 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260840.1 protein_id gnl|my_center|LOCUS_27740 37334 36999 gene locus_tag LOCUS_27750 gene asr 37334 36999 CDS product acid resistance repetitive basic protein Asr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743951.1 protein_id gnl|my_center|LOCUS_27750 38984 37731 gene locus_tag LOCUS_27760 38984 37731 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091840.1 protein_id gnl|my_center|LOCUS_27760 39091 39984 gene locus_tag LOCUS_27770 39091 39984 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019525.1 protein_id gnl|my_center|LOCUS_27770 40119 41339 gene locus_tag LOCUS_27780 gene mlc 40119 41339 CDS product DNA-binding transcriptional repressor Mlc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225262.1 protein_id gnl|my_center|LOCUS_27780 41464 42159 gene locus_tag LOCUS_27790 gene bioD 41464 42159 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919231.1 protein_id gnl|my_center|LOCUS_27790 43368 42112 gene locus_tag LOCUS_27800 gene clcB 43368 42112 CDS product voltage-gated ClC-type chloride channel ClcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302066.1 protein_id gnl|my_center|LOCUS_27800 44177 43563 gene locus_tag LOCUS_27810 gene dmsD 44177 43563 CDS product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148710.1 protein_id gnl|my_center|LOCUS_27810 45074 44220 gene locus_tag LOCUS_27820 45074 44220 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526503.1 protein_id gnl|my_center|LOCUS_27820 45693 45076 gene locus_tag LOCUS_27830 gene dmsB 45693 45076 CDS product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213028.1 protein_id gnl|my_center|LOCUS_27830 48130 45704 gene locus_tag LOCUS_27840 48130 45704 CDS product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340362.1 protein_id gnl|my_center|LOCUS_27840 50614 48188 gene locus_tag LOCUS_27850 50614 48188 CDS product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041675.1 protein_id gnl|my_center|LOCUS_27850 51118 50813 gene locus_tag LOCUS_27860 51118 50813 CDS product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300836.1 protein_id gnl|my_center|LOCUS_27860 51190 51936 gene locus_tag LOCUS_27870 51190 51936 CDS product YnfC family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571976.1 protein_id gnl|my_center|LOCUS_27870 52499 51939 gene locus_tag LOCUS_27880 gene speG 52499 51939 CDS product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138581.1 protein_id gnl|my_center|LOCUS_27880 52875 52534 gene locus_tag LOCUS_27890 52875 52534 CDS product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705211.1 protein_id gnl|my_center|LOCUS_27890 53010 53336 gene locus_tag LOCUS_27900 53010 53336 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598292.1 protein_id gnl|my_center|LOCUS_27900 53373 53561 gene locus_tag LOCUS_27910 53373 53561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 53542 54756 gene locus_tag LOCUS_27920 gene rspA 53542 54756 CDS product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295394.1 protein_id gnl|my_center|LOCUS_27920 54768 55787 gene locus_tag LOCUS_27930 54768 55787 CDS product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836066.1 protein_id gnl|my_center|LOCUS_27930 56238 55975 gene locus_tag LOCUS_27940 56238 55975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27940 57254 56280 gene locus_tag LOCUS_27950 57254 56280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27950 57540 57289 gene locus_tag LOCUS_27960 57540 57289 CDS product excisionase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005552.1 protein_id gnl|my_center|LOCUS_27960 60084 57613 gene locus_tag LOCUS_27970 60084 57613 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001515375.1 protein_id gnl|my_center|LOCUS_27970 60369 60178 gene locus_tag LOCUS_27980 gene ydfD 60369 60178 CDS product lysis protein YdfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083297.1 protein_id gnl|my_center|LOCUS_27980 60554 60366 gene locus_tag LOCUS_27990 gene dicB 60554 60366 CDS product cell division inhibition protein DicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854559.1 protein_id gnl|my_center|LOCUS_27990 61057 61257 gene locus_tag LOCUS_28000 61057 61257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 61591 61226 gene locus_tag LOCUS_28010 61591 61226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 61755 61603 gene locus_tag LOCUS_28020 61755 61603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 62331 61924 gene locus_tag LOCUS_28030 62331 61924 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381212.1 protein_id gnl|my_center|LOCUS_28030 62412 62639 gene locus_tag LOCUS_28040 62412 62639 CDS product Cro/CI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909905.1 protein_id gnl|my_center|LOCUS_28040 62623 63144 gene locus_tag LOCUS_28050 62623 63144 CDS product toxin YdaT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705349.1 protein_id gnl|my_center|LOCUS_28050 63176 64090 gene locus_tag LOCUS_28060 63176 64090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054512.1 protein_id gnl|my_center|LOCUS_28060 64131 64553 gene locus_tag LOCUS_28070 64131 64553 CDS product DUF977 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151262.1 protein_id gnl|my_center|LOCUS_28070 64936 65502 gene locus_tag LOCUS_28080 64936 65502 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021554705.1 protein_id gnl|my_center|LOCUS_28080 66115 66270 gene locus_tag LOCUS_28090 66115 66270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 66490 66738 gene locus_tag LOCUS_28100 gene rem 66490 66738 CDS product protein Rem inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980991.1 protein_id gnl|my_center|LOCUS_28100 67085 67735 gene locus_tag LOCUS_28110 67085 67735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 67753 68130 gene locus_tag LOCUS_28120 67753 68130 CDS product antiterminator Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204777.1 protein_id gnl|my_center|LOCUS_28120 68810 68286 gene locus_tag LOCUS_28130 68810 68286 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780585.1 protein_id gnl|my_center|LOCUS_28130 69003 69152 gene locus_tag LOCUS_28140 69003 69152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 >Feature sequence24 76 1 gene locus_tag LOCUS_t00380 76 1 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 832 287 gene locus_tag LOCUS_28150 gene orn 832 287 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295188.1 protein_id gnl|my_center|LOCUS_28150 927 1979 gene locus_tag LOCUS_28160 gene rsgA 927 1979 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041970.1 protein_id gnl|my_center|LOCUS_28160 2076 3044 gene locus_tag LOCUS_28170 gene asd 2076 3044 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934927.1 protein_id gnl|my_center|LOCUS_28170 3066 6389 gene locus_tag LOCUS_28180 gene mscM 3066 6389 CDS product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236847.1 protein_id gnl|my_center|LOCUS_28180 7996 6539 gene locus_tag LOCUS_28190 gene yjeM 7996 6539 CDS product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300174.1 protein_id gnl|my_center|LOCUS_28190 9237 8260 gene locus_tag LOCUS_28200 gene epmA 9237 8260 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004771.1 protein_id gnl|my_center|LOCUS_28200 9562 11370 gene locus_tag LOCUS_28210 gene frdA 9562 11370 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192973.1 protein_id gnl|my_center|LOCUS_28210 11363 12097 gene locus_tag LOCUS_28220 gene frdB 11363 12097 CDS product fumarate reductase iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829498.1 protein_id gnl|my_center|LOCUS_28220 12108 12503 gene locus_tag LOCUS_28230 gene frdC 12108 12503 CDS product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208757.1 protein_id gnl|my_center|LOCUS_28230 12514 12873 gene locus_tag LOCUS_28240 gene frdD 12514 12873 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299198.1 protein_id gnl|my_center|LOCUS_28240 12936 14069 gene locus_tag LOCUS_28250 12936 14069 CDS product BlaEC family class C beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477369.1 protein_id gnl|my_center|LOCUS_28250 14158 14694 gene locus_tag LOCUS_28260 gene blc 14158 14694 CDS product lipocalin Blc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238378.1 protein_id gnl|my_center|LOCUS_28260 15005 14688 gene locus_tag LOCUS_28270 gene sugE 15005 14688 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118482.1 protein_id gnl|my_center|LOCUS_28270 15327 15181 gene locus_tag LOCUS_28280 gene ecnB 15327 15181 CDS product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239596.1 protein_id gnl|my_center|LOCUS_28280 16181 15615 gene locus_tag LOCUS_28290 gene efp 16181 15615 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257278.1 protein_id gnl|my_center|LOCUS_28290 16223 17251 gene locus_tag LOCUS_28300 gene epmB 16223 17251 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940508.1 protein_id gnl|my_center|LOCUS_28300 17646 18515 gene locus_tag LOCUS_28310 17646 18515 CDS product YjeJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008046.1 protein_id gnl|my_center|LOCUS_28310 19061 18708 gene locus_tag LOCUS_28320 19061 18708 CDS product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168693.1 protein_id gnl|my_center|LOCUS_28320 20845 19199 gene locus_tag LOCUS_28330 gene groL 20845 19199 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729117.1 protein_id gnl|my_center|LOCUS_28330 21182 20889 gene locus_tag LOCUS_28340 21182 20889 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026276.1 protein_id gnl|my_center|LOCUS_28340 21458 22714 gene locus_tag LOCUS_28350 gene yjeH 21458 22714 CDS product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015852.1 protein_id gnl|my_center|LOCUS_28350 23206 22730 gene locus_tag LOCUS_28360 gene fxsA 23206 22730 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267448.1 protein_id gnl|my_center|LOCUS_28360 23543 24979 gene locus_tag LOCUS_28370 gene aspA 23543 24979 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069437.1 protein_id gnl|my_center|LOCUS_28370 25097 26398 gene locus_tag LOCUS_28380 gene dcuA 25097 26398 CDS product anaerobic C4-dicarboxylate transporter DcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961959.1 protein_id gnl|my_center|LOCUS_28380 26514 26852 gene locus_tag LOCUS_28390 gene cutA 26514 26852 CDS product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883400.1 protein_id gnl|my_center|LOCUS_28390 26828 28525 gene locus_tag LOCUS_28400 gene dsbD 26828 28525 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068927.1 protein_id gnl|my_center|LOCUS_28400 28562 29137 gene locus_tag LOCUS_28410 28562 29137 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188520.1 protein_id gnl|my_center|LOCUS_28410 29244 29319 gene locus_tag LOCUS_t00390 29244 29319 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 29936 31474 gene locus_tag LOCUS_28420 gene cadC 29936 31474 CDS product lysine decarboxylation/transport transcriptional activator CadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187177.1 protein_id gnl|my_center|LOCUS_28420 31840 33174 gene locus_tag LOCUS_28430 gene cadB 31840 33174 CDS product cadaverine/lysine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092909.1 protein_id gnl|my_center|LOCUS_28430 33254 35401 gene locus_tag LOCUS_28440 gene cadA 33254 35401 CDS product lysine decarboxylase CadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295383.1 protein_id gnl|my_center|LOCUS_28440 35460 36917 gene locus_tag LOCUS_28450 gene dtpC 35460 36917 CDS product dipeptide/tripeptide permease DtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856829.1 protein_id gnl|my_center|LOCUS_28450 37154 38671 gene locus_tag LOCUS_28460 gene lysS 37154 38671 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295074.1 protein_id gnl|my_center|LOCUS_28460 38963 38790 gene locus_tag LOCUS_28470 gene ghoT 38963 38790 CDS product type V toxin-antitoxin system toxin GhoT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173343.1 protein_id gnl|my_center|LOCUS_28470 39287 38991 gene locus_tag LOCUS_28480 gene ghoS 39287 38991 CDS product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398619.1 protein_id gnl|my_center|LOCUS_28480 39786 39514 gene locus_tag LOCUS_28490 39786 39514 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405651.1 protein_id gnl|my_center|LOCUS_28490 40028 39798 gene locus_tag LOCUS_28500 gene yjdI 40028 39798 CDS product 4Fe-4S mono-cluster protein YjdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371704.1 protein_id gnl|my_center|LOCUS_28500 40209 41120 gene locus_tag LOCUS_28510 40209 41120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28510 41204 41845 gene locus_tag LOCUS_28520 41204 41845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28520 41842 42561 gene locus_tag LOCUS_28530 gene dcuR 41842 42561 CDS product two-component system response regulator DcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611288.1 protein_id gnl|my_center|LOCUS_28530 43132 44472 gene locus_tag LOCUS_28540 gene dcuB 43132 44472 CDS product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899522.1 protein_id gnl|my_center|LOCUS_28540 44550 46196 gene locus_tag LOCUS_28550 gene fumB 44550 46196 CDS product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066681.1 protein_id gnl|my_center|LOCUS_28550 46319 46948 gene locus_tag LOCUS_28560 46319 46948 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198752.1 protein_id gnl|my_center|LOCUS_28560 48496 47087 gene locus_tag LOCUS_28570 gene melB 48496 47087 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028114.1 protein_id gnl|my_center|LOCUS_28570 49966 48611 gene locus_tag LOCUS_28580 gene melA 49966 48611 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988031.1 protein_id gnl|my_center|LOCUS_28580 50249 51157 gene locus_tag LOCUS_28590 gene melR 50249 51157 CDS product transcriptional regulator MelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090758.1 protein_id gnl|my_center|LOCUS_28590 51353 53623 gene locus_tag LOCUS_28600 gene adiA 51353 53623 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001381593.1 protein_id gnl|my_center|LOCUS_28600 53948 54709 gene locus_tag LOCUS_28610 gene adiY 53948 54709 CDS product DNA-binding transcriptional activator AdiY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217060.1 protein_id gnl|my_center|LOCUS_28610 54846 56183 gene locus_tag LOCUS_28620 gene adiC 54846 56183 CDS product arginine/agmatine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093154.1 protein_id gnl|my_center|LOCUS_28620 56317 57930 gene locus_tag LOCUS_28630 gene eptA 56317 57930 CDS product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298860.1 protein_id gnl|my_center|LOCUS_28630 57927 58595 gene locus_tag LOCUS_28640 gene basR 57927 58595 CDS product two-component system response regulator BasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697915.1 protein_id gnl|my_center|LOCUS_28640 58596 59696 gene locus_tag LOCUS_28650 gene pmrB 58596 59696 CDS product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300761.1 protein_id gnl|my_center|LOCUS_28650 61375 59873 gene locus_tag LOCUS_28660 gene proP 61375 59873 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298520.1 protein_id gnl|my_center|LOCUS_28660 62517 61639 gene locus_tag LOCUS_28670 62517 61639 CDS product YjcZ-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169188.1 protein_id gnl|my_center|LOCUS_28670 64742 62514 gene locus_tag LOCUS_28680 gene crfC 64742 62514 CDS product clamp-binding protein CrfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288590.1 protein_id gnl|my_center|LOCUS_28680 65143 65478 gene locus_tag LOCUS_28690 65143 65478 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300891.1 protein_id gnl|my_center|LOCUS_28690 >Feature sequence25 119 2473 gene locus_tag LOCUS_28700 gene lon 119 2473 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295325.1 protein_id gnl|my_center|LOCUS_28700 2682 2954 gene locus_tag LOCUS_28710 gene hupB 2682 2954 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043542.1 protein_id gnl|my_center|LOCUS_28710 3146 5017 gene locus_tag LOCUS_28720 gene ppiD 3146 5017 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969372.1 protein_id gnl|my_center|LOCUS_28720 5168 5539 gene locus_tag LOCUS_28730 5168 5539 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680314.1 protein_id gnl|my_center|LOCUS_28730 5645 6043 gene locus_tag LOCUS_28740 gene fadM 5645 6043 CDS product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194534.1 protein_id gnl|my_center|LOCUS_28740 6790 6095 gene locus_tag LOCUS_28750 gene queC 6790 6095 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817229.1 protein_id gnl|my_center|LOCUS_28750 8555 6855 gene locus_tag LOCUS_28760 8555 6855 CDS product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238234.1 protein_id gnl|my_center|LOCUS_28760 8655 9473 gene locus_tag LOCUS_28770 gene cof 8655 9473 CDS product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113027.1 protein_id gnl|my_center|LOCUS_28770 9626 10084 gene locus_tag LOCUS_28780 gene decR 9626 10084 CDS product DNA-binding transcriptional regulator DecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884589.1 protein_id gnl|my_center|LOCUS_28780 10114 11886 gene locus_tag LOCUS_28790 10114 11886 CDS product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235584.1 protein_id gnl|my_center|LOCUS_28790 11879 13660 gene locus_tag LOCUS_28800 11879 13660 CDS product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256174.1 protein_id gnl|my_center|LOCUS_28800 13841 14179 gene locus_tag LOCUS_28810 gene glnK 13841 14179 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780338.1 protein_id gnl|my_center|LOCUS_28810 14209 15495 gene locus_tag LOCUS_28820 gene amtB 14209 15495 CDS product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000685029.1 protein_id gnl|my_center|LOCUS_28820 16404 15544 gene locus_tag LOCUS_28830 gene tesB 16404 15544 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075876.1 protein_id gnl|my_center|LOCUS_28830 16622 17194 gene locus_tag LOCUS_28840 16622 17194 CDS product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779826.1 protein_id gnl|my_center|LOCUS_28840 17536 17225 gene locus_tag LOCUS_28850 gene atl 17536 17225 CDS product DNA base-flipping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300427.1 protein_id gnl|my_center|LOCUS_28850 17915 18268 gene locus_tag LOCUS_28860 17915 18268 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878140.1 protein_id gnl|my_center|LOCUS_28860 19866 18310 gene locus_tag LOCUS_28870 gene pdeB 19866 18310 CDS product cyclic-guanylate-specific phosphodiesterase PdeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961238.1 protein_id gnl|my_center|LOCUS_28870 20494 20024 gene locus_tag LOCUS_28880 20494 20024 CDS product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136192.1 protein_id gnl|my_center|LOCUS_28880 21161 20610 gene locus_tag LOCUS_28890 gene maa 21161 20610 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102564.1 protein_id gnl|my_center|LOCUS_28890 21551 21333 gene locus_tag LOCUS_28900 21551 21333 CDS product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291435.1 protein_id gnl|my_center|LOCUS_28900 21951 21577 gene locus_tag LOCUS_28910 gene tomB 21951 21577 CDS product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344800.1 protein_id gnl|my_center|LOCUS_28910 25646 22497 gene locus_tag LOCUS_28920 gene acrB 25646 22497 CDS product efflux RND transporter permease AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132469.1 protein_id gnl|my_center|LOCUS_28920 26754 25669 gene locus_tag LOCUS_28930 gene acrA 26754 25669 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386618.1 protein_id gnl|my_center|LOCUS_28930 27004 27651 gene locus_tag LOCUS_28940 gene acrR 27004 27651 CDS product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101737.1 protein_id gnl|my_center|LOCUS_28940 27779 31141 gene locus_tag LOCUS_28950 gene mscK 27779 31141 CDS product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177732.1 protein_id gnl|my_center|LOCUS_28950 31514 31353 gene locus_tag LOCUS_28960 gene rsmS 31514 31353 CDS product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051153.1 protein_id gnl|my_center|LOCUS_28960 32055 31528 gene locus_tag LOCUS_28970 gene priC 32055 31528 CDS product primosomal replication protein N'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844874.1 protein_id gnl|my_center|LOCUS_28970 32125 32502 gene locus_tag LOCUS_28980 32125 32502 CDS product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188905.1 protein_id gnl|my_center|LOCUS_28980 32655 33206 gene locus_tag LOCUS_28990 gene apt 32655 33206 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127356.1 protein_id gnl|my_center|LOCUS_28990 33335 35266 gene locus_tag LOCUS_29000 gene dnaX 33335 35266 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122013.1 protein_id gnl|my_center|LOCUS_29000 35319 35648 gene locus_tag LOCUS_29010 35319 35648 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 protein_id gnl|my_center|LOCUS_29010 35648 36253 gene locus_tag LOCUS_29020 gene recR 35648 36253 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195025.1 protein_id gnl|my_center|LOCUS_29020 36363 38237 gene locus_tag LOCUS_29030 gene htpG 36363 38237 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678201.1 protein_id gnl|my_center|LOCUS_29030 38418 39062 gene locus_tag LOCUS_29040 gene adk 38418 39062 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220233.1 protein_id gnl|my_center|LOCUS_29040 39298 40260 gene locus_tag LOCUS_29050 gene hemH 39298 40260 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250117.1 protein_id gnl|my_center|LOCUS_29050 41216 40257 gene locus_tag LOCUS_29060 gene aes 41216 40257 CDS product acetyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801813.1 protein_id gnl|my_center|LOCUS_29060 41368 42672 gene locus_tag LOCUS_29070 gene gsk 41368 42672 CDS product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671574.1 protein_id gnl|my_center|LOCUS_29070 44481 42805 gene locus_tag LOCUS_29080 gene ybaL 44481 42805 CDS product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546237.1 protein_id gnl|my_center|LOCUS_29080 45939 44719 gene locus_tag LOCUS_29090 gene fsr 45939 44719 CDS product fosmidomycin MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251608.1 protein_id gnl|my_center|LOCUS_29090 46157 47809 gene locus_tag LOCUS_29100 gene ushA 46157 47809 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771748.1 protein_id gnl|my_center|LOCUS_29100 48325 47846 gene locus_tag LOCUS_29110 gene ybaK 48325 47846 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186631.1 protein_id gnl|my_center|LOCUS_29110 49323 48529 gene locus_tag LOCUS_29120 49323 48529 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365173.1 protein_id gnl|my_center|LOCUS_29120 49407 49802 gene locus_tag LOCUS_29130 49407 49802 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617184.1 protein_id gnl|my_center|LOCUS_29130 50036 50106 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52680 50176 gene locus_tag LOCUS_29140 gene copA 52680 50176 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083955.1 protein_id gnl|my_center|LOCUS_29140 52942 53874 gene locus_tag LOCUS_29150 gene glsA 52942 53874 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883034.1 protein_id gnl|my_center|LOCUS_29150 53877 55169 gene locus_tag LOCUS_29160 53877 55169 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982170.1 protein_id gnl|my_center|LOCUS_29160 55294 55701 gene locus_tag LOCUS_29170 gene cueR 55294 55701 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026747.1 protein_id gnl|my_center|LOCUS_29170 56160 55702 gene locus_tag LOCUS_29180 56160 55702 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970323.1 protein_id gnl|my_center|LOCUS_29180 57074 56157 gene locus_tag LOCUS_29190 57074 56157 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904502.1 protein_id gnl|my_center|LOCUS_29190 57220 57897 gene locus_tag LOCUS_29200 gene fetA 57220 57897 CDS product iron ABC transporter ATP-binding protein FetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157548.1 protein_id gnl|my_center|LOCUS_29200 57884 58663 gene locus_tag LOCUS_29210 gene fetB 57884 58663 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295323.1 protein_id gnl|my_center|LOCUS_29210 59580 58726 gene locus_tag LOCUS_29220 gene cnoX 59580 58726 CDS product chaperedoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300573.1 protein_id gnl|my_center|LOCUS_29220 60450 59641 gene locus_tag LOCUS_29230 gene ybbO 60450 59641 CDS product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148959.1 protein_id gnl|my_center|LOCUS_29230 61096 60440 gene locus_tag LOCUS_29240 gene tesA 61096 60440 CDS product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297298.1 protein_id gnl|my_center|LOCUS_29240 61034 61720 gene locus_tag LOCUS_29250 61034 61720 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110573.1 protein_id gnl|my_center|LOCUS_29250 61717 64131 gene locus_tag LOCUS_29260 61717 64131 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561872.1 protein_id gnl|my_center|LOCUS_29260 >Feature sequence26 114 773 gene locus_tag LOCUS_29270 gene hchA 114 773 CDS product protein deglycase HchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218212.1 protein_id gnl|my_center|LOCUS_29270 2239 881 gene locus_tag LOCUS_29280 gene hprS 2239 881 CDS product two-component system sensor histidine kinase HprS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826732.1 protein_id gnl|my_center|LOCUS_29280 3021 2239 gene locus_tag LOCUS_29290 gene hprR 3021 2239 CDS product response regulator transcription factor HprR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007193.1 protein_id gnl|my_center|LOCUS_29290 3043 3456 gene locus_tag LOCUS_29300 gene hiuH 3043 3456 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920127.1 protein_id gnl|my_center|LOCUS_29300 3565 4569 gene locus_tag LOCUS_29310 gene msrP 3565 4569 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000740067.1 protein_id gnl|my_center|LOCUS_29310 4570 5205 gene locus_tag LOCUS_29320 gene msrQ 4570 5205 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240091.1 protein_id gnl|my_center|LOCUS_29320 5462 6112 gene locus_tag LOCUS_29330 gene zinT 5462 6112 CDS product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007759.1 protein_id gnl|my_center|LOCUS_29330 6455 6985 gene locus_tag LOCUS_29340 6455 6985 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079074.1 protein_id gnl|my_center|LOCUS_29340 7644 7555 gene locus_tag LOCUS_t00400 7644 7555 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7738 8535 gene locus_tag LOCUS_29350 gene mtfA 7738 8535 CDS product DgsA anti-repressor MtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300801.1 protein_id gnl|my_center|LOCUS_29350 8636 8711 gene locus_tag LOCUS_t00410 8636 8711 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 9082 16101 gene locus_tag LOCUS_29360 gene yeeJ 9082 16101 CDS product inverse autotransporter adhesin YeeJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723107.1 protein_id gnl|my_center|LOCUS_29360 16689 16363 gene locus_tag LOCUS_29370 16689 16363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29370 17415 16711 gene locus_tag LOCUS_29380 17415 16711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29380 17730 19046 gene locus_tag LOCUS_29390 gene shiA 17730 19046 CDS product shikimate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378575.1 protein_id gnl|my_center|LOCUS_29390 19148 20602 gene locus_tag LOCUS_29400 gene amn 19148 20602 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060244.1 protein_id gnl|my_center|LOCUS_29400 20945 21661 gene locus_tag LOCUS_29410 20945 21661 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532923.1 protein_id gnl|my_center|LOCUS_29410 22190 22115 gene locus_tag LOCUS_t00420 22190 22115 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 23673 22291 gene locus_tag LOCUS_29420 gene yeeO 23673 22291 CDS product toxic metabolite efflux MATE transporter YeeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943916.1 protein_id gnl|my_center|LOCUS_29420 23939 24014 gene locus_tag LOCUS_t00430 23939 24014 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 25002 24052 gene locus_tag LOCUS_29430 gene cbl 25002 24052 CDS product HTH-type transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011008.1 protein_id gnl|my_center|LOCUS_29430 26021 25104 gene locus_tag LOCUS_29440 gene nac 26021 25104 CDS product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011462.1 protein_id gnl|my_center|LOCUS_29440 26348 26423 gene locus_tag LOCUS_t00440 26348 26423 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 27414 26479 gene locus_tag LOCUS_29450 gene ldtA 27414 26479 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350523.1 protein_id gnl|my_center|LOCUS_29450 28555 27476 gene locus_tag LOCUS_29460 gene cobT 28555 27476 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166160.1 protein_id gnl|my_center|LOCUS_29460 29310 28567 gene locus_tag LOCUS_29470 gene cobS 29310 28567 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326708.1 protein_id gnl|my_center|LOCUS_29470 29852 29307 gene locus_tag LOCUS_29480 gene cobU 29852 29307 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973176.1 protein_id gnl|my_center|LOCUS_29480 32383 31841 gene locus_tag LOCUS_29490 32383 31841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 32399 32701 gene locus_tag LOCUS_29500 32399 32701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 34026 33619 gene locus_tag LOCUS_29510 34026 33619 CDS product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221617.1 protein_id gnl|my_center|LOCUS_29510 34415 34014 gene locus_tag LOCUS_29520 34415 34014 CDS product putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270978.1 protein_id gnl|my_center|LOCUS_29520 35892 35563 gene locus_tag LOCUS_29530 35892 35563 CDS product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450409.1 protein_id gnl|my_center|LOCUS_29530 37122 36064 gene locus_tag LOCUS_29540 37122 36064 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200891.1 protein_id gnl|my_center|LOCUS_29540 37793 37320 gene locus_tag LOCUS_29550 gene sbmC 37793 37320 CDS product DNA gyrase inhibitor SbmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105393.1 protein_id gnl|my_center|LOCUS_29550 38955 37912 gene locus_tag LOCUS_29560 gene dacD 38955 37912 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296209.1 protein_id gnl|my_center|LOCUS_29560 39287 40714 gene locus_tag LOCUS_29570 gene sbcB 39287 40714 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980557.1 protein_id gnl|my_center|LOCUS_29570 40984 40757 gene locus_tag LOCUS_29580 gene tsuB 40984 40757 CDS product thiosulfate utilization sulfurtransferase TsuB/YeeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985273.1 protein_id gnl|my_center|LOCUS_29580 41960 40998 gene locus_tag LOCUS_29590 gene tsuA 41960 40998 CDS product thiosulfate utilization transporter TsuA/YeeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492348.1 protein_id gnl|my_center|LOCUS_29590 43593 42235 gene locus_tag LOCUS_29600 gene plaP 43593 42235 CDS product putrescine/proton symporter PlaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019197.1 protein_id gnl|my_center|LOCUS_29600 44789 43860 gene locus_tag LOCUS_29610 44789 43860 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803363.1 protein_id gnl|my_center|LOCUS_29610 45659 44835 gene locus_tag LOCUS_29620 45659 44835 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754737.1 protein_id gnl|my_center|LOCUS_29620 46282 47181 gene locus_tag LOCUS_29630 gene hisG 46282 47181 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131756.1 protein_id gnl|my_center|LOCUS_29630 47187 48491 gene locus_tag LOCUS_29640 gene hisD 47187 48491 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350335.1 protein_id gnl|my_center|LOCUS_29640 48488 49558 gene locus_tag LOCUS_29650 gene hisC 48488 49558 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108921.1 protein_id gnl|my_center|LOCUS_29650 49558 50625 gene locus_tag LOCUS_29660 gene hisB 49558 50625 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039066265.1 protein_id gnl|my_center|LOCUS_29660 50625 51215 gene locus_tag LOCUS_29670 gene hisH 50625 51215 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103560.1 protein_id gnl|my_center|LOCUS_29670 51215 51952 gene locus_tag LOCUS_29680 gene hisA 51215 51952 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586449.1 protein_id gnl|my_center|LOCUS_29680 51934 52710 gene locus_tag LOCUS_29690 gene hisF 51934 52710 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880182.1 protein_id gnl|my_center|LOCUS_29690 52704 53315 gene locus_tag LOCUS_29700 gene hisIE 52704 53315 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954911.1 protein_id gnl|my_center|LOCUS_29700 54391 53411 gene locus_tag LOCUS_29710 gene wzzB 54391 53411 CDS product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350693.1 protein_id gnl|my_center|LOCUS_29710 55703 54537 gene locus_tag LOCUS_29720 gene ugd 55703 54537 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704855.1 protein_id gnl|my_center|LOCUS_29720 57357 55951 gene locus_tag LOCUS_29730 gene gndA 57357 55951 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043504.1 protein_id gnl|my_center|LOCUS_29730 58885 57521 gene locus_tag LOCUS_29740 gene cpsG 58885 57521 CDS product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954427.1 protein_id gnl|my_center|LOCUS_29740 60343 58919 gene locus_tag LOCUS_29750 60343 58919 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097982.1 protein_id gnl|my_center|LOCUS_29750 >Feature sequence27 196 267 gene locus_tag LOCUS_t00450 196 267 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 287 211 gene locus_tag LOCUS_t00460 287 211 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 383 291 gene locus_tag LOCUS_t00470 383 291 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 884 699 gene locus_tag LOCUS_29760 gene csrA 884 699 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 protein_id gnl|my_center|LOCUS_29760 3749 1119 gene locus_tag LOCUS_29770 gene alaS 3749 1119 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047184.1 protein_id gnl|my_center|LOCUS_29770 4377 3877 gene locus_tag LOCUS_29780 gene recX 4377 3877 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140508.1 protein_id gnl|my_center|LOCUS_29780 5507 4446 gene locus_tag LOCUS_29790 gene recA 5507 4446 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963143.1 protein_id gnl|my_center|LOCUS_29790 6084 5587 gene locus_tag LOCUS_29800 gene pncC 6084 5587 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 protein_id gnl|my_center|LOCUS_29800 7314 6229 gene locus_tag LOCUS_29810 gene mltB 7314 6229 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301333.1 protein_id gnl|my_center|LOCUS_29810 7570 8133 gene locus_tag LOCUS_29820 gene srlA 7570 8133 CDS product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573321.1 protein_id gnl|my_center|LOCUS_29820 8130 9089 gene locus_tag LOCUS_29830 gene srlE 8130 9089 CDS product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148875.1 protein_id gnl|my_center|LOCUS_29830 9100 9471 gene locus_tag LOCUS_29840 gene srlB 9100 9471 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216210.1 protein_id gnl|my_center|LOCUS_29840 9475 10254 gene locus_tag LOCUS_29850 gene srlD 9475 10254 CDS product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077351.1 protein_id gnl|my_center|LOCUS_29850 10360 10719 gene locus_tag LOCUS_29860 gene gutM 10360 10719 CDS product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252908.1 protein_id gnl|my_center|LOCUS_29860 10786 11559 gene locus_tag LOCUS_29870 gene srlR 10786 11559 CDS product glucitol operon DNA-binding transcriptional repressor SrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804550.1 protein_id gnl|my_center|LOCUS_29870 11552 12517 gene locus_tag LOCUS_29880 gene gutQ 11552 12517 CDS product arabinose-5-phosphate isomerase GutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287420.1 protein_id gnl|my_center|LOCUS_29880 14028 12514 gene locus_tag LOCUS_29890 gene norR 14028 12514 CDS product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010749.1 protein_id gnl|my_center|LOCUS_29890 14215 15654 gene locus_tag LOCUS_29900 gene norV 14215 15654 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029605.1 protein_id gnl|my_center|LOCUS_29900 15651 16784 gene locus_tag LOCUS_29910 gene norW 15651 16784 CDS product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064748.1 protein_id gnl|my_center|LOCUS_29910 19164 16912 gene locus_tag LOCUS_29920 gene hypF 19164 16912 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107704.1 protein_id gnl|my_center|LOCUS_29920 19844 19317 gene locus_tag LOCUS_29930 gene hydN 19844 19317 CDS product electron transport protein HydN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078777.1 protein_id gnl|my_center|LOCUS_29930 20994 19993 gene locus_tag LOCUS_29940 gene ascG 20994 19993 CDS product DNA-binding transcriptional regulator AscG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302219.1 protein_id gnl|my_center|LOCUS_29940 21263 22720 gene locus_tag LOCUS_29950 gene ascF 21263 22720 CDS product PTS cellobiose/arbutin/salicin transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107844.1 protein_id gnl|my_center|LOCUS_29950 22729 24153 gene locus_tag LOCUS_29960 gene ascB 22729 24153 CDS product 6-phospho-beta-glucosidase AscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110337.1 protein_id gnl|my_center|LOCUS_29960 24782 24312 gene locus_tag LOCUS_29970 gene hycI 24782 24312 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132961.1 protein_id gnl|my_center|LOCUS_29970 25185 24775 gene locus_tag LOCUS_29980 gene hycH 25185 24775 CDS product formate hydrogenlyase assembly protein HycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291921.1 protein_id gnl|my_center|LOCUS_29980 25949 25182 gene locus_tag LOCUS_29990 gene hycG 25949 25182 CDS product formate hydrogenlyase subunit HycG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067401.1 protein_id gnl|my_center|LOCUS_29990 26491 25949 gene locus_tag LOCUS_30000 gene hycF 26491 25949 CDS product formate hydrogenlyase subunit HycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493785.1 protein_id gnl|my_center|LOCUS_30000 28210 26501 gene locus_tag LOCUS_30010 gene hycE 28210 26501 CDS product formate hydrogenlyase subunit HycE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288122.1 protein_id gnl|my_center|LOCUS_30010 29151 28228 gene locus_tag LOCUS_30020 gene hycD 29151 28228 CDS product formate hydrogenlyase subunit HycD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115224.1 protein_id gnl|my_center|LOCUS_30020 30980 29154 gene locus_tag LOCUS_30030 gene hycC 30980 29154 CDS product formate hydrogenlyase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274388.1 protein_id gnl|my_center|LOCUS_30030 31588 30977 gene locus_tag LOCUS_30040 gene hycB 31588 30977 CDS product formate hydrogenlyase subunit HycB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079186.1 protein_id gnl|my_center|LOCUS_30040 32174 31713 gene locus_tag LOCUS_30050 gene hycA 32174 31713 CDS product formate hydrogenlyase regulator HycA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158056.1 protein_id gnl|my_center|LOCUS_30050 32374 32736 gene locus_tag LOCUS_30060 gene hypA 32374 32736 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508457.1 protein_id gnl|my_center|LOCUS_30060 32740 33612 gene locus_tag LOCUS_30070 gene hypB 32740 33612 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337665.1 protein_id gnl|my_center|LOCUS_30070 33603 33875 gene locus_tag LOCUS_30080 gene hypC 33603 33875 CDS product hydrogenase 3 maturation protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334881.1 protein_id gnl|my_center|LOCUS_30080 33875 34996 gene locus_tag LOCUS_30090 gene hypD 33875 34996 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212985.1 protein_id gnl|my_center|LOCUS_30090 34993 36003 gene locus_tag LOCUS_30100 gene hypE 34993 36003 CDS product hydrogenase maturation carbamoyl dehydratase HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059922.1 protein_id gnl|my_center|LOCUS_30100 36077 38155 gene locus_tag LOCUS_30110 gene flhA 36077 38155 CDS product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301332.1 protein_id gnl|my_center|LOCUS_30110 38545 38192 gene locus_tag LOCUS_30120 38545 38192 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015497.1 protein_id gnl|my_center|LOCUS_30120 38832 41393 gene locus_tag LOCUS_30130 gene mutS 38832 41393 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272928.1 protein_id gnl|my_center|LOCUS_30130 41499 42155 gene locus_tag LOCUS_30140 gene pphB 41499 42155 CDS product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141316.1 protein_id gnl|my_center|LOCUS_30140 42973 42206 gene locus_tag LOCUS_30150 gene ygbI 42973 42206 CDS product DNA-binding transcriptional repressor YgbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300386.1 protein_id gnl|my_center|LOCUS_30150 43169 44077 gene locus_tag LOCUS_30160 43169 44077 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847985.1 protein_id gnl|my_center|LOCUS_30160 44074 45336 gene locus_tag LOCUS_30170 44074 45336 CDS product 3-oxo-tetronate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590392.1 protein_id gnl|my_center|LOCUS_30170 45333 45971 gene locus_tag LOCUS_30180 45333 45971 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278994.1 protein_id gnl|my_center|LOCUS_30180 45976 46752 gene locus_tag LOCUS_30190 45976 46752 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136934.1 protein_id gnl|my_center|LOCUS_30190 46841 48205 gene locus_tag LOCUS_30200 46841 48205 CDS product GntP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104441.1 protein_id gnl|my_center|LOCUS_30200 49291 48299 gene locus_tag LOCUS_30210 gene rpoS 49291 48299 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081550.1 protein_id gnl|my_center|LOCUS_30210 50493 49354 gene locus_tag LOCUS_30220 gene nlpD 50493 49354 CDS product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272590.1 protein_id gnl|my_center|LOCUS_30220 51259 50633 gene locus_tag LOCUS_30230 gene pcm 51259 50633 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254708.1 protein_id gnl|my_center|LOCUS_30230 52014 51253 gene locus_tag LOCUS_30240 gene surE 52014 51253 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295182.1 protein_id gnl|my_center|LOCUS_30240 53044 51995 gene locus_tag LOCUS_30250 gene truD 53044 51995 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568943.1 protein_id gnl|my_center|LOCUS_30250 53520 53041 gene locus_tag LOCUS_30260 gene ispF 53520 53041 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219242.1 protein_id gnl|my_center|LOCUS_30260 54230 53520 gene locus_tag LOCUS_30270 gene ispD 54230 53520 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246138.1 protein_id gnl|my_center|LOCUS_30270 54560 54249 gene locus_tag LOCUS_30280 gene ftsB 54560 54249 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517476.1 protein_id gnl|my_center|LOCUS_30280 54769 54548 gene locus_tag LOCUS_30290 54769 54548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 55077 54754 gene locus_tag LOCUS_30300 55077 54754 CDS product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246104.1 protein_id gnl|my_center|LOCUS_30300 55732 55127 gene locus_tag LOCUS_30310 gene cysC 55732 55127 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173673.1 protein_id gnl|my_center|LOCUS_30310 57159 55732 gene locus_tag LOCUS_30320 gene cysN 57159 55732 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090361.1 protein_id gnl|my_center|LOCUS_30320 58069 57161 gene locus_tag LOCUS_30330 gene cysD 58069 57161 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372108.1 protein_id gnl|my_center|LOCUS_30330 58321 59358 gene locus_tag LOCUS_30340 gene iap 58321 59358 CDS product alkaline phosphatase isozyme conversion aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490426.1 protein_id gnl|my_center|LOCUS_30340 59440 59712 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtttatccccgctggcgcggggaacac >Feature sequence28 <1 947 gene locus_tag LOCUS_30350 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000145424.1:hydrogenase 2 small subunit 950 1936 gene locus_tag LOCUS_30360 gene hybA 950 1936 CDS product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081870.1 protein_id gnl|my_center|LOCUS_30360 1926 3104 gene locus_tag LOCUS_30370 gene hybB 1926 3104 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017703.1 protein_id gnl|my_center|LOCUS_30370 3101 4804 gene locus_tag LOCUS_30380 gene hybC 3101 4804 CDS product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083065.1 protein_id gnl|my_center|LOCUS_30380 4804 5298 gene locus_tag LOCUS_30390 4804 5298 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221946.1 protein_id gnl|my_center|LOCUS_30390 5291 5779 gene locus_tag LOCUS_30400 gene hybE 5291 5779 CDS product hydrogenase-2 assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134014.1 protein_id gnl|my_center|LOCUS_30400 5772 6113 gene locus_tag LOCUS_30410 gene hypA 5772 6113 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544952.1 protein_id gnl|my_center|LOCUS_30410 6126 6374 gene locus_tag LOCUS_30420 gene hybG 6126 6374 CDS product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334896.1 protein_id gnl|my_center|LOCUS_30420 7363 6497 gene locus_tag LOCUS_30430 gene yghU 7363 6497 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295515.1 protein_id gnl|my_center|LOCUS_30430 7568 9427 gene locus_tag LOCUS_30440 gene gss 7568 9427 CDS product bifunctional glutathionylspermidine amidase/synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297309.1 protein_id gnl|my_center|LOCUS_30440 9719 11218 gene locus_tag LOCUS_30450 gene pitB 9719 11218 CDS product inorganic phosphate transporter PitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933296.1 protein_id gnl|my_center|LOCUS_30450 11959 11267 gene locus_tag LOCUS_30460 11959 11267 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190781.1 protein_id gnl|my_center|LOCUS_30460 12172 12846 gene locus_tag LOCUS_30470 12172 12846 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076243.1 protein_id gnl|my_center|LOCUS_30470 12878 13636 gene locus_tag LOCUS_30480 12878 13636 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339531.1 protein_id gnl|my_center|LOCUS_30480 13682 15031 gene locus_tag LOCUS_30490 13682 15031 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896880.1 protein_id gnl|my_center|LOCUS_30490 15031 15855 gene locus_tag LOCUS_30500 15031 15855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984978.1 protein_id gnl|my_center|LOCUS_30500 15864 16427 gene locus_tag LOCUS_30510 15864 16427 CDS product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298770.1 protein_id gnl|my_center|LOCUS_30510 16458 17528 gene locus_tag LOCUS_30520 gene lptF 16458 17528 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779645.1 protein_id gnl|my_center|LOCUS_30520 17525 18604 gene locus_tag LOCUS_30530 gene lptG 17525 18604 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640208.1 protein_id gnl|my_center|LOCUS_30530 19811 18639 gene locus_tag LOCUS_30540 19811 18639 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524972.1 protein_id gnl|my_center|LOCUS_30540 20059 19811 gene locus_tag LOCUS_30550 20059 19811 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248097.1 protein_id gnl|my_center|LOCUS_30550 21005 20091 gene locus_tag LOCUS_30560 21005 20091 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145289.1 protein_id gnl|my_center|LOCUS_30560 22690 21002 gene locus_tag LOCUS_30570 22690 21002 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298766.1 protein_id gnl|my_center|LOCUS_30570 23100 24242 gene locus_tag LOCUS_30580 gene yghO 23100 24242 CDS product protein YghO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388786.1 protein_id gnl|my_center|LOCUS_30580 25013 24249 gene locus_tag LOCUS_30590 gene glcC 25013 24249 CDS product transcriptional regulator GlcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297764.1 protein_id gnl|my_center|LOCUS_30590 25264 26763 gene locus_tag LOCUS_30600 gene glcD 25264 26763 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026117.1 protein_id gnl|my_center|LOCUS_30600 26763 27815 gene locus_tag LOCUS_30610 gene glcE 26763 27815 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943059.1 protein_id gnl|my_center|LOCUS_30610 27826 29049 gene locus_tag LOCUS_30620 gene glcF 27826 29049 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194661.1 protein_id gnl|my_center|LOCUS_30620 29054 29458 gene locus_tag LOCUS_30630 29054 29458 CDS product GlcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853256.1 protein_id gnl|my_center|LOCUS_30630 29480 31651 gene locus_tag LOCUS_30640 gene glcB 29480 31651 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084131.1 protein_id gnl|my_center|LOCUS_30640 32006 33688 gene locus_tag LOCUS_30650 gene glcA 32006 33688 CDS product glycolate permease GlcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259302.1 protein_id gnl|my_center|LOCUS_30650 34306 38727 gene locus_tag LOCUS_30660 gene sslE 34306 38727 CDS product lipoprotein metalloprotease SslE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034472.1 protein_id gnl|my_center|LOCUS_30660 38891 39700 gene locus_tag LOCUS_30670 gene pppA 38891 39700 CDS product prepilin peptidase PppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895874.1 protein_id gnl|my_center|LOCUS_30670 39808 40176 gene locus_tag LOCUS_30680 gene gspS2 39808 40176 CDS product type II secretion system pilot lipoprotein GspS-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309757.1 protein_id gnl|my_center|LOCUS_30680 40323 41153 gene locus_tag LOCUS_30690 gene gspC 40323 41153 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317325.1 protein_id gnl|my_center|LOCUS_30690 41183 43243 gene locus_tag LOCUS_30700 gene gspD 41183 43243 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498829.1 protein_id gnl|my_center|LOCUS_30700 43243 44736 gene locus_tag LOCUS_30710 gene gspE 43243 44736 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249314.1 protein_id gnl|my_center|LOCUS_30710 44736 45959 gene locus_tag LOCUS_30720 gene gspF 44736 45959 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173410.1 protein_id gnl|my_center|LOCUS_30720 45976 46431 gene locus_tag LOCUS_30730 gene gspG 45976 46431 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087296.1 protein_id gnl|my_center|LOCUS_30730 46435 46998 gene locus_tag LOCUS_30740 gene gspH 46435 46998 CDS product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115140.1 protein_id gnl|my_center|LOCUS_30740 46995 47366 gene locus_tag LOCUS_30750 gene gspI 46995 47366 CDS product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820120.1 protein_id gnl|my_center|LOCUS_30750 47363 47968 gene locus_tag LOCUS_30760 gene gspJ 47363 47968 CDS product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250454.1 protein_id gnl|my_center|LOCUS_30760 47965 48942 gene locus_tag LOCUS_30770 gene gspK 47965 48942 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633238.1 protein_id gnl|my_center|LOCUS_30770 48939 50117 gene locus_tag LOCUS_30780 gene gspL 48939 50117 CDS product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095001.1 protein_id gnl|my_center|LOCUS_30780 50119 50655 gene locus_tag LOCUS_30790 gene yghD 50119 50655 CDS product GspM family type II secretion system protein YghD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942815.1 protein_id gnl|my_center|LOCUS_30790 51716 52492 gene locus_tag LOCUS_30800 51716 52492 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124279.1 protein_id gnl|my_center|LOCUS_30800 52489 53166 gene locus_tag LOCUS_30810 52489 53166 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590233.1 protein_id gnl|my_center|LOCUS_30810 53399 54751 gene locus_tag LOCUS_30820 53399 54751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 54769 55491 gene locus_tag LOCUS_30830 54769 55491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 >Feature sequence29 354 1637 gene locus_tag LOCUS_30840 354 1637 CDS product MHS family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347482.1 protein_id gnl|my_center|LOCUS_30840 1726 3186 gene locus_tag LOCUS_30850 1726 3186 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527804.1 protein_id gnl|my_center|LOCUS_30850 3425 3222 gene locus_tag LOCUS_30860 gene ydfZ 3425 3222 CDS product putative selenium delivery protein YdfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214712.1 protein_id gnl|my_center|LOCUS_30860 4288 3602 gene locus_tag LOCUS_30870 gene rspR 4288 3602 CDS product DNA-binding transcriptional regulator rspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215549.1 protein_id gnl|my_center|LOCUS_30870 5123 4377 gene locus_tag LOCUS_30880 gene ydfG 5123 4377 CDS product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636571.1 protein_id gnl|my_center|LOCUS_30880 5260 7305 gene locus_tag LOCUS_30890 gene dcp 5260 7305 CDS product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210373.1 protein_id gnl|my_center|LOCUS_30890 7867 7349 gene locus_tag LOCUS_30900 7867 7349 CDS product 2-oxo-tetronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024746.1 protein_id gnl|my_center|LOCUS_30900 8143 8535 gene locus_tag LOCUS_30910 gene ydeI 8143 8535 CDS product YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671737.1 protein_id gnl|my_center|LOCUS_30910 8790 9680 gene locus_tag LOCUS_30920 gene dgcZ 8790 9680 CDS product diguanylate cyclase DgcZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592814.1 protein_id gnl|my_center|LOCUS_30920 11221 10121 gene locus_tag LOCUS_30930 gene ydeE 11221 10121 CDS product efflux MFS transporter YdeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054189.1 protein_id gnl|my_center|LOCUS_30930 11503 12402 gene locus_tag LOCUS_30940 gene eamA 11503 12402 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087187.1 protein_id gnl|my_center|LOCUS_30940 12651 12433 gene locus_tag LOCUS_30950 gene marB 12651 12433 CDS product multiple antibiotic resistance protein MarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803657.1 protein_id gnl|my_center|LOCUS_30950 13066 12683 gene locus_tag LOCUS_30960 gene marA 13066 12683 CDS product MDR efflux pump AcrAB transcriptional activator MarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091199.1 protein_id gnl|my_center|LOCUS_30960 13520 13086 gene locus_tag LOCUS_30970 gene marR 13520 13086 CDS product multiple antibiotic resistance transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843414.1 protein_id gnl|my_center|LOCUS_30970 13740 14060 gene locus_tag LOCUS_30980 13740 14060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 14050 14334 gene locus_tag LOCUS_30990 14050 14334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 14455 15120 gene locus_tag LOCUS_31000 gene marC 14455 15120 CDS product NAAT family transporter MarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885033.1 protein_id gnl|my_center|LOCUS_31000 16335 15145 gene locus_tag LOCUS_31010 gene ydeA 16335 15145 CDS product L-arabinose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210785.1 protein_id gnl|my_center|LOCUS_31010 17600 16485 gene locus_tag LOCUS_31020 gene yneK 17600 16485 CDS product putative protein YneK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258599.1 protein_id gnl|my_center|LOCUS_31020 18559 17678 gene locus_tag LOCUS_31030 18559 17678 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366501.1 protein_id gnl|my_center|LOCUS_31030 18660 20048 gene locus_tag LOCUS_31040 gene sad 18660 20048 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156615.1 protein_id gnl|my_center|LOCUS_31040 20112 21038 gene locus_tag LOCUS_31050 gene glsB 20112 21038 CDS product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257409.1 protein_id gnl|my_center|LOCUS_31050 21038 21397 gene locus_tag LOCUS_31060 21038 21397 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191027.1 protein_id gnl|my_center|LOCUS_31060 21536 22954 gene locus_tag LOCUS_31070 21536 22954 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558061.1 protein_id gnl|my_center|LOCUS_31070 23181 24632 gene locus_tag LOCUS_31080 gene uxaB 23181 24632 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854633.1 protein_id gnl|my_center|LOCUS_31080 24839 25753 gene locus_tag LOCUS_31090 24839 25753 CDS product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637082.1 protein_id gnl|my_center|LOCUS_31090 26515 25757 gene locus_tag LOCUS_31100 gene tam 26515 25757 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286597.1 protein_id gnl|my_center|LOCUS_31100 26862 26572 gene locus_tag LOCUS_31110 gene lsrG 26862 26572 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558527.1 protein_id gnl|my_center|LOCUS_31110 27761 26886 gene locus_tag LOCUS_31120 gene lsrF 27761 26886 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774178.1 protein_id gnl|my_center|LOCUS_31120 28810 27788 gene locus_tag LOCUS_31130 gene lsrB 28810 27788 CDS product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172466.1 protein_id gnl|my_center|LOCUS_31130 29619 28822 gene locus_tag LOCUS_31140 gene lsrD 29619 28822 CDS product autoinducer 2 ABC transporter permease LsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222721.1 protein_id gnl|my_center|LOCUS_31140 29702 31174 gene locus_tag LOCUS_31150 29702 31174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 31379 31663 gene locus_tag LOCUS_31160 gene hipB 31379 31663 CDS product type II toxin-antitoxin system antitoxin HipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301023.1 protein_id gnl|my_center|LOCUS_31160 31663 32985 gene locus_tag LOCUS_31170 gene hipA 31663 32985 CDS product type II toxin-antitoxin system serine/threonine protein kinase toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125439.1 protein_id gnl|my_center|LOCUS_31170 33357 33839 gene locus_tag LOCUS_31180 33357 33839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 34200 34574 gene locus_tag LOCUS_31190 34200 34574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31190 34680 34910 gene locus_tag LOCUS_31200 34680 34910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31200 35006 35302 gene locus_tag LOCUS_31210 35006 35302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31210 35257 36390 gene locus_tag LOCUS_31220 35257 36390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31220 36454 37602 gene locus_tag LOCUS_31230 36454 37602 CDS product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017447.1 protein_id gnl|my_center|LOCUS_31230 37616 38146 gene locus_tag LOCUS_31240 37616 38146 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876763.1 protein_id gnl|my_center|LOCUS_31240 38159 38662 gene locus_tag LOCUS_31250 38159 38662 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825452.1 protein_id gnl|my_center|LOCUS_31250 38721 39635 gene locus_tag LOCUS_31260 38721 39635 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520676.1 protein_id gnl|my_center|LOCUS_31260 39969 42248 gene locus_tag LOCUS_31270 gene ydeP 39969 42248 CDS product acid resistance putative oxidoreductase YdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726691.1 protein_id gnl|my_center|LOCUS_31270 42496 42693 gene locus_tag LOCUS_31280 gene safA 42496 42693 CDS product two-component system connector SafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543384.1 protein_id gnl|my_center|LOCUS_31280 42768 43529 gene locus_tag LOCUS_31290 gene ydeO 42768 43529 CDS product acid stress response transcriptional regulator YdeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060493.1 protein_id gnl|my_center|LOCUS_31290 43931 45613 gene locus_tag LOCUS_31300 43931 45613 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303114.1 protein_id gnl|my_center|LOCUS_31300 45764 46822 gene locus_tag LOCUS_31310 45764 46822 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301030.1 protein_id gnl|my_center|LOCUS_31310 47206 48798 gene locus_tag LOCUS_31320 47206 48798 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628576.1 protein_id gnl|my_center|LOCUS_31320 48836 51208 gene locus_tag LOCUS_31330 48836 51208 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832437.1 protein_id gnl|my_center|LOCUS_31330 51265 54048 gene locus_tag LOCUS_31340 51265 54048 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723101.1 protein_id gnl|my_center|LOCUS_31340 >Feature sequence30 605 393 gene locus_tag LOCUS_31350 gene cspA 605 393 CDS product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014594.1 protein_id gnl|my_center|LOCUS_31350 1176 886 gene locus_tag LOCUS_31360 1176 886 CDS product HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455798.1 protein_id gnl|my_center|LOCUS_31360 1610 2320 gene locus_tag LOCUS_31370 1610 2320 CDS product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602794.1 protein_id gnl|my_center|LOCUS_31370 3344 2370 gene locus_tag LOCUS_31380 gene ghrB 3344 2370 CDS product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805027.1 protein_id gnl|my_center|LOCUS_31380 4107 3448 gene locus_tag LOCUS_31390 4107 3448 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747625.1 protein_id gnl|my_center|LOCUS_31390 4314 6593 gene locus_tag LOCUS_31400 gene bisC 4314 6593 CDS product biotin sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013950.1 protein_id gnl|my_center|LOCUS_31400 7002 6562 gene locus_tag LOCUS_31410 7002 6562 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617470.1 protein_id gnl|my_center|LOCUS_31410 7562 6999 gene locus_tag LOCUS_31420 gene tag 7562 6999 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438948.1 protein_id gnl|my_center|LOCUS_31420 7720 8418 gene locus_tag LOCUS_31430 7720 8418 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584472.1 protein_id gnl|my_center|LOCUS_31430 8647 9855 gene locus_tag LOCUS_31440 8647 9855 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189020.1 protein_id gnl|my_center|LOCUS_31440 10221 11870 gene locus_tag LOCUS_31450 gene eptB 10221 11870 CDS product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269197.1 protein_id gnl|my_center|LOCUS_31450 11962 12038 gene locus_tag LOCUS_t00480 11962 12038 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12949 14556 gene locus_tag LOCUS_31460 gene dppA 12949 14556 CDS product dipeptide ABC transporter substrate-binding protein DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222883.1 protein_id gnl|my_center|LOCUS_31460 14864 15883 gene locus_tag LOCUS_31470 gene dppB 14864 15883 CDS product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938855.1 protein_id gnl|my_center|LOCUS_31470 15893 16795 gene locus_tag LOCUS_31480 gene dppC 15893 16795 CDS product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084677.1 protein_id gnl|my_center|LOCUS_31480 16806 17789 gene locus_tag LOCUS_31490 gene dppD 16806 17789 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196486.1 protein_id gnl|my_center|LOCUS_31490 17786 18790 gene locus_tag LOCUS_31500 gene dppF 17786 18790 CDS product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107012.1 protein_id gnl|my_center|LOCUS_31500 20091 18820 gene locus_tag LOCUS_31510 20091 18820 CDS product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295225.1 protein_id gnl|my_center|LOCUS_31510 20399 20674 gene locus_tag LOCUS_31520 20399 20674 CDS product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254105.1 protein_id gnl|my_center|LOCUS_31520 21365 21640 gene locus_tag LOCUS_31530 21365 21640 CDS product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254108.1 protein_id gnl|my_center|LOCUS_31530 23406 21727 gene locus_tag LOCUS_31540 gene bcsG 23406 21727 CDS product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191622.1 protein_id gnl|my_center|LOCUS_31540 23594 23403 gene locus_tag LOCUS_31550 gene bcsF 23594 23403 CDS product cellulose biosynthesis protein BcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988308.1 protein_id gnl|my_center|LOCUS_31550 25150 23591 gene locus_tag LOCUS_31560 gene bcsE 25150 23591 CDS product cellulose biosynthesis c-di-GMP-binding protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204931.1 protein_id gnl|my_center|LOCUS_31560 25435 25623 gene locus_tag LOCUS_31570 gene bcsR 25435 25623 CDS product cellulose biosynthesis protein BcsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063318.1 protein_id gnl|my_center|LOCUS_31570 25635 26387 gene locus_tag LOCUS_31580 gene bcsQ 25635 26387 CDS product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279528.1 protein_id gnl|my_center|LOCUS_31580 26384 29002 gene locus_tag LOCUS_31590 gene bcsA 26384 29002 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025892.1 protein_id gnl|my_center|LOCUS_31590 29013 31352 gene locus_tag LOCUS_31600 gene bcsB 29013 31352 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307454.1 protein_id gnl|my_center|LOCUS_31600 31359 32465 gene locus_tag LOCUS_31610 gene bcsZ 31359 32465 CDS product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302749.1 protein_id gnl|my_center|LOCUS_31610 32447 35920 gene locus_tag LOCUS_31620 gene bcsC 32447 35920 CDS product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225124.1 protein_id gnl|my_center|LOCUS_31620 36041 37990 gene locus_tag LOCUS_31630 gene hmsP 36041 37990 CDS product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266293.1 protein_id gnl|my_center|LOCUS_31630 38173 39459 gene locus_tag LOCUS_31640 gene dctA 38173 39459 CDS product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858214.1 protein_id gnl|my_center|LOCUS_31640 39680 41176 gene locus_tag LOCUS_31650 39680 41176 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163141.1 protein_id gnl|my_center|LOCUS_31650 42201 41272 gene locus_tag LOCUS_31660 gene kdgK 42201 41272 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306595.1 protein_id gnl|my_center|LOCUS_31660 42565 43200 gene locus_tag LOCUS_31670 gene pdeH 42565 43200 CDS product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295219.1 protein_id gnl|my_center|LOCUS_31670 43270 45330 gene locus_tag LOCUS_31680 43270 45330 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296794.1 protein_id gnl|my_center|LOCUS_31680 46834 45512 gene locus_tag LOCUS_31690 46834 45512 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149003.1 protein_id gnl|my_center|LOCUS_31690 48258 47245 gene locus_tag LOCUS_31700 gene yhjD 48258 47245 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191237.1 protein_id gnl|my_center|LOCUS_31700 49188 48307 gene locus_tag LOCUS_31710 49188 48307 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357790.1 protein_id gnl|my_center|LOCUS_31710 49726 50328 gene locus_tag LOCUS_31720 49726 50328 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167676.1 protein_id gnl|my_center|LOCUS_31720 52028 50379 gene locus_tag LOCUS_31730 52028 50379 CDS product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934218.1 protein_id gnl|my_center|LOCUS_31730 52433 53830 gene locus_tag LOCUS_31740 gene ccp 52433 53830 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784827.1 protein_id gnl|my_center|LOCUS_31740 >Feature sequence31 1011 34 gene locus_tag LOCUS_31750 gene rdgC 1011 34 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298537.1 protein_id gnl|my_center|LOCUS_31750 1070 1978 gene locus_tag LOCUS_31760 gene mak 1070 1978 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219309.1 protein_id gnl|my_center|LOCUS_31760 3491 2223 gene locus_tag LOCUS_31770 gene araJ 3491 2223 CDS product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196824.1 protein_id gnl|my_center|LOCUS_31770 6679 3533 gene locus_tag LOCUS_31780 gene sbcC 6679 3533 CDS product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698951.1 protein_id gnl|my_center|LOCUS_31780 7878 6676 gene locus_tag LOCUS_31790 gene sbcD 7878 6676 CDS product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221319.1 protein_id gnl|my_center|LOCUS_31790 8068 8757 gene locus_tag LOCUS_31800 gene phoB 8068 8757 CDS product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113933.1 protein_id gnl|my_center|LOCUS_31800 8815 10110 gene locus_tag LOCUS_31810 gene phoR 8815 10110 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893611.1 protein_id gnl|my_center|LOCUS_31810 10517 11836 gene locus_tag LOCUS_31820 gene brnQ 10517 11836 CDS product branched-chain amino acid transporter carrier protein BrnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149639.1 protein_id gnl|my_center|LOCUS_31820 11912 13285 gene locus_tag LOCUS_31830 gene proY 11912 13285 CDS product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295329.1 protein_id gnl|my_center|LOCUS_31830 13441 15258 gene locus_tag LOCUS_31840 gene malZ 13441 15258 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930752.1 protein_id gnl|my_center|LOCUS_31840 15607 15263 gene locus_tag LOCUS_31850 15607 15263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31850 15844 15653 gene locus_tag LOCUS_31860 15844 15653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31860 15937 17007 gene locus_tag LOCUS_31870 15937 17007 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266503.1 protein_id gnl|my_center|LOCUS_31870 17063 18190 gene locus_tag LOCUS_31880 17063 18190 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667319.1 protein_id gnl|my_center|LOCUS_31880 18213 18545 gene locus_tag LOCUS_31890 gene yajC 18213 18545 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007629.1 protein_id gnl|my_center|LOCUS_31890 18606 20420 gene locus_tag LOCUS_31900 gene secD 18606 20420 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934822.1 protein_id gnl|my_center|LOCUS_31900 20431 21402 gene locus_tag LOCUS_31910 gene secF 20431 21402 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046637.1 protein_id gnl|my_center|LOCUS_31910 21530 21877 gene locus_tag LOCUS_31920 gene yajD 21530 21877 CDS product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974813.1 protein_id gnl|my_center|LOCUS_31920 22938 22165 gene locus_tag LOCUS_31930 gene tsx 22938 22165 CDS product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295328.1 protein_id gnl|my_center|LOCUS_31930 23776 23237 gene locus_tag LOCUS_31940 23776 23237 CDS product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949994.1 protein_id gnl|my_center|LOCUS_31940 23927 24376 gene locus_tag LOCUS_31950 gene nrdR 23927 24376 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543535.1 protein_id gnl|my_center|LOCUS_31950 24380 25483 gene locus_tag LOCUS_31960 gene ribD 24380 25483 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150457.1 protein_id gnl|my_center|LOCUS_31960 25572 26042 gene locus_tag LOCUS_31970 gene ribE 25572 26042 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021161.1 protein_id gnl|my_center|LOCUS_31970 26062 26481 gene locus_tag LOCUS_31980 gene nusB 26062 26481 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801125.1 protein_id gnl|my_center|LOCUS_31980 26559 27536 gene locus_tag LOCUS_31990 gene thiL 26559 27536 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742109.1 protein_id gnl|my_center|LOCUS_31990 27514 28032 gene locus_tag LOCUS_32000 gene pgpA 27514 28032 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154044.1 protein_id gnl|my_center|LOCUS_32000 29060 28086 gene locus_tag LOCUS_32010 gene yajO 29060 28086 CDS product 1-deoxyxylulose-5-phosphate synthase YajO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199799.1 protein_id gnl|my_center|LOCUS_32010 31102 29240 gene locus_tag LOCUS_32020 gene dxs 31102 29240 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006797.1 protein_id gnl|my_center|LOCUS_32020 32026 31127 gene locus_tag LOCUS_32030 gene ispA 32026 31127 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347217.1 protein_id gnl|my_center|LOCUS_32030 32268 32026 gene locus_tag LOCUS_32040 gene xseB 32268 32026 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124935.1 protein_id gnl|my_center|LOCUS_32040 32474 33922 gene locus_tag LOCUS_32050 gene thiI 32474 33922 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668685.1 protein_id gnl|my_center|LOCUS_32050 34566 33976 gene locus_tag LOCUS_32060 gene yajL 34566 33976 CDS product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276309.1 protein_id gnl|my_center|LOCUS_32060 35440 34529 gene locus_tag LOCUS_32070 gene panE 35440 34529 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705865.1 protein_id gnl|my_center|LOCUS_32070 35608 36099 gene locus_tag LOCUS_32080 gene yajQ 35608 36099 CDS product nucleotide binding protein YajQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138904.1 protein_id gnl|my_center|LOCUS_32080 37591 36227 gene locus_tag LOCUS_32090 37591 36227 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000978.1 protein_id gnl|my_center|LOCUS_32090 38008 38943 gene locus_tag LOCUS_32100 38008 38943 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297127.1 protein_id gnl|my_center|LOCUS_32100 39541 38999 gene locus_tag LOCUS_32110 39541 38999 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227784.1 protein_id gnl|my_center|LOCUS_32110 39836 39525 gene locus_tag LOCUS_32120 39836 39525 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297137.1 protein_id gnl|my_center|LOCUS_32120 40911 40021 gene locus_tag LOCUS_32130 gene cyoE 40911 40021 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971336.1 protein_id gnl|my_center|LOCUS_32130 41252 40923 gene locus_tag LOCUS_32140 41252 40923 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019869.1 protein_id gnl|my_center|LOCUS_32140 41767 41252 gene locus_tag LOCUS_32150 41767 41252 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179819.1 protein_id gnl|my_center|LOCUS_32150 43847 41856 gene locus_tag LOCUS_32160 gene cyoB 43847 41856 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467180.1 protein_id gnl|my_center|LOCUS_32160 44756 43869 gene locus_tag LOCUS_32170 gene cyoA 44756 43869 CDS product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239441.1 protein_id gnl|my_center|LOCUS_32170 46753 45278 gene locus_tag LOCUS_32180 gene ampG 46753 45278 CDS product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098438.1 protein_id gnl|my_center|LOCUS_32180 47375 46797 gene locus_tag LOCUS_32190 47375 46797 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295326.1 protein_id gnl|my_center|LOCUS_32190 47680 47997 gene locus_tag LOCUS_32200 gene bolA 47680 47997 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973448.1 protein_id gnl|my_center|LOCUS_32200 48341 49639 gene locus_tag LOCUS_32210 gene tig 48341 49639 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198384.1 protein_id gnl|my_center|LOCUS_32210 49885 50508 gene locus_tag LOCUS_32220 gene clpP 49885 50508 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122253.1 protein_id gnl|my_center|LOCUS_32220 50634 51908 gene locus_tag LOCUS_32230 gene clpX 50634 51908 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130305.1 protein_id gnl|my_center|LOCUS_32230 >Feature sequence32 34 4281 gene locus_tag LOCUS_32240 gene rhsD 34 4281 CDS product rhs element protein RhsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014739.1 protein_id gnl|my_center|LOCUS_32240 4321 4689 gene locus_tag LOCUS_32250 4321 4689 CDS product YbbC/YhhH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877768.1 protein_id gnl|my_center|LOCUS_32250 4689 5399 gene locus_tag LOCUS_32260 4689 5399 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300714.1 protein_id gnl|my_center|LOCUS_32260 5410 5640 gene locus_tag LOCUS_32270 5410 5640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001320180.1 protein_id gnl|my_center|LOCUS_32270 5697 5870 gene locus_tag LOCUS_32280 5697 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32280 6755 6384 gene locus_tag LOCUS_32290 6755 6384 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903287.1 protein_id gnl|my_center|LOCUS_32290 7965 6871 gene locus_tag LOCUS_32300 gene mnmH 7965 6871 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157938.1 protein_id gnl|my_center|LOCUS_32300 8960 8034 gene locus_tag LOCUS_32310 gene allS 8960 8034 CDS product HTH-type transcriptional activator AllS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460145.1 protein_id gnl|my_center|LOCUS_32310 9190 9672 gene locus_tag LOCUS_32320 gene allA 9190 9672 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776388.1 protein_id gnl|my_center|LOCUS_32320 9795 10565 gene locus_tag LOCUS_32330 gene allR 9795 10565 CDS product HTH-type transcriptional repressor AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141275.1 protein_id gnl|my_center|LOCUS_32330 10655 12436 gene locus_tag LOCUS_32340 gene gcl 10655 12436 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096881.1 protein_id gnl|my_center|LOCUS_32340 12449 13225 gene locus_tag LOCUS_32350 gene hyi 12449 13225 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943544.1 protein_id gnl|my_center|LOCUS_32350 13325 14203 gene locus_tag LOCUS_32360 gene glxR 13325 14203 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765839.1 protein_id gnl|my_center|LOCUS_32360 14372 15826 gene locus_tag LOCUS_32370 14372 15826 CDS product putative allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401100.1 protein_id gnl|my_center|LOCUS_32370 15886 17247 gene locus_tag LOCUS_32380 gene allB 15886 17247 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006887.1 protein_id gnl|my_center|LOCUS_32380 17304 18605 gene locus_tag LOCUS_32390 17304 18605 CDS product uracil/xanthine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298987.1 protein_id gnl|my_center|LOCUS_32390 18627 19772 gene locus_tag LOCUS_32400 gene glxK 18627 19772 CDS product glycerate 3-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706355.1 protein_id gnl|my_center|LOCUS_32400 20785 20000 gene locus_tag LOCUS_32410 gene allE 20785 20000 CDS product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540946.1 protein_id gnl|my_center|LOCUS_32410 22031 20796 gene locus_tag LOCUS_32420 gene allC 22031 20796 CDS product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310618.1 protein_id gnl|my_center|LOCUS_32420 23102 22053 gene locus_tag LOCUS_32430 gene allD 23102 22053 CDS product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703914.1 protein_id gnl|my_center|LOCUS_32430 23419 25086 gene locus_tag LOCUS_32440 23419 25086 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580831.1 protein_id gnl|my_center|LOCUS_32440 25096 26355 gene locus_tag LOCUS_32450 25096 26355 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495385.1 protein_id gnl|my_center|LOCUS_32450 26366 27181 gene locus_tag LOCUS_32460 26366 27181 CDS product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152519.1 protein_id gnl|my_center|LOCUS_32460 27178 28071 gene locus_tag LOCUS_32470 27178 28071 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855388.1 protein_id gnl|my_center|LOCUS_32470 29275 28208 gene locus_tag LOCUS_32480 gene purK 29275 28208 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815540.1 protein_id gnl|my_center|LOCUS_32480 29781 29272 gene locus_tag LOCUS_32490 gene purE 29781 29272 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295318.1 protein_id gnl|my_center|LOCUS_32490 30621 29899 gene locus_tag LOCUS_32500 gene lpxH 30621 29899 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212252.1 protein_id gnl|my_center|LOCUS_32500 31118 30624 gene locus_tag LOCUS_32510 gene ppiB 31118 30624 CDS product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255997.1 protein_id gnl|my_center|LOCUS_32510 31292 32677 gene locus_tag LOCUS_32520 gene cysS 31292 32677 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912345.1 protein_id gnl|my_center|LOCUS_32520 33234 32713 gene locus_tag LOCUS_32530 33234 32713 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143558.1 protein_id gnl|my_center|LOCUS_32530 33554 33342 gene locus_tag LOCUS_32540 gene ybcJ 33554 33342 CDS product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310620.1 protein_id gnl|my_center|LOCUS_32540 34422 33556 gene locus_tag LOCUS_32550 gene folD 34422 33556 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729160.1 protein_id gnl|my_center|LOCUS_32550 34893 35435 gene locus_tag LOCUS_32560 gene fimA 34893 35435 CDS product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776555.1 protein_id gnl|my_center|LOCUS_32560 35655 36347 gene locus_tag LOCUS_32570 gene fimC 35655 36347 CDS product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988364.1 protein_id gnl|my_center|LOCUS_32570 36378 38987 gene locus_tag LOCUS_32580 36378 38987 CDS product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301865.1 protein_id gnl|my_center|LOCUS_32580 39029 40006 gene locus_tag LOCUS_32590 gene fimH 39029 40006 CDS product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240464.1 protein_id gnl|my_center|LOCUS_32590 40017 40532 gene locus_tag LOCUS_32600 gene sfmF 40017 40532 CDS product fimbria assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255230.1 protein_id gnl|my_center|LOCUS_32600 41167 40535 gene locus_tag LOCUS_32610 gene fimZ 41167 40535 CDS product fimbria biosynthesis transcriptional regulator FimZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805422.1 protein_id gnl|my_center|LOCUS_32610 41410 41486 gene locus_tag LOCUS_t00490 41410 41486 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 42665 41502 gene locus_tag LOCUS_32620 42665 41502 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299447.1 protein_id gnl|my_center|LOCUS_32620 43142 42864 gene locus_tag LOCUS_32630 43142 42864 CDS product DUF4222 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488407.1 protein_id gnl|my_center|LOCUS_32630 43722 43507 gene locus_tag LOCUS_32640 43722 43507 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386642.1 protein_id gnl|my_center|LOCUS_32640 44199 44411 gene locus_tag LOCUS_32650 44199 44411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 44408 44710 gene locus_tag LOCUS_32660 44408 44710 CDS product protein ren inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145915.1 protein_id gnl|my_center|LOCUS_32660 44778 45110 gene locus_tag LOCUS_32670 gene emrE 44778 45110 CDS product SMR family multidrug efflux protein EmrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070446.1 protein_id gnl|my_center|LOCUS_32670 45365 46891 gene locus_tag LOCUS_32680 45365 46891 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709082.1 protein_id gnl|my_center|LOCUS_32680 47356 47907 gene locus_tag LOCUS_32690 gene ybcL 47356 47907 CDS product Raf kinase inhibitor-like protein YbcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306955.1 protein_id gnl|my_center|LOCUS_32690 47917 48714 gene locus_tag LOCUS_32700 47917 48714 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881075.1 protein_id gnl|my_center|LOCUS_32700 48929 49384 gene locus_tag LOCUS_32710 gene ybcN 48929 49384 CDS product DNA base-flipping protein YbcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054340.1 protein_id gnl|my_center|LOCUS_32710 49384 49554 gene locus_tag LOCUS_32720 49384 49554 CDS product NinE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224907.1 protein_id gnl|my_center|LOCUS_32720 49547 49837 gene locus_tag LOCUS_32730 49547 49837 CDS product DUF1364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774486.1 protein_id gnl|my_center|LOCUS_32730 49834 50196 gene locus_tag LOCUS_32740 gene rusA 49834 50196 CDS product crossover junction endodeoxyribonuclease RusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099522.1 protein_id gnl|my_center|LOCUS_32740 50419 50802 gene locus_tag LOCUS_32750 gene quuD 50419 50802 CDS product antitermination protein QuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204780.1 protein_id gnl|my_center|LOCUS_32750 <51568 50992 gene locus_tag LOCUS_32760 <51568 50992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000737271.1:porin OmpC >Feature sequence33 2616 3224 gene locus_tag LOCUS_32770 2616 3224 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779792.1 protein_id gnl|my_center|LOCUS_32770 3322 4713 gene locus_tag LOCUS_32780 gene selA 3322 4713 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206275.1 protein_id gnl|my_center|LOCUS_32780 4710 6554 gene locus_tag LOCUS_32790 gene selB 4710 6554 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582468.1 protein_id gnl|my_center|LOCUS_32790 6744 7895 gene locus_tag LOCUS_32800 gene yiaY 6744 7895 CDS product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741518.1 protein_id gnl|my_center|LOCUS_32800 8060 9598 gene locus_tag LOCUS_32810 gene aldB 8060 9598 CDS product aldehyde dehydrogenase AldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183980.1 protein_id gnl|my_center|LOCUS_32810 10029 9817 gene locus_tag LOCUS_32820 10029 9817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332751.1 protein_id gnl|my_center|LOCUS_32820 10143 10466 gene locus_tag LOCUS_32830 10143 10466 CDS product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478195.1 protein_id gnl|my_center|LOCUS_32830 10472 11608 gene locus_tag LOCUS_32840 10472 11608 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364884.1 protein_id gnl|my_center|LOCUS_32840 12579 11605 gene locus_tag LOCUS_32850 12579 11605 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164036.1 protein_id gnl|my_center|LOCUS_32850 12703 13443 gene locus_tag LOCUS_32860 12703 13443 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906806.1 protein_id gnl|my_center|LOCUS_32860 15543 13564 gene locus_tag LOCUS_32870 15543 13564 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026882.1 protein_id gnl|my_center|LOCUS_32870 16954 15554 gene locus_tag LOCUS_32880 16954 15554 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204819.1 protein_id gnl|my_center|LOCUS_32880 17180 17995 gene locus_tag LOCUS_32890 17180 17995 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891843.1 protein_id gnl|my_center|LOCUS_32890 18722 18027 gene locus_tag LOCUS_32900 gene araD 18722 18027 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893142.1 protein_id gnl|my_center|LOCUS_32900 19576 18716 gene locus_tag LOCUS_32910 19576 18716 CDS product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296811.1 protein_id gnl|my_center|LOCUS_32910 20231 19569 gene locus_tag LOCUS_32920 gene ulaD 20231 19569 CDS product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089497.1 protein_id gnl|my_center|LOCUS_32920 21724 20228 gene locus_tag LOCUS_32930 gene lyxK 21724 20228 CDS product L-xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196054.1 protein_id gnl|my_center|LOCUS_32930 22714 21728 gene locus_tag LOCUS_32940 gene yiaO 22714 21728 CDS product 2,3-diketo-L-gulonate transporter substrate-binding protein YiaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776887.1 protein_id gnl|my_center|LOCUS_32940 24004 22727 gene locus_tag LOCUS_32950 gene yiaN 24004 22727 CDS product 2,3-diketo-L-gulonate transporter large permease YiaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279599.1 protein_id gnl|my_center|LOCUS_32950 24480 24007 gene locus_tag LOCUS_32960 gene yiaM 24480 24007 CDS product 2,3-diketo-L-gulonate TRAP transporter small permease YiaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721664.1 protein_id gnl|my_center|LOCUS_32960 25065 24598 gene locus_tag LOCUS_32970 25065 24598 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576079.1 protein_id gnl|my_center|LOCUS_32970 26075 25077 gene locus_tag LOCUS_32980 gene yiaK 26075 25077 CDS product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869037.1 protein_id gnl|my_center|LOCUS_32980 26276 27124 gene locus_tag LOCUS_32990 gene yiaJ 26276 27124 CDS product IclR family transcriptional regulator YiaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514240.1 protein_id gnl|my_center|LOCUS_32990 27226 27699 gene locus_tag LOCUS_33000 27226 27699 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300918.1 protein_id gnl|my_center|LOCUS_33000 29103 27850 gene locus_tag LOCUS_33010 gene avtA 29103 27850 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144361.1 protein_id gnl|my_center|LOCUS_33010 31311 29281 gene locus_tag LOCUS_33020 gene malS 31311 29281 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761225.1 protein_id gnl|my_center|LOCUS_33020 31883 32455 gene locus_tag LOCUS_33030 31883 32455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 33829 32651 gene locus_tag LOCUS_33040 gene xylR 33829 32651 CDS product DNA-binding transcriptional regulator XylR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494484.1 protein_id gnl|my_center|LOCUS_33040 35088 33907 gene locus_tag LOCUS_33050 gene xylH 35088 33907 CDS product xylose ABC transporter permease XylH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045978.1 protein_id gnl|my_center|LOCUS_33050 35392 35066 gene locus_tag LOCUS_33060 35392 35066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33060 36606 35389 gene locus_tag LOCUS_33070 gene xylG 36606 35389 CDS product D-xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146479.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33070 37675 36683 gene locus_tag LOCUS_33080 gene xylF 37675 36683 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694881.1 protein_id gnl|my_center|LOCUS_33080 38041 39363 gene locus_tag LOCUS_33090 gene xylA 38041 39363 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149592.1 protein_id gnl|my_center|LOCUS_33090 39435 40889 gene locus_tag LOCUS_33100 gene xylB 39435 40889 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275334.1 protein_id gnl|my_center|LOCUS_33100 41058 41399 gene locus_tag LOCUS_33110 gene yiaB 41058 41399 CDS product inner membrane protein YiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295228.1 protein_id gnl|my_center|LOCUS_33110 41445 41882 gene locus_tag LOCUS_33120 gene yiaA 41445 41882 CDS product inner membrane protein YiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296808.1 protein_id gnl|my_center|LOCUS_33120 42919 41924 gene locus_tag LOCUS_33130 gene wecH 42919 41924 CDS product O-acetyltransferase WecH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182641.1 protein_id gnl|my_center|LOCUS_33130 43181 43393 gene locus_tag LOCUS_33140 43181 43393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 43488 44399 gene locus_tag LOCUS_33150 gene glyQ 43488 44399 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168544.1 protein_id gnl|my_center|LOCUS_33150 44409 46478 gene locus_tag LOCUS_33160 gene glyS 44409 46478 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291772.1 protein_id gnl|my_center|LOCUS_33160 >Feature sequence34 263 1411 gene locus_tag LOCUS_33170 gene fucO 263 1411 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013588.1 protein_id gnl|my_center|LOCUS_33170 2221 1466 gene locus_tag LOCUS_33180 gene xni 2221 1466 CDS product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268232.1 protein_id gnl|my_center|LOCUS_33180 3700 2333 gene locus_tag LOCUS_33190 gene sdaB 3700 2333 CDS product L-serine ammonia-lyase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626410.1 protein_id gnl|my_center|LOCUS_33190 5047 3758 gene locus_tag LOCUS_33200 gene sdaC 5047 3758 CDS product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450476.1 protein_id gnl|my_center|LOCUS_33200 6968 5604 gene locus_tag LOCUS_33210 gene ppnN 6968 5604 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627995.1 protein_id gnl|my_center|LOCUS_33210 7928 7080 gene locus_tag LOCUS_33220 gene queF 7928 7080 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100421.1 protein_id gnl|my_center|LOCUS_33220 7996 8541 gene locus_tag LOCUS_33230 gene syd 7996 8541 CDS product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342431.1 protein_id gnl|my_center|LOCUS_33230 8655 8497 gene locus_tag LOCUS_33240 8655 8497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 9163 9492 gene locus_tag LOCUS_33250 9163 9492 CDS product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206990.1 protein_id gnl|my_center|LOCUS_33250 9492 10274 gene locus_tag LOCUS_33260 gene truC 9492 10274 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890001.1 protein_id gnl|my_center|LOCUS_33260 10292 10741 gene locus_tag LOCUS_33270 10292 10741 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807756.1 protein_id gnl|my_center|LOCUS_33270 11176 12528 gene locus_tag LOCUS_33280 gene gudP 11176 12528 CDS product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097082.1 protein_id gnl|my_center|LOCUS_33280 12530 13870 gene locus_tag LOCUS_33290 12530 13870 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211753.1 protein_id gnl|my_center|LOCUS_33290 13891 15231 gene locus_tag LOCUS_33300 gene gudD 13891 15231 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098255.1 protein_id gnl|my_center|LOCUS_33300 18220 15464 gene locus_tag LOCUS_33310 gene barA 18220 15464 CDS product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186450.1 protein_id gnl|my_center|LOCUS_33310 18277 19578 gene locus_tag LOCUS_33320 gene rlmD 18277 19578 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046812.1 protein_id gnl|my_center|LOCUS_33320 19626 21860 gene locus_tag LOCUS_33330 19626 21860 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226815.1 protein_id gnl|my_center|LOCUS_33330 21938 22186 gene locus_tag LOCUS_33340 gene mazE 21938 22186 CDS product type II toxin-antitoxin system antitoxin MazE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581937.1 protein_id gnl|my_center|LOCUS_33340 22186 22521 gene locus_tag LOCUS_33350 gene mazF 22186 22521 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254738.1 protein_id gnl|my_center|LOCUS_33350 22592 23383 gene locus_tag LOCUS_33360 gene mazG 22592 23383 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071648.1 protein_id gnl|my_center|LOCUS_33360 23611 25248 gene locus_tag LOCUS_33370 gene pyrG 23611 25248 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210878.1 protein_id gnl|my_center|LOCUS_33370 25336 26634 gene locus_tag LOCUS_33380 gene eno 25336 26634 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036723.1 protein_id gnl|my_center|LOCUS_33380 27566 26694 gene locus_tag LOCUS_33390 27566 26694 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268460.1 protein_id gnl|my_center|LOCUS_33390 27720 27580 gene locus_tag LOCUS_33400 gene yqcG 27720 27580 CDS product cell envelope stress response protein YqcG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288228.1 protein_id gnl|my_center|LOCUS_33400 27859 28530 gene locus_tag LOCUS_33410 gene queE 27859 28530 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199973.1 protein_id gnl|my_center|LOCUS_33410 28870 29692 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcgccagcggggataaaccg 31809 30331 gene locus_tag LOCUS_33420 31809 30331 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039688.1 protein_id gnl|my_center|LOCUS_33420 33113 31836 gene locus_tag LOCUS_33430 33113 31836 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164544.1 protein_id gnl|my_center|LOCUS_33430 33432 34217 gene locus_tag LOCUS_33440 33432 34217 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021321.1 protein_id gnl|my_center|LOCUS_33440 34287 35741 gene locus_tag LOCUS_33450 34287 35741 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059307.1 protein_id gnl|my_center|LOCUS_33450 35835 37172 gene locus_tag LOCUS_33460 35835 37172 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098105.1 protein_id gnl|my_center|LOCUS_33460 37150 37929 gene locus_tag LOCUS_33470 37150 37929 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299652.1 protein_id gnl|my_center|LOCUS_33470 37926 38786 gene locus_tag LOCUS_33480 37926 38786 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299097.1 protein_id gnl|my_center|LOCUS_33480 39509 38934 gene locus_tag LOCUS_33490 39509 38934 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130266.1 protein_id gnl|my_center|LOCUS_33490 39786 39526 gene locus_tag LOCUS_33500 39786 39526 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109532.1 protein_id gnl|my_center|LOCUS_33500 41048 39777 gene locus_tag LOCUS_33510 41048 39777 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301334.1 protein_id gnl|my_center|LOCUS_33510 41491 41126 gene locus_tag LOCUS_33520 gene queD 41491 41126 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987944.1 protein_id gnl|my_center|LOCUS_33520 41807 43606 gene locus_tag LOCUS_33530 gene cysJ 41807 43606 CDS product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211913.1 protein_id gnl|my_center|LOCUS_33530 43606 45318 gene locus_tag LOCUS_33540 gene cysI 43606 45318 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290706.1 protein_id gnl|my_center|LOCUS_33540 45392 46126 gene locus_tag LOCUS_33550 gene cysH 45392 46126 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039862.1 protein_id gnl|my_center|LOCUS_33550 >Feature sequence35 1051 377 gene locus_tag LOCUS_33560 gene gltK 1051 377 CDS product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272824.1 protein_id gnl|my_center|LOCUS_33560 1791 1051 gene locus_tag LOCUS_33570 gene gltJ 1791 1051 CDS product glutamate/aspartate ABC transporter permease GltJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020941.1 protein_id gnl|my_center|LOCUS_33570 2869 1961 gene locus_tag LOCUS_33580 gene gltI 2869 1961 CDS product glutamate/aspartate ABC transporter substrate-binding protein GltI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177085.1 protein_id gnl|my_center|LOCUS_33580 3324 5201 gene locus_tag LOCUS_33590 3324 5201 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276780.1 protein_id gnl|my_center|LOCUS_33590 6866 5328 gene locus_tag LOCUS_33600 gene lnt 6866 5328 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853024.1 protein_id gnl|my_center|LOCUS_33600 7769 6891 gene locus_tag LOCUS_33610 gene corC 7769 6891 CDS product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278605.1 protein_id gnl|my_center|LOCUS_33610 8326 7859 gene locus_tag LOCUS_33620 gene ybeY 8326 7859 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084469.1 protein_id gnl|my_center|LOCUS_33620 9363 8323 gene locus_tag LOCUS_33630 9363 8323 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018040.1 protein_id gnl|my_center|LOCUS_33630 10940 9516 gene locus_tag LOCUS_33640 gene miaB 10940 9516 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162740.1 protein_id gnl|my_center|LOCUS_33640 11086 12261 gene locus_tag LOCUS_33650 gene ubiF 11086 12261 CDS product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184541.1 protein_id gnl|my_center|LOCUS_33650 12436 12619 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12762 12686 gene locus_tag LOCUS_t00500 12762 12686 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12852 12778 gene locus_tag LOCUS_t00510 12852 12778 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12961 12887 gene locus_tag LOCUS_t00520 12961 12887 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 13069 12985 gene locus_tag LOCUS_t00530 13069 12985 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13154 13078 gene locus_tag LOCUS_t00540 13154 13078 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 15199 13535 gene locus_tag LOCUS_33660 gene asnB 15199 13535 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337077.1 protein_id gnl|my_center|LOCUS_33660 16348 15596 gene locus_tag LOCUS_33670 gene nagD 16348 15596 CDS product ribonucleotide monophosphatase NagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153129.1 protein_id gnl|my_center|LOCUS_33670 17616 16396 gene locus_tag LOCUS_33680 gene nagC 17616 16396 CDS product DNA-binding transcriptional regulator NagC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187594.1 protein_id gnl|my_center|LOCUS_33680 18773 17625 gene locus_tag LOCUS_33690 gene nagA 18773 17625 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271154.1 protein_id gnl|my_center|LOCUS_33690 19633 18833 gene locus_tag LOCUS_33700 gene nagB 19633 18833 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237072.1 protein_id gnl|my_center|LOCUS_33700 19966 21912 gene locus_tag LOCUS_33710 gene nagE 19966 21912 CDS product PTS N-acetyl glucosamine transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023115.1 protein_id gnl|my_center|LOCUS_33710 22115 23779 gene locus_tag LOCUS_33720 gene glnS 22115 23779 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287154.1 protein_id gnl|my_center|LOCUS_33720 24356 25762 gene locus_tag LOCUS_33730 gene chiP 24356 25762 CDS product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258839.1 protein_id gnl|my_center|LOCUS_33730 25812 26138 gene locus_tag LOCUS_33740 gene chiQ 25812 26138 CDS product ChiQ/YbfN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733592.1 protein_id gnl|my_center|LOCUS_33740 26668 26222 gene locus_tag LOCUS_33750 gene fur 26668 26222 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131702.1 protein_id gnl|my_center|LOCUS_33750 27487 26957 gene locus_tag LOCUS_33760 gene fldA 27487 26957 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018618.1 protein_id gnl|my_center|LOCUS_33760 27989 27627 gene locus_tag LOCUS_33770 gene ybfE 27989 27627 CDS product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291238.1 protein_id gnl|my_center|LOCUS_33770 28824 28060 gene locus_tag LOCUS_33780 gene ybfF 28824 28060 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773301.1 protein_id gnl|my_center|LOCUS_33780 29009 29554 gene locus_tag LOCUS_33790 gene seqA 29009 29554 CDS product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848387.1 protein_id gnl|my_center|LOCUS_33790 29580 31220 gene locus_tag LOCUS_33800 gene pgm 29580 31220 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297249.1 protein_id gnl|my_center|LOCUS_33800 31464 31928 gene locus_tag LOCUS_33810 31464 31928 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856353.1 protein_id gnl|my_center|LOCUS_33810 32619 31969 gene locus_tag LOCUS_33820 32619 31969 CDS product DUF2625 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017803196.1 protein_id gnl|my_center|LOCUS_33820 34287 32968 gene locus_tag LOCUS_33830 gene potE 34287 32968 CDS product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075845.1 protein_id gnl|my_center|LOCUS_33830 36482 34284 gene locus_tag LOCUS_33840 gene speF 36482 34284 CDS product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040195.1 protein_id gnl|my_center|LOCUS_33840 36605 36862 gene locus_tag LOCUS_33850 36605 36862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171592.1 protein_id gnl|my_center|LOCUS_33850 37755 37078 gene locus_tag LOCUS_33860 gene kdpE 37755 37078 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186076.1 protein_id gnl|my_center|LOCUS_33860 40436 37752 gene locus_tag LOCUS_33870 gene kdpD 40436 37752 CDS product two-component system sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309343.1 protein_id gnl|my_center|LOCUS_33870 41001 40429 gene locus_tag LOCUS_33880 gene kdpC 41001 40429 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309344.1 protein_id gnl|my_center|LOCUS_33880 43058 41010 gene locus_tag LOCUS_33890 gene kdpB 43058 41010 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087964.1 protein_id gnl|my_center|LOCUS_33890 44754 43081 gene locus_tag LOCUS_33900 gene kdpA 44754 43081 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741129.1 protein_id gnl|my_center|LOCUS_33900 45156 45362 gene locus_tag LOCUS_33910 45156 45362 CDS product YbfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424924.1 protein_id gnl|my_center|LOCUS_33910 >Feature sequence36 225 2414 gene locus_tag LOCUS_33920 225 2414 CDS product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497400.1 protein_id gnl|my_center|LOCUS_33920 3666 2464 gene locus_tag LOCUS_33930 gene nupC 3666 2464 CDS product nucleoside permease NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376337.1 protein_id gnl|my_center|LOCUS_33930 4065 5240 gene locus_tag LOCUS_33940 4065 5240 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186369.1 protein_id gnl|my_center|LOCUS_33940 5707 5381 gene locus_tag LOCUS_33950 gene ypeC 5707 5381 CDS product DUF2502 domain-containing protein YpeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490072.1 protein_id gnl|my_center|LOCUS_33950 7078 5822 gene locus_tag LOCUS_33960 7078 5822 CDS product ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903148.1 protein_id gnl|my_center|LOCUS_33960 7282 8247 gene locus_tag LOCUS_33970 gene glk 7282 8247 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170346.1 protein_id gnl|my_center|LOCUS_33970 8466 8792 gene locus_tag LOCUS_33980 8466 8792 CDS product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038456.1 protein_id gnl|my_center|LOCUS_33980 8814 10061 gene locus_tag LOCUS_33990 8814 10061 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985359.1 protein_id gnl|my_center|LOCUS_33990 10076 11161 gene locus_tag LOCUS_34000 gene ypdF 10076 11161 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173288.1 protein_id gnl|my_center|LOCUS_34000 11161 12198 gene locus_tag LOCUS_34010 gene ypdE 11161 12198 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366028.1 protein_id gnl|my_center|LOCUS_34010 12223 14718 gene locus_tag LOCUS_34020 gene ptsP 12223 14718 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955906.1 protein_id gnl|my_center|LOCUS_34020 15578 14721 gene locus_tag LOCUS_34030 15578 14721 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646844.1 protein_id gnl|my_center|LOCUS_34030 16343 15591 gene locus_tag LOCUS_34040 gene ypdB 16343 15591 CDS product two-component system response regulator YpdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091327.1 protein_id gnl|my_center|LOCUS_34040 18019 16340 gene locus_tag LOCUS_34050 gene ypdA 18019 16340 CDS product two-component system sensor histidine kinase YpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544359.1 protein_id gnl|my_center|LOCUS_34050 18414 19652 gene locus_tag LOCUS_34060 gene alaC 18414 19652 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785931.1 protein_id gnl|my_center|LOCUS_34060 21064 20144 gene locus_tag LOCUS_34070 gene lpxP 21064 20144 CDS product kdo(2)-lipid IV(A) palmitoleoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484404.1 protein_id gnl|my_center|LOCUS_34070 21417 21659 gene locus_tag LOCUS_34080 21417 21659 CDS product YfdY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639883.1 protein_id gnl|my_center|LOCUS_34080 22011 21736 gene locus_tag LOCUS_34090 gene ypdI 22011 21736 CDS product colanic acid biosynthesis lipoprotein YpdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867637.1 protein_id gnl|my_center|LOCUS_34090 22307 22939 gene locus_tag LOCUS_34100 22307 22939 CDS product YfdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825604.1 protein_id gnl|my_center|LOCUS_34100 23452 24702 gene locus_tag LOCUS_34110 gene frc 23452 24702 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106759.1 protein_id gnl|my_center|LOCUS_34110 24786 26450 gene locus_tag LOCUS_34120 gene oxc 24786 26450 CDS product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283490.1 protein_id gnl|my_center|LOCUS_34120 26520 27464 gene locus_tag LOCUS_34130 gene yfdV 26520 27464 CDS product transporter YfdV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955028.1 protein_id gnl|my_center|LOCUS_34130 27538 28683 gene locus_tag LOCUS_34140 gene yfdE 27538 28683 CDS product CoA:oxalate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296867.1 protein_id gnl|my_center|LOCUS_34140 32332 28739 gene locus_tag LOCUS_34150 gene evgS 32332 28739 CDS product acid-sensing system histidine kinase EvgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326970.1 protein_id gnl|my_center|LOCUS_34150 32951 32337 gene locus_tag LOCUS_34160 gene evgA 32951 32337 CDS product acid-sensing system DNA-binding response regulator EvgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991370.1 protein_id gnl|my_center|LOCUS_34160 33367 34530 gene locus_tag LOCUS_34170 gene emrK 33367 34530 CDS product multidrug efflux MFS transporter periplasmic adaptor subunit EmrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435167.1 protein_id gnl|my_center|LOCUS_34170 34530 36068 gene locus_tag LOCUS_34180 gene emrY 34530 36068 CDS product multidrug efflux MFS transporter permease subunit EmrY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018714.1 protein_id gnl|my_center|LOCUS_34180 37504 36176 gene locus_tag LOCUS_34190 gene dsdA 37504 36176 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426427.1 protein_id gnl|my_center|LOCUS_34190 38859 37522 gene locus_tag LOCUS_34200 gene dsdX 38859 37522 CDS product D-serine transporter DsdX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556048.1 protein_id gnl|my_center|LOCUS_34200 39077 40012 gene locus_tag LOCUS_34210 gene dsdC 39077 40012 CDS product DNA-binding transcriptional regulator DsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326971.1 protein_id gnl|my_center|LOCUS_34210 40182 40108 gene locus_tag LOCUS_t00550 40182 40108 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 41190 40258 gene locus_tag LOCUS_34220 41190 40258 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368140.1 protein_id gnl|my_center|LOCUS_34220 41484 42239 gene locus_tag LOCUS_34230 gene mlaA 41484 42239 CDS product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776768.1 protein_id gnl|my_center|LOCUS_34230 42633 42421 gene locus_tag LOCUS_34240 42633 42421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 >Feature sequence37 332 3025 gene locus_tag LOCUS_34250 gene chiA 332 3025 CDS product bifunctional chitinase/lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773156.1 protein_id gnl|my_center|LOCUS_34250 3194 3388 gene locus_tag LOCUS_34260 gene bfd 3194 3388 CDS product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289085.1 protein_id gnl|my_center|LOCUS_34260 3460 3936 gene locus_tag LOCUS_34270 gene bfr 3460 3936 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675504.1 protein_id gnl|my_center|LOCUS_34270 4642 3965 gene locus_tag LOCUS_34280 gene gspO 4642 3965 CDS product prepilin peptidase GspO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178154.1 protein_id gnl|my_center|LOCUS_34280 5103 4642 gene locus_tag LOCUS_34290 gene gspM 5103 4642 CDS product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295161.1 protein_id gnl|my_center|LOCUS_34290 6263 5100 gene locus_tag LOCUS_34300 gene gspL 6263 5100 CDS product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115238.1 protein_id gnl|my_center|LOCUS_34300 7261 6278 gene locus_tag LOCUS_34310 gene gspK 7261 6278 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058522.1 protein_id gnl|my_center|LOCUS_34310 7841 7254 gene locus_tag LOCUS_34320 gene gspJ 7841 7254 CDS product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610634.1 protein_id gnl|my_center|LOCUS_34320 8193 7834 gene locus_tag LOCUS_34330 gene gspI 8193 7834 CDS product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041743.1 protein_id gnl|my_center|LOCUS_34330 8717 8208 gene locus_tag LOCUS_34340 gene gspH 8717 8208 CDS product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076046.1 protein_id gnl|my_center|LOCUS_34340 9162 8725 gene locus_tag LOCUS_34350 gene gspG 9162 8725 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202874.1 protein_id gnl|my_center|LOCUS_34350 10368 9172 gene locus_tag LOCUS_34360 gene gspF 10368 9172 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109573.1 protein_id gnl|my_center|LOCUS_34360 11846 10365 gene locus_tag LOCUS_34370 gene gspE 11846 10365 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219894.1 protein_id gnl|my_center|LOCUS_34370 13820 11856 gene locus_tag LOCUS_34380 gene gspD 13820 11856 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326512.1 protein_id gnl|my_center|LOCUS_34380 14607 13792 gene locus_tag LOCUS_34390 gene gspC 14607 13792 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142708.1 protein_id gnl|my_center|LOCUS_34390 14787 16256 gene locus_tag LOCUS_34400 gene gspA 14787 16256 CDS product type II secretion system protein GspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107576.1 protein_id gnl|my_center|LOCUS_34400 16258 16677 gene locus_tag LOCUS_34410 gene gspB 16258 16677 CDS product putative general secretion pathway protein GspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461450.1 protein_id gnl|my_center|LOCUS_34410 16915 17226 gene locus_tag LOCUS_34420 gene rpsJ 16915 17226 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181004.1 protein_id gnl|my_center|LOCUS_34420 17259 17888 gene locus_tag LOCUS_34430 gene rplC 17259 17888 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579833.1 protein_id gnl|my_center|LOCUS_34430 17899 18504 gene locus_tag LOCUS_34440 gene rplD 17899 18504 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424395.1 protein_id gnl|my_center|LOCUS_34440 18501 18803 gene locus_tag LOCUS_34450 gene rplW 18501 18803 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617544.1 protein_id gnl|my_center|LOCUS_34450 18821 19642 gene locus_tag LOCUS_34460 gene rplB 18821 19642 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301864.1 protein_id gnl|my_center|LOCUS_34460 19659 19937 gene locus_tag LOCUS_34470 gene rpsS 19659 19937 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138117.1 protein_id gnl|my_center|LOCUS_34470 19952 20284 gene locus_tag LOCUS_34480 gene rplV 19952 20284 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447529.1 protein_id gnl|my_center|LOCUS_34480 20302 21003 gene locus_tag LOCUS_34490 gene rpsC 20302 21003 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529945.1 protein_id gnl|my_center|LOCUS_34490 21016 21426 gene locus_tag LOCUS_34500 gene rplP 21016 21426 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941212.1 protein_id gnl|my_center|LOCUS_34500 21426 21617 gene locus_tag LOCUS_34510 gene rpmC 21426 21617 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644741.1 protein_id gnl|my_center|LOCUS_34510 21617 21871 gene locus_tag LOCUS_34520 gene rpsQ 21617 21871 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130100.1 protein_id gnl|my_center|LOCUS_34520 22036 22407 gene locus_tag LOCUS_34530 gene rplN 22036 22407 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613955.1 protein_id gnl|my_center|LOCUS_34530 22418 22732 gene locus_tag LOCUS_34540 gene rplX 22418 22732 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729185.1 protein_id gnl|my_center|LOCUS_34540 22747 23286 gene locus_tag LOCUS_34550 gene rplE 22747 23286 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096200.1 protein_id gnl|my_center|LOCUS_34550 23301 23606 gene locus_tag LOCUS_34560 gene rpsN 23301 23606 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118930.1 protein_id gnl|my_center|LOCUS_34560 23640 24032 gene locus_tag LOCUS_34570 gene rpsH 23640 24032 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062611.1 protein_id gnl|my_center|LOCUS_34570 24045 24578 gene locus_tag LOCUS_34580 gene rplF 24045 24578 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091945.1 protein_id gnl|my_center|LOCUS_34580 24588 24941 gene locus_tag LOCUS_34590 gene rplR 24588 24941 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358960.1 protein_id gnl|my_center|LOCUS_34590 24956 25459 gene locus_tag LOCUS_34600 gene rpsE 24956 25459 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940121.1 protein_id gnl|my_center|LOCUS_34600 25463 25642 gene locus_tag LOCUS_34610 gene rpmD 25463 25642 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140433.1 protein_id gnl|my_center|LOCUS_34610 25646 26080 gene locus_tag LOCUS_34620 gene rplO 25646 26080 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238917.1 protein_id gnl|my_center|LOCUS_34620 26088 27419 gene locus_tag LOCUS_34630 gene secY 26088 27419 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118861.1 protein_id gnl|my_center|LOCUS_34630 27714 28070 gene locus_tag LOCUS_34640 gene rpsM 27714 28070 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090775.1 protein_id gnl|my_center|LOCUS_34640 28087 28476 gene locus_tag LOCUS_34650 gene rpsK 28087 28476 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029684.1 protein_id gnl|my_center|LOCUS_34650 28510 29130 gene locus_tag LOCUS_34660 gene rpsD 28510 29130 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135224.1 protein_id gnl|my_center|LOCUS_34660 29156 30145 gene locus_tag LOCUS_34670 gene rpoA 29156 30145 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162094.1 protein_id gnl|my_center|LOCUS_34670 30186 30569 gene locus_tag LOCUS_34680 gene rplQ 30186 30569 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216368.1 protein_id gnl|my_center|LOCUS_34680 30676 31044 gene locus_tag LOCUS_34690 30676 31044 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266486.1 protein_id gnl|my_center|LOCUS_34690 31055 31480 gene locus_tag LOCUS_34700 gene zntR 31055 31480 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285607.1 protein_id gnl|my_center|LOCUS_34700 31536 31754 gene locus_tag LOCUS_34710 gene arfA 31536 31754 CDS product alternative ribosome-rescue factor ArfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092696.1 protein_id gnl|my_center|LOCUS_34710 32161 31751 gene locus_tag LOCUS_34720 gene mscL 32161 31751 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022442.1 protein_id gnl|my_center|LOCUS_34720 33667 32291 gene locus_tag LOCUS_34730 gene trkA 33667 32291 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691382.1 protein_id gnl|my_center|LOCUS_34730 34978 33689 gene locus_tag LOCUS_34740 gene rsmB 34978 33689 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744778.1 protein_id gnl|my_center|LOCUS_34740 35971 35024 gene locus_tag LOCUS_34750 gene fmt 35971 35024 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004473.1 protein_id gnl|my_center|LOCUS_34750 36495 35986 gene locus_tag LOCUS_34760 gene def 36495 35986 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114984.1 protein_id gnl|my_center|LOCUS_34760 36625 37749 gene locus_tag LOCUS_34770 gene dprA 36625 37749 CDS product DNA-protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228551.1 protein_id gnl|my_center|LOCUS_34770 37721 38194 gene locus_tag LOCUS_34780 gene smg 37721 38194 CDS product DUF494 family protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460680.1 protein_id gnl|my_center|LOCUS_34780 38675 38439 gene locus_tag LOCUS_34790 38675 38439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 38899 39342 gene locus_tag LOCUS_34800 gene tsaC 38899 39342 CDS product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301412.1 protein_id gnl|my_center|LOCUS_34800 39347 40165 gene locus_tag LOCUS_34810 gene aroE 39347 40165 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451243.1 protein_id gnl|my_center|LOCUS_34810 40162 40419 gene locus_tag LOCUS_34820 40162 40419 CDS product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070563.1 protein_id gnl|my_center|LOCUS_34820 40949 40395 gene locus_tag LOCUS_34830 40949 40395 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286216.1 protein_id gnl|my_center|LOCUS_34830 >Feature sequence38 <1 523 gene locus_tag LOCUS_34840 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001001729.1:glycosyltransferase 533 1225 gene locus_tag LOCUS_34850 gene rfaY 533 1225 CDS product lipopolysaccharide core heptose(II) kinase RfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633087.1 protein_id gnl|my_center|LOCUS_34850 1251 2276 gene locus_tag LOCUS_34860 1251 2276 CDS product UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364799.1 protein_id gnl|my_center|LOCUS_34860 2361 3344 gene locus_tag LOCUS_34870 2361 3344 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064007.1 protein_id gnl|my_center|LOCUS_34870 3390 4643 gene locus_tag LOCUS_34880 3390 4643 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602581.1 protein_id gnl|my_center|LOCUS_34880 5693 4713 gene locus_tag LOCUS_34890 gene rfaC 5693 4713 CDS product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264595.1 protein_id gnl|my_center|LOCUS_34890 6743 5697 gene locus_tag LOCUS_34900 gene rfaF 6743 5697 CDS product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699223.1 protein_id gnl|my_center|LOCUS_34900 7685 6753 gene locus_tag LOCUS_34910 gene rfaD 7685 6753 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587764.1 protein_id gnl|my_center|LOCUS_34910 7899 9095 gene locus_tag LOCUS_34920 gene kbl 7899 9095 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213834.1 protein_id gnl|my_center|LOCUS_34920 9105 10130 gene locus_tag LOCUS_34930 gene tdh 9105 10130 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646014.1 protein_id gnl|my_center|LOCUS_34930 10369 11403 gene locus_tag LOCUS_34940 gene waaH 10369 11403 CDS product UDP-glucuronate:LPS(HepIII) glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982115.1 protein_id gnl|my_center|LOCUS_34940 12349 11390 gene locus_tag LOCUS_34950 12349 11390 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483856.1 protein_id gnl|my_center|LOCUS_34950 13534 12353 gene locus_tag LOCUS_34960 gene envC 13534 12353 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196256.1 protein_id gnl|my_center|LOCUS_34960 15190 13646 gene locus_tag LOCUS_34970 gene gpmM 15190 13646 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116565.1 protein_id gnl|my_center|LOCUS_34970 15435 15866 gene locus_tag LOCUS_34980 15435 15866 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156181.1 protein_id gnl|my_center|LOCUS_34980 16008 16259 gene locus_tag LOCUS_34990 gene grxC 16008 16259 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024392.1 protein_id gnl|my_center|LOCUS_34990 16322 16789 gene locus_tag LOCUS_35000 gene secB 16322 16789 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003377.1 protein_id gnl|my_center|LOCUS_35000 16789 17808 gene locus_tag LOCUS_35010 gene gpsA 16789 17808 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076194.1 protein_id gnl|my_center|LOCUS_35010 17888 18709 gene locus_tag LOCUS_35020 gene cysE 17888 18709 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277561.1 protein_id gnl|my_center|LOCUS_35020 19235 18762 gene locus_tag LOCUS_35030 gene trmL 19235 18762 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932346.1 protein_id gnl|my_center|LOCUS_35030 20579 19389 gene locus_tag LOCUS_35040 gene lldD 20579 19389 CDS product quinone-dependent L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586962.1 protein_id gnl|my_center|LOCUS_35040 21352 20576 gene locus_tag LOCUS_35050 gene lldR 21352 20576 CDS product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636500.1 protein_id gnl|my_center|LOCUS_35050 23007 21352 gene locus_tag LOCUS_35060 gene lldP 23007 21352 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297977.1 protein_id gnl|my_center|LOCUS_35060 28225 23375 gene locus_tag LOCUS_35070 gene ehaG 28225 23375 CDS product trimeric autotransporter adhesin EhaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033221.1 protein_id gnl|my_center|LOCUS_35070 28952 28269 gene locus_tag LOCUS_35080 28952 28269 CDS product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049544.1 protein_id gnl|my_center|LOCUS_35080 29858 29496 gene locus_tag LOCUS_35090 29858 29496 CDS product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665680.1 protein_id gnl|my_center|LOCUS_35090 30143 30352 gene locus_tag LOCUS_35100 gene yibT 30143 30352 CDS product protein YibT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517100.1 protein_id gnl|my_center|LOCUS_35100 30951 30364 gene locus_tag LOCUS_35110 gene mtlR 30951 30364 CDS product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228269.1 protein_id gnl|my_center|LOCUS_35110 32099 30951 gene locus_tag LOCUS_35120 gene mtlD 32099 30951 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645420.1 protein_id gnl|my_center|LOCUS_35120 34242 32329 gene locus_tag LOCUS_35130 gene mtlA 34242 32329 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093247.1 protein_id gnl|my_center|LOCUS_35130 34779 35141 gene locus_tag LOCUS_35140 34779 35141 CDS product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479624.1 protein_id gnl|my_center|LOCUS_35140 35144 36280 gene locus_tag LOCUS_35150 35144 36280 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364939.1 protein_id gnl|my_center|LOCUS_35150 37177 36740 gene locus_tag LOCUS_35160 37177 36740 CDS product Imm57 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326561.1 protein_id gnl|my_center|LOCUS_35160 37559 37266 gene locus_tag LOCUS_35170 37559 37266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 38345 37884 gene locus_tag LOCUS_35180 38345 37884 CDS product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642490.1 protein_id gnl|my_center|LOCUS_35180 39295 38357 gene locus_tag LOCUS_35190 39295 38357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 40185 39343 gene locus_tag LOCUS_35200 40185 39343 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072850.1 protein_id gnl|my_center|LOCUS_35200 <41003 40206 gene locus_tag LOCUS_35210 <41003 40206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000015300.1:RHS element protein RhsA >Feature sequence39 457 2 gene locus_tag LOCUS_35220 457 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 2260 1031 gene locus_tag LOCUS_35230 2260 1031 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065950.1 protein_id gnl|my_center|LOCUS_35230 2516 3697 gene locus_tag LOCUS_35240 2516 3697 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656030.1 protein_id gnl|my_center|LOCUS_35240 3984 4820 gene locus_tag LOCUS_35250 gene kduI 3984 4820 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383248.1 protein_id gnl|my_center|LOCUS_35250 4850 5611 gene locus_tag LOCUS_35260 gene kduD 4850 5611 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603518.1 protein_id gnl|my_center|LOCUS_35260 5926 7344 gene locus_tag LOCUS_35270 gene araE 5926 7344 CDS product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256438.1 protein_id gnl|my_center|LOCUS_35270 7473 8165 gene locus_tag LOCUS_35280 gene ygeA 7473 8165 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848664.1 protein_id gnl|my_center|LOCUS_35280 9087 8152 gene locus_tag LOCUS_35290 gene lysR 9087 8152 CDS product DNA-binding transcriptional regulator LysR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741825.1 protein_id gnl|my_center|LOCUS_35290 9209 10471 gene locus_tag LOCUS_35300 gene lysA 9209 10471 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120711.1 protein_id gnl|my_center|LOCUS_35300 11509 10478 gene locus_tag LOCUS_35310 gene galR 11509 10478 CDS product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201048.1 protein_id gnl|my_center|LOCUS_35310 12095 14254 gene locus_tag LOCUS_35320 gene aas 12095 14254 CDS product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899069.1 protein_id gnl|my_center|LOCUS_35320 14247 15440 gene locus_tag LOCUS_35330 gene lplT 14247 15440 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004616.1 protein_id gnl|my_center|LOCUS_35330 16512 15472 gene locus_tag LOCUS_35340 16512 15472 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199295.1 protein_id gnl|my_center|LOCUS_35340 16838 16620 gene locus_tag LOCUS_35350 gene ygdR 16838 16620 CDS product lipoprotein YgdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758655.1 protein_id gnl|my_center|LOCUS_35350 17689 16976 gene locus_tag LOCUS_35360 17689 16976 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895624.1 protein_id gnl|my_center|LOCUS_35360 18447 17758 gene locus_tag LOCUS_35370 gene mutH 18447 17758 CDS product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082201.1 protein_id gnl|my_center|LOCUS_35370 19132 19662 gene locus_tag LOCUS_35380 gene rppH 19132 19662 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564489.1 protein_id gnl|my_center|LOCUS_35380 19675 21921 gene locus_tag LOCUS_35390 gene ptsP 19675 21921 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957914.1 protein_id gnl|my_center|LOCUS_35390 22072 22947 gene locus_tag LOCUS_35400 gene lgt 22072 22947 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204658.1 protein_id gnl|my_center|LOCUS_35400 22954 23748 gene locus_tag LOCUS_35410 gene thyA 22954 23748 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816232.1 protein_id gnl|my_center|LOCUS_35410 23933 24403 gene locus_tag LOCUS_35420 23933 24403 CDS product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 protein_id gnl|my_center|LOCUS_35420 24394 24957 gene locus_tag LOCUS_35430 24394 24957 CDS product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144322.1 protein_id gnl|my_center|LOCUS_35430 24954 25361 gene locus_tag LOCUS_35440 24954 25361 CDS product DUF2509 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078376.1 protein_id gnl|my_center|LOCUS_35440 25346 25669 gene locus_tag LOCUS_35450 25346 25669 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276460.1 protein_id gnl|my_center|LOCUS_35450 25682 29050 gene locus_tag LOCUS_35460 gene recC 25682 29050 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946938.1 protein_id gnl|my_center|LOCUS_35460 29226 32114 gene locus_tag LOCUS_35470 gene ptrA 29226 32114 CDS product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138152.1 protein_id gnl|my_center|LOCUS_35470 32107 35649 gene locus_tag LOCUS_35480 gene recB 32107 35649 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285993.1 protein_id gnl|my_center|LOCUS_35480 35649 37475 gene locus_tag LOCUS_35490 gene recD 35649 37475 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775955.1 protein_id gnl|my_center|LOCUS_35490 38868 37537 gene locus_tag LOCUS_35500 gene argA 38868 37537 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237947.1 protein_id gnl|my_center|LOCUS_35500 39100 40353 gene locus_tag LOCUS_35510 gene amiC 39100 40353 CDS product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016907.1 protein_id gnl|my_center|LOCUS_35510 >Feature sequence40 1773 649 gene locus_tag LOCUS_35520 1773 649 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216257.1 protein_id gnl|my_center|LOCUS_35520 4508 1773 gene locus_tag LOCUS_35530 gene rbbA 4508 1773 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149156.1 protein_id gnl|my_center|LOCUS_35530 5572 4505 gene locus_tag LOCUS_35540 5572 4505 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361458.1 protein_id gnl|my_center|LOCUS_35540 7560 5938 gene locus_tag LOCUS_35550 7560 5938 CDS product YhiJ/YhiL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393583.1 protein_id gnl|my_center|LOCUS_35550 9429 7822 gene locus_tag LOCUS_35560 9429 7822 CDS product DUF4049 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862346.1 protein_id gnl|my_center|LOCUS_35560 9812 10864 gene locus_tag LOCUS_35570 9812 10864 CDS product DUF2776 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028905.1 protein_id gnl|my_center|LOCUS_35570 12381 11179 gene locus_tag LOCUS_35580 12381 11179 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439170.1 protein_id gnl|my_center|LOCUS_35580 12613 14112 gene locus_tag LOCUS_35590 gene pitA 12613 14112 CDS product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902780.1 protein_id gnl|my_center|LOCUS_35590 14691 14356 gene locus_tag LOCUS_35600 gene uspB 14691 14356 CDS product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626187.1 protein_id gnl|my_center|LOCUS_35600 15082 15516 gene locus_tag LOCUS_35610 gene uspA 15082 15516 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323571.1 protein_id gnl|my_center|LOCUS_35610 15879 15700 gene locus_tag LOCUS_35620 15879 15700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 15834 17303 gene locus_tag LOCUS_35630 gene dtpB 15834 17303 CDS product dipeptide/tripeptide permease DtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098647.1 protein_id gnl|my_center|LOCUS_35630 18104 17352 gene locus_tag LOCUS_35640 gene rsmJ 18104 17352 CDS product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686620.1 protein_id gnl|my_center|LOCUS_35640 20154 18112 gene locus_tag LOCUS_35650 gene prlC 20154 18112 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295214.1 protein_id gnl|my_center|LOCUS_35650 20357 21199 gene locus_tag LOCUS_35660 gene rlmJ 20357 21199 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954225.1 protein_id gnl|my_center|LOCUS_35660 21271 22623 gene locus_tag LOCUS_35670 gene gorA 21271 22623 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160808.1 protein_id gnl|my_center|LOCUS_35670 22826 22677 gene locus_tag LOCUS_35680 22826 22677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 22788 22961 gene locus_tag LOCUS_35690 22788 22961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004976829.1 protein_id gnl|my_center|LOCUS_35690 23500 23853 gene locus_tag LOCUS_35700 gene arsR 23500 23853 CDS product As(III)-sensing metalloregulatory transcriptional repressor ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008957.1 protein_id gnl|my_center|LOCUS_35700 23907 25196 gene locus_tag LOCUS_35710 gene arsB 23907 25196 CDS product arsenite/antimonite:H(+) antiporter ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922639.1 protein_id gnl|my_center|LOCUS_35710 25209 25634 gene locus_tag LOCUS_35720 gene arsC 25209 25634 CDS product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065769.1 protein_id gnl|my_center|LOCUS_35720 26263 27486 gene locus_tag LOCUS_35730 26263 27486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020611.1 protein_id gnl|my_center|LOCUS_35730 27734 28300 gene locus_tag LOCUS_35740 gene slp 27734 28300 CDS product outer membrane lipoprotein Slp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242917.1 protein_id gnl|my_center|LOCUS_35740 28456 28986 gene locus_tag LOCUS_35750 28456 28986 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478619.1 protein_id gnl|my_center|LOCUS_35750 29603 29028 gene locus_tag LOCUS_35760 29603 29028 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296814.1 protein_id gnl|my_center|LOCUS_35760 30077 29739 gene locus_tag LOCUS_35770 gene hdeB 30077 29739 CDS product acid-activated periplasmic chaperone HdeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540805.1 protein_id gnl|my_center|LOCUS_35770 30513 30181 gene locus_tag LOCUS_35780 gene hdeA 30513 30181 CDS product acid-activated periplasmic chaperone HdeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756550.1 protein_id gnl|my_center|LOCUS_35780 30768 31340 gene locus_tag LOCUS_35790 gene hdeD 30768 31340 CDS product acid-resistance protein HdeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965672.1 protein_id gnl|my_center|LOCUS_35790 32139 32666 gene locus_tag LOCUS_35800 gene gadE 32139 32666 CDS product acid resistance transcriptional activator GadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576690.1 protein_id gnl|my_center|LOCUS_35800 33053 34162 gene locus_tag LOCUS_35810 gene mdtE 33053 34162 CDS product multidrug transporter subunit MdtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081984.1 protein_id gnl|my_center|LOCUS_35810 34187 37300 gene locus_tag LOCUS_35820 gene mdtF 34187 37300 CDS product multidrug efflux pump RND permease MdtF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024872.1 protein_id gnl|my_center|LOCUS_35820 38391 37663 gene locus_tag LOCUS_35830 gene gadW 38391 37663 CDS product acid resistance transcriptional activator GadW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149999.1 protein_id gnl|my_center|LOCUS_35830 >Feature sequence41 191 418 gene locus_tag LOCUS_35840 gene pptA 191 418 CDS product tautomerase PptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120143.1 protein_id gnl|my_center|LOCUS_35840 991 422 gene locus_tag LOCUS_35850 991 422 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085912.1 protein_id gnl|my_center|LOCUS_35850 1164 2009 gene locus_tag LOCUS_35860 gene nhoA 1164 2009 CDS product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187905.1 protein_id gnl|my_center|LOCUS_35860 2365 2105 gene locus_tag LOCUS_35870 2365 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35870 2998 2432 gene locus_tag LOCUS_35880 2998 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35880 3757 3077 gene locus_tag LOCUS_35890 gene narI 3757 3077 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617115.1 protein_id gnl|my_center|LOCUS_35890 4449 3754 gene locus_tag LOCUS_35900 gene narW 4449 3754 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166353.1 protein_id gnl|my_center|LOCUS_35900 5993 4449 gene locus_tag LOCUS_35910 gene narH 5993 4449 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702560.1 protein_id gnl|my_center|LOCUS_35910 9730 5990 gene locus_tag LOCUS_35920 gene narZ 9730 5990 CDS product nitrate reductase Z subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040458.1 protein_id gnl|my_center|LOCUS_35920 11200 9812 gene locus_tag LOCUS_35930 gene narU 11200 9812 CDS product nitrate/nitrite transporter NarU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207905.1 protein_id gnl|my_center|LOCUS_35930 11850 11524 gene locus_tag LOCUS_35940 11850 11524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35940 12818 11898 gene locus_tag LOCUS_35950 12818 11898 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001407592.1 protein_id gnl|my_center|LOCUS_35950 13168 12878 gene locus_tag LOCUS_35960 13168 12878 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768384.1 protein_id gnl|my_center|LOCUS_35960 14251 13427 gene locus_tag LOCUS_35970 gene yddG 14251 13427 CDS product aromatic amino acid efflux DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198214.1 protein_id gnl|my_center|LOCUS_35970 14540 17587 gene locus_tag LOCUS_35980 gene fdnG 14540 17587 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602782.1 transl_except (pos:15125..15127,aa:Sec) note codon on position 196 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_35980 17600 18484 gene locus_tag LOCUS_35990 gene fdnH 17600 18484 CDS product formate dehydrogenase N subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240582.1 protein_id gnl|my_center|LOCUS_35990 18477 19130 gene locus_tag LOCUS_36000 gene fdnI 18477 19130 CDS product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045648.1 protein_id gnl|my_center|LOCUS_36000 19609 19325 gene locus_tag LOCUS_36010 19609 19325 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781370.1 protein_id gnl|my_center|LOCUS_36010 20765 19755 gene locus_tag LOCUS_36020 gene adhP 20765 19755 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642433.1 protein_id gnl|my_center|LOCUS_36020 22596 20899 gene locus_tag LOCUS_36030 gene maeA 22596 20899 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433476.1 protein_id gnl|my_center|LOCUS_36030 22890 22753 gene locus_tag LOCUS_36040 gene sra 22890 22753 CDS product stationary-phase-induced ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841554.1 protein_id gnl|my_center|LOCUS_36040 23207 22992 gene locus_tag LOCUS_36050 gene bdm 23207 22992 CDS product biofilm-dependent modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495771.1 protein_id gnl|my_center|LOCUS_36050 23552 23349 gene locus_tag LOCUS_36060 23552 23349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 23552 23983 gene locus_tag LOCUS_36070 gene osmC 23552 23983 CDS product peroxiredoxin OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152305.1 protein_id gnl|my_center|LOCUS_36070 24965 24039 gene locus_tag LOCUS_36080 24965 24039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285536.1 protein_id gnl|my_center|LOCUS_36080 25944 24958 gene locus_tag LOCUS_36090 25944 24958 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193547.1 protein_id gnl|my_center|LOCUS_36090 26837 25941 gene locus_tag LOCUS_36100 26837 25941 CDS product D,D-dipeptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979608.1 protein_id gnl|my_center|LOCUS_36100 27856 26834 gene locus_tag LOCUS_36110 27856 26834 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145123.1 protein_id gnl|my_center|LOCUS_36110 29408 27858 gene locus_tag LOCUS_36120 29408 27858 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830550.1 protein_id gnl|my_center|LOCUS_36120 30003 29422 gene locus_tag LOCUS_36130 gene ddpX 30003 29422 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285833.1 protein_id gnl|my_center|LOCUS_36130 32660 30261 gene locus_tag LOCUS_36140 gene dosP 32660 30261 CDS product oxygen-sensing cyclic-di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360132.1 protein_id gnl|my_center|LOCUS_36140 34067 32685 gene locus_tag LOCUS_36150 gene dosC 34067 32685 CDS product diguanylate cyclase DosC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426279.1 protein_id gnl|my_center|LOCUS_36150 35598 34444 gene locus_tag LOCUS_36160 35598 34444 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350395.1 protein_id gnl|my_center|LOCUS_36160 37429 35894 gene locus_tag LOCUS_36170 gene gadC 37429 35894 CDS product acid resistance gamma-aminobutyrate antiporter GadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246019.1 protein_id gnl|my_center|LOCUS_36170 >Feature sequence42 1736 1119 gene locus_tag LOCUS_36180 1736 1119 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598857.1 protein_id gnl|my_center|LOCUS_36180 2003 3502 gene locus_tag LOCUS_36190 gene ansP 2003 3502 CDS product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300590.1 protein_id gnl|my_center|LOCUS_36190 4678 3617 gene locus_tag LOCUS_36200 4678 3617 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550675.1 protein_id gnl|my_center|LOCUS_36200 5004 7022 gene locus_tag LOCUS_36210 gene pqqU 5004 7022 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689363.1 protein_id gnl|my_center|LOCUS_36210 7723 7058 gene locus_tag LOCUS_36220 gene mcbR 7723 7058 CDS product colanic acid/biofilm transcriptional regulator McbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300742.1 protein_id gnl|my_center|LOCUS_36220 8958 7921 gene locus_tag LOCUS_36230 gene curA 8958 7921 CDS product NADPH-dependent curcumin/dihydrocurcumin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531452.1 protein_id gnl|my_center|LOCUS_36230 9139 9657 gene locus_tag LOCUS_36240 gene mddA 9139 9657 CDS product L-methionine sulfoximine/L-methionine sulfone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027563.1 protein_id gnl|my_center|LOCUS_36240 9654 10103 gene locus_tag LOCUS_36250 9654 10103 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076535.1 protein_id gnl|my_center|LOCUS_36250 10337 10104 gene locus_tag LOCUS_36260 gene ydcY 10337 10104 CDS product DUF2526 family protein YdcY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018633.1 protein_id gnl|my_center|LOCUS_36260 10671 10423 gene locus_tag LOCUS_36270 10671 10423 CDS product GhoT/OrtT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732115.1 protein_id gnl|my_center|LOCUS_36270 12407 10983 gene locus_tag LOCUS_36280 gene patD 12407 10983 CDS product aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163872.1 protein_id gnl|my_center|LOCUS_36280 13223 12429 gene locus_tag LOCUS_36290 13223 12429 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555471.1 protein_id gnl|my_center|LOCUS_36290 14154 13213 gene locus_tag LOCUS_36300 14154 13213 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251315.1 protein_id gnl|my_center|LOCUS_36300 15168 14155 gene locus_tag LOCUS_36310 15168 14155 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220396.1 protein_id gnl|my_center|LOCUS_36310 16331 15186 gene locus_tag LOCUS_36320 16331 15186 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047424.1 protein_id gnl|my_center|LOCUS_36320 17982 16576 gene locus_tag LOCUS_36330 17982 16576 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760626.1 protein_id gnl|my_center|LOCUS_36330 18498 18061 gene locus_tag LOCUS_36340 gene hicB 18498 18061 CDS product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209405.1 protein_id gnl|my_center|LOCUS_36340 18921 19151 gene locus_tag LOCUS_36350 18921 19151 CDS product YncJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494244.1 protein_id gnl|my_center|LOCUS_36350 21204 19243 gene locus_tag LOCUS_36360 gene rlhA 21204 19243 CDS product 23S rRNA 5-hydroxycytidine C2501 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301045.1 protein_id gnl|my_center|LOCUS_36360 21813 21277 gene locus_tag LOCUS_36370 gene sutR 21813 21277 CDS product DNA-binding transcriptional regulator SutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429155.1 protein_id gnl|my_center|LOCUS_36370 21905 23080 gene locus_tag LOCUS_36380 gene ydcO 21905 23080 CDS product BenE family transporter YdcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236265.1 protein_id gnl|my_center|LOCUS_36380 24268 23120 gene locus_tag LOCUS_36390 24268 23120 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251043.1 protein_id gnl|my_center|LOCUS_36390 25528 24860 gene locus_tag LOCUS_36400 25528 24860 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261013.1 protein_id gnl|my_center|LOCUS_36400 26424 25831 gene locus_tag LOCUS_36410 gene tehB 26424 25831 CDS product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586714.1 protein_id gnl|my_center|LOCUS_36410 27413 26421 gene locus_tag LOCUS_36420 gene tehA 27413 26421 CDS product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301046.1 protein_id gnl|my_center|LOCUS_36420 27537 28517 gene locus_tag LOCUS_36430 gene ydcK 27537 28517 CDS product YdcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234048.1 protein_id gnl|my_center|LOCUS_36430 29048 28509 gene locus_tag LOCUS_36440 gene rimL 29048 28509 CDS product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140873.1 protein_id gnl|my_center|LOCUS_36440 29335 29111 gene locus_tag LOCUS_36450 29335 29111 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296778.1 protein_id gnl|my_center|LOCUS_36450 31094 29475 gene locus_tag LOCUS_36460 gene opgD 31094 29475 CDS product glucan biosynthesis protein OpgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375961.1 protein_id gnl|my_center|LOCUS_36460 32698 31355 gene locus_tag LOCUS_36470 32698 31355 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013789.1 protein_id gnl|my_center|LOCUS_36470 32996 33838 gene locus_tag LOCUS_36480 32996 33838 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414567.1 protein_id gnl|my_center|LOCUS_36480 35516 33876 gene locus_tag LOCUS_36490 gene trg 35516 33876 CDS product methyl-accepting chemotaxis protein Trg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098559.1 protein_id gnl|my_center|LOCUS_36490 35915 36064 gene locus_tag LOCUS_36500 gene hokB 35915 36064 CDS product type I toxin-antitoxin system toxin HokB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001320773.1 protein_id gnl|my_center|LOCUS_36500 36309 36136 gene locus_tag LOCUS_36510 36309 36136 CDS product periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731833.1 protein_id gnl|my_center|LOCUS_36510 37084 36554 gene locus_tag LOCUS_36520 gene cybB 37084 36554 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954775.1 protein_id gnl|my_center|LOCUS_36520 >Feature sequence43 <1 641 gene locus_tag LOCUS_36530 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000847144.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme 1524 793 gene locus_tag LOCUS_36540 gene frlR 1524 793 CDS product DNA-binding transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276847.1 protein_id gnl|my_center|LOCUS_36540 2409 1624 gene locus_tag LOCUS_36550 gene frlD 2409 1624 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853353.1 protein_id gnl|my_center|LOCUS_36550 3236 2406 gene locus_tag LOCUS_36560 gene frlC 3236 2406 CDS product fructoselysine 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847837.1 protein_id gnl|my_center|LOCUS_36560 4308 3286 gene locus_tag LOCUS_36570 gene frlB 4308 3286 CDS product fructoselysine 6-phosphate deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295163.1 protein_id gnl|my_center|LOCUS_36570 5666 4329 gene locus_tag LOCUS_36580 gene frlA 5666 4329 CDS product fructoselysine/psicoselysine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535505.1 protein_id gnl|my_center|LOCUS_36580 6128 5961 gene locus_tag LOCUS_36590 6128 5961 CDS product YhfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031834.1 protein_id gnl|my_center|LOCUS_36590 7748 6375 gene locus_tag LOCUS_36600 gene cysG 7748 6375 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349855.1 protein_id gnl|my_center|LOCUS_36600 8573 7767 gene locus_tag LOCUS_36610 gene nirC 8573 7767 CDS product nitrite transporter NirC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493556.1 protein_id gnl|my_center|LOCUS_36610 9025 8699 gene locus_tag LOCUS_36620 gene nirD 9025 8699 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084764.1 protein_id gnl|my_center|LOCUS_36620 11565 9022 gene locus_tag LOCUS_36630 gene nirB 11565 9022 CDS product NADPH-nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049208.1 protein_id gnl|my_center|LOCUS_36630 13008 11827 gene locus_tag LOCUS_36640 gene tsgA 13008 11827 CDS product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185232.1 protein_id gnl|my_center|LOCUS_36640 13279 13851 gene locus_tag LOCUS_36650 gene ppiA 13279 13851 CDS product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477225.1 protein_id gnl|my_center|LOCUS_36650 13956 14123 gene locus_tag LOCUS_36660 13956 14123 CDS product YhfG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736860.1 protein_id gnl|my_center|LOCUS_36660 14113 14715 gene locus_tag LOCUS_36670 14113 14715 CDS product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280623.1 protein_id gnl|my_center|LOCUS_36670 14747 15310 gene locus_tag LOCUS_36680 gene pabA 14747 15310 CDS product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601847.1 protein_id gnl|my_center|LOCUS_36680 15396 16616 gene locus_tag LOCUS_36690 gene argD 15396 16616 CDS product bifunctional acetylornithine/succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963792.1 protein_id gnl|my_center|LOCUS_36690 18686 16683 gene locus_tag LOCUS_36700 18686 16683 CDS product YccS/YhfK family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484349.1 protein_id gnl|my_center|LOCUS_36700 19456 18824 gene locus_tag LOCUS_36710 gene crp 19456 18824 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242755.1 protein_id gnl|my_center|LOCUS_36710 19758 20162 gene locus_tag LOCUS_36720 19758 20162 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148908.1 protein_id gnl|my_center|LOCUS_36720 21086 20217 gene locus_tag LOCUS_36730 21086 20217 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274680.1 protein_id gnl|my_center|LOCUS_36730 21358 21140 gene locus_tag LOCUS_36740 21358 21140 CDS product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907085.1 protein_id gnl|my_center|LOCUS_36740 22374 21352 gene locus_tag LOCUS_36750 22374 21352 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057356.1 protein_id gnl|my_center|LOCUS_36750 24287 22374 gene locus_tag LOCUS_36760 24287 22374 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634798.1 protein_id gnl|my_center|LOCUS_36760 24418 24969 gene locus_tag LOCUS_36770 gene kefG 24418 24969 CDS product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987657.1 protein_id gnl|my_center|LOCUS_36770 24969 26774 gene locus_tag LOCUS_36780 gene kefB 24969 26774 CDS product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399122.1 protein_id gnl|my_center|LOCUS_36780 26784 26984 gene locus_tag LOCUS_36790 26784 26984 CDS product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007730.1 protein_id gnl|my_center|LOCUS_36790 27079 27669 gene locus_tag LOCUS_36800 gene slyD 27079 27669 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861334.1 protein_id gnl|my_center|LOCUS_36800 27936 27718 gene locus_tag LOCUS_36810 27936 27718 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153615.1 protein_id gnl|my_center|LOCUS_36810 28157 28969 gene locus_tag LOCUS_36820 gene fkpA 28157 28969 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838264.1 protein_id gnl|my_center|LOCUS_36820 29136 29858 gene locus_tag LOCUS_36830 29136 29858 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091466.1 protein_id gnl|my_center|LOCUS_36830 29858 30244 gene locus_tag LOCUS_36840 gene tusD 29858 30244 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209689.1 protein_id gnl|my_center|LOCUS_36840 30244 30603 gene locus_tag LOCUS_36850 gene tusC 30244 30603 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820720.1 protein_id gnl|my_center|LOCUS_36850 30611 30898 gene locus_tag LOCUS_36860 gene tusB 30611 30898 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903377.1 protein_id gnl|my_center|LOCUS_36860 31024 31398 gene locus_tag LOCUS_36870 gene rpsL 31024 31398 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001319024.1 protein_id gnl|my_center|LOCUS_36870 31495 31965 gene locus_tag LOCUS_36880 gene rpsG 31495 31965 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138043.1 protein_id gnl|my_center|LOCUS_36880 32062 34176 gene locus_tag LOCUS_36890 gene fusA 32062 34176 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124700.1 protein_id gnl|my_center|LOCUS_36890 >Feature sequence44 1724 1913 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3042 3152 gene locus_tag LOCUS_r00010 3042 3152 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3170 3245 gene locus_tag LOCUS_t00560 3170 3245 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3287 3397 gene locus_tag LOCUS_r00020 3287 3397 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4389 3631 gene locus_tag LOCUS_36900 4389 3631 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078349.1 protein_id gnl|my_center|LOCUS_36900 5500 4397 gene locus_tag LOCUS_36910 5500 4397 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300681.1 protein_id gnl|my_center|LOCUS_36910 6709 5510 gene locus_tag LOCUS_36920 6709 5510 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019655.1 protein_id gnl|my_center|LOCUS_36920 7784 6759 gene locus_tag LOCUS_36930 7784 6759 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738579.1 protein_id gnl|my_center|LOCUS_36930 8436 8215 gene locus_tag LOCUS_36940 8436 8215 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825639.1 protein_id gnl|my_center|LOCUS_36940 11793 8689 gene locus_tag LOCUS_36950 gene acrF 11793 8689 CDS product multidrug efflux RND transporter permease subunit AcrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273212.1 protein_id gnl|my_center|LOCUS_36950 12962 11805 gene locus_tag LOCUS_36960 gene acrE 12962 11805 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160334.1 protein_id gnl|my_center|LOCUS_36960 13361 14023 gene locus_tag LOCUS_36970 gene acrS 13361 14023 CDS product multidrug efflux transporter transcriptional repressor AcrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129518.1 protein_id gnl|my_center|LOCUS_36970 14205 14026 gene locus_tag LOCUS_36980 14205 14026 CDS product DUF2556 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295275.1 protein_id gnl|my_center|LOCUS_36980 15173 14289 gene locus_tag LOCUS_36990 gene yhdJ 15173 14289 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258898.1 protein_id gnl|my_center|LOCUS_36990 15555 15259 gene locus_tag LOCUS_37000 gene fis 15555 15259 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 protein_id gnl|my_center|LOCUS_37000 16453 15581 gene locus_tag LOCUS_37010 gene dusB 16453 15581 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219652.1 protein_id gnl|my_center|LOCUS_37010 17756 16875 gene locus_tag LOCUS_37020 gene prmA 17756 16875 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145827.1 protein_id gnl|my_center|LOCUS_37020 19219 17768 gene locus_tag LOCUS_37030 gene panF 19219 17768 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175728.1 protein_id gnl|my_center|LOCUS_37030 19451 19209 gene locus_tag LOCUS_37040 19451 19209 CDS product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381173.1 protein_id gnl|my_center|LOCUS_37040 20909 19560 gene locus_tag LOCUS_37050 gene accC 20909 19560 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884639.1 protein_id gnl|my_center|LOCUS_37050 21390 20920 gene locus_tag LOCUS_37060 gene accB 21390 20920 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354622.1 protein_id gnl|my_center|LOCUS_37060 21551 21363 gene locus_tag LOCUS_37070 21551 21363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 23342 22368 gene locus_tag LOCUS_37080 23342 22368 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148481.1 protein_id gnl|my_center|LOCUS_37080 23494 25434 gene locus_tag LOCUS_37090 gene csrD 23494 25434 CDS product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241469.1 protein_id gnl|my_center|LOCUS_37090 25739 26782 gene locus_tag LOCUS_37100 gene mreB 25739 26782 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913396.1 protein_id gnl|my_center|LOCUS_37100 26848 27951 gene locus_tag LOCUS_37110 gene mreC 26848 27951 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802516.1 protein_id gnl|my_center|LOCUS_37110 27951 28439 gene locus_tag LOCUS_37120 gene mreD 27951 28439 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179409.1 protein_id gnl|my_center|LOCUS_37120 28448 29041 gene locus_tag LOCUS_37130 gene yhdE 28448 29041 CDS product nucleoside triphosphate pyrophosphatase YhdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203105.1 protein_id gnl|my_center|LOCUS_37130 29031 30500 gene locus_tag LOCUS_37140 gene rng 29031 30500 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123197.1 protein_id gnl|my_center|LOCUS_37140 30568 34368 gene locus_tag LOCUS_37150 gene yhdP 30568 34368 CDS product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253587.1 protein_id gnl|my_center|LOCUS_37150 >Feature sequence45 270 653 gene locus_tag LOCUS_37160 gene secE 270 653 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275702.1 protein_id gnl|my_center|LOCUS_37160 655 1200 gene locus_tag LOCUS_37170 gene nusG 655 1200 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287516.1 protein_id gnl|my_center|LOCUS_37170 1359 1787 gene locus_tag LOCUS_37180 gene rplK 1359 1787 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085926.1 protein_id gnl|my_center|LOCUS_37180 1791 2495 gene locus_tag LOCUS_37190 gene rplA 1791 2495 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096684.1 protein_id gnl|my_center|LOCUS_37190 2908 3405 gene locus_tag LOCUS_37200 gene rplJ 2908 3405 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207201.1 protein_id gnl|my_center|LOCUS_37200 3472 3837 gene locus_tag LOCUS_37210 gene rplL 3472 3837 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028878.1 protein_id gnl|my_center|LOCUS_37210 4157 8185 gene locus_tag LOCUS_37220 gene rpoB 4157 8185 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263098.1 protein_id gnl|my_center|LOCUS_37220 8262 12485 gene locus_tag LOCUS_37230 gene rpoC 8262 12485 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653944.1 protein_id gnl|my_center|LOCUS_37230 12698 13237 gene locus_tag LOCUS_37240 12698 13237 CDS product heat-shock protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307500.1 protein_id gnl|my_center|LOCUS_37240 14780 13647 gene locus_tag LOCUS_37250 gene thiH 14780 13647 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847445.1 protein_id gnl|my_center|LOCUS_37250 15547 14777 gene locus_tag LOCUS_37260 gene thiG 15547 14777 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944103.1 protein_id gnl|my_center|LOCUS_37260 15749 15549 gene locus_tag LOCUS_37270 gene thiS 15749 15549 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166230.1 protein_id gnl|my_center|LOCUS_37270 16488 15733 gene locus_tag LOCUS_37280 gene thiF 16488 15733 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999737.1 protein_id gnl|my_center|LOCUS_37280 17116 16481 gene locus_tag LOCUS_37290 gene thiE 17116 16481 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284615.1 protein_id gnl|my_center|LOCUS_37290 19011 17116 gene locus_tag LOCUS_37300 gene thiC 19011 17116 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276909.1 protein_id gnl|my_center|LOCUS_37300 19721 19245 gene locus_tag LOCUS_37310 gene rsd 19721 19245 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934302.1 protein_id gnl|my_center|LOCUS_37310 19816 20589 gene locus_tag LOCUS_37320 gene nudC 19816 20589 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373940.1 protein_id gnl|my_center|LOCUS_37320 20629 21693 gene locus_tag LOCUS_37330 gene hemE 20629 21693 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137657.1 protein_id gnl|my_center|LOCUS_37330 21703 22374 gene locus_tag LOCUS_37340 gene nfi 21703 22374 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362388.1 protein_id gnl|my_center|LOCUS_37340 22417 23007 gene locus_tag LOCUS_37350 22417 23007 CDS product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940106.1 protein_id gnl|my_center|LOCUS_37350 23194 23466 gene locus_tag LOCUS_37360 gene hupA 23194 23466 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044513.1 protein_id gnl|my_center|LOCUS_37360 23539 24174 gene locus_tag LOCUS_37370 23539 24174 CDS product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299291.1 protein_id gnl|my_center|LOCUS_37370 24595 24176 gene locus_tag LOCUS_37380 24595 24176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 24833 26209 gene locus_tag LOCUS_37390 gene zraS 24833 26209 CDS product two-component system sensor histidine kinase ZraS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211933.1 protein_id gnl|my_center|LOCUS_37390 26206 27531 gene locus_tag LOCUS_37400 gene zraR 26206 27531 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148503.1 protein_id gnl|my_center|LOCUS_37400 28817 27528 gene locus_tag LOCUS_37410 gene purD 28817 27528 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866828.1 protein_id gnl|my_center|LOCUS_37410 30418 28829 gene locus_tag LOCUS_37420 gene purH 30418 28829 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187559.1 protein_id gnl|my_center|LOCUS_37420 >Feature sequence46 510 1445 gene locus_tag LOCUS_37430 gene rihA 510 1445 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207520.1 protein_id gnl|my_center|LOCUS_37430 1529 3199 gene locus_tag LOCUS_37440 gene hscC 1529 3199 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367875.1 protein_id gnl|my_center|LOCUS_37440 4398 3259 gene locus_tag LOCUS_37450 gene djlC 4398 3259 CDS product co-chaperone DjlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300403.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37450 5413 4706 gene locus_tag LOCUS_37460 5413 4706 CDS product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367041.1 protein_id gnl|my_center|LOCUS_37460 5577 6089 gene locus_tag LOCUS_37470 5577 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37470 6162 6554 gene locus_tag LOCUS_37480 6162 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37480 7106 6624 gene locus_tag LOCUS_37490 7106 6624 CDS product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044880.1 protein_id gnl|my_center|LOCUS_37490 7341 9923 gene locus_tag LOCUS_37500 gene leuS 7341 9923 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157890.1 protein_id gnl|my_center|LOCUS_37500 9938 10519 gene locus_tag LOCUS_37510 gene lptE 9938 10519 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269673.1 protein_id gnl|my_center|LOCUS_37510 10519 11550 gene locus_tag LOCUS_37520 gene holA 10519 11550 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620503.1 protein_id gnl|my_center|LOCUS_37520 11552 12193 gene locus_tag LOCUS_37530 gene nadD 11552 12193 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838889.1 protein_id gnl|my_center|LOCUS_37530 12217 12828 gene locus_tag LOCUS_37540 12217 12828 CDS product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241888.1 protein_id gnl|my_center|LOCUS_37540 13088 13405 gene locus_tag LOCUS_37550 gene rsfS 13088 13405 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161664.1 protein_id gnl|my_center|LOCUS_37550 13409 13876 gene locus_tag LOCUS_37560 gene rlmH 13409 13876 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776104.1 protein_id gnl|my_center|LOCUS_37560 13907 15808 gene locus_tag LOCUS_37570 gene mrdA 13907 15808 CDS product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776191.1 protein_id gnl|my_center|LOCUS_37570 15811 16923 gene locus_tag LOCUS_37580 gene mrdB 15811 16923 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131719.1 protein_id gnl|my_center|LOCUS_37580 16934 18022 gene locus_tag LOCUS_37590 gene rlpA 16934 18022 CDS product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231428.1 protein_id gnl|my_center|LOCUS_37590 18162 19373 gene locus_tag LOCUS_37600 gene dacA 18162 19373 CDS product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092082.1 protein_id gnl|my_center|LOCUS_37600 19483 19746 gene locus_tag LOCUS_37610 gene ybeD 19483 19746 CDS product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850550.1 protein_id gnl|my_center|LOCUS_37610 19847 20488 gene locus_tag LOCUS_37620 gene lipB 19847 20488 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284027.1 protein_id gnl|my_center|LOCUS_37620 20747 21700 gene locus_tag LOCUS_37630 20747 21700 CDS product YbeF family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378026.1 protein_id gnl|my_center|LOCUS_37630 21909 22874 gene locus_tag LOCUS_37640 gene lipA 21909 22874 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042632.1 protein_id gnl|my_center|LOCUS_37640 23178 22975 gene locus_tag LOCUS_37650 gene tatE 23178 22975 CDS product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503931.1 protein_id gnl|my_center|LOCUS_37650 24095 23307 gene locus_tag LOCUS_37660 24095 23307 CDS product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959109.1 protein_id gnl|my_center|LOCUS_37660 24188 24571 gene locus_tag LOCUS_37670 gene crcB 24188 24571 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939738.1 protein_id gnl|my_center|LOCUS_37670 24835 24626 gene locus_tag LOCUS_37680 gene cspE 24835 24626 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034825.1 protein_id gnl|my_center|LOCUS_37680 25564 25004 gene locus_tag LOCUS_37690 gene pagP 25564 25004 CDS product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103094.1 protein_id gnl|my_center|LOCUS_37690 26152 27537 gene locus_tag LOCUS_37700 gene dcuC 26152 27537 CDS product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955063.1 protein_id gnl|my_center|LOCUS_37700 28258 27578 gene locus_tag LOCUS_37710 gene dpiA 28258 27578 CDS product two-component response regulator DpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126500.1 protein_id gnl|my_center|LOCUS_37710 29885 28227 gene locus_tag LOCUS_37720 gene dpiB 29885 28227 CDS product sensor histidine kinase DpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939766.1 protein_id gnl|my_center|LOCUS_37720 >Feature sequence47 2887 314 gene locus_tag LOCUS_37730 gene clpB 2887 314 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235102.1 protein_id gnl|my_center|LOCUS_37730 3748 3017 gene locus_tag LOCUS_37740 gene yfiH 3748 3017 CDS product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040130.1 protein_id gnl|my_center|LOCUS_37740 4725 3745 gene locus_tag LOCUS_37750 gene rluD 4725 3745 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079100.1 protein_id gnl|my_center|LOCUS_37750 4860 5597 gene locus_tag LOCUS_37760 gene bamD 4860 5597 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197686.1 protein_id gnl|my_center|LOCUS_37760 5868 6209 gene locus_tag LOCUS_37770 gene raiA 5868 6209 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178456.1 protein_id gnl|my_center|LOCUS_37770 6458 7618 gene locus_tag LOCUS_37780 gene pheA 6458 7618 CDS product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200120.1 protein_id gnl|my_center|LOCUS_37780 8782 7661 gene locus_tag LOCUS_37790 gene tyrA 8782 7661 CDS product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225204.1 protein_id gnl|my_center|LOCUS_37790 9863 8793 gene locus_tag LOCUS_37800 gene aroF 9863 8793 CDS product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168045.1 protein_id gnl|my_center|LOCUS_37800 10073 10438 gene locus_tag LOCUS_37810 10073 10438 CDS product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976004.1 protein_id gnl|my_center|LOCUS_37810 10588 11106 gene locus_tag LOCUS_37820 10588 11106 CDS product YfiR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212391.1 protein_id gnl|my_center|LOCUS_37820 11096 12322 gene locus_tag LOCUS_37830 gene dgcN 11096 12322 CDS product diguanylate cyclase DgcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969032.1 protein_id gnl|my_center|LOCUS_37830 12338 12820 gene locus_tag LOCUS_37840 12338 12820 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589828.1 protein_id gnl|my_center|LOCUS_37840 13243 12896 gene locus_tag LOCUS_37850 gene rplS 13243 12896 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065253.1 protein_id gnl|my_center|LOCUS_37850 14052 13285 gene locus_tag LOCUS_37860 gene trmD 14052 13285 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264777.1 protein_id gnl|my_center|LOCUS_37860 14631 14083 gene locus_tag LOCUS_37870 gene rimM 14631 14083 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043335.1 protein_id gnl|my_center|LOCUS_37870 14898 14650 gene locus_tag LOCUS_37880 gene rpsP 14898 14650 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256450.1 protein_id gnl|my_center|LOCUS_37880 16396 15035 gene locus_tag LOCUS_37890 gene ffh 16396 15035 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460035.1 protein_id gnl|my_center|LOCUS_37890 16745 16509 gene locus_tag LOCUS_37900 16745 16509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 16659 17354 gene locus_tag LOCUS_37910 16659 17354 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001338897.1 protein_id gnl|my_center|LOCUS_37910 17399 18661 gene locus_tag LOCUS_37920 17399 18661 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723175.1 protein_id gnl|my_center|LOCUS_37920 19309 18716 gene locus_tag LOCUS_37930 gene grpE 19309 18716 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296310.1 protein_id gnl|my_center|LOCUS_37930 19432 20310 gene locus_tag LOCUS_37940 gene nadK 19432 20310 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059169.1 protein_id gnl|my_center|LOCUS_37940 20396 22057 gene locus_tag LOCUS_37950 gene recN 20396 22057 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880910.1 protein_id gnl|my_center|LOCUS_37950 22206 22547 gene locus_tag LOCUS_37960 gene bamE 22206 22547 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203437.1 protein_id gnl|my_center|LOCUS_37960 22899 22609 gene locus_tag LOCUS_37970 22899 22609 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117838.1 protein_id gnl|my_center|LOCUS_37970 23365 22889 gene locus_tag LOCUS_37980 gene ratA 23365 22889 CDS product type II toxin-antitoxin system toxin RatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600189.1 protein_id gnl|my_center|LOCUS_37980 23497 23979 gene locus_tag LOCUS_37990 gene smpB 23497 23979 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162574.1 protein_id gnl|my_center|LOCUS_37990 24194 24556 gene locus_tag LOCUS_tm00010 24194 24556 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 24723 25952 gene locus_tag LOCUS_38000 24723 25952 CDS product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815743.1 protein_id gnl|my_center|LOCUS_38000 26235 27791 gene locus_tag LOCUS_38010 26235 27791 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102959.1 protein_id gnl|my_center|LOCUS_38010 27781 28677 gene locus_tag LOCUS_38020 27781 28677 CDS product plasmid partitioning protein RepB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102958.1 protein_id gnl|my_center|LOCUS_38020 28674 29570 gene locus_tag LOCUS_38030 28674 29570 CDS product plasmid partitioning protein RepB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338948.1 protein_id gnl|my_center|LOCUS_38030 >Feature sequence48 375 1352 gene locus_tag LOCUS_38040 gene glaH 375 1352 CDS product glutarate dioxygenase GlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993087.1 protein_id gnl|my_center|LOCUS_38040 1371 2639 gene locus_tag LOCUS_38050 gene lhgO 1371 2639 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271983.1 protein_id gnl|my_center|LOCUS_38050 2662 4110 gene locus_tag LOCUS_38060 gene gabD 2662 4110 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772884.1 protein_id gnl|my_center|LOCUS_38060 4124 5404 gene locus_tag LOCUS_38070 gene gabT 4124 5404 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097641.1 protein_id gnl|my_center|LOCUS_38070 5715 7115 gene locus_tag LOCUS_38080 gene gabP 5715 7115 CDS product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301367.1 protein_id gnl|my_center|LOCUS_38080 7136 7798 gene locus_tag LOCUS_38090 gene csiR 7136 7798 CDS product DNA-binding transcriptional regulator CsiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156811.1 protein_id gnl|my_center|LOCUS_38090 8248 7799 gene locus_tag LOCUS_38100 gene kbp 8248 7799 CDS product potassium binding protein Kbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522424.1 protein_id gnl|my_center|LOCUS_38100 8490 8332 gene locus_tag LOCUS_38110 8490 8332 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508177.1 protein_id gnl|my_center|LOCUS_38110 8673 8972 gene locus_tag LOCUS_38120 8673 8972 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137280.1 protein_id gnl|my_center|LOCUS_38120 8982 9506 gene locus_tag LOCUS_38130 gene ygaP 8982 9506 CDS product thiosulfate sulfurtransferase YgaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229442.1 protein_id gnl|my_center|LOCUS_38130 9957 9553 gene locus_tag LOCUS_38140 gene stpA 9957 9553 CDS product DNA-binding protein StpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115383.1 protein_id gnl|my_center|LOCUS_38140 10625 11074 gene locus_tag LOCUS_38150 gene alaE 10625 11074 CDS product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492656.1 protein_id gnl|my_center|LOCUS_38150 11455 11111 gene locus_tag LOCUS_38160 11455 11111 CDS product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281320.1 protein_id gnl|my_center|LOCUS_38160 11607 11936 gene locus_tag LOCUS_38170 11607 11936 CDS product DUF883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295174.1 protein_id gnl|my_center|LOCUS_38170 12184 12429 gene locus_tag LOCUS_38180 gene nrdH 12184 12429 CDS product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223227.1 protein_id gnl|my_center|LOCUS_38180 12426 12836 gene locus_tag LOCUS_38190 gene nrdI 12426 12836 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080947.1 protein_id gnl|my_center|LOCUS_38190 12848 14953 gene locus_tag LOCUS_38200 gene nrdE 12848 14953 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246534.1 protein_id gnl|my_center|LOCUS_38200 14963 15922 gene locus_tag LOCUS_38210 gene nrdF 14963 15922 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777969.1 protein_id gnl|my_center|LOCUS_38210 16276 17478 gene locus_tag LOCUS_38220 gene proV 16276 17478 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985494.1 protein_id gnl|my_center|LOCUS_38220 17471 18535 gene locus_tag LOCUS_38230 gene proW 17471 18535 CDS product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774978.1 protein_id gnl|my_center|LOCUS_38230 18593 19585 gene locus_tag LOCUS_38240 gene proX 18593 19585 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216521.1 protein_id gnl|my_center|LOCUS_38240 19877 21061 gene locus_tag LOCUS_38250 19877 21061 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165699.1 protein_id gnl|my_center|LOCUS_38250 21185 21922 gene locus_tag LOCUS_38260 gene ygaZ 21185 21922 CDS product L-valine exporter subunit YgaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445651.1 protein_id gnl|my_center|LOCUS_38260 21912 22247 gene locus_tag LOCUS_38270 gene ygaH 21912 22247 CDS product L-valine transporter subunit YgaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119763.1 protein_id gnl|my_center|LOCUS_38270 22338 22868 gene locus_tag LOCUS_38280 gene emrR 22338 22868 CDS product multidrug efflux transporter EmrAB transcriptional repressor EmrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378442.1 protein_id gnl|my_center|LOCUS_38280 22995 24167 gene locus_tag LOCUS_38290 gene emrA 22995 24167 CDS product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295175.1 protein_id gnl|my_center|LOCUS_38290 24184 25722 gene locus_tag LOCUS_38300 gene emrB 24184 25722 CDS product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295176.1 protein_id gnl|my_center|LOCUS_38300 26301 25786 gene locus_tag LOCUS_38310 gene luxS 26301 25786 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130211.1 protein_id gnl|my_center|LOCUS_38310 28007 26451 gene locus_tag LOCUS_38320 gene gshA 28007 26451 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611804.1 protein_id gnl|my_center|LOCUS_38320 28508 28080 gene locus_tag LOCUS_38330 28508 28080 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287454.1 protein_id gnl|my_center|LOCUS_38330 29071 28505 gene locus_tag LOCUS_38340 gene yqaB 29071 28505 CDS product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273290.1 protein_id gnl|my_center|LOCUS_38340 29428 29352 gene locus_tag LOCUS_t00570 29428 29352 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence49 332 1630 gene locus_tag LOCUS_38350 gene kgtP 332 1630 CDS product alpha-ketoglutarate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841103.1 protein_id gnl|my_center|LOCUS_38350 1899 1627 gene locus_tag LOCUS_38360 1899 1627 CDS product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300818.1 protein_id gnl|my_center|LOCUS_38360 3354 1996 gene locus_tag LOCUS_38370 gene pssA 3354 1996 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949265.1 protein_id gnl|my_center|LOCUS_38370 6125 3465 gene locus_tag LOCUS_38380 gene pat 6125 3465 CDS product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082964.1 protein_id gnl|my_center|LOCUS_38380 6687 6157 gene locus_tag LOCUS_38390 gene tapT 6687 6157 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138184.1 protein_id gnl|my_center|LOCUS_38390 7343 6924 gene locus_tag LOCUS_38400 gene trxC 7343 6924 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098717.1 protein_id gnl|my_center|LOCUS_38400 7550 8587 gene locus_tag LOCUS_38410 7550 8587 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997403.1 protein_id gnl|my_center|LOCUS_38410 9324 8635 gene locus_tag LOCUS_38420 gene ung 9324 8635 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262720.1 protein_id gnl|my_center|LOCUS_38420 9629 10012 gene locus_tag LOCUS_38430 gene grcA 9629 10012 CDS product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627807.1 protein_id gnl|my_center|LOCUS_38430 10655 10068 gene locus_tag LOCUS_38440 gene eamB 10655 10068 CDS product cysteine/O-acetylserine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189207.1 protein_id gnl|my_center|LOCUS_38440 10758 11639 gene locus_tag LOCUS_38450 10758 11639 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300638.1 protein_id gnl|my_center|LOCUS_38450 13182 11848 gene locus_tag LOCUS_38460 gene srmB 13182 11848 CDS product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219193.1 protein_id gnl|my_center|LOCUS_38460 13314 14051 gene locus_tag LOCUS_38470 gene trmN 13314 14051 CDS product tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295363.1 protein_id gnl|my_center|LOCUS_38470 15658 14036 gene locus_tag LOCUS_38480 gene nadB 15658 14036 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094279.1 protein_id gnl|my_center|LOCUS_38480 16066 16641 gene locus_tag LOCUS_38490 gene rpoE 16066 16641 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295364.1 protein_id gnl|my_center|LOCUS_38490 16674 17324 gene locus_tag LOCUS_38500 gene rseA 16674 17324 CDS product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168459.1 protein_id gnl|my_center|LOCUS_38500 17324 18280 gene locus_tag LOCUS_38510 gene rseB 17324 18280 CDS product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812053.1 protein_id gnl|my_center|LOCUS_38510 18277 18756 gene locus_tag LOCUS_38520 gene rseC 18277 18756 CDS product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589070.1 protein_id gnl|my_center|LOCUS_38520 18954 20753 gene locus_tag LOCUS_38530 gene lepA 18954 20753 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790168.1 protein_id gnl|my_center|LOCUS_38530 20769 21743 gene locus_tag LOCUS_38540 gene lepB 20769 21743 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002542.1 protein_id gnl|my_center|LOCUS_38540 22082 22696 gene locus_tag LOCUS_38550 gene rnc 22082 22696 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068343.1 protein_id gnl|my_center|LOCUS_38550 22693 23598 gene locus_tag LOCUS_38560 gene era 22693 23598 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020749.1 protein_id gnl|my_center|LOCUS_38560 23610 24338 gene locus_tag LOCUS_38570 gene recO 23610 24338 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399404.1 protein_id gnl|my_center|LOCUS_38570 24350 25081 gene locus_tag LOCUS_38580 gene pdxJ 24350 25081 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297412.1 protein_id gnl|my_center|LOCUS_38580 25081 25461 gene locus_tag LOCUS_38590 gene acpS 25081 25461 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986023.1 protein_id gnl|my_center|LOCUS_38590 26341 26156 gene locus_tag LOCUS_38600 26341 26156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 27320 26472 gene locus_tag LOCUS_38610 27320 26472 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013779.1 protein_id gnl|my_center|LOCUS_38610 27529 28164 gene locus_tag LOCUS_38620 gene yfhb 27529 28164 CDS product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190655.1 protein_id gnl|my_center|LOCUS_38620 28222 28725 gene locus_tag LOCUS_38630 gene tadA 28222 28725 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297409.1 protein_id gnl|my_center|LOCUS_38630 >Feature sequence50 677 1273 gene locus_tag LOCUS_38640 gene fimE 677 1273 CDS product type 1 fimbria switch DNA invertase FimE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044711.1 protein_id gnl|my_center|LOCUS_38640 1755 2303 gene locus_tag LOCUS_38650 gene fimA 1755 2303 CDS product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695564.1 protein_id gnl|my_center|LOCUS_38650 2410 2907 gene locus_tag LOCUS_38660 2410 2907 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824114.1 protein_id gnl|my_center|LOCUS_38660 2944 3669 gene locus_tag LOCUS_38670 gene fimC 2944 3669 CDS product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066560.1 protein_id gnl|my_center|LOCUS_38670 3736 6372 gene locus_tag LOCUS_38680 gene fimD 3736 6372 CDS product fimbrial usher FimD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121002.1 protein_id gnl|my_center|LOCUS_38680 6382 6912 gene locus_tag LOCUS_38690 gene fimF 6382 6912 CDS product type 1 fimbria minor subunit FimF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244827.1 protein_id gnl|my_center|LOCUS_38690 6925 7428 gene locus_tag LOCUS_38700 gene fimG 6925 7428 CDS product type 1 fimbria minor subunit FimG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870592.1 protein_id gnl|my_center|LOCUS_38700 7448 8350 gene locus_tag LOCUS_38710 gene fimH 7448 8350 CDS product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832247.1 protein_id gnl|my_center|LOCUS_38710 9936 8593 gene locus_tag LOCUS_38720 gene gntP 9936 8593 CDS product gluconate permease GntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558251.1 protein_id gnl|my_center|LOCUS_38720 10276 11460 gene locus_tag LOCUS_38730 gene uxuA 10276 11460 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438562.1 protein_id gnl|my_center|LOCUS_38730 11541 13001 gene locus_tag LOCUS_38740 11541 13001 CDS product fructuronate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208205.1 protein_id gnl|my_center|LOCUS_38740 13216 13989 gene locus_tag LOCUS_38750 gene uxuR 13216 13989 CDS product Uxu operon transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833679.1 protein_id gnl|my_center|LOCUS_38750 14960 14130 gene locus_tag LOCUS_38760 14960 14130 CDS product YjfZ/YjiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062552.1 protein_id gnl|my_center|LOCUS_38760 15774 16025 gene locus_tag LOCUS_38770 15774 16025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 16929 16018 gene locus_tag LOCUS_38780 gene hypT 16929 16018 CDS product hypochlorite stress DNA-binding transcriptional regulator HypT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340740.1 protein_id gnl|my_center|LOCUS_38780 18166 16994 gene locus_tag LOCUS_38790 gene iadA 18166 16994 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568432.1 protein_id gnl|my_center|LOCUS_38790 18640 18179 gene locus_tag LOCUS_38800 18640 18179 CDS product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211971.1 protein_id gnl|my_center|LOCUS_38800 19332 18637 gene locus_tag LOCUS_38810 19332 18637 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513390.1 protein_id gnl|my_center|LOCUS_38810 19570 20124 gene locus_tag LOCUS_38820 gene kptA 19570 20124 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151855.1 protein_id gnl|my_center|LOCUS_38820 21315 20137 gene locus_tag LOCUS_38830 21315 20137 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141220.1 protein_id gnl|my_center|LOCUS_38830 22243 21383 gene locus_tag LOCUS_38840 22243 21383 CDS product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350572.1 protein_id gnl|my_center|LOCUS_38840 22565 22308 gene locus_tag LOCUS_38850 22565 22308 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657675.1 protein_id gnl|my_center|LOCUS_38850 23329 22562 gene locus_tag LOCUS_38860 gene yjiL 23329 22562 CDS product putative 2-hydroxyacyl-CoA dehydratase activator YjiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331745.1 protein_id gnl|my_center|LOCUS_38860 24490 23339 gene locus_tag LOCUS_38870 24490 23339 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300012.1 protein_id gnl|my_center|LOCUS_38870 25769 24606 gene locus_tag LOCUS_38880 25769 24606 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037419.1 protein_id gnl|my_center|LOCUS_38880 27159 25927 gene locus_tag LOCUS_38890 27159 25927 CDS product multidrug efflux MFS transporter MdtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137036.1 protein_id gnl|my_center|LOCUS_38890 27638 28405 gene locus_tag LOCUS_38900 27638 28405 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181202.1 protein_id gnl|my_center|LOCUS_38900 >Feature sequence51 51 1091 gene locus_tag LOCUS_38910 51 1091 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029814.1 protein_id gnl|my_center|LOCUS_38910 1064 1693 gene locus_tag LOCUS_38920 1064 1693 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502941.1 protein_id gnl|my_center|LOCUS_38920 2854 1694 gene locus_tag LOCUS_38930 gene ybdL 2854 1694 CDS product methionine-oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183907.1 protein_id gnl|my_center|LOCUS_38930 2963 4051 gene locus_tag LOCUS_38940 gene hcxA 2963 4051 CDS product hydroxycarboxylate dehydrogenase HcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120449.1 protein_id gnl|my_center|LOCUS_38940 4258 4061 gene locus_tag LOCUS_38950 4258 4061 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460431.1 protein_id gnl|my_center|LOCUS_38950 5534 4440 gene locus_tag LOCUS_38960 5534 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38960 6535 5513 gene locus_tag LOCUS_38970 6535 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38970 7129 6716 gene locus_tag LOCUS_38980 gene entH 7129 6716 CDS product proofreading thioesterase EntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637953.1 protein_id gnl|my_center|LOCUS_38980 7878 7132 gene locus_tag LOCUS_38990 gene entA 7878 7132 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase EntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347664.1 protein_id gnl|my_center|LOCUS_38990 8735 7878 gene locus_tag LOCUS_39000 gene entB 8735 7878 CDS product enterobactin biosynthesis bifunctional isochorismatase/aryl carrier protein EntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007138.1 protein_id gnl|my_center|LOCUS_39000 10359 8749 gene locus_tag LOCUS_39010 gene entE 10359 8749 CDS product (2,3-dihydroxybenzoyl)adenylate synthase EntE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026805.1 protein_id gnl|my_center|LOCUS_39010 11544 10369 gene locus_tag LOCUS_39020 gene entC 11544 10369 CDS product isochorismate synthase EntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295313.1 protein_id gnl|my_center|LOCUS_39020 11919 12875 gene locus_tag LOCUS_39030 gene fepB 11919 12875 CDS product Fe2+-enterobactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234314.1 protein_id gnl|my_center|LOCUS_39030 14129 12879 gene locus_tag LOCUS_39040 gene entS 14129 12879 CDS product enterobactin transporter EntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041789.1 protein_id gnl|my_center|LOCUS_39040 14240 15244 gene locus_tag LOCUS_39050 gene fepD 14240 15244 CDS product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295314.1 protein_id gnl|my_center|LOCUS_39050 15241 16233 gene locus_tag LOCUS_39060 gene fepG 15241 16233 CDS product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640988.1 protein_id gnl|my_center|LOCUS_39060 16230 17045 gene locus_tag LOCUS_39070 gene fepC 16230 17045 CDS product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140647.1 protein_id gnl|my_center|LOCUS_39070 18046 17042 gene locus_tag LOCUS_39080 gene wzz(fepE) 18046 17042 CDS product LPS O-antigen length regulator Wzz(fepE) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096715.1 protein_id gnl|my_center|LOCUS_39080 22272 18391 gene locus_tag LOCUS_39090 gene entF 22272 18391 CDS product enterobactin non-ribosomal peptide synthetase EntF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077805.1 protein_id gnl|my_center|LOCUS_39090 22487 22269 gene locus_tag LOCUS_39100 gene ybdZ 22487 22269 CDS product enterobactin biosynthesis protein YbdZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885798.1 protein_id gnl|my_center|LOCUS_39100 23692 22490 gene locus_tag LOCUS_39110 gene fes 23692 22490 CDS product enterochelin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125843.1 protein_id gnl|my_center|LOCUS_39110 23936 26176 gene locus_tag LOCUS_39120 gene fepA 23936 26176 CDS product siderophore enterobactin receptor FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034943.1 protein_id gnl|my_center|LOCUS_39120 26342 26971 gene locus_tag LOCUS_39130 gene entD 26342 26971 CDS product enterobactin synthase subunit EntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001749708.1 protein_id gnl|my_center|LOCUS_39130 >Feature sequence52 128 1090 gene locus_tag LOCUS_39140 gene tauA 128 1090 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018416.1 protein_id gnl|my_center|LOCUS_39140 1103 1870 gene locus_tag LOCUS_39150 gene tauB 1103 1870 CDS product taurine ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939394.1 protein_id gnl|my_center|LOCUS_39150 1867 2694 gene locus_tag LOCUS_39160 gene tauC 1867 2694 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114575.1 protein_id gnl|my_center|LOCUS_39160 2691 3542 gene locus_tag LOCUS_39170 gene tauD 2691 3542 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004024.1 protein_id gnl|my_center|LOCUS_39170 4623 3649 gene locus_tag LOCUS_39180 gene hemB 4623 3649 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295337.1 protein_id gnl|my_center|LOCUS_39180 5146 8052 gene locus_tag LOCUS_39190 5146 8052 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556441.1 protein_id gnl|my_center|LOCUS_39190 8140 8763 gene locus_tag LOCUS_39200 gene iprA 8140 8763 CDS product hydrogen peroxide resistance inhibitor IprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295335.1 protein_id gnl|my_center|LOCUS_39200 9921 8764 gene locus_tag LOCUS_39210 gene ampH 9921 8764 CDS product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830741.1 protein_id gnl|my_center|LOCUS_39210 10273 11493 gene locus_tag LOCUS_39220 gene sbmA 10273 11493 CDS product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001342332.1 protein_id gnl|my_center|LOCUS_39220 11506 12600 gene locus_tag LOCUS_39230 gene yaiW 11506 12600 CDS product surface-exposed outer membrane lipoprotein YaiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092069.1 protein_id gnl|my_center|LOCUS_39230 12967 12659 gene locus_tag LOCUS_39240 12967 12659 CDS product YaiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763151.1 protein_id gnl|my_center|LOCUS_39240 13227 13439 gene locus_tag LOCUS_39250 13227 13439 CDS product DUF2754 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295334.1 protein_id gnl|my_center|LOCUS_39250 14557 13463 gene locus_tag LOCUS_39260 gene ddlA 14557 13463 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413677.1 protein_id gnl|my_center|LOCUS_39260 15020 15280 gene locus_tag LOCUS_39270 gene iraP 15020 15280 CDS product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792970.1 protein_id gnl|my_center|LOCUS_39270 15381 16796 gene locus_tag LOCUS_39280 gene phoA 15381 16796 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814404.1 protein_id gnl|my_center|LOCUS_39280 16915 17235 gene locus_tag LOCUS_39290 gene psiF 16915 17235 CDS product phosphate starvation-inducible protein PsiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295332.1 protein_id gnl|my_center|LOCUS_39290 17337 18452 gene locus_tag LOCUS_39300 gene adrA 17337 18452 CDS product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484048.1 protein_id gnl|my_center|LOCUS_39300 19278 18469 gene locus_tag LOCUS_39310 gene proC 19278 18469 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295331.1 protein_id gnl|my_center|LOCUS_39310 19398 19856 gene locus_tag LOCUS_39320 19398 19856 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158159.1 protein_id gnl|my_center|LOCUS_39320 20096 20563 gene locus_tag LOCUS_39330 gene aroL 20096 20563 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193393.1 protein_id gnl|my_center|LOCUS_39330 20613 20804 gene locus_tag LOCUS_39340 gene yaiA 20613 20804 CDS product protein YaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142439.1 protein_id gnl|my_center|LOCUS_39340 21062 21739 gene locus_tag LOCUS_39350 21062 21739 CDS product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276420.1 protein_id gnl|my_center|LOCUS_39350 21898 22095 gene locus_tag LOCUS_39360 21898 22095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 22303 22584 gene locus_tag LOCUS_39370 22303 22584 CDS product DUF2773 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942006.1 protein_id gnl|my_center|LOCUS_39370 >Feature sequence53 491 90 gene locus_tag LOCUS_39380 gene crl 491 90 CDS product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174677.1 protein_id gnl|my_center|LOCUS_39380 1793 549 gene locus_tag LOCUS_39390 gene frsA 1793 549 CDS product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189541.1 protein_id gnl|my_center|LOCUS_39390 2343 1885 gene locus_tag LOCUS_39400 gene gpt 2343 1885 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291990.1 protein_id gnl|my_center|LOCUS_39400 2604 4061 gene locus_tag LOCUS_39410 gene pepD 2604 4061 CDS product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293009.1 protein_id gnl|my_center|LOCUS_39410 4618 4118 gene locus_tag LOCUS_39420 gene prfH 4618 4118 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602135.1 protein_id gnl|my_center|LOCUS_39420 4853 4587 gene locus_tag LOCUS_39430 4853 4587 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303804.1 protein_id gnl|my_center|LOCUS_39430 5539 5087 gene locus_tag LOCUS_39440 5539 5087 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059883.1 protein_id gnl|my_center|LOCUS_39440 5947 5549 gene locus_tag LOCUS_39450 gene yafO 5947 5549 CDS product type II toxin-antitoxin system mRNA interferase toxin YafO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263491.1 protein_id gnl|my_center|LOCUS_39450 6243 5950 gene locus_tag LOCUS_39460 gene yafN 6243 5950 CDS product type I toxin-antitoxin system antitoxin YafN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554757.1 protein_id gnl|my_center|LOCUS_39460 7350 6295 gene locus_tag LOCUS_39470 gene dinB 7350 6295 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226164.1 protein_id gnl|my_center|LOCUS_39470 8191 7421 gene locus_tag LOCUS_39480 gene lafU 8191 7421 CDS product putative lateral flagellar export/assembly protein LafU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207556.1 protein_id gnl|my_center|LOCUS_39480 8151 9890 gene locus_tag LOCUS_39490 8151 9890 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301901.1 protein_id gnl|my_center|LOCUS_39490 10603 10106 gene locus_tag LOCUS_39500 gene rayT 10603 10106 CDS product REP-associated tyrosine transposase RayT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006255.1 protein_id gnl|my_center|LOCUS_39500 11405 10779 gene locus_tag LOCUS_39510 11405 10779 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001389087.1 protein_id gnl|my_center|LOCUS_39510 11443 11610 gene locus_tag LOCUS_39520 11443 11610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 11738 11998 gene locus_tag LOCUS_39530 gene dinJ 11738 11998 CDS product type II toxin-antitoxin system antitoxin DinJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729704.1 protein_id gnl|my_center|LOCUS_39530 12001 12279 gene locus_tag LOCUS_39540 gene yafQ 12001 12279 CDS product type II toxin-antitoxin system mRNA interferase toxin YafQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615980.1 protein_id gnl|my_center|LOCUS_39540 12435 13175 gene locus_tag LOCUS_39550 gene dpaA 12435 13175 CDS product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225679.1 protein_id gnl|my_center|LOCUS_39550 13913 13146 gene locus_tag LOCUS_39560 13913 13146 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333379.1 protein_id gnl|my_center|LOCUS_39560 14697 14119 gene locus_tag LOCUS_39570 gene lpcA 14697 14119 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284050.1 protein_id gnl|my_center|LOCUS_39570 14937 17381 gene locus_tag LOCUS_39580 gene fadE 14937 17381 CDS product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973083.1 protein_id gnl|my_center|LOCUS_39580 17897 17424 gene locus_tag LOCUS_39590 gene ivy 17897 17424 CDS product Ivy family C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532698.1 protein_id gnl|my_center|LOCUS_39590 18051 18821 gene locus_tag LOCUS_39600 gene yafV 18051 18821 CDS product 2-oxoglutaramate amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118036.1 protein_id gnl|my_center|LOCUS_39600 <19402 18862 gene locus_tag LOCUS_39610 <19402 18862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000420980.1:ISAs1-like element ISEc1 family transposase >Feature sequence54 258 1325 gene locus_tag LOCUS_39620 gene mltA 258 1325 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678646.1 protein_id gnl|my_center|LOCUS_39620 1564 2370 gene locus_tag LOCUS_39630 gene tcdA 1564 2370 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117728.1 protein_id gnl|my_center|LOCUS_39630 2864 2421 gene locus_tag LOCUS_39640 gene csdE 2864 2421 CDS product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184261.1 protein_id gnl|my_center|LOCUS_39640 4069 2864 gene locus_tag LOCUS_39650 gene csdA 4069 2864 CDS product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300698.1 protein_id gnl|my_center|LOCUS_39650 4261 4488 gene locus_tag LOCUS_39660 4261 4488 CDS product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750398.1 protein_id gnl|my_center|LOCUS_39660 4839 5756 gene locus_tag LOCUS_39670 gene gcvA 4839 5756 CDS product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044401.1 protein_id gnl|my_center|LOCUS_39670 5775 6170 gene locus_tag LOCUS_39680 5775 6170 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203905.1 protein_id gnl|my_center|LOCUS_39680 6163 7263 gene locus_tag LOCUS_39690 gene rlmM 6163 7263 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045520.1 protein_id gnl|my_center|LOCUS_39690 8038 7307 gene locus_tag LOCUS_39700 gene fucR 8038 7307 CDS product L-fucose operon activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642344.1 protein_id gnl|my_center|LOCUS_39700 8518 8096 gene locus_tag LOCUS_39710 gene fucU 8518 8096 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920840.1 protein_id gnl|my_center|LOCUS_39710 9938 8520 gene locus_tag LOCUS_39720 gene fucK 9938 8520 CDS product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808376.1 protein_id gnl|my_center|LOCUS_39720 11822 10047 gene locus_tag LOCUS_39730 gene fucI 11822 10047 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724153.1 protein_id gnl|my_center|LOCUS_39730 12292 13791 gene locus_tag LOCUS_39740 gene gguA 12292 13791 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_39740 13795 14778 gene locus_tag LOCUS_39750 13795 14778 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 protein_id gnl|my_center|LOCUS_39750 14852 15802 gene locus_tag LOCUS_39760 14852 15802 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_39760 15855 17435 gene locus_tag LOCUS_39770 15855 17435 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210047.1 protein_id gnl|my_center|LOCUS_39770 17500 18498 gene locus_tag LOCUS_39780 17500 18498 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232704.1 protein_id gnl|my_center|LOCUS_39780 18631 19104 gene locus_tag LOCUS_39790 18631 19104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 >Feature sequence55 963 529 gene locus_tag LOCUS_39800 gene uspF 963 529 CDS product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300461.1 protein_id gnl|my_center|LOCUS_39800 2237 1104 gene locus_tag LOCUS_39810 gene ompN 2237 1104 CDS product porin OmpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837902.1 protein_id gnl|my_center|LOCUS_39810 6128 2604 gene locus_tag LOCUS_39820 gene nifJ 6128 2604 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628222.1 protein_id gnl|my_center|LOCUS_39820 6402 6668 gene locus_tag LOCUS_39830 6402 6668 CDS product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295715.1 protein_id gnl|my_center|LOCUS_39830 7087 6665 gene locus_tag LOCUS_39840 gene hslJ 7087 6665 CDS product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298828.1 protein_id gnl|my_center|LOCUS_39840 8187 7198 gene locus_tag LOCUS_39850 gene ldhA 8187 7198 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762229.1 protein_id gnl|my_center|LOCUS_39850 8395 11034 gene locus_tag LOCUS_39860 8395 11034 CDS product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900912.1 protein_id gnl|my_center|LOCUS_39860 11031 11216 gene locus_tag LOCUS_39870 11031 11216 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698145.1 protein_id gnl|my_center|LOCUS_39870 11281 11550 gene locus_tag LOCUS_39880 11281 11550 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296730.1 protein_id gnl|my_center|LOCUS_39880 12627 11722 gene locus_tag LOCUS_39890 gene feaR 12627 11722 CDS product transcriptional regulator FeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067514.1 protein_id gnl|my_center|LOCUS_39890 12863 14362 gene locus_tag LOCUS_39900 gene feaB 12863 14362 CDS product phenylacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138615.1 protein_id gnl|my_center|LOCUS_39900 <16394 14421 gene locus_tag LOCUS_39910 <16394 14421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000535469.1:primary-amine oxidase >Feature sequence56 135 1136 gene locus_tag LOCUS_39920 gene gap 135 1136 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048667.1 protein_id gnl|my_center|LOCUS_39920 2617 1178 gene locus_tag LOCUS_39930 gene aldA 2617 1178 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115947.1 protein_id gnl|my_center|LOCUS_39930 3614 2814 gene locus_tag LOCUS_39940 gene ydcF 3614 2814 CDS product DUF218 domain-containing protein YdcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027967.1 protein_id gnl|my_center|LOCUS_39940 7788 3886 gene locus_tag LOCUS_39950 gene hrpA 7788 3886 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139614.1 protein_id gnl|my_center|LOCUS_39950 7989 8594 gene locus_tag LOCUS_39960 gene azoR 7989 8594 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048948.1 protein_id gnl|my_center|LOCUS_39960 9913 8645 gene locus_tag LOCUS_39970 9913 8645 CDS product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001391902.1 protein_id gnl|my_center|LOCUS_39970 11537 9951 gene locus_tag LOCUS_39980 11537 9951 CDS product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431845.1 protein_id gnl|my_center|LOCUS_39980 12620 11724 gene locus_tag LOCUS_39990 12620 11724 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890941.1 protein_id gnl|my_center|LOCUS_39990 13087 12620 gene locus_tag LOCUS_40000 13087 12620 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177515.1 protein_id gnl|my_center|LOCUS_40000 15702 13396 gene locus_tag LOCUS_40010 15702 13396 CDS product DUF2773 domain-containing bactofilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471490.1 protein_id gnl|my_center|LOCUS_40010 <16305 15766 gene locus_tag LOCUS_40020 <16305 15766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000097801.1:pyridoxine 4-dehydrogenase >Feature sequence57 973 191 gene locus_tag LOCUS_40030 973 191 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082780.1 protein_id gnl|my_center|LOCUS_40030 1622 990 gene locus_tag LOCUS_40040 1622 990 CDS product ribulose-phosphate 3 epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600622.1 protein_id gnl|my_center|LOCUS_40040 2065 1634 gene locus_tag LOCUS_40050 gene sgcA 2065 1634 CDS product SgcA family PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606406.1 protein_id gnl|my_center|LOCUS_40050 3002 2196 gene locus_tag LOCUS_40060 gene sgcQ 3002 2196 CDS product BtpA family protein SgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118626.1 protein_id gnl|my_center|LOCUS_40060 4328 3015 gene locus_tag LOCUS_40070 gene sgcC 4328 3015 CDS product PTS sugar transporter subunit IIC SgcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460843.1 protein_id gnl|my_center|LOCUS_40070 4618 4340 gene locus_tag LOCUS_40080 gene sgcB 4618 4340 CDS product PTS sugar transporter subunit IIB SgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722973.1 protein_id gnl|my_center|LOCUS_40080 5736 4615 gene locus_tag LOCUS_40090 5736 4615 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010829.1 protein_id gnl|my_center|LOCUS_40090 7268 6522 gene locus_tag LOCUS_40100 7268 6522 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354251.1 protein_id gnl|my_center|LOCUS_40100 7869 7324 gene locus_tag LOCUS_40110 7869 7324 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309181.1 protein_id gnl|my_center|LOCUS_40110 8138 7881 gene locus_tag LOCUS_40120 8138 7881 CDS product YjhX family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054376.1 protein_id gnl|my_center|LOCUS_40120 8924 9133 gene locus_tag LOCUS_40130 8924 9133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40130 9100 9276 gene locus_tag LOCUS_40140 9100 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40140 9292 10116 gene locus_tag LOCUS_40150 9292 10116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40150 11706 10699 gene locus_tag LOCUS_40160 11706 10699 CDS product 9-O-acetyl-N-acetylneuraminic acid deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991438.1 protein_id gnl|my_center|LOCUS_40160 12850 11744 gene locus_tag LOCUS_40170 gene nanM 12850 11744 CDS product N-acetylneuraminate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309184.1 protein_id gnl|my_center|LOCUS_40170 13586 12870 gene locus_tag LOCUS_40180 gene nanC 13586 12870 CDS product N-acetylneuraminic acid outer membrane channel NanC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295734.1 protein_id gnl|my_center|LOCUS_40180 >Feature sequence58 2196 748 gene locus_tag LOCUS_40190 gene cusS 2196 748 CDS product Cu(+)/Ag(+) sensor histidine kinase CusS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253826.1 protein_id gnl|my_center|LOCUS_40190 2869 2186 gene locus_tag LOCUS_40200 gene cusR 2869 2186 CDS product copper response regulator transcription factor CusR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770953.1 protein_id gnl|my_center|LOCUS_40200 3026 4399 gene locus_tag LOCUS_40210 gene cusC 3026 4399 CDS product Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074237.1 protein_id gnl|my_center|LOCUS_40210 4557 4889 gene locus_tag LOCUS_40220 gene cusF 4557 4889 CDS product Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709865.1 protein_id gnl|my_center|LOCUS_40220 4905 6128 gene locus_tag LOCUS_40230 gene cusB 4905 6128 CDS product Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717157.1 protein_id gnl|my_center|LOCUS_40230 6140 9283 gene locus_tag LOCUS_40240 gene cusA 6140 9283 CDS product Cu(+)/Ag(+) efflux RND transporter permease subunit CusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573945.1 protein_id gnl|my_center|LOCUS_40240 9349 10761 gene locus_tag LOCUS_40250 gene pheP 9349 10761 CDS product phenylalanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786320.1 protein_id gnl|my_center|LOCUS_40250 12076 10829 gene locus_tag LOCUS_40260 gene ybdG 12076 10829 CDS product mechanosensitive ion channel YbdG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153148.1 protein_id gnl|my_center|LOCUS_40260 12837 12184 gene locus_tag LOCUS_40270 gene nfsB 12837 12184 CDS product oxygen-insensitive NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351464.1 protein_id gnl|my_center|LOCUS_40270 13299 12931 gene locus_tag LOCUS_40280 13299 12931 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360951.1 protein_id gnl|my_center|LOCUS_40280 13564 13364 gene locus_tag LOCUS_40290 13564 13364 CDS product DUF1158 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682524.1 protein_id gnl|my_center|LOCUS_40290 14796 13678 gene locus_tag LOCUS_40300 14796 13678 CDS product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130654.1 protein_id gnl|my_center|LOCUS_40300 >Feature sequence59 <1 2412 gene locus_tag LOCUS_40310 <1 2412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000290535.1:prophage tail fiber N-terminal domain-containing protein 2409 2690 gene locus_tag LOCUS_40320 2409 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654151.1 protein_id gnl|my_center|LOCUS_40320 2700 3404 gene locus_tag LOCUS_40330 2700 3404 CDS product tail fiber domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235980.1 protein_id gnl|my_center|LOCUS_40330 3415 3708 gene locus_tag LOCUS_40340 3415 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640154.1 protein_id gnl|my_center|LOCUS_40340 4384 5133 gene locus_tag LOCUS_40350 gene appY 4384 5133 CDS product DNA-binding transcriptional activator AppY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386784.1 protein_id gnl|my_center|LOCUS_40350 6335 5382 gene locus_tag LOCUS_40360 gene ompT 6335 5382 CDS product omptin family outer membrane protease OmpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201845.1 protein_id gnl|my_center|LOCUS_40360 7610 6849 gene locus_tag LOCUS_40370 gene envY 7610 6849 CDS product DNA-binding transcriptional regulator EnvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177464.1 protein_id gnl|my_center|LOCUS_40370 8683 7793 gene locus_tag LOCUS_40380 8683 7793 CDS product DUF4434 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224568.1 protein_id gnl|my_center|LOCUS_40380 11656 8684 gene locus_tag LOCUS_40390 gene nfrA 11656 8684 CDS product bacteriophage adsorption protein NfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662366.1 protein_id gnl|my_center|LOCUS_40390 13295 11643 gene locus_tag LOCUS_40400 13295 11643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40400 13880 13302 gene locus_tag LOCUS_40410 13880 13302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40410 <14653 14151 gene locus_tag LOCUS_40420 <14653 14151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_097335731.1:ISAs1 family transposase >Feature sequence60 808 35 gene locus_tag LOCUS_40430 gene dsbG 808 35 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913829.1 protein_id gnl|my_center|LOCUS_40430 1180 1743 gene locus_tag LOCUS_40440 gene ahpC 1180 1743 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052796.1 protein_id gnl|my_center|LOCUS_40440 1988 3553 gene locus_tag LOCUS_40450 gene ahpF 1988 3553 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887629.1 protein_id gnl|my_center|LOCUS_40450 4102 3674 gene locus_tag LOCUS_40460 gene uspG 4102 3674 CDS product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278509.1 protein_id gnl|my_center|LOCUS_40460 4323 5561 gene locus_tag LOCUS_40470 4323 5561 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646173.1 protein_id gnl|my_center|LOCUS_40470 6202 5792 gene locus_tag LOCUS_40480 gene rnk 6202 5792 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089731.1 protein_id gnl|my_center|LOCUS_40480 7238 6432 gene locus_tag LOCUS_40490 gene rna 7238 6432 CDS product ribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643397.1 protein_id gnl|my_center|LOCUS_40490 8815 7352 gene locus_tag LOCUS_40500 gene citT 8815 7352 CDS product citrate/succinate antiporter CitT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050323.1 protein_id gnl|my_center|LOCUS_40500 9744 8866 gene locus_tag LOCUS_40510 gene citG 9744 8866 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062457.1 protein_id gnl|my_center|LOCUS_40510 10270 9719 gene locus_tag LOCUS_40520 gene citX 10270 9719 CDS product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550422.1 protein_id gnl|my_center|LOCUS_40520 11806 10274 gene locus_tag LOCUS_40530 gene citF 11806 10274 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192245.1 protein_id gnl|my_center|LOCUS_40530 12725 11817 gene locus_tag LOCUS_40540 gene citE 12725 11817 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622357.1 protein_id gnl|my_center|LOCUS_40540 13018 12722 gene locus_tag LOCUS_40550 gene citD 13018 12722 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700701.1 protein_id gnl|my_center|LOCUS_40550 14091 13033 gene locus_tag LOCUS_40560 gene citC 14091 13033 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467705.1 protein_id gnl|my_center|LOCUS_40560 >Feature sequence61 1993 1139 gene locus_tag LOCUS_40570 gene gatY 1993 1139 CDS product tagatose-bisphosphate aldolase subunit GatY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307281.1 protein_id gnl|my_center|LOCUS_40570 3345 2293 gene locus_tag LOCUS_40580 gene fbaB 3345 2293 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129551.1 protein_id gnl|my_center|LOCUS_40580 3602 4879 gene locus_tag LOCUS_40590 3602 4879 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858484.1 protein_id gnl|my_center|LOCUS_40590 4876 5880 gene locus_tag LOCUS_40600 4876 5880 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846217.1 protein_id gnl|my_center|LOCUS_40600 5877 6842 gene locus_tag LOCUS_40610 5877 6842 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012001.1 protein_id gnl|my_center|LOCUS_40610 7562 6816 gene locus_tag LOCUS_40620 7562 6816 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434038.1 protein_id gnl|my_center|LOCUS_40620 8432 7614 gene locus_tag LOCUS_40630 8432 7614 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297420.1 protein_id gnl|my_center|LOCUS_40630 9297 8497 gene locus_tag LOCUS_40640 gene thiD 9297 8497 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822274.1 protein_id gnl|my_center|LOCUS_40640 10082 9294 gene locus_tag LOCUS_40650 gene thiM 10082 9294 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195564.1 protein_id gnl|my_center|LOCUS_40650 10405 10650 gene locus_tag LOCUS_40660 10405 10650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141034.1 protein_id gnl|my_center|LOCUS_40660 10697 11128 gene locus_tag LOCUS_40670 10697 11128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 11897 11232 gene locus_tag LOCUS_40680 11897 11232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 12021 11857 gene locus_tag LOCUS_40690 12021 11857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098602.1 protein_id gnl|my_center|LOCUS_40690 12282 12091 gene locus_tag LOCUS_40700 12282 12091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 >Feature sequence62 183 986 gene locus_tag LOCUS_40710 gene dkgB 183 986 CDS product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997036.1 protein_id gnl|my_center|LOCUS_40710 1897 983 gene locus_tag LOCUS_40720 gene yafC 1897 983 CDS product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648586.1 protein_id gnl|my_center|LOCUS_40720 2138 2938 gene locus_tag LOCUS_40730 2138 2938 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230983.1 protein_id gnl|my_center|LOCUS_40730 2942 3565 gene locus_tag LOCUS_40740 2942 3565 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016007.1 protein_id gnl|my_center|LOCUS_40740 4767 3613 gene locus_tag LOCUS_40750 gene mltD 4767 3613 CDS product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644685.1 protein_id gnl|my_center|LOCUS_40750 5798 5043 gene locus_tag LOCUS_40760 gene gloB 5798 5043 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052715.1 protein_id gnl|my_center|LOCUS_40760 5832 6554 gene locus_tag LOCUS_40770 5832 6554 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307587.1 protein_id gnl|my_center|LOCUS_40770 7018 6551 gene locus_tag LOCUS_40780 gene rnhA 7018 6551 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917883.1 protein_id gnl|my_center|LOCUS_40780 7083 7814 gene locus_tag LOCUS_40790 gene dnaQ 7083 7814 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001366128.1 protein_id gnl|my_center|LOCUS_40790 7947 8023 gene locus_tag LOCUS_t00580 7947 8023 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8353 9138 gene locus_tag LOCUS_40800 8353 9138 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086141.1 protein_id gnl|my_center|LOCUS_40800 >Feature sequence63 380 1072 gene locus_tag LOCUS_40810 380 1072 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131164.1 protein_id gnl|my_center|LOCUS_40810 1095 2522 gene locus_tag LOCUS_40820 gene mdtD 1095 2522 CDS product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280852.1 protein_id gnl|my_center|LOCUS_40820 3480 2488 gene locus_tag LOCUS_40830 gene rbsR 3480 2488 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224470.1 protein_id gnl|my_center|LOCUS_40830 4428 3484 gene locus_tag LOCUS_40840 gene rbsK 4428 3484 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354235.1 protein_id gnl|my_center|LOCUS_40840 5429 4539 gene locus_tag LOCUS_40850 gene rbsB 5429 4539 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056273.1 protein_id gnl|my_center|LOCUS_40850 6419 5454 gene locus_tag LOCUS_40860 gene rbsC 6419 5454 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211858.1 protein_id gnl|my_center|LOCUS_40860 7929 6424 gene locus_tag LOCUS_40870 gene rbsA 7929 6424 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387770.1 protein_id gnl|my_center|LOCUS_40870 8356 7937 gene locus_tag LOCUS_40880 gene rbsD 8356 7937 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715936.1 protein_id gnl|my_center|LOCUS_40880 >Feature sequence64 74 1009 gene locus_tag LOCUS_40890 gene ompC 74 1009 CDS product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865568.1 protein_id gnl|my_center|LOCUS_40890 1121 2176 gene locus_tag LOCUS_40900 gene apbE 1121 2176 CDS product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406064.1 protein_id gnl|my_center|LOCUS_40900 2516 2298 gene locus_tag LOCUS_40910 2516 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 2499 3314 gene locus_tag LOCUS_40920 gene ada 2499 3314 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710375.1 protein_id gnl|my_center|LOCUS_40920 3314 3964 gene locus_tag LOCUS_40930 gene alkB 3314 3964 CDS product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884972.1 protein_id gnl|my_center|LOCUS_40930 4040 5683 gene locus_tag LOCUS_40940 gene yojI 4040 5683 CDS product microcin J25 efflux ABC transporter YojI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422182.1 protein_id gnl|my_center|LOCUS_40940 5901 7547 gene locus_tag LOCUS_40950 gene mqo 5901 7547 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758086.1 protein_id gnl|my_center|LOCUS_40950 >Feature sequence65 493 418 gene locus_tag LOCUS_t00590 493 418 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 574 500 gene locus_tag LOCUS_t00600 574 500 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 775 691 gene locus_tag LOCUS_t00610 775 691 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 859 784 gene locus_tag LOCUS_t00620 859 784 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1245 2171 gene locus_tag LOCUS_40960 gene coaA 1245 2171 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023081.1 protein_id gnl|my_center|LOCUS_40960 3165 2200 gene locus_tag LOCUS_40970 gene birA 3165 2200 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654614.1 protein_id gnl|my_center|LOCUS_40970 4190 3162 gene locus_tag LOCUS_40980 gene murB 4190 3162 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016672.1 protein_id gnl|my_center|LOCUS_40980 >Feature sequence66 2814 811 gene locus_tag LOCUS_40990 gene betT 2814 811 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130624425.1 protein_id gnl|my_center|LOCUS_40990 3402 2962 gene locus_tag LOCUS_41000 3402 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 4118 3816 gene locus_tag LOCUS_41010 4118 3816 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083824.1 protein_id gnl|my_center|LOCUS_41010 >Feature sequence67 <1 1990 gene locus_tag LOCUS_41020 <1 1990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_181890839.1:prophage tail fiber N-terminal domain-containing protein 1990 2271 gene locus_tag LOCUS_41030 1990 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654151.1 protein_id gnl|my_center|LOCUS_41030 2281 2985 gene locus_tag LOCUS_41040 2281 2985 CDS product tail fiber domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235984.1 protein_id gnl|my_center|LOCUS_41040 3259 3413 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends