COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..128563 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 712..884 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(993..1484) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264135.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene queD CDS 1786..3174 product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887075.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 assembly_gap 3877..3982 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4047..4709 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921300.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 4969..8451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 8590..10128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 assembly_gap 9989..10108 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10212..13892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 assembly_gap 13638..13720 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13978..14889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 14990..15766 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324393.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(15812..16720) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922316.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 16973..17947 product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(17985..18842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 assembly_gap 19119..19310 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19502..20680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(20803..21870) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326673.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 assembly_gap 22832..22967 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 23126..23743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 24043..24435 product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329772.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(24468..24878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(24930..27716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 assembly_gap 25953..26000 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(27941..28654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(28676..32842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 assembly_gap 31005..31099 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(32933..34945) product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532602.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 35327..35881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(36014..37081) product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene waaF CDS complement(37078..37473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 assembly_gap 37534..37642 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 37929..38107 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 39085..40263 product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061087.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(40270..42984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 assembly_gap 43184..43287 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(43324..43899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 assembly_gap 44084..44283 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(44355..45155) product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335257.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene larB CDS complement(45395..46348) product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399304.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene galM CDS 46475..46753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(46779..47540) product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(47657..50416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 50857..51645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(51702..52049) product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(52081..52932) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121000.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 assembly_gap 52997..53149 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(53270..53911) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene eda CDS 54188..55930 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121786.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(55940..56509) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene hpt CDS complement(56648..57589) product DNA integrity scanning protein DisA nucleotide-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615923.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(57776..58648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(58911..60041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 60482..75724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 assembly_gap 62915..63004 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 67954..68076 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 77377..77595 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 77646..78755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 assembly_gap 78633..78697 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 78787..81057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(81275..83842) product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(83852..84787) product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921630.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(84915..85499) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921949.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(85516..85866) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327329.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene nirD CDS complement(86088..86915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 assembly_gap 86977..87114 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(87358..88548) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703804.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(88693..89358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 assembly_gap 89459..89612 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 89872..90024 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 90313..90512 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 90879..91062 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(91101..91874) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 tRNA 92361..92435 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 92549..93361 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119041.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 93416..94330 product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(94381..94977) product putative metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943559.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(94983..95894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(96220..96831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(96863..97210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 assembly_gap 97256..97353 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(97948..98676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 98850..100637 product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 100778..101419 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583746.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(101427..105086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 105843..106574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326821.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 106792..108534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(108664..108999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 assembly_gap 109274..109410 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(109577..110569) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921457.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene hemB CDS 110739..111083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(111223..113160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(113285..114280) product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389971.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 assembly_gap 114300..114491 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 115053..115234 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(115407..116351) product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 116725..117783 product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922223.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(118199..118585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 assembly_gap 118607..118748 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 119047..119157 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 120666..121091 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941051.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 121430..121696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 121806..123542 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118026.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 assembly_gap 122953..123050 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(123546..124703) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767199.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 assembly_gap 124715..124861 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(125675..126448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(126662..127285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 sequence002 source 1..116700 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 275..473 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2057..2815 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249618.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 3067..3774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 3747..4595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 assembly_gap 5557..5664 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5679..7229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 assembly_gap 7303..7464 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7910..8003 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 8409..8482 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8602..9000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 8997..9383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 9414..11015 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(11211..11489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(11561..13000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(13097..13996) product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121957.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 assembly_gap 14211..14406 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14604..15986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 16887..18416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(18513..18800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(18993..19160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(19888..20616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 assembly_gap 21288..21415 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21642..22265) product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119018.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(22280..23053) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328112.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene ubiE CDS 23125..24117 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399225.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(24068..24733) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094752.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene cmk CDS complement(24864..25940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(25828..27714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 assembly_gap 25962..26045 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 27746..27841 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 28528..29346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(29446..30681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(30895..33606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 assembly_gap 33802..33954 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 34902..35041 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(35085..35276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(35281..37572) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922366.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 assembly_gap 37629..37784 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(37832..40429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 assembly_gap 38666..38770 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 40913..41713 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333044.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(41863..43011) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene queA CDS 43293..44192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(44249..44728) product MJ0936 family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870450.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(44850..46157) product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703671.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 assembly_gap 47515..47699 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 47715..48758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 49294..50412 product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 50469..52175 product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 52289..53539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 53728..54729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 54777..55829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 55832..57052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 57058..58578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 58731..60641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 60698..66109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 66505..67665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 assembly_gap 67762..67894 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 68084..68992 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921310.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(69011..69934) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140301.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(69986..71509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(71638..73677) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669835.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(73922..75583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(75842..78244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 78350..78544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 79146..80258 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615452.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(80366..80953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(81014..81589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 assembly_gap 81603..81734 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(82104..84029) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325559.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene dxs CDS complement(84258..85148) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 assembly_gap 85925..86022 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 86028..86639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 86759..87487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(87505..88908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(89340..89597) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073353.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene glnB assembly_gap 89678..89782 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(89942..90130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 assembly_gap 90242..90381 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 92148..92795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(92930..93442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(93488..94762) product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329509.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 95123..95878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(96168..96338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 96627..97445 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815039.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 97651..98457 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332037.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 98515..99699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(99750..99911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(100110..101060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(101093..102397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 assembly_gap 101157..101249 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(102429..103010) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105333325.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(103121..104206) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 assembly_gap 104237..104355 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(104598..106217) product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123879.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 107188..107748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 107948..109153 product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922567.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 assembly_gap 108755..108866 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 109345..110760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 assembly_gap 110619..110706 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 110780..111181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 111342..111692 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420010.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 assembly_gap 111718..111880 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 112083..112221 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 112283..112777 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327785.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene recR CDS 113097..114527 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435015.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene rpoN CDS complement(114613..115974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 assembly_gap 116316..116487 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence003 source 1..97445 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(112..948) product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 assembly_gap 1034..1161 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1369..2295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 assembly_gap 2394..2523 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2550..3134) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400615.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene pnuC CDS complement(3148..4395) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(4493..5563) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722159.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(5608..6948) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 7128..8237 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 8302..9339 product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267821.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 9524..10813 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 11035..12963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 assembly_gap 12807..12865 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12869..13438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 assembly_gap 13759..13892 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14010..15494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 assembly_gap 15351..15441 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 15491..16267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 16303..17643 product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121673.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(17745..19130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 assembly_gap 17777..17851 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19273..20160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 20387..21442 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120960.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(21457..22263) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 23062..24033 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121074.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(24043..25137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(25204..26469) product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(26514..28073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 assembly_gap 28149..28279 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 29072..29275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 29424..33752 product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921311.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(33755..34267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(34311..34988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 assembly_gap 34353..34414 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(35066..36928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(37022..38344) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118102.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 38622..40073 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122347.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene cls CDS complement(40085..41854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 assembly_gap 42473..42565 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 42676..46278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(46684..47325) product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325064.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(47539..47871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118471.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 48291..49337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 49424..50473 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922559.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene purM CDS 50531..51373 product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333289.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 51548..54622 product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615465.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 54619..56073 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922839.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 56168..59188 product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813379.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(59290..59763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(59840..64384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 assembly_gap 59873..60010 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 64467..65450 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559357.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 65488..66411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022102.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 66498..68132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 assembly_gap 67751..67816 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 68020..68259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 68478..69536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 note possible pseudo, frameshifted assembly_gap 69433..69486 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 69500..69754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 note possible pseudo, frameshifted assembly_gap 70032..70103 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 70490..70972 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330832.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 71025..71780 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142832.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 71829..72527 product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639816.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene yhhW CDS 72709..74358 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888377.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene pgi CDS complement(74400..75578) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921425.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(75689..76549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(76482..77300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 assembly_gap 76568..76647 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 78598..78758 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 79039..79199 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 79240..80691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 80701..81225 product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122795.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(81188..81412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 assembly_gap 81470..81566 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 82482..84026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 assembly_gap 82815..82956 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 84206..85633 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121030.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 85801..88128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(88142..88510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 88680..89558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 89655..91277 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616258.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(91297..91632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(91625..92194) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145388845.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(92191..92454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(92409..93668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 assembly_gap 94177..94292 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(94363..95385) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119992.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 95735..96772 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121242.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene aroF sequence004 source 1..97318 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 64..1002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 assembly_gap 1090..1241 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1377..2609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(2609..3952) product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121673.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(4021..6534) product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 assembly_gap 4040..4172 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7093..7314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 7548..10139 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615806.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 10136..10993 product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260625.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 11107..12291 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327063.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 12288..13280 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922127.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 assembly_gap 13307..13413 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13428..15509 product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121743.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 15506..19264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121744.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 19261..21654 product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 21656..22642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061227.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 22972..25518 product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118122.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 25598..27034 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(27054..28472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 assembly_gap 28750..28932 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 29691..30023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(31020..33638) product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260401.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 assembly_gap 31042..31218 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(33685..34350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 assembly_gap 34373..34492 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(36430..38487) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140584.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 39048..40805 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703698.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene ggt CDS complement(41044..42162) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 42740..45103 product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921574.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 assembly_gap 46183..46369 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 46899..48014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 assembly_gap 48086..48254 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 48563..48742 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 49045..49198 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(50187..51587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 assembly_gap 52503..52533 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 54232..55200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 55227..56288 product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333030.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 56428..57462 product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 57516..57695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(57902..59326) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099258810.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(59379..59777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 assembly_gap 59818..59942 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(60853..63120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(63395..65272) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(65703..67094) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(67112..69544) product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921574.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(69707..71308) product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816830.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(71318..72646) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(72699..74915) product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816832.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(75083..77590) product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616124.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(77593..78876) product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123786.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 79205..80494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921591.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 80639..81979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 assembly_gap 82463..82592 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 83226..84098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(84139..84402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(84410..87943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 assembly_gap 84436..84569 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 88073..90907 product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 90974..92842 product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(93065..94132) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462028.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene arsB CDS complement(94217..94594) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948550.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 95082..96875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 assembly_gap 96673..96796 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence005 source 1..81581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(20..799) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326458.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(879..1079) product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326457.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(1129..1467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 assembly_gap 1664..1801 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2693..2859 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3314..3661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 assembly_gap 3771..3862 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3980..5863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(6026..6712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(6731..7171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(7212..8579) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene fliI CDS complement(8743..9360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 9542..10432 product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119017.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene ubiA CDS 10630..11760 product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339462.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene mqnE CDS complement(11894..12832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(12927..13709) product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328291.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene uppS CDS complement(13880..14071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(14378..15778) product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339839.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 assembly_gap 16032..16207 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 16603..16772 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 17079..17229 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 17429..17556 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 17919..18035 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 18430..19788 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330049.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene der CDS complement(19865..20563) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120859.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(21132..21521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(21588..22457) product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118509.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(22734..24155) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene lpdA assembly_gap 24266..24434 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(24527..25855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 26323..28410 product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921986.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 28455..29804 product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120991.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(29856..30635) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922035.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 assembly_gap 30869..30953 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 31706..31866 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 32088..32277 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 32530..33321 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972950.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 33732..34019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(34079..34804) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105300.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 34950..35156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(35282..36400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 assembly_gap 36413..36507 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 36998..37163 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(37196..38143) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325730.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 38460..39116 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082246.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 39518..41305 product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326414.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 41544..42239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 42286..43311 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966438.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene trpD CDS complement(43377..44213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(44847..45752) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120018.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(45771..45980) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049507.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene thiS CDS complement(46058..47398) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327001.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene trkA CDS 47591..48235 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(48413..49177) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329364.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(49705..51495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 51868..54132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 54277..54981 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922323.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 assembly_gap 55090..55256 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 55347..56621 product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039292.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 56872..58158 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327153.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 58186..58596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325780.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(58867..60504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(60979..62220) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120393.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 assembly_gap 62260..62396 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(62645..63052) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324235.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(63296..64315) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118349.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(64455..64937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 65221..66096 product excisionase family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335835.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 assembly_gap 67103..67273 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 67314..67652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 assembly_gap 67676..67787 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 67845..69593 product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615613.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene polX CDS 69667..70305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 70384..70677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 70799..73156 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922147.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene priA CDS 73592..75022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 assembly_gap 74866..74996 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 75429..75527 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 75616..76557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 77113..78666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(78826..79044) product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327487.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(79052..79468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(79629..81302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 sequence006 source 1..79283 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 123..255 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 296..895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 assembly_gap 960..1092 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1144..1818) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 assembly_gap 2038..2282 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2742..3041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 3252..5132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 5672..7240 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810537.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 assembly_gap 7820..7901 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7917..9209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(9317..9529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 9923..11539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 11647..12846 product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121149.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 12848..15301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 assembly_gap 14905..15030 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 15497..16603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 assembly_gap 16713..16844 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17035..18525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 18736..18930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 18920..19486 product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877237.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene cyaB CDS 19536..20048 product protein-arginine kinase activator protein McsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966297.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene mcsA CDS 20062..20400 product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326321.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(20416..21309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 21417..22256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 22270..22953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(22989..23921) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841461.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(24231..25091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(25113..25985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(26114..27643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 assembly_gap 27795..27904 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(28152..29579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 assembly_gap 28523..28637 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(29592..30143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 assembly_gap 30167..30386 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(30963..32078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 assembly_gap 32159..32341 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 32736..32823 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(33011..33394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(33484..33798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(33959..34693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 assembly_gap 34789..34948 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 35355..35499 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 35734..35875 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(36029..38410) product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615954.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 38632..39225 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325657.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene hisB CDS complement(39277..40215) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325399.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(40520..42007) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(42245..43231) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 43504..45024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(45101..46201) product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 46441..47871 product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669743.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 assembly_gap 47607..47704 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(47981..48358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 48808..51552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 51638..52930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(53104..53400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 assembly_gap 53893..53979 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 54464..55336 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033982.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(55361..56668) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922280.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(56842..58047) product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122076.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(58143..58676) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530095.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 58883..59629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123337.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(59705..60322) product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922085.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 60484..61203 product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969922.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(61430..62395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(62395..63036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 63755..65737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 assembly_gap 63795..63955 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(66516..66983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 67430..69301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 assembly_gap 69007..69056 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 69383..70624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 assembly_gap 70958..71088 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 71448..71693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(71659..74736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 assembly_gap 73939..73984 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 76082..76191 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 76496..76628 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 76687..78069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 assembly_gap 77884..77994 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 78030..78875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 sequence007 source 1..77878 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 384..593 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(681..1949) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922632.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(1983..3977) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124141.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene asnB assembly_gap 3270..3333 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4065..5147) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329097.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(5277..5477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(5474..6889) product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124139.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 assembly_gap 5585..5709 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6886..7413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124138.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 7627..8070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(8084..9808) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948830.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 10181..10822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 note possible pseudo, frameshifted assembly_gap 10583..10638 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10765..11418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 note possible pseudo, frameshifted CDS 11730..13169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 assembly_gap 12985..13093 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13153..15090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(15099..16358) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118010.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(16408..16611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(16651..17142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(17121..17339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(17336..17782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(17840..18106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(18172..18627) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335921.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(18764..19840) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081611101.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(19901..20506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 assembly_gap 20518..20642 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 20801..20953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(21225..22616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(22728..23177) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095815.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(23357..24703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(24878..25501) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930126.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(25498..26739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(26821..27252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 assembly_gap 27327..27432 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 28109..28208 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(28723..29463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 note possible pseudo, internal stop codon, frameshifted assembly_gap 29593..29746 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(30748..32976) product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117877.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(32973..33782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 assembly_gap 33825..33973 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(34840..35736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(35754..36704) product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324929.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 assembly_gap 36967..37104 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(37819..39432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 assembly_gap 39824..39945 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 40542..40644 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(41929..43521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 44065..45804 product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332180.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 assembly_gap 45696..45779 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(45820..46359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 46888..48615 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122637.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(48673..49224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(49416..49790) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705627.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(49909..52131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(52248..52748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(52789..53304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 assembly_gap 53782..53900 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(53970..54356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 assembly_gap 54404..54545 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(55787..56608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 56921..59614 product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922351.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 assembly_gap 60571..60748 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 61314..61451 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 61793..61911 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 62415..62534 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(62584..63537) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263043.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(63924..64340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 64709..65314 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene rpoE CDS 65318..66802 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922532.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(66811..67002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(67017..67913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(69282..70985) product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339980.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 assembly_gap 69653..69744 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(71032..72171) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 assembly_gap 72213..72378 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(72621..74903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(74961..77204) product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816832.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 77497..77754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 sequence008 source 1..73826 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(38..3451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 assembly_gap 796..953 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4258..6414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 6672..8264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 8621..9580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 9661..11472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 11541..13277 product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 13322..15898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 assembly_gap 15739..15842 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16103..18922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 assembly_gap 18937..19058 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(20643..22652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 22871..23770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 assembly_gap 23869..23958 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(24043..26070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 assembly_gap 24571..24671 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(26224..27369) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122039.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(27514..28485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 assembly_gap 28673..28736 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(29386..29565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(29562..30896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 note possible pseudo, frameshifted CDS complement(30920..31942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 note possible pseudo, frameshifted CDS complement(32011..32847) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615371.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(32851..33378) product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339097.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(33357..34739) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120871.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene ccoG assembly_gap 34911..35135 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(35225..35830) product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120870.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(35827..36000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(35997..38318) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615370.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene ccoN CDS complement(38972..40327) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037198060.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(40350..40697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(40732..42795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(42815..43018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 43569..43979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 44188..45447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04840 assembly_gap 45517..45627 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 45704..47326 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368539.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 assembly_gap 45953..46038 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 47323..48840 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 assembly_gap 47900..47999 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 49155..50150 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932202.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 50172..50810 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123161.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(51024..51728) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922405.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(51725..52561) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123166.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(52980..53414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327803.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 53731..54840 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 54981..56600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 56504..57463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 note possible pseudo, internal stop codon assembly_gap 56559..56582 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 57819..59183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 59278..59682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 note possible pseudo, internal stop codon, frameshifted CDS 59603..59788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 59807..60136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 note possible pseudo, internal stop codon, frameshifted assembly_gap 60543..60667 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 60676..62013 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442644.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene atpD assembly_gap 61082..61209 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 62010..62402 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120166.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 62399..62713 product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120167.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 62849..63187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 63187..63969 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328512.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 63956..64408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 64546..65301 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120169.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 65369..66955 product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921807.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 66959..67870 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340302.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 68907..70748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 70745..71401 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 71657..71944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 assembly_gap 72328..72450 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 72640..73122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(73237..73680) product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257301.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 sequence009 source 1..70239 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 174..323 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 778..950 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1009..2034 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460499.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene fabF assembly_gap 2651..2778 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3170..3397 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4152..4568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 assembly_gap 4760..4808 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5011..5790 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095638.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene rlmB CDS 6203..6562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(6652..7116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 assembly_gap 7146..7327 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10086..10308 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10476..11429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 11677..12372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 12762..14018 product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121715.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 assembly_gap 15176..15351 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 15537..15740 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 15769..16236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 assembly_gap 16426..16523 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16548..17933) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337912.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene asnS CDS complement(17967..18755) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396453.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(18950..19231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(19228..20829) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327900.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 assembly_gap 20879..20972 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21389..22276) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327663.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(22444..23295) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327662.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene accD CDS complement(23396..23950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(24048..24725) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118429.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene rpe CDS complement(24817..26133) product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(26278..28449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(28701..29027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(29140..29430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 assembly_gap 29447..29542 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 29834..31579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 assembly_gap 31388..31557 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 31584..32171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 assembly_gap 32574..32703 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(32908..33345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(33342..34991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(35241..36275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 36707..37792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(37822..39291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(39323..40000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(39997..40956) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118555.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(40953..41354) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548044.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 41592..41852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(41874..42836) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118333.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(42833..44638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(44638..47028) product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815631.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 47325..48341 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002185292.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(48963..50423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(50630..51583) product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986893.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(51607..51747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(51946..52449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(52394..53248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 assembly_gap 52461..52544 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 53444..53724 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 54517..54641 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 55256..55708 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686664.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 55785..56741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 57247..58164 product DUF1571 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 assembly_gap 58447..58564 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(58599..58808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 assembly_gap 59539..59671 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 59672..60766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 assembly_gap 60825..60867 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(60895..62073) product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 62512..64731 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118530.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(64784..65029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(65265..66383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(66386..66652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(66803..67966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(68662..69336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(69333..69890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 70006..70152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 sequence010 source 1..69979 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 133..386 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1234..2490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 assembly_gap 1309..1417 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2559..4511) product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165441912.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 assembly_gap 5123..5194 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 5469..5614 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5864..8098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 assembly_gap 8380..8509 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9406..9870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 10023..10985 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123205.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 11443..12843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 12821..13045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 13085..13402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 13615..16152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 assembly_gap 15957..16045 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16076..16906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(16985..18190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(18187..19188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 assembly_gap 18192..18231 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19555..25656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(25656..27041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(27310..27681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 note possible pseudo, frameshifted CDS complement(27707..27946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 note possible pseudo, internal stop codon, frameshifted CDS complement(27981..28208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(28230..28421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 28817..31228 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819019.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 31255..32349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 32356..33798 product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387312.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 34431..36086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 36457..36642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 36654..37733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 assembly_gap 38107..38203 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(38534..39694) product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(39691..43101) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930290.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(43098..43724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(43717..45195) product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(45427..46443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(46518..47735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(48103..48807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 assembly_gap 48900..49009 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 49715..51196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(51236..52591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 tRNA complement(53204..53293) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(53644..55068) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 55184..58231 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447205.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 58566..59078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 59486..60013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 60861..61670 product DUF1571 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(61775..62566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(62840..63184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(63222..64898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 assembly_gap 63231..63366 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(65085..65423) product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442716.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 65850..68192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(68305..68556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 68883..69878 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 sequence011 source 1..67857 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(241..1083) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 1487..2359 product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922721.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 2469..3161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 3281..3907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(3922..4608) product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922761.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 4827..5822 product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442722.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 5883..7064 product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 7235..8626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 9069..10184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 note possible pseudo, frameshifted CDS 10185..11417 product phosphonoacetaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202931.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(11791..12996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(13156..14385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 14524..15813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122044.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 16060..16860 product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971334.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 16911..18398 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118024.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 18674..19966 product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 20210..21190 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 21485..22933 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146578646.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 assembly_gap 21807..21898 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(23300..24658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(24652..27213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 assembly_gap 24865..24931 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(27452..28432) product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339822.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 assembly_gap 28599..28713 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(28805..29278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 assembly_gap 29280..29364 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 29467..29691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 assembly_gap 30052..30173 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 30762..32681 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326035.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene dnaK assembly_gap 32777..32898 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 33044..33156 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 34459..34623 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 35457..35621 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 35631..36326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(36457..37557) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074078.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(37554..38216) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene modB CDS complement(38216..39013) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258350.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene modA CDS 39180..41096 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122293.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 41292..42602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121732.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 42743..43255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 43680..44927 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111143.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 assembly_gap 44998..45189 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 45953..46099 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 46691..46759 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(46915..47706) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545863.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene panB CDS complement(48114..48965) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene ilvE assembly_gap 49324..49389 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 50080..50314 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 52481..53017 product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391683.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 53139..54188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 54402..55490 product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329092.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 55714..56808 product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329092.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 assembly_gap 56956..57029 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(57045..57293) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764857.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(57380..58021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(58151..59152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(59249..59839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(59803..63072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 assembly_gap 59854..59940 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 63666..65180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117691.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 65287..66978 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 assembly_gap 67338..67517 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 67579..67803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 sequence012 source 1..58472 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 583..735 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 759..1067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 1171..1944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 2161..2787 product DUF4303 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071853.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 3032..3562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 3771..4052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 4183..6474 product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117947.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(6555..7280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 assembly_gap 7361..7505 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7564..7929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(8330..9367) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(9564..10334) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121328.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 10582..11424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 note possible pseudo, frameshifted assembly_gap 11275..11335 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11429..13375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 assembly_gap 13427..13573 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13678..15093 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 15717..16370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 16409..17188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 17193..17555 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121435.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 17795..19759 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120594.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene argS CDS 20391..21275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 note possible pseudo, frameshifted assembly_gap 20407..20457 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21230..22000) product HisA/HisF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870208.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(22134..24056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(24489..25586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 assembly_gap 25630..25754 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 26555..26809 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327901.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene rpmA CDS 27077..27568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 assembly_gap 27875..27992 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 29089..29147 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(29305..30108) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121390.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(30188..32200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 32430..32933 product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(32919..33527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(33805..34164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(34239..35444) product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123857.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(35564..37273) product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328372.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(37330..38220) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404828.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene coxB CDS complement(38372..39217) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(39285..39644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(39793..41016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922553.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(41064..42440) product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123851.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(42505..43923) product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene nrfD CDS complement(43982..46150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 assembly_gap 45186..45304 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(46162..47511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 assembly_gap 46196..46286 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(47629..48312) product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123848.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 48806..50203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 50370..51812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 assembly_gap 51119..51213 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 51857..51943 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 52602..52749 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 52869..53558 product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333027.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene bshB1 assembly_gap 53586..53670 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(53702..54943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 55656..56009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(56514..58202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 sequence013 source 1..57701 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(78..782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 assembly_gap 933..1179 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1402..1571 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1978..2113 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2295..5594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(5612..7393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(7390..7863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 8360..10558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(10577..11071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(11112..12485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 12683..15661 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(15727..17130) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117864.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 17478..18371 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 assembly_gap 18664..18773 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 19016..19172 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 19235..21541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(21596..23458) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120593.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(23448..24236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 assembly_gap 24401..24523 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 24743..26572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 assembly_gap 24955..25070 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 26721..27797 product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615590.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(27969..29399) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921691.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(29568..31034) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921496.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(31131..32930) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260568.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 33058..34056 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118199.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 34197..34751 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene rpoE CDS 34810..35415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 35416..36063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 36147..38795 product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146524746.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 38945..40246 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 40611..41132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 41334..41945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 41963..42700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 assembly_gap 42932..43056 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(43207..46467) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123580.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene carB CDS 46965..47327 product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119951.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(47344..48093) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327679.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(48266..49180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 assembly_gap 49181..49289 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(49635..50936) product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326690.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(51046..51534) product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326691.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(51683..52072) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326692.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(52408..53163) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene fabG CDS complement(53284..53775) product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326693.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 54049..55221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 55365..56723 product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118607.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 assembly_gap 55451..55561 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 56875..57210 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence014 source 1..57433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(295..1593) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(1843..2844) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327421.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(3064..3642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(3701..4426) product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336025.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(4545..6212) product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(6293..7225) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121793.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(7497..8579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 8999..9727 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011945636.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(9831..10148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(10210..10500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(10825..11811) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048017.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(11947..13815) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816500.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(13882..14343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 assembly_gap 14541..14698 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15227..16057) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121937.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(16302..16784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324288.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 assembly_gap 16972..17106 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(17898..18101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 18261..19682 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324828.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene clpX assembly_gap 18746..18866 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19772..20635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 21027..22580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119977.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(22602..23201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 23379..24767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 24983..25750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(25923..26744) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123511.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene dapB CDS complement(26957..28147) product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(28241..29599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327711.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 tRNA 29808..29881 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(30081..30401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 30516..30692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 30810..31091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(31407..31574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 31706..32686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 32727..33026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 assembly_gap 33115..33151 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 33212..33565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 33543..33782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 33792..33989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 34028..34246 product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327053.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene csrA CDS 34243..35406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 35438..35722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 35722..36021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 36018..36641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(36686..38584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(38655..39680) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939034.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(39959..40399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 assembly_gap 40630..40752 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 40974..41164 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(41536..41763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(41840..42106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 42238..42807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 42800..43642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 assembly_gap 43772..43927 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 44050..44649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 assembly_gap 44925..45015 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 45402..47066 product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336918.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 47080..48507 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523689.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 48507..48701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 48691..49308 product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385658.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 49415..50779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 assembly_gap 51042..51187 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 51189..51500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 51508..52101 product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975492.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 assembly_gap 52138..52222 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 52331..52543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 52545..53066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 53069..53503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 53514..53927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 53983..54324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 54390..54845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 54884..55162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 55166..57133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 sequence015 source 1..57086 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1309..1974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 assembly_gap 1990..2159 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2578..2705 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3001..4875) product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946128.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(5131..6141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 assembly_gap 6158..6326 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6694..8064) product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669743.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(8200..8742) product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 8866..9729 product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117816.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(10034..11362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 11814..13184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 assembly_gap 13436..13523 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13686..14669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 assembly_gap 14496..14569 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14881..15447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(15578..17350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 17600..18106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 18343..18708 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121445.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 18783..19985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 20045..20470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(20477..22537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 assembly_gap 21571..21662 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22992..24308 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922561.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 note possible pseudo, internal stop codon CDS 24321..24539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 note possible pseudo, internal stop codon CDS 24792..25082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(25185..25466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 tRNA complement(25767..25838) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 26019..26342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330016.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(26357..27436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 27870..28352 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392363.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(28475..28684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 assembly_gap 28793..28947 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 29785..29858 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(29986..30777) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188202.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 tRNA complement(30988..31062) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 31609..33837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(33895..35067) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963546.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(35203..36561) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929181.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 assembly_gap 36619..36731 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(37236..37958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(38116..38880) product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922236.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 39221..39757 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942915.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(39767..40258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(40373..41512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(41666..42352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 42729..43505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(43678..44745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(44896..45681) product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 45875..47725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 47776..48651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 48715..49179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(49289..49495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 49717..51138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(51200..52312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922219.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 52591..55668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 56089..56601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 sequence016 source 1..54208 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(76..1497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(2529..2771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(2999..4030) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907650.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene fbaA CDS complement(4312..5790) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 6066..7247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 7413..7865 product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922010.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(7931..9982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(10114..10716) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329277.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 assembly_gap 11330..11525 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 11831..11951 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11952..13385 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118376.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 assembly_gap 12665..12766 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13397..13801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 14102..15046 product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(15110..16471) product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118126.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 assembly_gap 15264..15366 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16590..17015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(17008..17574) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325344.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 18223..19461 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812397.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 19747..22263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 22510..22935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 23157..23582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(23586..24524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 assembly_gap 24621..24686 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 24894..25065 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(25211..25402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 assembly_gap 25478..25591 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 25849..26110 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 26645..26846 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 26864..27595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 27716..28714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 28761..29492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(29567..29986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 assembly_gap 30069..30198 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 31322..32659 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(32700..33467) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene rfbA assembly_gap 33477..33595 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(33778..33972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 assembly_gap 34126..34264 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(34305..35015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 assembly_gap 34432..34482 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(35012..35962) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919030.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(36025..37005) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 assembly_gap 38880..39058 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 39398..40543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 41154..42128 product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 42342..42674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(43139..43747) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846140.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene rpsD CDS complement(43805..44131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 44194..45501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 45544..45855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 45962..47122 product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946625.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 assembly_gap 47309..47398 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 47747..49351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 assembly_gap 49676..49794 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 50949..51086 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 52466..53251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(53601..53975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 sequence017 source 1..53503 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(284..442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 578..1318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(1412..1906) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615559.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene smpB assembly_gap 2111..2208 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2337..2747) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326965.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene nusB assembly_gap 2884..3020 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3636..3917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(3961..5115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 assembly_gap 4008..4120 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5311..5943) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816768.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene coaE CDS complement(6463..7656) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122791.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 assembly_gap 8298..8449 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8473..11607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 11633..13084 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123415.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(13157..15040) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120669.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(15244..17130) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120669.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 17558..18508 product phospholipase YtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398545.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene ytpA CDS complement(18821..21163) product arylsulfatase AtsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403397.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene atsD assembly_gap 21520..21647 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21681..22523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 assembly_gap 22610..22664 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 23166..23654 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene bfr CDS 23837..25624 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332595.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(25639..26055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(26173..27105) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(27417..27857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 27982..28608 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121917.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 28666..30987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 31179..32183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 32369..34816 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117853.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 assembly_gap 34819..35006 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(35157..35903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 36172..36384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 36381..36590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 36695..37384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 37438..38730 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257067.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 38929..39819 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118048.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(39924..42317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(42292..46290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 assembly_gap 42329..42424 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(46812..47552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 assembly_gap 47714..47790 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(48532..48741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 48847..49896 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121766.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 50149..51036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 51328..52356 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258178.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 52419..53465 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 sequence018 source 1..52603 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(253..930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(1006..2355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 2669..3985 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(4358..5929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 6550..7281 product DUF899 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730220.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 7533..8999 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921673.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 8996..10090 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121336.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene lpxK assembly_gap 10127..10289 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10323..10790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 note possible pseudo, frameshifted assembly_gap 10803..10872 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11146..12201) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044885.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(12322..14205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(14336..14695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(14688..16154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 assembly_gap 14810..14925 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16431..19232) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258469.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 19523..22759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 assembly_gap 20607..20782 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22996..24465 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(24483..25250) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338546.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 25565..26023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 note possible pseudo, internal stop codon CDS 26057..26845 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122697.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(27007..27774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(27869..28486) product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922130.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 assembly_gap 29606..29767 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 30023..30195 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 30397..30554 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 30723..31883 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(31987..33510) product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 assembly_gap 32587..32720 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(33619..34446) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122620.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene trpC assembly_gap 34507..34586 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 35238..35367 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 35581..35740 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 35822..36205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 36608..37912 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672011.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene lysS assembly_gap 37956..38135 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(38238..38540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 assembly_gap 38578..38713 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 39129..39288 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(39520..40164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 assembly_gap 40166..40309 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 40512..40689 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 41346..41537 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(41834..43357) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326639.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(43482..43907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 assembly_gap 43963..44124 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(45206..45508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 45739..46113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 46539..47495 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922054.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 47650..48615 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838058.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 48769..50436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 assembly_gap 49664..49804 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 50460..50572 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(50692..51165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 assembly_gap 51262..51358 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence019 source 1..52250 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1025..2008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 assembly_gap 2142..2245 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3016..3966) product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211021.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene uspE assembly_gap 5302..5507 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 5870..5912 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5934..6263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 note possible pseudo, frameshifted CDS complement(6372..6764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 7052..8119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(8206..9066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(9195..9881) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328113.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(10699..12990) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(13104..14597) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene glpK CDS complement(14715..15839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09720 assembly_gap 15860..15997 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16508..17251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(17734..18165) product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922123.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(18325..19068) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122160.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene ispD CDS complement(19394..20695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 21020..21955 product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(21986..22477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(22749..23702) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324315.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(23965..24861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(24924..25253) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333113.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 25590..26261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(26387..27025) product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 27221..28354 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922041.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 28422..28934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 assembly_gap 29147..29331 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(30314..31342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 assembly_gap 30420..30508 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 31651..32688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013109395.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 assembly_gap 33146..33154 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(33490..34908) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029629072.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene cls CDS 35222..35875 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207531.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(35860..36369) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036472525.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene rfbC assembly_gap 36817..36860 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 36926..37777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 37984..38916 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522631.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 39081..40643 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene zwf CDS complement(40647..41456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(41663..42841) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331112.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene metK CDS complement(43031..44353) product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123393.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(44465..44833) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(44973..48194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 48720..50384 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121094.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(50648..51166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(51326..51994) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963914.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 sequence020 source 1..52055 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(29..694) product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764871.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene pdeM CDS complement(694..3309) product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921429.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(3306..4955) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118433.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(4952..6034) product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268709.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(6266..9598) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123029.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(9595..11175) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123028.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(11570..12541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(12826..13767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(13769..14893) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799504.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene wecB CDS complement(14958..16157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(16150..16911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(16908..17291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 assembly_gap 17338..17440 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(18341..19168) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(19994..21538) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671603.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 assembly_gap 20504..20613 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21546..24764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(25054..26772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(26781..27872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 assembly_gap 28102..28203 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 29476..30633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 30702..31826 product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119032.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 32068..33081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 33130..34941 product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123986.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 34926..35765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(36644..36871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 36845..37894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 38049..39506 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(39615..41081) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 assembly_gap 41232..41376 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 41551..43914 product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615656.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene katG CDS complement(44184..44339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 44640..45452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922454.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 45467..46369 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921649.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(46541..47752) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 assembly_gap 48529..48636 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 48646..49257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 49345..50715 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 assembly_gap 49550..49603 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(50772..51113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 misc_feature complement(51354..>52055) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615454.1:DUF1559 domain-containing protein locus_tag LOCUS_10360 sequence021 source 1..51774 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 211..274 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1075..2523) product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(2825..3352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(3584..4480) product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063968.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene thpD CDS complement(4554..4937) product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895350.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(4952..6211) product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729399.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene ectB CDS complement(6300..6782) product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729400.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene ectA CDS 6951..8483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 assembly_gap 7633..7733 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8571..9182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(9187..13317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 13812..15074 product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(15241..17403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(17775..20747) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117787.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 assembly_gap 20844..20980 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21127..22461) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615854.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 22771..24687 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117783.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 25195..25641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 26016..26990 product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921814.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 27556..28971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120217.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(29439..29720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 assembly_gap 30773..30922 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 31248..33758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 assembly_gap 33540..33651 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 33727..34710 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124010.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 34707..35159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 35152..36711 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124008.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 36758..37126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 37123..38205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 38257..39015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 assembly_gap 39881..39987 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 40064..40414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 40450..41151 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948859.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(41180..41479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(41629..41955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 assembly_gap 43177..43404 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 43480..44226 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945965.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(44565..45668) product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122037.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(45710..46807) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922187.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(46852..47520) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339994.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 47996..49360 product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 49859..51169 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002934126.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene mgtE sequence022 source 1..51547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 516..629 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1675..1934 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2271..3272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(3393..3965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 assembly_gap 3990..4082 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4381..5760 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 5753..5980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(6123..7121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 assembly_gap 7292..7525 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7552..8397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(8490..9509) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922725.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 assembly_gap 9595..9852 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10111..10254 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10813..10882 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11599..12684 product transaldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119230.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 12833..13948 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922132.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(13976..15619) product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118840.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(15630..16340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 assembly_gap 16920..16978 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17183..19753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(19795..20820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121407.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 21706..22269 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene msrA CDS 22262..22702 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene msrB CDS complement(22764..25079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(25450..26829) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 27013..27249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 assembly_gap 27518..27707 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 27784..28368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 28508..31828 product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666716.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 assembly_gap 29389..29514 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 31855..32400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 assembly_gap 32983..33126 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 33652..33812 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 33852..34181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 assembly_gap 34215..34383 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(34535..35923) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388970.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene lpdA assembly_gap 36079..36250 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 36475..36686 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(38575..39738) product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411661.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 assembly_gap 39822..40067 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 40361..40454 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 41854..41979 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 42184..42357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 assembly_gap 42616..42738 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(43004..43645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(44301..45011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(45112..45996) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(46150..47088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(47202..48662) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663784.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 49024..49464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 49591..50094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 50135..51262 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119119.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene rsgA sequence023 source 1..50813 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..4491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 assembly_gap 2775..3163 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4611..6005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 assembly_gap 6009..6089 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6740..7306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328536.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(7459..8022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 8372..9382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 9770..11638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 assembly_gap 11211..11367 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11656..11871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 11892..12650 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066331278.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 13286..14218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 assembly_gap 13296..13381 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14497..16695 product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118691.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(16704..17699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 assembly_gap 18087..18213 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(18491..19000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(18997..19467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(19491..21140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 21418..21846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 21898..22293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 22342..23778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 23775..24110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 24107..25855 product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 25880..27208 product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene xcpS assembly_gap 26558..26667 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 27661..27758 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 27776..28402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 28399..29034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 29031..29621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 29626..30126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 30394..31200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 31219..35406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(35599..36159) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339966.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene frr CDS complement(36284..37030) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261659.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene pyrH CDS complement(37131..37961) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733232.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene tsf CDS complement(37992..38231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(38276..39028) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122857.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene rpsB CDS complement(39328..39888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(40036..40356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 assembly_gap 40621..40726 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(40816..41856) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 assembly_gap 42166..42347 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 42608..43111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 43251..44144 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665013.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene lipA CDS 44160..44459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(44456..45088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 45514..46287 product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338881.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 46463..47269 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329888.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene flgG CDS 47316..48515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 assembly_gap 49068..49230 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 49729..49809 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 49894..50772 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869891.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 sequence024 source 1..50739 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 318..465 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 683..2914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(3609..4391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 assembly_gap 4431..4526 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5752..6282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 6898..7641 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340410.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 8162..9313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(9703..12558) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921767.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene secD CDS complement(12790..13173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 assembly_gap 13434..13584 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 13823..14010 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15003..15734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 assembly_gap 15766..15832 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15920..16453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(16820..18400) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120586.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 18891..20348 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene pyk CDS 20387..20815 product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976464.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(20881..21198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(22371..23675) product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145108765.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(23890..24840) product sugar phosphate isomerase/epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421554.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(25114..26523) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(26721..29147) product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118122.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 29621..30595 product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120825.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 30699..31172 product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921738.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 assembly_gap 31338..31464 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 31834..31940 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 32112..32627 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922234.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(32646..32810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 33350..34174 product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664611.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(34200..35060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 assembly_gap 35092..35261 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(35559..36281) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880787.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 assembly_gap 36750..36904 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 37434..37567 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 37577..37747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 assembly_gap 37806..37960 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(38054..38968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 assembly_gap 39134..39237 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 39786..39924 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 39931..40866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 40866..42242 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267422.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene pabB CDS complement(42401..42967) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119882.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(43038..43256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(43597..44271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 assembly_gap 44318..44514 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 45729..45883 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 45905..48637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(48813..49007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 assembly_gap 49099..49161 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 49460..50374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 sequence025 source 1..50508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 200..422 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2059..3597 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615974.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 3636..4430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 4549..6360 product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 assembly_gap 6424..6635 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6889..7019 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7032..7817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 assembly_gap 7860..8054 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8166..9218 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene cyoE assembly_gap 8592..8693 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9399..10400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 assembly_gap 10426..10554 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10919..11157 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11622..12365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(12365..14149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 assembly_gap 12490..12562 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 15192..15289 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 15608..15772 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 16289..16472 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 17100..17258 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17371..17787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(17888..18505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(18498..18740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 18853..19656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(19658..20857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(20975..21385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 21675..23093 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene glnA CDS 23425..24930 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922306.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 assembly_gap 24612..24742 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(25000..25512) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774219.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(25910..27058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 27266..27493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 assembly_gap 28663..28847 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(28868..29545) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(29460..31988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 assembly_gap 29568..29691 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 32342..34381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 assembly_gap 33963..34091 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 34266..37307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(37475..38206) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022379.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(38216..38638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(38645..39097) product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328798.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 39585..41387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 assembly_gap 41854..41974 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 42454..42593 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 42761..43738 product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121388.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 43891..45600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 assembly_gap 45265..45344 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 45647..45836 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(46046..47137) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615834.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(47249..47992) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008656119.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(48288..49367) product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(49468..50439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 sequence026 source 1..49791 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(933..1127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 assembly_gap 1162..1330 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1920..2768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 3649..4821 product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene egtB CDS 4863..5825 product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146537107.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene egtD CDS complement(6330..7562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(7559..8341) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889919.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(8589..10049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 assembly_gap 8611..8642 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10256..11698 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141527.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene gatA CDS 11844..13256 product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525109.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 assembly_gap 13534..13649 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 13984..14093 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14499..14717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(14823..15860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(16032..16499) product PA2169 family four-helix-bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324679.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(16626..16901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 17185..17766 product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975865.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 17953..19446 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921752.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 19836..22790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 assembly_gap 22553..22674 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 23086..23250 product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096961.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 23315..23506 product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084988.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 23591..23845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(23931..24329) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183065.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(24372..25115) product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 25438..27297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 assembly_gap 26965..27040 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 27183..29177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 29301..30719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(30862..32220) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447204.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 assembly_gap 32373..32476 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 33481..33671 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 34172..34285 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 34403..35494 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921758.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 35554..38772 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 38854..39408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 39630..42779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 assembly_gap 42642..42749 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 42766..43494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(43541..44737) product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 assembly_gap 44780..44863 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(45000..45935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 assembly_gap 46104..46204 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(46641..47993) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(48047..49222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 assembly_gap 49301..49414 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence027 source 1..47394 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 698..2245 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325643.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene rny CDS 2370..3866 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121650.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene trpE CDS 4025..4645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 4649..5833 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122512.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene hemW CDS 5939..7360 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922374.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene rimO CDS 7447..7983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(8142..10118) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene asnB CDS complement(10143..11291) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120966.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 11273..11485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 11547..13169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 assembly_gap 11748..11869 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13322..14506) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922340.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene dprA CDS complement(14738..15682) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922221.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene ispH CDS complement(15962..16240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 assembly_gap 16748..16815 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16831..17190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 note possible pseudo, frameshifted CDS 17309..20551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 assembly_gap 18085..18260 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(20864..22237) product DUF4147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922364.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 22616..23383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 23717..24412 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554843.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(24477..25481) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339869.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene ilvC CDS complement(25631..26158) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339870.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene ilvN CDS complement(26548..27984) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919304.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 28177..28851 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120140.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 28920..30284 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327631.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(30565..30885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334037.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 31103..32683 product glycosyhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120634.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(32658..32894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(33681..34124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 34568..35524 product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 35655..36089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 assembly_gap 36193..36357 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(36408..37511) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434952.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 assembly_gap 37701..37902 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 37989..38846 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421593.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 38921..39331 product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(39404..41128) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333284.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 41166..41372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(41436..41648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 42180..42551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 42602..43288 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123923.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene trmD CDS 43376..43765 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814465.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene rplS CDS 43782..44183 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392503.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 44451..44909 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088269.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene hisI CDS 44909..46156 product tRNA adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262485.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 misc_feature complement(46289..>47394) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119342.1:sulfatase-like hydrolase/transferase locus_tag LOCUS_12890 sequence028 source 1..47141 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 227..1168 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118998.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 1368..2432 product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814616.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 2796..3071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 assembly_gap 3607..3742 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3909..5273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 5387..6241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 6241..7413 product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(7441..8823) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329168.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 assembly_gap 8998..9175 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9222..10523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(10658..11800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(12099..13124) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707888.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene tdh tRNA 13610..13695 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 14738..18052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 assembly_gap 14763..14864 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(18156..19088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 assembly_gap 19221..19298 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19709..21508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 assembly_gap 21570..21696 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21801..22481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 22709..23557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 assembly_gap 24396..24506 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 24844..25665 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 25749..26636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 26814..27461 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(27777..29156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 29578..29886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(29917..31692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(31856..33253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 33397..33618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 33649..34377 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122354.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(34571..35191) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974604.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(35287..38634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 assembly_gap 38996..39183 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(39230..40540) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529386.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 assembly_gap 39886..39933 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 40690..41073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 41291..43720 product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664503.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 43926..45155 product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121153.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 sequence029 source 1..46164 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(28..567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 913..1842 product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878433.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene ilvE CDS 1957..2883 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120550.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 2935..3987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 4502..4855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 5081..5614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 assembly_gap 5845..5963 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6434..6498 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6685..8205) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402000.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 8564..9121 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119378.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 9121..10419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 10539..11147 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943718.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene hisH CDS 11212..11955 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327023.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene hisA CDS 12239..13147 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122336.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 13147..14847 product mu-protocadherin- cell-suface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122337.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(14936..15343) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922498.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(15360..15743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(15768..16235) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948144.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(16393..16884) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(16927..17286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(17343..18212) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117977.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(18342..18776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(18938..20197) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117973.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(20313..21803) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene aroE CDS complement(22056..23564) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073422.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(23658..24686) product beta-ribofuranosylaminobenzene 5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119640.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(24683..25327) product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119639.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 25593..26300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 26341..26712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 26732..27355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 assembly_gap 27438..27646 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 27748..28761 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene obgE CDS 28878..29495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 29900..30727 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333052.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 30746..31468 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329973.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 31772..33385 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922486.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene ilvD CDS 33513..34652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(34758..36020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 assembly_gap 36140..36265 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 36657..36834 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 37096..37285 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 37781..38419 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967892.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(38423..39136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(39231..40361) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(40757..41869) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654729.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 assembly_gap 42024..42129 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(42334..43746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 assembly_gap 43867..44025 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 44384..44553 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(44992..45150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 assembly_gap 45178..45232 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence030 source 1..45421 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 349..858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 assembly_gap 1359..1470 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1534..2211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 2672..4012 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 assembly_gap 4451..4564 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 5025..5145 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5403..6398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 6388..7404 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327669.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 7634..8134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(8264..9784) product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(10166..10600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 assembly_gap 10745..10845 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 11419..11534 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11549..11773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13690 assembly_gap 11925..12107 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 13578..13673 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 14626..14759 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15509..16420) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 16556..18028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 18151..19116 product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417954.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene hpnD CDS complement(19270..20097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 20259..20648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(20823..21854) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401898.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(22066..24114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(24308..25051) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 assembly_gap 25557..25684 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(27045..28091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 28327..29274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 assembly_gap 29715..29940 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(30118..31638) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107859.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(31788..32063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(32307..33737) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 33903..34820 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 34902..35579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 35713..36228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 assembly_gap 36261..36417 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(36451..37068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 assembly_gap 37137..37294 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 37534..37760 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(37907..38518) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380502.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene cysC CDS 38878..39384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328133.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 39699..40334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 40615..41391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(41467..41775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(41970..42350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 assembly_gap 42459..42566 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 43553..45322 product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122985.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 sequence031 source 1..45114 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 765..1193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 1186..1614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 assembly_gap 1668..1938 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2202..2507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(2521..3090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(3111..3809) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921488.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 assembly_gap 3878..4074 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4297..4456 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4559..5455 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324200.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(5683..5892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(5892..6485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(6722..7099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081025014.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(7096..8220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269295.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 8545..10032 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329358.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene ffh CDS 10176..11603 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene purB CDS 11677..11901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(12061..12663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 12994..13263 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329975.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene rpsO CDS 13471..14067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 note possible pseudo, frameshifted assembly_gap 13825..13883 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14060..15760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 note possible pseudo, frameshifted assembly_gap 16283..16407 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16575..16949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 16954..17232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 17763..18263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 assembly_gap 19043..19139 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 19327..20220 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922494.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 20459..20761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 assembly_gap 21103..21189 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 21682..21804 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 22219..22395 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 22632..22767 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(23908..24873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(24827..25021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 assembly_gap 25630..25680 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 25732..26274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 note possible pseudo, internal stop codon, frameshifted assembly_gap 26295..26420 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(26506..26979) product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326579.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene dps assembly_gap 27093..27253 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(27365..28090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 28655..29128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(29234..31099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 31308..31508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(31651..32841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(32881..33828) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 34132..35625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 35717..36478 product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 assembly_gap 36569..36709 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(36774..38777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 assembly_gap 37196..37367 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 38811..38936 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 39135..39343 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 39415..39609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 assembly_gap 39726..39937 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 40140..40315 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(40624..42648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 assembly_gap 44676..44902 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence032 source 1..43227 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(206..673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(690..1670) product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 1910..3238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 3445..5058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 assembly_gap 4679..4762 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5063..6286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 6476..7615 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120966.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 7783..8982 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 assembly_gap 9131..9240 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10223..10351 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10481..10888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 10923..12098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 12285..12626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(12868..14664) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329990.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(14841..15026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 15609..17417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 assembly_gap 16862..17003 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 17469..17618 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17744..18679 product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324520.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(18775..19344) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 19638..21752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(21828..22022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 22041..22898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(22903..23721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 assembly_gap 23848..24005 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 24209..24365 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(24398..24655) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143272.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene gatC assembly_gap 24694..24784 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(24841..25155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 25710..26024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 assembly_gap 27139..27223 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 27583..29613 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122606.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 assembly_gap 29641..29713 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 29906..30853 product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122858.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 31010..32311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 32460..33131 product LssY C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816911.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 assembly_gap 34324..34466 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 34487..34819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 34859..35212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(35775..35963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(36109..36663) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220392.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene bcp CDS complement(36714..37040) product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877119.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(37229..37987) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922179.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(38236..38820) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921906.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 39230..40174 product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 40258..40716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 40806..41999 product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262953.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 assembly_gap 41663..41779 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 42128..43210 product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262953.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 sequence033 source 1..41456 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 161..319 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(801..1823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 2237..2389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 2907..5183 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259371.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 5180..6073 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 6364..6855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 assembly_gap 7031..7202 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7341..9575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 assembly_gap 9608..9707 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10029..10157 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10456..10725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 11474..12193 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277074.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 assembly_gap 12087..12156 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12413..13996 product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(14082..15500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(15891..16586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 assembly_gap 16657..16793 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(17816..19705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(19816..21501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(21682..23685) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328238.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 assembly_gap 21939..21999 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(23705..24031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 assembly_gap 24253..24417 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(26353..26775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 27224..27634 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086522.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 27842..29338 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037227775.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene argH CDS 29325..30155 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene truA assembly_gap 30350..30493 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(30588..31625) product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(31793..32140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(32191..35397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 assembly_gap 32240..32314 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 35491..35597 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 36019..37122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(37455..38162) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903268.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(38426..40198) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990142.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(40239..40934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 assembly_gap 41034..41169 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence034 source 1..41227 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 478..1077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 note possible pseudo, frameshifted assembly_gap 971..1024 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1043..2455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 note possible pseudo, frameshifted CDS 2458..3201 product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 4146..5273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 5276..6742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 assembly_gap 5462..5523 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6829..7272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(7380..7739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(7958..8092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 assembly_gap 8712..8884 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8953..9795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 assembly_gap 9820..9926 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11290..13770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(13767..15086) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(15267..16664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 16695..16955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 17239..18717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(18832..20118) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203404.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(20333..20932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(20973..22397) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(22589..23227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 assembly_gap 23239..23356 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(24071..24868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 assembly_gap 24929..25029 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(25718..27070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 27470..28618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 29371..31422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 31511..31672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 32952..34109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 34246..36771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(37504..37923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 note possible pseudo, internal stop codon, frameshifted assembly_gap 38703..38972 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 39225..39472 estimated_length known gap_type within scaffold linkage_evidence paired-ends misc_feature complement(40364..>41227) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921757.1:efflux RND transporter permease subunit locus_tag LOCUS_15200 sequence035 source 1..41160 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 308..413 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 778..935 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1557..2261) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812013.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(2268..2651) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174182.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene acpS CDS complement(2811..3329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 4093..7218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 7328..7753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 8261..9838 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902322.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene dnaK CDS 9890..10912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(11045..12076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 note possible pseudo, internal stop codon assembly_gap 12136..12278 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 12776..12939 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13426..15486 product isoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120158.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 assembly_gap 15547..15688 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 16016..16083 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 16518..16650 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17468..17803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 17945..18463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(18521..19294) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120816.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(19481..20815) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815191.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene dnaB assembly_gap 20822..20903 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21104..21613) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122533.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene rplI CDS complement(21816..22313) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339883.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(22409..22828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(23072..23641) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122535.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene pth assembly_gap 23762..23879 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(24051..24260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 assembly_gap 24339..24464 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(24480..24848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 assembly_gap 26367..26487 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 26540..26959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 26985..27854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(28192..29472) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331975.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(29563..30978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 31426..32640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15440 assembly_gap 33505..33600 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 33661..34371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 34563..35483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(35494..36666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(36671..38227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 assembly_gap 36675..36797 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 38251..38404 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(38468..38941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 assembly_gap 38981..39115 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 39399..39693 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 40265..40329 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 40675..40910 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence036 source 1..40639 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..733 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085687.1:sulfite oxidase-like oxidoreductase locus_tag LOCUS_15500 assembly_gap 802..897 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1044..1466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 1600..2562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 2563..3255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(3383..4441) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957655.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene rodA CDS 5076..5852 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921002.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene lpxA CDS complement(5954..6457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 assembly_gap 6523..6649 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7393..7893 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122863.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene coaD CDS complement(7942..8781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(8842..10194) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(10307..11116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(11132..12478) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(12737..14053) product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119953.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(14394..14882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 assembly_gap 14894..14968 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15248..16066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(16172..17605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(17829..18374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 assembly_gap 18629..18804 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(18835..20754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 assembly_gap 19421..19525 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 20795..20927 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 21344..22579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 assembly_gap 22612..22738 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22950..23852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(24133..24336) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061019.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(24384..24593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(24628..25098) product PA2169 family four-helix-bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324679.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 25508..25852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 note possible pseudo, internal stop codon, frameshifted CDS complement(25959..26759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(26985..28667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(28931..31276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 31438..31911 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 32587..33132 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263004.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 33327..34271 product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334456.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene fhcD CDS 34363..36354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 36373..37551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530033.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(37548..38924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(38995..39885) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228479.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 assembly_gap 40298..40446 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence037 source 1..40189 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 114..1106 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331126.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 assembly_gap 1144..1269 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1482..2585 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313553.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene mraY assembly_gap 3575..3735 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4033..4193 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4227..4427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 4540..5946 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 5987..6841 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947363.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 6923..7195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 note possible pseudo, internal stop codon CDS complement(7097..7438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 tRNA 7516..7600 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(7721..9643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 9915..10685 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123860.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene kdsB CDS 10837..12459 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326169.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 12634..14988 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121337.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 14992..16323 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921544.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(16447..17598) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922354.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(17629..18339) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 18628..19233 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442700.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 19292..19651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 19706..20965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 21064..22092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 22231..23481 product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112721.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene gspF CDS 23560..24732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 24738..25184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 25177..25788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 25785..26195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 assembly_gap 26275..26383 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 27787..27921 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(28023..29051) product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324151.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(29118..30230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 assembly_gap 30370..30482 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 32790..32924 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 33105..34556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 assembly_gap 34379..34485 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 34540..35130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(35283..36245) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 36796..37980 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327386.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene sucC assembly_gap 38053..38226 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 39005..39130 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence038 source 1..39974 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1645..2619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 assembly_gap 3223..3361 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5203..6285) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334519.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene fliM CDS complement(6324..7592) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121351.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 assembly_gap 8313..8538 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8570..8818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 assembly_gap 8822..9030 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9342..9514 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9986..10144 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10344..11816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 assembly_gap 11655..11770 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11842..14172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 assembly_gap 13349..13541 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 14264..14395 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14487..15632) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921398.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 assembly_gap 15081..15191 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 15838..16578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 16693..18252 product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119512.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 18242..18709 product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404314.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 assembly_gap 18724..18944 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 19203..19326 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 19826..20026 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 20114..20794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 note possible pseudo, frameshifted assembly_gap 20934..21003 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 21274..22629 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene thrC CDS 22766..23269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 23364..24686 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(24690..25772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(25802..26260) product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120329.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(26283..27230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(27310..28173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 28722..29132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 29235..29972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(29986..30156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(30253..31014) product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119307.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(31116..31934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 assembly_gap 31954..32051 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(32802..33737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 assembly_gap 33751..33866 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(34203..35201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(35243..35509) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811859.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene fliQ CDS complement(35588..36523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(36520..37638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 assembly_gap 36709..36785 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(37703..38368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(38431..38979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(39199..39903) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326459.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 sequence039 source 1..37066 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(283..1269) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(1266..1559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 1960..3720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(3792..4772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 assembly_gap 3898..3958 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5037..5516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 assembly_gap 5606..5775 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6258..6443 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6794..6931 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7318..7460 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7810..10371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(10591..13002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 assembly_gap 11312..11403 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13179..14165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(14182..14364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 14760..15179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 assembly_gap 15409..15522 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 16490..16646 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16682..16906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(16991..17980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(17983..20034) product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151654740.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene fadJ assembly_gap 20102..20259 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(20318..21640) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957671.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 assembly_gap 21845..21977 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(22048..22278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(22266..23420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 assembly_gap 22319..22423 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 23584..23772 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 24117..24218 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(24928..25491) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329717.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 assembly_gap 25656..25762 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(26098..28182) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121593.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene fusA CDS 28392..28739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(28903..29058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 assembly_gap 29094..29193 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 29932..30084 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 30174..30524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 assembly_gap 30664..30772 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(31008..31409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 31614..33458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 33455..34645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 34801..35379 product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921657.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 misc_feature complement(35553..>37066) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007337137.1:glycine--tRNA ligase locus_tag LOCUS_16690 sequence040 source 1..36905 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 169..343 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 358..1005 product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene sigW assembly_gap 1075..1359 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1960..2045 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2332..2481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(2666..5092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 assembly_gap 2672..2818 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5306..5863) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332895.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(5992..8265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(8415..10871) product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(11041..12717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(12677..13486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 assembly_gap 12815..12887 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13847..15187) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(15563..16003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 assembly_gap 16209..16359 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16819..17358) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene dtd CDS complement(17409..17861) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(17935..18642) product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 19151..21889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(21904..22236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 assembly_gap 22266..22394 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(23267..23875) product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052031.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene sodA assembly_gap 24547..24686 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 24886..25533 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122890.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 25668..29063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 29279..31732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(31791..33026) product DUF5690 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120645.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(33284..34138) product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206428.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(34320..35096) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325161.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene hisF CDS complement(35149..35364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(35900..36274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 sequence041 source 1..36755 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 603..1586 product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(1720..1965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 1846..2292 product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339818.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(2496..5303) product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922491.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 assembly_gap 5397..5483 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 5932..6058 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6470..6751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(6853..7887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 assembly_gap 6867..6950 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8067..9056 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140196.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene nadA CDS 9159..10520 product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121268.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(10618..11814) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965859.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(11979..12362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 12879..14807 product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767598.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene speA CDS 14926..16236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 16300..17136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 17189..18271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(18332..21427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(21435..22583) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731604.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(22654..22989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(23124..26114) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416348.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(26232..27809) product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332450.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene cimA CDS complement(28149..30152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 assembly_gap 28474..28604 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 29512..29566 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(30282..31106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(31111..33171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 assembly_gap 31157..31299 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 33212..33377 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(33423..33935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 assembly_gap 33971..34149 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(34666..35781) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122077.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 36046..36693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 sequence042 source 1..36668 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(947..1366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(1391..2227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 2893..3924 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118924.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene argC CDS complement(4271..4564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(4684..6384) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123969.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 assembly_gap 7234..7342 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7371..7898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(7951..8466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(8673..9701) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 10018..10356 product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122463.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(10357..11769) product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037247553.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 12207..13268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 note possible pseudo, frameshifted assembly_gap 13141..13203 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13261..13620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 13707..14990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 assembly_gap 14687..14796 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14900..15136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 assembly_gap 15163..15270 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15458..17014) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118024.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(17118..17837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 18097..21135 product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 assembly_gap 21894..22068 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22104..22733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(22773..23261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 assembly_gap 23265..23380 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 23744..23828 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(24265..25050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 assembly_gap 25100..25220 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 26473..27018 product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937609.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 27066..27431 product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546608.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(27632..29059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086332.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(29122..31983) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 32793..34289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(34591..35169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(35259..35948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 assembly_gap 36356..36455 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence043 source 1..36534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1418..2776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 3469..4932 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021070980.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 4982..5194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 5309..5659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(5822..7861) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669835.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 8168..9061 product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 9202..9927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(10023..11042) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337669.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(11500..11832) product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326964.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 12185..13552 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107715.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(13575..13961) product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 assembly_gap 14146..14407 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14510..15433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 assembly_gap 15501..15586 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 16070..16228 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16811..17602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 note possible pseudo, frameshifted assembly_gap 17467..17536 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17602..17874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 18043..19455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 assembly_gap 19323..19445 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 19481..20362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 assembly_gap 21100..21211 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 21260..21676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(21654..23372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(23446..26661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 assembly_gap 26092..26176 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(26744..27970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 assembly_gap 28217..28387 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(28413..29972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(30061..31626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(31777..32235) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922384.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 32337..32966 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186100.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 assembly_gap 33593..33786 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 34111..34304 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 34546..35673 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782251.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 assembly_gap 35797..35976 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence044 source 1..36075 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 463..595 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1243..1776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 1769..3559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 3734..7108 product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119561.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 assembly_gap 5251..5334 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7007..7098 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7141..7644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 7711..8985 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921673.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 9050..9844 product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527984.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 10973..12298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17770 assembly_gap 12107..12178 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12453..13862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 14012..16213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 assembly_gap 16634..16721 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17624..19591 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122606.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(19691..20716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 21053..22576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 assembly_gap 22432..22505 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 22896..22981 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(23208..24455) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(24526..27387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(27517..28440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(29038..31521) product DUF1588 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921596.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(31518..32660) product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921597.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 33789..35270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 assembly_gap 35120..35230 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 35419..35653 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence045 source 1..35637 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(165..422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 412..1833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(1830..2192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(2263..5565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 6013..6804 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122726.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 6997..7953 product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 assembly_gap 8408..8611 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9304..9448 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9563..10600 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405019.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene pstA CDS 10685..11542 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962535.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene pstB CDS 11657..12268 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene phoU assembly_gap 12684..12880 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13347..14852 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123160.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 15635..15985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 15985..17094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 assembly_gap 16951..17048 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17141..18292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(18383..18682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 19311..20924 product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615374.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 20981..21259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 21348..22784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 assembly_gap 22647..22756 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22766..23491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(23660..24133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(24260..25300) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(25689..27314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 assembly_gap 26482..26574 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(27435..28196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 assembly_gap 28260..28400 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(28775..29659) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 29952..31238 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 31419..31772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 31957..32955 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326204.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 32992..33816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 assembly_gap 33579..33641 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 34025..34121 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 34175..34537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 misc_feature complement(34606..>35637) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122381.1:DUF1501 domain-containing protein locus_tag LOCUS_18170 sequence046 source 1..35538 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(29..736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(759..1751) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326344.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene fliG CDS complement(1844..2626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 assembly_gap 2635..2763 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3656..3964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(4009..4410) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442696.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene flgC assembly_gap 4477..4638 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4717..5256) product flagellar biosynthesis protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922066.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(5405..5854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(5901..8585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(8836..10662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(10944..12083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(12835..13830) product DUF21 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324277.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(13827..15128) product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324278.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 assembly_gap 15294..15433 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 15732..17576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 assembly_gap 17443..17516 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17711..18214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 repeat_region 18365..18976 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatggggccgtccattttcaggacggaagac assembly_gap 18977..19075 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 19229..19333 estimated_length known gap_type within scaffold linkage_evidence paired-ends repeat_region 19320..20078 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatggggccgtccattttcaggacggaagac CDS complement(20265..20558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(20632..20976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 note possible pseudo, internal stop codon CDS complement(20986..21693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 note possible pseudo, internal stop codon assembly_gap 21750..21926 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22465..22662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(22879..24492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(24499..25458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(25515..27707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(27704..30217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(30230..31243) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118773.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 assembly_gap 34181..34305 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 35120..35267 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence047 source 1..34011 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(50..358) product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336823.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 625..1434 product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327143.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 1570..2433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 assembly_gap 2682..2805 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2863..3021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 assembly_gap 3380..3595 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3678..6680) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 assembly_gap 6894..7000 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7138..8859) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921919.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene recQ assembly_gap 8865..8976 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9214..9405 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9638..10444 product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922163.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 10657..11313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 assembly_gap 11957..12169 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 12448..12662 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12739..13458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(13475..13948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 assembly_gap 13956..14062 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 14421..14510 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15362..16204) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814831.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene pstC CDS complement(16191..16853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 assembly_gap 17007..17135 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(17366..17689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 assembly_gap 17872..17983 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(18068..18769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 assembly_gap 19001..19154 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 21584..22174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(22274..24388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 assembly_gap 24461..24688 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(24745..26238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119062.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(26313..26879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(26876..28108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 assembly_gap 26950..27032 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 28137..28257 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(29121..30221) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120858.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(30719..31006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(31243..32427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 32758..33273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 33653..33976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 sequence048 source 1..33653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(887..1105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(1134..1709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(2090..2401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(2423..2659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 assembly_gap 2662..2730 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3161..3327 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3673..3771 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3967..5043) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(5118..5690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(5770..6987) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene tyrS CDS 7145..8296 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene murG CDS complement(8283..9401) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 9677..10459 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775976.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 10599..11990 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665703.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(12332..13750) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119573.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene nadB assembly_gap 13852..13936 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14112..14903) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(15147..16010) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 16287..17444 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120810.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene queG assembly_gap 17537..17726 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 17935..18112 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 18198..18755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 assembly_gap 18776..18886 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 19155..20930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120907.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 assembly_gap 19573..19682 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 20957..22927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 assembly_gap 21739..21859 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 23258..23812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(23977..24411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 25003..25710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 25707..27350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(27347..28834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(28831..29550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(29547..32984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 sequence049 source 1..33600 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 170..1648 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922709.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 1737..3167 product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120435.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(3240..3944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 4580..5428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(5659..6744) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813294.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene recA CDS 7177..7557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 assembly_gap 8059..8185 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9725..11098 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229640.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 11309..12202 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728501.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene truB CDS 12430..13863 product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340179.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 14001..14990 product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 15045..18407 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122581.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 18741..21290 product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008668559.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 21287..22204 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407851.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 22307..24451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(24743..25642) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008670430.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(25688..27115) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 27590..28564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 assembly_gap 28379..28458 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 28554..29033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 29030..29323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 29327..29938 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812379.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(30107..31483) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(31663..31986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 assembly_gap 32014..32176 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 32506..32615 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 33243..33472 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence050 source 1..33529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 747..938 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2471..3043 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329551.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 assembly_gap 3639..3849 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4027..4545) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932912.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene mscL CDS 4867..5424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 assembly_gap 5478..5690 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5778..6938) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922070.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 assembly_gap 6308..6378 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7003..7130 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8134..8631) product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318810.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(8708..10783) product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549921.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene tssH assembly_gap 10821..10927 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11549..12616) product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705450.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene tssG CDS complement(12613..14454) product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343627.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene tssF CDS complement(14803..15279) product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318239.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene tssE CDS complement(15333..16133) product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463815.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(16459..18090) product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480259.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene tssC CDS complement(18206..19702) product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463811.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene tssC CDS complement(19823..20218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 assembly_gap 20243..20336 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(20795..21919) product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480330.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene tssA assembly_gap 22240..22368 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22602..23498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 assembly_gap 23553..23828 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(24028..25485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(25851..26636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(26856..27365) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(27587..27961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 assembly_gap 28073..28185 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 28849..29448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(29628..30992) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 31246..32451 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880318.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 assembly_gap 33108..33288 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence051 source 1..33418 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 50..1489 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922918.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 1570..2808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(3103..4212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 4498..5055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921838.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 assembly_gap 5414..5504 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5533..5994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 6144..7568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(7755..8162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 assembly_gap 8168..8401 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8786..9103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(9003..11012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 11892..12134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(12471..15254) product vegetatible incompatibility protein HET-E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122384.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(15286..18264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(18407..20941) product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816832.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 21509..21946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 22008..23492 product PA14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260479.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 23493..23831 product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635217.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 23943..24491 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194622.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(25194..26300) product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327198.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 26975..27715 product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964070.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 27802..28239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 28250..29371 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202982.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(29415..30608) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442691.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(30621..31661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922092.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(31661..32803) product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427735.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(32875..33336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121521.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 sequence052 source 1..33251 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(76..3609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 assembly_gap 259..372 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3960..4409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(4564..5808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(5810..7228) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(7511..9124) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325911.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene groL CDS complement(9229..9531) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325910.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 9757..10005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(10120..10623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(10694..11299) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 assembly_gap 12656..12811 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12900..13388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 13491..14096 product DUF4291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(14109..14705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 assembly_gap 14770..14882 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14938..15285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 15716..15970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 16155..16982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 17110..17514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(17782..18990) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(19121..19705) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082901050.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 assembly_gap 19939..20013 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(20095..20316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 20653..20856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 21295..21837 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017535.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene rimI CDS complement(21949..23217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(23309..24343) product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118600.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 assembly_gap 24350..24441 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(24494..25123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(25383..25928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(25925..26161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(26736..27971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 assembly_gap 29291..29487 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 29608..30459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(30736..31467) product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122357.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(31472..33046) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 sequence053 source 1..33128 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 109..3990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 4673..7183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 note possible pseudo, frameshifted assembly_gap 7016..7102 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7129..7704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 7701..9095 product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122712.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 9095..10570 product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122711.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 10563..12551 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615587.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 12835..15087 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921395.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 assembly_gap 16107..16196 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 16934..17072 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17114..17755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 17848..18642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 assembly_gap 18574..18627 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 18644..19525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 assembly_gap 19825..19920 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 20348..20544 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 20958..21030 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 21090..22460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 22345..23511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 assembly_gap 22351..22428 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 23514..24947 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120961.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(25184..25879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(25957..26607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 assembly_gap 26656..26780 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(27363..27707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615892.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(27707..28339) product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921580.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(28339..29394) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119071.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(29489..30496) product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615893.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 assembly_gap 31002..31190 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 31671..31805 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence054 source 1..32329 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 1160..1362 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1667..1800 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2655..4835 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336886.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 4819..6771 product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616027.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(6788..7405) product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921833.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene rdgB CDS complement(7458..9161) product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123836.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(9338..10399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(10609..11391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(11470..13380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 14374..15777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 15823..16305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(16302..16982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 17486..18463 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921954.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(18474..19505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 note possible pseudo, internal stop codon CDS complement(19810..20382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(20417..21439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 assembly_gap 20458..20543 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21439..22554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 23202..25079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 25247..25507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 25504..26271 product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266861.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(26292..28373) product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 assembly_gap 29138..29219 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 29346..30035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 30117..31727 product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073595568.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(31743..32327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20290 sequence055 source 1..31430 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(197..1081) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846539.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(1056..2426) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene murC CDS complement(2614..3108) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334911.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 assembly_gap 3268..3358 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4656..4800 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4958..5407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(5436..5768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 6094..10299 product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039974.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 assembly_gap 9199..9346 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10111..10243 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10330..10548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20360 assembly_gap 10800..10918 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11004..13616) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121911.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene alaS CDS complement(14036..14335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 14712..15941 product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616082.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 assembly_gap 16786..16938 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16976..17440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 assembly_gap 17552..17707 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 18205..18358 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(18488..18790) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332030.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene rplT CDS complement(18971..19234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(19410..19739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 assembly_gap 19746..19875 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 20580..23129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 23197..23706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(23731..24609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 assembly_gap 24631..24719 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 24890..25052 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 25613..25762 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(25898..26509) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123705.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(26649..29132) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898930.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene glgX assembly_gap 29529..29637 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 30202..31374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 assembly_gap 30314..30386 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence056 source 1..31412 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(296..490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(487..855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 1370..1594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(1962..4283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(4276..6627) product BREX-1 system phosphatase PglZ type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393722.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene pglZ CDS complement(6655..7416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(7398..8489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(8499..12134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20570 assembly_gap 11061..11187 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12228..13157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 assembly_gap 13251..13399 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 14583..14697 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15905..16453) product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(16440..17231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393727.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(17287..17538) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459051.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 17703..18005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 18142..18762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(19129..20025) product plasmid partitioning protein RepB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974303.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(20022..20912) product plasmid partitioning protein RepB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974304.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(20909..22483) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338946.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(22607..23047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 24246..24485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(25462..25650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(25629..25943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(26058..26366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(28202..29185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(29303..29506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(29913..30740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20740 sequence057 source 1..31218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1418..2419) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146392543.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene prfB CDS complement(2654..3976) product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(4136..5242) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene rfbB CDS complement(5283..5984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333116.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(6236..8110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(8247..8801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 8958..10124 product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(10150..10329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 10396..11493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 assembly_gap 11570..11725 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11931..13109 product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324149.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 13111..13677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 assembly_gap 14302..14451 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 14601..14740 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16856..17167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(17283..17765) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339475.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene greA CDS complement(17976..18257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 assembly_gap 18338..18492 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19359..19673) product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(19787..20263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 assembly_gap 20398..20513 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21089..22735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(22732..23037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(23558..24100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 assembly_gap 24117..24304 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 25129..25515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 assembly_gap 25604..25732 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 25908..26882 product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 26912..28330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 assembly_gap 28226..28303 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 28371..29237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(29268..30269) product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 assembly_gap 30295..30404 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 31010..31093 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence058 source 1..31184 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(318..857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 assembly_gap 1007..1190 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1221..1463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 assembly_gap 1535..1611 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1920..2957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 assembly_gap 3015..3198 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4328..5602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 assembly_gap 5997..6215 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6466..6656 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7459..9816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 10271..11293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 assembly_gap 11432..11555 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11591..12679) product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene waaC CDS complement(12758..13189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 assembly_gap 13225..13315 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 14081..14212 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 15254..15376 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15401..15913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 assembly_gap 15914..16125 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17032..18996 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120288.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 assembly_gap 20400..20587 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 21080..21173 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 21305..23290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 assembly_gap 23409..23491 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(23585..24841) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 assembly_gap 24933..25078 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(25298..26143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 assembly_gap 28027..28159 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 28512..28687 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 29300..31003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 sequence059 source 1..31139 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1599..2594) product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 2991..4220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 note possible pseudo, frameshifted assembly_gap 4133..4194 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4747..4856 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 5081..5275 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5529..7676 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922898.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 assembly_gap 7418..7533 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7673..7861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 assembly_gap 7933..8135 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8578..9756 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117840.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene mutY assembly_gap 10021..10135 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10780..10906 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11006..11722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 12091..12306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(12556..12948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(13076..14203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 assembly_gap 14250..14405 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16422..17864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(17867..19417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(19559..21298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 21367..21525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(21545..21799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 note possible pseudo, frameshifted CDS complement(21687..23735) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120937.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 note possible pseudo, frameshifted assembly_gap 21902..21963 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(23732..24475) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327800.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(25041..25535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(25787..26089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(26317..27981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(29574..30578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 sequence060 source 1..30379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 379..518 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1080..1234 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1277..1858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21330 assembly_gap 1980..2069 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2617..2922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 note possible pseudo, frameshifted CDS 2919..3644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 note possible pseudo, frameshifted CDS complement(3688..4437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(4516..5094) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328727.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 5888..6865 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329644.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 6939..8333 product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 note possible pseudo, frameshifted assembly_gap 8220..8277 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8357..8575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 assembly_gap 8690..8858 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8995..11091 product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922240.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene ppk1 CDS complement(11205..11717) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014064.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 11957..12808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 13493..13906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 14079..15218 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921837.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene carA CDS 15218..15736 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123449.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene ndk CDS 15861..16697 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256575.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 16888..19206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(19347..20174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 20661..22256 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615418.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 22320..23975 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340030.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(24061..24375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(24375..24824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 assembly_gap 24907..25127 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 25438..25616 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 25895..26041 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 26078..26488 product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327586.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene mntR assembly_gap 26621..26737 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(27313..27756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 assembly_gap 27863..27977 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(28774..29319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 assembly_gap 29342..29458 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence061 source 1..30345 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921834.1:sialidase family protein locus_tag LOCUS_21570 CDS 1878..2366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 2367..3911 product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140144.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 4080..4454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 4525..6108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 6092..6733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 6733..7575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(7580..8140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 8539..10419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(10618..11376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 11565..12215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 12240..12731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 12728..13687 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080803342.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 13817..14191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 14267..14653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(14733..15665) product Bpu10I family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259288.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(15662..16933) product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259289.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 tRNA complement(17237..17310) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(17632..17826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 18153..18467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 18471..19145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 20094..21797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 22370..24013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 24010..24396 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545378.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 24396..27962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 28273..28770 product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325128.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene nrfH CDS 28776..30188 product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123116.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 sequence062 source 1..29993 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(65..565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21830 assembly_gap 620..785 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(888..1265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 assembly_gap 1345..1538 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1888..2028 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2566..2707 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3279..3377 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3507..5225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 5644..7434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(7630..7821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 assembly_gap 8195..8339 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 8754..8847 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9010..9780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 10051..12369 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene ppdK note possible pseudo, frameshifted assembly_gap 12275..12319 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12332..12844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21900 note possible pseudo, internal stop codon, frameshifted CDS complement(12952..13836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 assembly_gap 14021..14169 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14299..14637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 assembly_gap 14728..14792 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15168..16226) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061017.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(16649..18196) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666312.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 assembly_gap 18403..18495 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(18535..18834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(18882..21179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 assembly_gap 18932..19030 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 21239..21355 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22542..23915 product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615810.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(23990..24466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 assembly_gap 24852..24941 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(24971..25402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 assembly_gap 25410..25565 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 26458..26660 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 26961..27134 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 27512..28156 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327156.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 assembly_gap 28285..28384 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 29558..29739 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence063 source 1..29720 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2939..4855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22010 assembly_gap 4498..4647 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4792..7647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(8036..8812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 9680..10855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 assembly_gap 10262..10309 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10906..11298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(11401..12528) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921852.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(12599..15193) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923035.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 15852..17093 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117991.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 17207..17656 product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269323.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(17727..18407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(18759..21416) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057718.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene topA CDS 21833..23518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22120 assembly_gap 23329..23468 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 23493..24548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 24734..25339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(25379..25843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 assembly_gap 25940..26070 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(26120..26338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(26465..27004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 assembly_gap 27025..27197 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 28106..28244 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(28280..28531) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921431.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(28629..29243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 assembly_gap 29307..29430 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence064 source 1..29408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(345..1271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 1582..3162 product lysine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886371.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(3183..4307) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922313.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(4352..4711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 4904..5449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 5762..10858 product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669069.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(10982..11251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(11451..12230) product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817082.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(12427..12693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(12956..13861) product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946724.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(14023..14673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22300 assembly_gap 14736..14824 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 15545..15658 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15705..16940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22310 assembly_gap 16952..17142 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 18213..18419 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 18563..18776 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 19157..19314 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19351..19977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 assembly_gap 19995..20113 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 21053..21218 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 21482..21635 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22024..23115 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037200879.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene ychF CDS 23164..23835 product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325327.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 assembly_gap 23875..23978 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 24326..24580 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 24827..24972 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 24985..27138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 assembly_gap 27140..27291 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 27412..29133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22360 assembly_gap 28866..29006 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 29130..29321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 sequence065 source 1..29254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 284..533 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1482..2255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 2450..2962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(3327..6149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 assembly_gap 4660..4727 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6281..6364 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7086..7754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(7819..8376) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008652955.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 assembly_gap 8502..8562 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8736..8951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(9199..10170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(10724..11122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(11185..11967) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121332.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 12231..12956 product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(13022..13618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(13576..16128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 assembly_gap 13647..13708 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16961..18424 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(18598..19656) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050459751.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(20115..20939) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921878.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 gene trpA assembly_gap 21110..21246 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 21548..21622 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 21752..22858 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922445.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 23078..24064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 24172..24471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 24590..24955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 24955..26265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 26255..26719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(27586..28113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 assembly_gap 28603..28653 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence066 source 1..28417 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 825..953 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1133..1285 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1319..1630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 assembly_gap 1716..1828 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2147..2320 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3199..3777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(4050..5570) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391551.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene dnaA CDS complement(6169..7212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS 7308..9122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(9216..11363) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(11551..11760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22660 assembly_gap 13005..13154 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 13376..13464 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13585..14100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 14346..16208 product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048118.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 16881..18143 product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669743.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(18244..19479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 assembly_gap 18286..18393 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19831..22035) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921616.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 22390..22767 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454676.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 22872..23759 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921771.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 23990..26878 product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922097.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 26895..28340 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 sequence067 source 1..27328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(69..1103) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482201.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene epmB assembly_gap 1193..1297 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1712..1830 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2289..2394 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2459..2704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 3027..4487 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122282.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 gene miaB CDS complement(4827..5813) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene glk CDS complement(5892..6932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 7252..7443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(7895..9643) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328922.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene ptsP CDS complement(9907..13170) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615881.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 assembly_gap 14052..14156 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14158..15444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 15709..16050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 assembly_gap 16273..16417 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16438..17451 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 17649..18590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 assembly_gap 18850..18975 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19201..19830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(19943..20284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(20773..21102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 assembly_gap 22026..22141 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22353..22943 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921755.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 assembly_gap 23798..23895 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 23913..24410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22920 note possible pseudo, frameshifted CDS complement(24704..24940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22930 assembly_gap 25237..25321 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 25755..25879 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 25955..26347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 26442..27281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22950 sequence068 source 1..27104 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(248..1447) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 assembly_gap 1549..1696 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1967..3406) product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 assembly_gap 2083..2202 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4051..4413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 4707..5540 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330043.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 assembly_gap 6368..6455 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6509..7276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(7312..8745) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525043.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 9033..9413 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118554.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 9460..10515 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260609.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 assembly_gap 9843..9921 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10613..13705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 assembly_gap 11733..11852 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13775..14194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(14210..15295) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121508.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene hisC CDS complement(15337..15549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 assembly_gap 15623..15794 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16012..17304) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene xseA assembly_gap 16380..16456 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 18073..18177 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 18196..18867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 assembly_gap 18906..19111 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 19164..22646 product nodulation protein NolG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970886.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene nolG assembly_gap 19995..20060 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 21393..21523 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 22264..22341 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22882..23478 product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120779.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 23936..25027 product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922635.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 misc_feature complement(25183..>27104) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_109982246.1:response regulator locus_tag LOCUS_23130 sequence069 source 1..26918 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 165..338 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 681..1178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23140 assembly_gap 1214..1421 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1509..1895) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090251.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(2086..3240) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434916.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(3295..3810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(3871..5112) product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921947.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 5378..8389 product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142749.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 assembly_gap 8494..8591 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8637..9410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(9353..11107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 assembly_gap 9468..9604 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11411..12400) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119981.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 12838..14625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23230 assembly_gap 14685..14952 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15129..16733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(16864..17574) product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883144.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(17680..18840) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene corA CDS complement(18941..20059) product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037227959.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(20108..21313) product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337623.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 sequence070 source 1..26652 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 262..2298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 3334..3672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(3756..3938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23310 assembly_gap 4035..4138 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4182..4574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(4681..7044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 assembly_gap 4725..4900 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7156..7983) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815129.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS complement(8102..8566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 assembly_gap 8636..8814 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9943..10212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 10276..10461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS complement(11679..12680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 assembly_gap 12712..12857 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13273..15861) product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120839.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(16425..16604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 17983..20478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23410 assembly_gap 19079..19227 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 20629..20836 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21060..21275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 note possible pseudo, frameshifted assembly_gap 22530..22739 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22752..23996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 24635..26215 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037201681.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 sequence071 source 1..26509 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(13..198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 assembly_gap 427..679 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 848..1031 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1716..1854 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1974..2159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 assembly_gap 2636..2728 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2783..3181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(3646..4794) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174702.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene aroB CDS 5519..7567 product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(7681..8838) product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921709.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene mqnC CDS complement(8969..9826) product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 10224..11543 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328879.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 11540..12058 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643199.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(12118..13008) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329092.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(13176..15998) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099383.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene polA CDS 16156..16437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 16531..17067 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922248.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(17072..18406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(18490..19731) product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922502.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene hmpA CDS 19850..20272 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922126.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(20468..23638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 23973..24452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23620 sequence072 source 1..26240 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(168..1040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(1155..1997) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(2150..2839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 3255..4130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(4473..6161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 assembly_gap 5736..5874 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6287..6685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(6932..7666) product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401997.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 7945..9762 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324768.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene typA CDS 9940..10575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(10706..12415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(12818..15160) product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122749.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(15266..15652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23740 note possible pseudo, frameshifted CDS complement(15649..16062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 note possible pseudo, frameshifted assembly_gap 15681..15719 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 16106..16248 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(17180..22450) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121648.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene uvrA assembly_gap 21542..21626 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(22381..23793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23770 assembly_gap 22497..22610 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 24034..24231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 24228..24632 product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 assembly_gap 25643..25764 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 25787..26101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23800 sequence073 source 1..25853 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(30..719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23810 assembly_gap 726..829 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1093..1213 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1218..1493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23820 assembly_gap 1618..1750 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1885..1932 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2144..4129 product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(4190..4594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(4707..5420) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660467.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(5680..6825) product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118672.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene ispG CDS complement(7080..8378) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122348.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 8529..8807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(8824..10062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122399.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 10419..11939 product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922192.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 11973..12713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 13110..14324 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene proB CDS complement(14491..15831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(15831..17513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(17621..18556) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(18916..19377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(19420..19827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(20020..20925) product TIGR03009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922291.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 21686..24289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(24393..25733) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117814.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene hisS sequence074 source 1..25470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 775..924 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(958..1872) product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene hpnC CDS complement(1908..2309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(2598..3716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 assembly_gap 2702..2756 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3947..5548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(5579..7684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 8108..9442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24060 assembly_gap 9297..9420 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9528..12035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24070 assembly_gap 11215..11353 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 11715..11817 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 13194..13366 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13429..14316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 14565..16775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 assembly_gap 16614..16722 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16772..17377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 17521..17967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 18043..18933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 19113..21695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(21708..22529) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530346.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 22810..23526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 23541..23912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 23995..25410 product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 sequence075 source 1..25148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(149..1339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(1336..3117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(3230..3658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(3789..4820) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(5532..6422) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121449.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 6996..7175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 7168..8520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 assembly_gap 8706..8918 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9891..10036 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10128..11678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 note possible pseudo, frameshifted assembly_gap 11566..11636 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11653..12360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 note possible pseudo, frameshifted CDS 12407..13897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 assembly_gap 13535..13640 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 14236..14367 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14843..15355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 15461..16234 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068264628.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 16231..17226 product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336191.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 17216..18010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921699.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 18035..18814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 18811..19932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 19929..21023 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119708.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 21020..22354 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121952.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(22553..22732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 23520..24980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 sequence076 source 1..24980 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 352..478 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1020..1247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(1284..1448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(1460..2506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(2547..3314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24410 assembly_gap 3435..3584 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4881..5096) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459051.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 5226..5411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 5408..5659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24440 assembly_gap 5845..5996 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7014..7122 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7888..8054 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8239..8469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(8858..11179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 assembly_gap 11848..11969 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12058..13257) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 gene rpoD CDS complement(14878..15051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 15209..15442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 15439..15627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 assembly_gap 15859..15990 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16059..17267 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 assembly_gap 17657..17701 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17713..18357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 18369..18614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 18707..18925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 assembly_gap 20091..20278 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 20661..21245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 assembly_gap 20795..20850 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 21242..22069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 22117..22290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(22505..23089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24580 assembly_gap 23350..23437 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(24102..24560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24590 assembly_gap 24582..24688 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence077 source 1..24954 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 515..6328 product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061269.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 6381..8690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 8694..10013 product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861451.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 10169..10780 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325155.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 10789..14433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 14523..15863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 15964..16668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 16965..17318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 17415..17972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(19253..19381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(19602..21860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 22761..24350 product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922210.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 assembly_gap 24449..24657 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence078 source 1..24753 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 205..388 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1026..2363) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332220.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene accC CDS complement(2431..2952) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328900.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene accB CDS complement(3098..4201) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121913.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 assembly_gap 4410..4659 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5542..5790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 5907..7136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24760 assembly_gap 8239..8393 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8405..8788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 assembly_gap 8981..9161 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9599..9755 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10860..11201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(11355..20015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 assembly_gap 12610..12686 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 15573..15670 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 18643..18787 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 20083..20312 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(20425..21204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(21111..22661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 assembly_gap 21240..21394 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(22684..23910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24820 assembly_gap 22707..22820 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 23920..24024 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 24266..24442 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence079 source 1..24566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(883..2610) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 3122..4573 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS 4557..5099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 tRNA complement(5296..5367) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(5493..6620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 6870..7988 product DUF1570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616071.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(8087..8809) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400058.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(8852..9181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 9406..10161 product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226565.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 10158..11468 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655595.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene bioA assembly_gap 11375..11442 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11776..12750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 13044..13496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 13592..14161 product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946639.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS complement(14167..14538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24950 assembly_gap 14566..14763 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 15825..16028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 16353..17618 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616070.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 assembly_gap 16888..16999 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(17639..18604) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921771.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 19156..20280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 assembly_gap 20485..20563 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 21343..23922 product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666716.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 assembly_gap 23727..23854 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 23870..24514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 sequence080 source 1..24553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 147..1343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS 1356..2120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS 2550..3794 product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816063.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene mdoC CDS complement(3798..4259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(4307..6169) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 6839..7384 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329169.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 7481..8842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616020.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(9022..9432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(9562..10596) product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(10786..11961) product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324978.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(12109..12402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25120 assembly_gap 12407..12520 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12999..14237) product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(14282..14734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25140 assembly_gap 14841..14984 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15616..19299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25150 assembly_gap 16170..16263 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 16964..17051 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19437..20762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25160 assembly_gap 21080..21264 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 21482..22765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25170 assembly_gap 22669..22754 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 23831..23966 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 23975..24499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25180 sequence081 source 1..24094 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 138..548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122820.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 assembly_gap 607..754 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(826..1782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25200 assembly_gap 1846..1944 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2725..3894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25210 assembly_gap 3751..3850 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3869..6175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 6182..9658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 9648..10850 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257321.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(10919..11422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 11849..13048 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669535.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 13177..14190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 14219..15043 product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265558.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(15118..15633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 15890..17113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 17478..18077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(18153..19580) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228658.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(20050..21045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 21444..22994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25340 assembly_gap 23609..23894 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence082 source 1..23967 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 179..358 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1570..3591) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120867.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene dnaG CDS complement(4644..5981) product retron St85 family RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124764.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 assembly_gap 6040..6161 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6761..7066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS 7330..8250 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922514.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene rsmA CDS 8368..9861 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325011.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene guaB CDS 9794..11305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25400 assembly_gap 9986..10096 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11504..12988) product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 assembly_gap 13088..13255 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13296..13694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25420 assembly_gap 13723..13943 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14345..14881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(15082..16404) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256652.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 gene murD CDS 16562..17791 product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 assembly_gap 17844..17952 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(17995..18207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25460 assembly_gap 18261..18389 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 18783..18975 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 19272..19439 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19932..20936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25470 assembly_gap 19982..20061 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 20991..21203 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 21650..21841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 22303..22614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260968.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(22621..23253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 23269..23544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25510 sequence083 source 1..23894 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(221..829) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338439.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 951..3254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(3311..4102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(4257..5132) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 5456..5905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(6376..6891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 6935..7720 product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 7787..9298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25590 assembly_gap 9760..9875 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10137..10395 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10474..13950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(14028..16175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 assembly_gap 15158..15264 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16307..16561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25620 assembly_gap 16956..17030 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(17412..18866) product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084998.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(18967..20403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(20459..21934) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(22597..23739) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922783.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 sequence084 source 1..23845 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(599..1627) product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262120.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 assembly_gap 641..716 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1639..3300) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479312.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 assembly_gap 3382..3601 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3763..3877 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4096..4365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25690 assembly_gap 4419..4523 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5074..5814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(5880..7286) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123146.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(7318..8142) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922402.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(8349..8843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(9258..10013) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667131.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 10268..10507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 10689..12374 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334446.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 assembly_gap 11917..12071 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12634..15831 product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921330.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(15867..16358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 16652..17689 product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 17788..18258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(18407..19126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 19350..20492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25820 assembly_gap 20581..20828 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 21565..21646 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21711..21932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 assembly_gap 22094..22205 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(22492..23412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 assembly_gap 23457..23615 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence085 source 1..23682 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(459..9428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 assembly_gap 489..607 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4988..5073 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9686..10321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 11278..12696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 assembly_gap 12338..12468 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12656..13831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 13855..14877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(14851..15171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 15444..16118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 16590..18749 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120445.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene fusA assembly_gap 19078..19217 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 19440..20291 product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827560.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 20383..20928 product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330217.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 21075..21257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(21254..21562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 21987..22157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 22141..23568 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447220.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 sequence086 source 1..23532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 371..1426 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120182.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 assembly_gap 1489..1648 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1791..3620) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120741.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(3974..4705) product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(4869..5105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(5080..7242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26040 assembly_gap 5122..5317 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7379..7538 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7671..8561 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037253110.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(8856..9635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(10104..11570) product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119037.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene gnd CDS complement(11621..12553) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120218.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(12671..13255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(13280..14149) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027122.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(14239..14973) product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929061.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(15021..16316) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(16501..17280) product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199071.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 17571..17891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 17987..18466 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326294.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene rnhA CDS 18611..19210 product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723402.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 19343..19849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 assembly_gap 20000..20228 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 20397..21575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS 21649..22095 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729724.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(22390..22659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 22870..23499 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427748.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 sequence087 source 1..23527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(345..1376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(1451..2392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 2822..3550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(3832..4020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(4187..5419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 5774..7885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(8086..8472) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812273.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 8646..9824 product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403248.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(9897..11072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26300 assembly_gap 11076..11176 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11485..11937) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804693.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene mraZ assembly_gap 13849..14031 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14163..14786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26320 assembly_gap 14816..14870 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 15094..15744 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324221.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 15934..19566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922202.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 19629..20720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 20889..21734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 21885..22361 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327446.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 22419..22919 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327445.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 sequence088 source 1..23499 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(8..472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26390 assembly_gap 538..694 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(913..1581) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090711.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(2753..4282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(4269..8444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26420 assembly_gap 8459..8594 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9125..9249 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9955..11316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(11377..11871) product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257245.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 12526..13326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 13344..15317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26460 assembly_gap 15938..16009 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16040..17245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 17282..17500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 17722..19143 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 19659..20756 product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329196.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS 20968..21429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118347.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(21894..22640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26520 assembly_gap 22788..22958 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence089 source 1..23197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 170..302 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 606..746 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1196..1714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 1782..2621 product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327752.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene floA note possible pseudo, frameshifted assembly_gap 2583..2605 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2618..2782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 2843..3250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921589.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS 3569..3988 product IS200/IS605-like element IS1004 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503164.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 gene tnpA CDS 4098..4913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 4910..5221 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256234.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 5272..5760 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227509.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 5913..6110 product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 assembly_gap 6583..6715 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6851..7117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(7134..7553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 7863..7991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS complement(8265..10001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(9998..12973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26660 assembly_gap 10027..10144 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13445..14068 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767407.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 14078..15238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(15450..15845) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031500121.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS complement(16221..16544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(16591..16842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS complement(16817..16984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(17184..17636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS 17924..18757 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123168.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 19005..19274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 19431..19670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922413.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(19980..20207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26770 assembly_gap 20215..20450 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence090 source 1..23112 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(287..1702) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615434.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(1732..3528) product NPCBM/NEW2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615476.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS complement(3479..3643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(4159..5127) product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704299.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(5114..6091) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329070.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS 6315..7082 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036308.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 7131..7457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS 7728..8279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26850 assembly_gap 8319..8501 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8707..9315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 9321..9959 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029057.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 assembly_gap 9977..10128 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 11871..11981 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13135..13632) product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328025.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS 13775..14656 product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 14846..15838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS 16026..16424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 16492..17415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 17504..17776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 17855..18553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 18623..19267 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067136.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 19218..20768 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334261.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene atpA CDS 20878..21792 product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122671.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene atpG sequence091 source 1..22467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(196..1239) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(1330..5118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 5356..6276 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922282.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(6522..7409) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921650.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 7534..8559 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921278.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 assembly_gap 7588..7655 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 8593..8770 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8941..9969 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119735.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 10204..11481 product D-tagaturonate epimerase UxaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081526.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene uxaE CDS 11829..13385 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922522.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 13597..14529 product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615454.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 14593..14919 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122598.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS 15448..15897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 15894..17666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS 17678..20785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 20849..21661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27110 assembly_gap 21547..21620 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 21658..22338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27120 sequence092 source 1..21989 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(55..555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(558..2048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 assembly_gap 598..744 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2746..3201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(3255..4646) product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325276.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene sthA CDS complement(4862..5908) product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615376.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS complement(5912..7384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS complement(7314..9839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947112.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 note possible pseudo, frameshifted assembly_gap 7438..7538 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 8511..8573 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9937..10060 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10688..11854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27200 assembly_gap 10697..10745 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 12023..12234 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12775..14421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27210 assembly_gap 12804..12898 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 14471..14611 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15026..16048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27220 assembly_gap 16063..16199 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(17055..18176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27230 assembly_gap 17521..17615 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 18289..19332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 19561..21555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27250 assembly_gap 21277..21368 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 21624..21763 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence093 source 1..21412 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 133..1335 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922523.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 1529..2632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 2746..4245 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528380.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(4409..4885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(5047..6135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(6374..7426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27310 assembly_gap 7538..7694 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7792..8232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27320 assembly_gap 8521..8605 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9250..9720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197998779.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 tRNA complement(9982..10056) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 10417..11781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27340 assembly_gap 11821..12014 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 12165..12370 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 12751..12938 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 13110..13323 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13359..14801) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 15003..15887 product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327171.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 assembly_gap 15945..16192 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16298..17890) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327245.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(18380..19360) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120916.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene trpS CDS complement(19409..20374) product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332287.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 assembly_gap 20600..20707 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(20755..20973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672712.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 sequence094 source 1..21310 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 62..2497 product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921453.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 2494..4926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 5178..7574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS 7638..9392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921469.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 9435..10466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 10514..11755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 11805..13541 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922881.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 13567..14616 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922058.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS 14839..16923 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329492.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene uvrB CDS 17130..17762 product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073379.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 17759..18901 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926879.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 18948..19727 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057678.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS 19729..20817 product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187814.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 sequence095 source 1..21257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 173..357 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 669..837 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 953..1453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(1509..2966) product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120624.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 3267..4619 product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921592.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS 4959..6296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(6321..7340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(7551..8483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27590 assembly_gap 9708..9890 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10231..10381 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10483..14175 product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922355.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 assembly_gap 12451..12613 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 14716..14812 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15212..15517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 15416..15955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(17039..18652) product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044334326.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(18669..18848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27640 assembly_gap 18883..18945 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 20421..20520 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 20767..20865 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence096 source 1..21232 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 213..1478 product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037250665.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(1482..1820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS complement(1850..3169) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906404.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(3384..4313) product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333288.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS complement(4310..4498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27690 assembly_gap 4534..4754 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5867..7939) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 8690..10729 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120499.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene metG assembly_gap 11089..11237 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 11544..11660 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12302..12763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS complement(12779..13294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27730 assembly_gap 13312..13430 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 13811..13968 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14318..14548) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324899.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(14799..15719) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117846.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene fabD CDS complement(15802..16809) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene plsX CDS 17809..17967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS 18164..18376 product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 misc_feature complement(18457..>21232) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121554.1:autotransporter outer membrane beta-barrel domain-containing protein locus_tag LOCUS_27790 assembly_gap 18779..18917 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence097 source 1..21133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 76..537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 654..839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27810 assembly_gap 922..1005 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1958..2144 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2239..3633 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(3683..4342) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 4627..5496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27840 assembly_gap 5391..5444 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5493..5756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(5789..6700) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 assembly_gap 7024..7162 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 8300..8419 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8464..8964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27870 assembly_gap 9084..9219 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9515..9697 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10635..10777 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10858..11670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS 11738..13399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 13473..13958 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093030.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene moaC CDS complement(14126..14365) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632782.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene csrA CDS 14884..16026 product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene hpnH CDS 16098..16643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(16649..19213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27940 misc_feature complement(19397..>21133) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122073.1:leucine--tRNA ligase locus_tag LOCUS_27950 sequence098 source 1..20930 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 2145..2258 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2280..2921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 3046..3444 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325148.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene rplU CDS complement(3482..4423) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546758.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 gene miaA CDS complement(4685..5152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(5431..7095) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948335.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 gene murJ CDS complement(7209..7700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 8214..8369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(8699..9253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(9250..9525) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326729.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(9518..10138) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326728.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 gene gmk CDS complement(10315..10737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28060 assembly_gap 10745..10871 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 11069..11226 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 11543..11809 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 12214..12444 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12915..15221 product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(15316..15648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(15784..15999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 16288..16653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS complement(16873..18354) product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061798.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 18825..19286 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 sequence099 source 1..20794 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(50..814) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117867.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(896..2233) product BtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117868.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS complement(2202..3248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(3309..3449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28160 assembly_gap 3620..3859 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3944..4132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS complement(4168..5409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 assembly_gap 4180..4302 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6641..6768 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6961..7211 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9392..10396 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123109.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(10422..11240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(11312..12001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(12083..12619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28220 assembly_gap 12631..12796 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14318..15379 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565946.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 15510..16511 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615404.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 16731..17474 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 tRNA 17561..17635 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(17764..18684) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922180.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 assembly_gap 20352..20524 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence100 source 1..20755 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 437..530 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1199..1303 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2023..2134 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2339..2815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 3190..3897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014503.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(4281..6383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 6578..7525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 7532..8440 product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS 8522..9409 product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 9483..12638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28330 assembly_gap 12972..13080 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 14166..14287 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 14824..14973 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 15664..16461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 16468..17430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28350 assembly_gap 18978..19089 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence101 source 1..20609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1137..2267) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS 2492..3178 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS 3272..3568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(3713..4480) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223885.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(4477..5715) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087691.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene pepT CDS complement(5733..6617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339871.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(6880..9861) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118092.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 assembly_gap 8120..8236 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9888..10071 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10801..11427 product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061309.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 assembly_gap 11850..11991 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 12775..12931 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13119..14564 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(14723..15346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 15600..16598 product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 gene thyX assembly_gap 15988..16047 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16845..17429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 assembly_gap 17458..17529 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(17874..18923) product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324646.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 assembly_gap 19391..19557 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 19603..19971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 20015..20491 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704886.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 gene queD sequence102 source 1..20515 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 2171..2280 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2578..3588) product DUF4365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108028898.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(3585..3917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 assembly_gap 3955..4113 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4304..4612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 5390..5833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(5812..6480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28550 assembly_gap 6563..6691 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9125..9250 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10390..10477 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10855..11037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 12311..12505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(13561..13725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(15311..17092) product response regulator receiver domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530590.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(17085..20042) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939035.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 sequence103 source 1..20387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(53..625) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404273.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(613..1698) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 assembly_gap 1801..1923 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1970..3277) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921673.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(3407..4939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(5077..6921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 assembly_gap 5115..5216 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7556..7843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(7926..8195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS 8803..8967 product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096961.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 9007..9198 product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390272.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 9319..10218 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977671.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(10433..11962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS 12122..13702 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125187.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS 14032..14568 product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811261.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS complement(14587..15753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(16078..18078) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921992.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(18317..18775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28760 assembly_gap 18974..19213 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 19376..19549 estimated_length known gap_type within scaffold linkage_evidence paired-ends misc_feature complement(19800..>20387) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393770.1:acetylornithine transaminase locus_tag LOCUS_28770 sequence104 source 1..19757 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 160..519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 694..1209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 1246..2943 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616092.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 gene flgK assembly_gap 2978..3169 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3564..3761 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4135..4300 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4582..4781 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4807..6024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(6118..7158) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922558.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 7368..8534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(8616..9317) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(9555..11294) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228370.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(11269..14232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922069.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 14964..15719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814201.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(15818..17029) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 17227..17493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(17589..19010) product glycosyltransferase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922438.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(19271..19636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28910 sequence105 source 1..19403 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 267..1937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 1998..3008 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927014.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(3076..4005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(4002..5615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28950 assembly_gap 4122..4237 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5727..6788) product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077175158.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene hypE CDS complement(6785..7912) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893645.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 gene hypD CDS complement(7909..8169) product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893644.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(8169..10565) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258631.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene hypF assembly_gap 8871..8934 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10583..11242) product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 gene hypB CDS complement(11239..11571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29010 assembly_gap 11579..11691 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11725..12246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(12290..13516) product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895383.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 assembly_gap 13520..13626 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 14059..14149 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14589..15449) product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948171.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(15446..16489) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(16595..17005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS complement(17182..18015) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123124.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(18065..18937) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123124.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 sequence106 source 1..19366 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 243..1076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29090 assembly_gap 1888..2077 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2670..2776 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3339..8624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29100 assembly_gap 5937..6032 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 8418..8573 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8621..9151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29110 assembly_gap 9405..9482 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9539..10858) product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113429.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene wbpA CDS complement(10878..11069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29130 note possible pseudo, internal stop codon, frameshifted assembly_gap 12346..12509 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12991..18357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29140 assembly_gap 15949..16124 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 18480..18613 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 19022..19177 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence107 source 1..19325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 217..382 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1577..1960 product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121923.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS 2114..2650 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 assembly_gap 2677..2842 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2895..4391) product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669743.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 4816..5934 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338730.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 gene tatC CDS complement(6111..7709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(7775..9160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS complement(9147..9479) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 assembly_gap 9917..10027 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10233..11000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29220 note possible pseudo, frameshifted assembly_gap 10919..10981 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11003..11332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29230 note possible pseudo, frameshifted CDS 11491..11898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS 11955..12812 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 12939..13301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29260 assembly_gap 13432..13563 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13606..14652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29270 assembly_gap 14551..14634 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14663..16246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29280 note possible pseudo, frameshifted CDS 16266..18188 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442624.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene lepB CDS complement(18272..18709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS 18822..19181 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141229.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 sequence108 source 1..19301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 882..1637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(2874..3611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS complement(3693..3968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29340 assembly_gap 4645..4788 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4857..5084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 assembly_gap 5799..5888 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5996..6238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(6196..6534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(6603..7244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326285.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS 7404..8387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS 8384..8941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 9990..10694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 assembly_gap 11363..11513 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11834..13690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 13694..14896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS 15056..15418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 15472..16326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 16370..18055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 18055..19020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29470 sequence109 source 1..19282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 317..1291 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 gene folP assembly_gap 930..1006 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1308..1518 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2082..2144 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2791..2910 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3016..3927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(4082..4273) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338941.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 gene rpsU assembly_gap 5502..5665 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5673..5804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29510 assembly_gap 5865..6074 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6487..6635 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6869..7825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29520 assembly_gap 8265..8379 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9366..10205) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084985.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS complement(10202..11389) product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868672.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(11594..11848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29550 note possible pseudo, frameshifted CDS complement(11871..13601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29560 note possible pseudo, frameshifted assembly_gap 11906..11964 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13692..14162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS complement(14196..17138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS complement(17200..17478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(17528..17893) product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940486.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(17942..18433) product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073661.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 assembly_gap 18489..18558 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 18926..19097 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence110 source 1..19265 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(438..887) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326814.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 gene rplO CDS complement(1032..1511) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326813.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 gene rpsE CDS complement(1690..1941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29640 assembly_gap 2098..2187 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2285..2830) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121609.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene rplF CDS complement(2882..3277) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326810.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 gene rpsH CDS complement(3394..3948) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225809.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene rplE CDS complement(4003..4359) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326807.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene rplX CDS complement(4511..4879) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326806.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene rplN CDS complement(4935..5234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(5293..5505) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326804.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene rpmC CDS complement(5566..5988) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121605.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 gene rplP CDS complement(5927..6628) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326802.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene rpsC CDS complement(6681..7025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(7110..7379) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326800.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 gene rpsS CDS complement(7441..8295) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121603.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene rplB CDS complement(8357..8665) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326798.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene rplW CDS complement(8735..9181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29780 assembly_gap 9191..9298 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9559..10254) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121602.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene rplC CDS 10253..10474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(10430..10753) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326795.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 gene rpsJ CDS complement(11081..11851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29820 assembly_gap 12522..12661 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 13151..13229 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13811..14896 product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338937.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 15150..17084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29840 assembly_gap 16854..16992 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(17206..17634) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123285.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 assembly_gap 17732..17830 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(17900..19138) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122283.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 sequence111 source 1..18928 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 67..675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29870 assembly_gap 746..853 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 903..1067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29880 assembly_gap 1320..1466 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1956..2159 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3022..3345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS 4131..4523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS 4622..5191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 5306..5533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29920 assembly_gap 6091..6263 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6318..6632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(6945..7184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(7958..8131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(8219..8608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS complement(8728..9252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29970 assembly_gap 9347..9492 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9927..10124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(10352..10480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29990 assembly_gap 10499..10588 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10945..11247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS 11846..12199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30010 assembly_gap 12531..12658 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12666..13595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS 14822..15307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30030 assembly_gap 15364..15570 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 16169..16275 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16314..17603 product STM4012 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058547.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 assembly_gap 17437..17487 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17662..18567 product STM4011 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640248.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 sequence112 source 1..18548 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(38..433) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(509..1696) product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615932.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 note possible pseudo, internal stop codon assembly_gap 2201..2379 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4141..5835 product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 5838..6680 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868299.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene rfbD assembly_gap 6766..6863 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6899..8758 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 gene asnB CDS complement(8762..9169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(9230..11692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS complement(11836..13746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(13832..14188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS complement(14185..15084) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816586.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 15382..18324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30160 assembly_gap 17799..17818 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 18099..18204 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence113 source 1..18367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 217..383 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(430..1008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 1439..1870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 2005..2712 product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918412.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 gene metW CDS 2815..3459 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123691.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS 3595..4452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123690.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS 4478..4993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 4990..6435 product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122224.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 gene hpnE CDS 6633..8180 product ATPase with chaperone activity inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615735.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 assembly_gap 8552..8690 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8770..9339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS 9410..9847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30260 assembly_gap 9849..9980 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10379..11185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(11265..14252) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922034.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 assembly_gap 14315..14452 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15022..15753) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118407.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 assembly_gap 15870..16027 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16040..16480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(16601..17077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30310 assembly_gap 17126..17245 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 17635..17782 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence114 source 1..18181 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 147..298 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 448..738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30320 assembly_gap 789..882 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 965..1981 product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 assembly_gap 2757..2924 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2941..4065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 4214..4975 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 4968..5519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS 5618..8269 product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615489.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS 8266..9687 product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921968.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 tRNA 9905..9978 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(10036..11241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(11796..11969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30400 assembly_gap 12074..12225 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12341..12511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(12749..12913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(12914..13861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(14098..16485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(16473..16880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30450 assembly_gap 16944..17052 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence115 source 1..18145 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1682..1936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(2193..3992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(4393..5385) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618875.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(5549..6037) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615468.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 gene rpiB CDS complement(6363..7103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS 7557..9053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(9218..10027) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845492.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS 10431..12986 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(13027..14028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 14436..15386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 15459..15785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119559.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(16066..17475) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610677.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene murF misc_feature complement(17498..>18145) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057081.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase locus_tag LOCUS_30580 sequence116 source 1..18121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(364..1206) product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121456.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 1496..3232 product DUF1598 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435082.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 3744..5291 product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973343.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 assembly_gap 5921..6103 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6119..7657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS complement(7917..9044) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503660.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 gene citZ CDS 9099..9332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(9225..10172) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921953.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene xerD CDS complement(10436..11371) product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334279.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS 11802..11999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(12048..12443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(12512..14122) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405091.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 gene pckA assembly_gap 14844..14920 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 15001..16266 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921570.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 16483..16719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30710 sequence117 source 1..18095 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 213..316 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(466..675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(876..1715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30730 assembly_gap 2321..2488 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2599..2808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 2884..3225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS 3839..5251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS 5755..6363 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986377.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 gene lexA CDS 6607..8100 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922314.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 assembly_gap 8131..8253 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8359..9717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(9851..10330) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660073.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(10337..10741) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210424.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 gene mutT CDS complement(10839..11369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30820 assembly_gap 11378..11480 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11685..13763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 14044..14925 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS 15024..17180 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325413.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 gene ftsH assembly_gap 16434..16564 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 17240..17442 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 17673..17826 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence118 source 1..17793 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 350..703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS 963..3146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS 3420..3818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 3818..4423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 4447..5742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30900 assembly_gap 5976..6045 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6215..8416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS 8445..11432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS 11486..12961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS 13006..13842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS 13866..14684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS 14772..15611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30960 assembly_gap 16835..17105 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17435..17629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30970 sequence119 source 1..17765 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 420..619 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 786..909 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 946..1182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS 1287..1676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS 1792..2238 product molybdate metabolism regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921610.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 2370..3893 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615477.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 assembly_gap 3744..3817 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3886..5118 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS 5115..8222 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 assembly_gap 8504..8755 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9352..10119) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900356.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(10201..10707) product DUF1569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123026.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(11170..11388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 11278..12564 product MBOAT family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035887521.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 12688..13830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 13920..14258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(14787..16154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31100 assembly_gap 16441..16537 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 16992..17130 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 17296..17557 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence120 source 1..17625 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 519..1868 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122715.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 assembly_gap 2921..3105 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3647..3752 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4204..8970 product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921683.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 assembly_gap 5788..5894 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8994..10388) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121615.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(10491..12218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(12247..12777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 assembly_gap 12884..12990 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13776..14027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS 14298..14654 product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324538.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 assembly_gap 15201..15334 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 15998..16143 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16591..17559 product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328629.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 assembly_gap 17001..17088 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence121 source 1..17561 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31190 assembly_gap 406..746 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1285..1794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS complement(1912..2757) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328056.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(2847..3215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31220 assembly_gap 3216..3317 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3752..5053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(5167..6141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31240 assembly_gap 6158..6352 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7086..7237 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7456..7747 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7773..9911) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(9911..11017) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123514.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS complement(11323..11664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 12138..12587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(12594..13424) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207902.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS complement(13441..14133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31300 assembly_gap 14160..14301 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14562..16784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615391.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 assembly_gap 17057..17213 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence122 source 1..17511 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(112..1110) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 tRNA complement(1363..1436) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 1812..2615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 assembly_gap 3660..3810 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4086..4270 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4307..4468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS complement(4627..5631) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120806.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 assembly_gap 5689..5811 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6070..6298 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6939..7070 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7073..7954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(8029..8880) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329162.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS 9254..10573 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922160.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 assembly_gap 10760..10890 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 11529..11674 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12026..13063 product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS complement(13164..14342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(14448..15575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS complement(15732..16790) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS complement(16965..17225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31430 sequence123 source 1..17336 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 426..576 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 609..992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 1081..2148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 2242..3150 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 assembly_gap 3182..3402 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3436..4278 product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211996.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 assembly_gap 4310..4484 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4567..5283 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120828.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 5280..5714 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 assembly_gap 5867..5989 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6338..6440 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6794..7702 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 assembly_gap 8286..8419 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8449..8790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31510 assembly_gap 8996..9211 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10286..10411 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10420..10572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS complement(10590..11699) product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122777.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene hemG assembly_gap 11741..11835 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 11963..12101 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12288..13358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(13515..13886) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008656289.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS complement(13883..15271) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS complement(15346..16026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 16233..16949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260192.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 sequence124 source 1..17237 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(42..182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31590 assembly_gap 230..347 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1314..4394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS complement(4739..5884) product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073077526.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 assembly_gap 6930..7065 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7179..7871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 8152..9915 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262483.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS 9970..10968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS 10979..11926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329547.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS 12019..12993 product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121256.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS complement(13184..15739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(15822..16190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(16392..16559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 sequence125 source 1..17223 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 284..451 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(654..1436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS complement(1499..1729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 1875..2054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31720 assembly_gap 2126..2367 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2544..4997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31730 assembly_gap 4832..4957 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5307..7904) product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530161.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(7905..8726) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122379.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 assembly_gap 8024..8085 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8732..9106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975153.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS complement(9116..9646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 assembly_gap 9737..9832 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10145..10687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(10684..12069) product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042159660.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS complement(12472..15348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31800 assembly_gap 15367..15512 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15800..16294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(16912..17109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31820 sequence126 source 1..16957 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 387..971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31830 assembly_gap 1255..1327 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1470..2258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31840 note possible pseudo, internal stop codon CDS 2280..2594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31850 assembly_gap 2702..2869 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2942..3178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 3778..3981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(4029..4391) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330019.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(4616..7522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS 8988..9542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS 9708..11363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(11394..11681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31920 assembly_gap 11698..11868 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 12236..12385 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 12687..12862 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13275..14180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(14486..15880) product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 assembly_gap 15918..16040 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 16600..16808 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence127 source 1..16914 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1270..1848 product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143802.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS 2033..2674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS 2882..3874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640454.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS 3982..4530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS complement(4581..5429) product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920840.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 gene larE CDS 5581..7485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 7661..8791 product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266588.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene thiO CDS 8878..10095 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007445862.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 assembly_gap 10194..10309 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10691..10863 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10983..11438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS 11448..12290 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS 12613..13995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32050 assembly_gap 13890..13977 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13979..14296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 14514..15185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340960.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 assembly_gap 15269..15427 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 15464..16876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921376.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 sequence128 source 1..16884 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1486..2190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS 2190..3203 product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456968.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene epmA CDS complement(3390..4067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS complement(4137..4778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(4778..5017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(5465..6364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32140 assembly_gap 6443..6530 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6879..7067 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7170..8171 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266745.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(8212..9846) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123091.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS 10079..10306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146535257.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS 10337..11812 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922160.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 11855..12781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS 13096..14946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 14998..15585 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122524.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(15722..16654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32220 sequence129 source 1..16678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 270..1331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(1596..2129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(2209..2589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS complement(2612..3586) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921857.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 3960..4226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS complement(5558..5788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32280 assembly_gap 6020..6284 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6429..6726 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6880..7144 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7201..7542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 assembly_gap 7562..7891 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9011..9751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS complement(10081..11118) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262953.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS complement(11141..12049) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124007.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(12214..13980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32330 assembly_gap 14201..14332 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15219..15839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(16063..16302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32350 sequence130 source 1..16580 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 413..538 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 972..1081 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1652..1762 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1857..2528) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057788.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 assembly_gap 2962..3088 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3118..4152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS 4274..5050 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266475.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 5337..7184 product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816805.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 7270..8616 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 assembly_gap 8228..8275 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 8708..8822 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9102..10631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS complement(10770..11441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS 11635..12204 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219860.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 12568..13965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS 14231..14920 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 15032..15832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 assembly_gap 15905..16076 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence131 source 1..16512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 298..361 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 370..1101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32470 assembly_gap 1117..1336 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1392..1610) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219727.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 gene csrA assembly_gap 1863..1970 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2032..2430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32490 assembly_gap 2436..2552 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2829..3041 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3280..3442 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5263..5760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS complement(5796..7004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS 7452..7742 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326150.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene rpsT CDS 7914..8339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS 8444..9229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS complement(9315..10613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(10628..12205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS 12506..13411 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328287.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene map CDS 13624..14592 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324266.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS 14963..16108 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 assembly_gap 16169..16325 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence132 source 1..16375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(782..856) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(922..2010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS complement(2179..2814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS complement(2878..3351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(3314..4036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32630 assembly_gap 3360..3426 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4249..4836) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812221.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(4863..5660) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667138.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS complement(5782..5997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS 5984..7498 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427734.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS 7691..8575 product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246467.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 gene mmuM CDS 9129..14021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 assembly_gap 14773..14889 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14903..15838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32700 assembly_gap 15862..15956 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence133 source 1..16366 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 1047..1120 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1294..2583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32710 assembly_gap 2713..2968 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3281..4384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS 4443..5522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32730 assembly_gap 5602..5780 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5864..6925 product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615657.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS complement(6989..7687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32750 assembly_gap 7762..7875 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8815..9483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32760 assembly_gap 9643..9807 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9892..11169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS 11382..11723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32780 note possible pseudo, frameshifted CDS 11740..11970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS 11977..12171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS complement(12415..13608) product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922962.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 assembly_gap 13623..13746 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13914..16229) product PA14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122548.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 sequence134 source 1..16220 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(252..4670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(5347..6660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(6707..7969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(8148..9704) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101636.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene dnaK assembly_gap 8808..8863 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9875..13447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(13657..14007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS complement(15144..15503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(15544..16161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32900 sequence135 source 1..16216 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 602..1240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS complement(1837..2292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32920 assembly_gap 2969..3120 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3546..4277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS 4408..4941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32940 assembly_gap 5139..5199 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 5762..5895 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6170..6260 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6576..7967 product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615810.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS 8132..9955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32960 assembly_gap 10935..11124 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 11347..11493 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11502..11804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32970 assembly_gap 11877..12051 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12958..13992 product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261424.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS complement(14094..14900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS 15170..15895 product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122175.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 sequence136 source 1..16203 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 313..461 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 711..1133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS 1760..3007 product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS 3165..4178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(4194..5609) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123577.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS complement(5920..6696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33050 assembly_gap 6793..6953 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8344..9036 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546261.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 gene tsaB CDS complement(9051..9632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS complement(9688..10329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS 10491..11498 product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327113.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(11581..12903) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339900.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS 13192..14661 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119613.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS 14932..15417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS 15454..15948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33130 assembly_gap 15953..16050 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence137 source 1..16077 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(272..1267) product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208809.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS complement(1578..2846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS complement(2914..3135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(4325..5242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS 5376..5891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS 6303..6566 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038339.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS 6780..7847 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328933.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene prfA CDS 7984..8889 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122233.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 gene prmC assembly_gap 8959..9068 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9488..9618 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9963..10135 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10162..10704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33220 assembly_gap 10774..10888 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11283..12998 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121776.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 gene aspS CDS 13171..13530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS complement(13556..13828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS complement(13828..14040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS complement(14143..14907) product protocatechuate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922892.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 assembly_gap 15693..15778 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence138 source 1..15933 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 134..416 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 619..895 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1074..1250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(1229..1534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS complement(1713..2021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS complement(3128..4984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS complement(5431..7296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33320 assembly_gap 7298..7369 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7919..8584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33330 assembly_gap 8722..8823 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9935..10130 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10365..10534 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12910..13119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33340 assembly_gap 13138..13314 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 13524..13682 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 14613..14711 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 15305..15448 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence139 source 1..15913 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1028..2455) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921402.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS 2993..3688 product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(4206..5114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS complement(5362..5934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33380 assembly_gap 5960..6065 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6638..6764 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7117..7722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS complement(7770..8915) product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122678.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS complement(9159..9512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33410 assembly_gap 10182..10248 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10735..12033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS 12201..12632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS 12690..13637 product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337669.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 13765..15159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS complement(15250..15741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33460 sequence140 source 1..15864 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 320..417 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 835..946 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 988..1539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33470 assembly_gap 1628..1735 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1845..3479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33480 assembly_gap 3542..3628 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4061..4239 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4662..4835 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 5526..5712 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6192..6440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 assembly_gap 6512..6598 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7400..7550 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7683..9242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33500 assembly_gap 8855..8905 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9268..9425 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9636..10094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(10110..10346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS complement(10628..11815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS complement(11805..12344) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921996.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS complement(12566..13609) product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203529.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 assembly_gap 14028..14212 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14244..15554) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118969.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 gene xylA sequence141 source 1..15819 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 153..731 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324462.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 gene def assembly_gap 1234..1340 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2475..2593 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3230..3435 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3786..3886 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3979..4461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS 4597..7080 product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037247075.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 assembly_gap 7129..7229 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7324..8769 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120117.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 9032..10507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS 10520..11575 product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331752.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(11707..12609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(13086..14480) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(14541..14915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(14972..15508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33660 assembly_gap 15532..15660 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence142 source 1..15717 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 219..393 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 822..951 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1270..1399 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1567..2892 product putative sugar nucleotidyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256908.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 assembly_gap 2361..2462 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3276..3368 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3379..4392 product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(4547..4954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(5015..6046) product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615947.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS 6208..6768 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846080.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene pyrE CDS 7026..8342 product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676943.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS complement(8555..9469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(9532..11595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33740 assembly_gap 10715..10804 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 11637..11728 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11805..12512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33750 assembly_gap 12629..12769 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12896..13690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(14084..14317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33770 assembly_gap 15380..15511 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence143 source 1..15623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(29..532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33780 assembly_gap 622..793 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2990..3137 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3167..5104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS complement(5389..7293) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119431.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS 7741..8709 product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616218.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS 8811..9866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33820 assembly_gap 10708..10854 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10881..11369) product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119987.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 gene lptE CDS complement(11505..13100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS complement(13279..13494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33850 assembly_gap 13508..13596 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13946..14137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33860 assembly_gap 14439..14540 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 15420..15498 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence144 source 1..15484 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(166..1833) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667792.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS complement(2091..3575) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140024.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(3568..5700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS complement(5890..8499) product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667788.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS complement(8556..10127) product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921384.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS 10324..10809 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118223.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS 10806..11000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS complement(11071..12696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS complement(12693..13190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS complement(13296..14372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33960 assembly_gap 14492..14611 estimated_length known gap_type within scaffold linkage_evidence paired-ends misc_feature complement(14952..>15484) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008666047.1:PSD1 and planctomycete cytochrome C domain-containing protein locus_tag LOCUS_33970 sequence145 source 1..15457 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(760..1071) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089739.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 gene fliN CDS 1741..1968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS 2136..2405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS complement(2509..2802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS complement(2868..4751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS 5902..7110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS complement(7214..7579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS complement(7894..8265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34050 assembly_gap 9176..9320 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9427..9594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS complement(9833..10312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS complement(10368..10790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34080 assembly_gap 10857..11001 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11036..11275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34090 tRNA complement(11439..11515) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 assembly_gap 11556..11735 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12159..12479) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS complement(12768..13124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34110 assembly_gap 13362..13442 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14363..15334 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260939.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 gene hemC sequence146 source 1..15453 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(161..415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34130 assembly_gap 449..573 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1057..2088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS complement(2082..3008) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263515.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS complement(3005..3409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34160 assembly_gap 3498..3637 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4108..5001) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120923.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS complement(5114..6166) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS complement(6519..7523) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123048.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS 7688..9367 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920950.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS 9503..11770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS 12274..15201 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 gene ppc assembly_gap 12613..12814 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence147 source 1..15419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 203..450 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 642..838 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1100..1399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS complement(1410..1757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS 2131..3561 product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 3798..4814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS 4911..5993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS complement(6172..6816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS complement(6954..7532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS 8064..9269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS 9318..9815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS 10410..12020 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921618.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS 12050..12940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS 13057..14763 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921498.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 assembly_gap 13110..13240 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14797..15300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34350 sequence148 source 1..15364 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 1134..1195 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1970..3121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS complement(3116..4270) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120981.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 gene mnmA CDS complement(4410..4661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS 6227..8797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS 9064..9693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS complement(9690..10016) product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945958.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS 10449..13343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS 13614..15302 product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 sequence149 source 1..15245 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 245..3685 product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121181.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 assembly_gap 3509..3680 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3898..6333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS complement(6380..7306) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121111.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene thiL CDS 7378..8799 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140350.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 assembly_gap 9588..9759 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9835..10203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS 10117..12585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34490 assembly_gap 12706..12818 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13062..13880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34500 note possible pseudo, frameshifted sequence150 source 1..15232 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(19..897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS complement(1089..2417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS complement(2740..3477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS complement(3760..4485) product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325025.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS 4722..7211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34550 assembly_gap 7040..7207 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7387..8883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS 9005..9379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(9638..10603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS 10827..11612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34590 assembly_gap 11747..11934 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 12302..12389 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12656..14062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS complement(14079..15068) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615481.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 gene tilS sequence151 source 1..15115 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 169..372 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 770..864 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1589..1896 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2104..2336 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3016..3217 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3592..3722 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4728..4918 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 5136..5286 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5381..6211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS 6648..7373 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326459.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 assembly_gap 7538..7669 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8593..8880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS complement(9211..10413) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190627.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS complement(11186..11569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS complement(11969..12319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(12328..12546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS complement(12857..14308) product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615810.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 assembly_gap 14442..14581 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence152 source 1..14779 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1314..1622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34700 tRNA complement(1832..1917) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 2211..4286 product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS complement(4380..5195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS complement(5418..6761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34730 assembly_gap 6795..6904 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7496..8512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34740 assembly_gap 7507..7569 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 8626..8725 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8979..10760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS complement(10878..11174) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329447.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 assembly_gap 12828..13017 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 14190..14310 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14368..14712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34770 sequence153 source 1..14756 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(127..1119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34780 assembly_gap 1410..1572 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1657..1989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34790 assembly_gap 2068..2219 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2684..2905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34800 assembly_gap 3047..3172 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3509..7750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34810 assembly_gap 4966..5010 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7856..8638) product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS 9042..10019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS 10117..13731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS complement(13807..14190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS complement(14209..14550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34860 note possible pseudo, internal stop codon sequence154 source 1..14497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 138..407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(1045..1443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS complement(1577..2350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS complement(2394..4028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS complement(4085..5209) product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921506.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS 6124..6915 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399684.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 gene rlmB CDS complement(6950..8557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS 8707..8883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS complement(8889..9095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS 9015..9365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS 9592..10713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34970 assembly_gap 10988..11177 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 11486..11634 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11758..11916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34980 assembly_gap 12075..12157 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12252..12713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS complement(12832..13020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS complement(13124..13336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35010 assembly_gap 14095..14323 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence155 source 1..14322 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 215..1771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS 1870..4980 product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615874.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS complement(5170..6591) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123376.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS complement(6576..7601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS 8457..9752 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS 9815..11959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS 12028..14307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35080 sequence156 source 1..14313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(11..517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS complement(771..1682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35100 assembly_gap 1896..2034 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2215..2757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS 3019..3531 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531462.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS complement(3836..5338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS 5650..6147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS complement(6506..7972) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122596.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS complement(7979..11305) product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 assembly_gap 8879..9011 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12275..12658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS complement(12689..12886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35180 assembly_gap 13641..13760 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence157 source 1..14195 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 253..624 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 gene rpsL CDS 687..1160 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326864.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 gene rpsG CDS 1304..1684 product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943630.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS 1806..2507 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122007.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS 2526..4115 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS 4115..5020 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122009.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS 5061..7019 product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615420.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 assembly_gap 7704..7859 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8269..8751) product YfbM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061753.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 assembly_gap 8752..8886 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA complement(9434..9507) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 9660..10490 product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 assembly_gap 11235..11345 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11388..11930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS complement(12014..13081) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140702.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS complement(13078..13872) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 sequence158 source 1..14157 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(210..1574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS complement(1607..2350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(2374..2634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35330 note possible pseudo, frameshifted CDS complement(3228..3962) product IS5-like element ISMac15 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065538.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS complement(4330..7947) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814813.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 assembly_gap 7978..8100 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 8883..9007 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9383..11287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS complement(11446..12267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35370 assembly_gap 12278..12381 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12383..13936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35380 sequence159 source 1..13893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 509..608 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1116..1256 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1343..1789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS 1954..2331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35400 assembly_gap 2470..2595 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2711..3181 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS 3571..3891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS complement(3962..4873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35430 assembly_gap 4984..5080 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6076..6206 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6264..7043 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS 7078..8001 product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357252.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 gene ptb CDS 8026..8442 product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455485.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(8465..12271) product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921330.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS complement(12617..13528) product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141082.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS complement(13513..13794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35490 note possible pseudo, frameshifted sequence160 source 1..13813 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 170..262 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(338..802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35500 assembly_gap 931..1045 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1741..1938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS complement(2217..5222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS 5714..6325 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121917.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 assembly_gap 6849..6961 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6967..9993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 10451..11722 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113306.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS complement(11873..12571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS complement(12574..13092) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 gene rpoE assembly_gap 13199..13279 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence161 source 1..13705 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(19..441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS complement(473..1498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35590 assembly_gap 477..563 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1850..1958 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2127..3830 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922486.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 gene ilvD CDS 3820..4860 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241535.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS 5008..7122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35620 assembly_gap 7153..7327 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7367..8359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35630 assembly_gap 8412..8559 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8959..9927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS 10555..11343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS 11671..12942 product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880955.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 assembly_gap 13248..13375 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence162 source 1..13561 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 128..256 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1090..1239 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1263..1889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS 1932..2291 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS 2318..3130 product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297973.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 gene dinD CDS 3193..4254 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873440.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS complement(4526..5782) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122402.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS 6036..7802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS 7954..9324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35730 assembly_gap 9819..9891 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9987..10646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35740 assembly_gap 10769..10939 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11122..12030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS complement(12093..12539) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120861.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 assembly_gap 12571..12647 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13033..13527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35770 sequence163 source 1..13554 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 623..1630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS 1872..2528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS 2807..2971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS 3332..4816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS complement(5041..6297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS complement(6399..7625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS complement(7686..7874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS 7961..9133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS complement(9181..10206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(10285..11028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35870 assembly_gap 11155..11310 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 11577..11764 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 11956..12152 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 13073..13172 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence164 source 1..13502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(784..1830) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061017.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS 2330..3586 product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777076.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS 3831..4640 product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927030.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 gene hisN CDS 4704..6236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35910 assembly_gap 6086..6232 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6334..6867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS 6926..7984 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975709.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS 8174..8518 product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326696.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS 8561..9271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS 9399..10670 product Trx7/PDZ domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922213.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS complement(10695..12269) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 assembly_gap 13140..13310 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence165 source 1..13415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(921..2399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS 3131..3769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS 3897..5864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS complement(5902..6126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS 7400..7825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS 8044..8868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS 9161..10684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36040 assembly_gap 10473..10603 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 11086..11184 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11351..12958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36050 assembly_gap 12071..12185 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 13057..13211 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence166 source 1..13324 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(102..764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS 988..2448 product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816379.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(2541..4544) product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119585.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(5254..5415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS 5398..7605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36100 assembly_gap 7371..7544 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7599..8342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS 8339..9787 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122596.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS complement(9927..11135) product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121299.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 assembly_gap 12654..12766 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence167 source 1..13228 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(162..2105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS 3685..5607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS complement(6115..6312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS 7081..7803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS 8924..9265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS 9278..10447 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922784.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS 10508..11026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119839.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS 11027..12661 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119838.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 sequence168 source 1..13175 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 384..496 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1037..1235 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1263..2261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36220 assembly_gap 2407..2500 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2564..2842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36230 assembly_gap 2934..3079 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3955..4062 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4536..6011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS complement(6300..7046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS complement(7058..7990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS complement(8280..9173) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427744.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS complement(9412..10080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS complement(10267..10599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS complement(10670..10987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36300 assembly_gap 11052..11216 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12344..12928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36310 sequence169 source 1..13160 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(857..1420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS complement(1574..1990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS complement(1991..2215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS complement(2673..3038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS 3037..3165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS complement(3336..3587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36370 note possible pseudo, internal stop codon CDS complement(3624..3803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36380 note possible pseudo, internal stop codon CDS complement(3948..6494) product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918869.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS complement(6716..7174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS complement(7248..8231) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS complement(8516..9709) product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324978.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS 10047..11360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS 11414..12181 product BPL-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336892.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS 12272..12997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36450 sequence170 source 1..13118 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 306..433 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 810..979 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1345..3012 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324371.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 assembly_gap 2877..2970 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2978..3361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS 3544..4401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS 4684..6135 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS 6281..7318 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS complement(7397..8728) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123371.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 assembly_gap 8906..9072 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9110..9436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36520 assembly_gap 9454..9611 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10348..10788 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 assembly_gap 11573..11747 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 12211..12287 estimated_length known gap_type within scaffold linkage_evidence paired-ends misc_feature complement(12345..>13118) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120422.1:phosphoribosylformylglycinamidine synthase subunit PurL locus_tag LOCUS_36540 sequence171 source 1..13116 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(28..504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36550 assembly_gap 582..750 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1023..1076 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2539..2725 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3003..3179 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3310..4161 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS 4526..5296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS complement(5866..7413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS complement(7707..8417) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480398.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS complement(8580..9491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS 9732..10778 product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922462.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS 11100..11747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36620 assembly_gap 12148..12219 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 12568..12690 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence172 source 1..13063 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 313..1551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS 1707..3029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS 3040..4338 product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120135.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS 5197..6306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS 6852..7394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS 7885..8397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS 8614..8865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS 9879..11072 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921573.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS complement(11142..11345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS complement(11485..12717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36720 sequence173 source 1..13040 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1179..1934 product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921816.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS 2644..3753 product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065824.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS complement(3815..4231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS complement(4623..7247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS 7840..8337 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488386.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 gene ispF CDS 8347..8841 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120029.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 gene ruvC CDS 8885..9511 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326966.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS 9556..10548 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS 10733..11323 product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296608.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS 11353..12081 product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972295.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS 12398..12961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36830 sequence174 source 1..12971 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(48..2999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36840 assembly_gap 254..406 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3119..3310 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3333..3623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36850 assembly_gap 3802..3973 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4059..4667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS 4866..6311 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 assembly_gap 6403..6523 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6732..6910 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8163..8708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36880 assembly_gap 8766..8915 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9777..10640) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255294.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 assembly_gap 10797..10990 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11121..11528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36900 assembly_gap 11544..11667 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 11889..12028 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 12468..12637 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence175 source 1..12945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 875..2353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS 2773..3486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS 3534..5006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36930 tRNA complement(5089..5162) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 5498..5704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS complement(5670..5879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS 6738..8210 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963189.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS 8207..8917 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730515.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS 8883..9296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS 9412..9780 product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS 9792..10283 product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271000.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS complement(10288..11871) product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081614227.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 tRNA complement(12114..12184) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 sequence176 source 1..12840 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 264..1562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS complement(1699..2043) product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941930.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(2231..3355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS complement(3444..4163) product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038927.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS complement(4507..5115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37060 assembly_gap 5202..5303 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5442..6002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS 6470..7288 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS complement(7481..8029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329453.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS complement(8622..9776) product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329274.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS 10455..10922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS 11137..12777 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326392.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 gene serA sequence177 source 1..12736 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 454..722 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 767..1093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37130 assembly_gap 1160..1352 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1578..2591) product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162996.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS complement(2808..4232) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 assembly_gap 4681..4794 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4988..6898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS complement(6895..7770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37170 assembly_gap 7796..7910 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 8351..8646 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9293..9685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37180 assembly_gap 9708..9797 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10305..10468 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10599..11024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37190 assembly_gap 11135..11283 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11426..12664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37200 sequence178 source 1..12469 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 362..958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS complement(1032..2138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS complement(2362..6360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS complement(6354..8615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37240 assembly_gap 6372..6472 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence179 source 1..12463 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1319..2473) product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122758.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS 2733..2957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS 2954..5245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37270 note possible pseudo, internal stop codon assembly_gap 5477..5588 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5635..7770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37280 assembly_gap 7561..7716 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence180 source 1..12442 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 1056..1193 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1248..1547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37290 assembly_gap 1628..1872 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1944..2960) product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667541.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 assembly_gap 2993..3126 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3708..4217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615841.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS 4274..6088 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123401.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS complement(6125..6460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37330 assembly_gap 6598..6757 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7916..8578 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769285.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS 8708..10309 product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399332.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 gene dhaS assembly_gap 10070..10148 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10423..10567 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10823..11428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS 11545..11748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS 11859..12227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37380 sequence181 source 1..12278 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 301..484 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 861..1022 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1324..1857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37390 assembly_gap 1895..2020 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2281..2491 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2875..4014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921966.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS complement(4251..4469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37410 assembly_gap 4839..4975 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5484..6989 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081401.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 gene hslU assembly_gap 5819..5924 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7029..7297 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7451..8719 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921846.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS complement(8721..9584) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 assembly_gap 9812..10049 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10090..10935) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085059.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 assembly_gap 11034..11103 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11347..11796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37460 assembly_gap 11797..11945 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence182 source 1..12159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1256..1978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS 2076..2414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS 2465..3727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS 3813..5495 product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS 5710..5859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS complement(5892..7298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37520 assembly_gap 7509..7659 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 8107..8201 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8245..8562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS 8687..9904 product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 assembly_gap 9574..9666 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9993..10172 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10417..11988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37550 sequence183 source 1..11962 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 271..523 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(566..850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37560 assembly_gap 904..1076 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1496..1586 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1972..3897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37570 assembly_gap 2055..2235 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4054..4446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS 4842..6446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS complement(6500..7639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37600 assembly_gap 7973..8167 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 8294..8532 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8572..9927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37610 assembly_gap 11317..11475 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence184 source 1..11732 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 199..364 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1016..1075 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1112..3778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS complement(4436..5647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS complement(5889..9182) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427773.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 gene mfd assembly_gap 6447..6577 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9216..9390 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9706..9868 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9937..11031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682355.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 sequence185 source 1..11724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(247..1896) product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122614.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS complement(2032..2496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS complement(2486..3403) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615454.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS 3761..3940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS complement(4014..4778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS 5337..6830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37710 assembly_gap 7016..7146 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7280..7912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS complement(8104..8271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS 8828..11671 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922184.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 gene gyrA sequence186 source 1..11685 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(168..1988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS 2562..4055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS complement(4095..5138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS complement(5131..5745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS complement(5745..9605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS complement(9966..10889) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505073.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 sequence187 source 1..11435 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(80..1993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS 2526..2828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS complement(3072..3992) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 assembly_gap 4167..4292 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4706..4806 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5365..6099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37840 assembly_gap 6266..6460 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6630..6810 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7131..7211 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7524..8684) product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 gene gdhA assembly_gap 8690..8824 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9160..10782 product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922119.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 assembly_gap 9786..9862 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10845..11336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37870 sequence188 source 1..11367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 160..383 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(445..1197) product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922990.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 gene lpxI assembly_gap 1261..1430 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1574..2674) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922341.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene lpxD CDS complement(3294..4343) product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065417.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 gene thiF CDS 4644..4997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS 5163..5729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS 5726..5890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS 6013..6876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37940 assembly_gap 6037..6082 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7495..7569 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 8535..8616 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8758..9618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37950 assembly_gap 10598..10768 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10833..11111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37960 sequence189 source 1..11176 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 206..286 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 853..972 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1376..2257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS complement(2251..2781) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809919.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS complement(2848..3105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS 3965..4180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38000 assembly_gap 5453..5558 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7336..8748) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS complement(9292..9501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38020 sequence190 source 1..11100 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 10..1236 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 gene ahcY assembly_gap 1541..1598 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2880..3052 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3512..4036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS complement(4160..5506) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122601.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS complement(5971..7314) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122601.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS complement(7747..9228) product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS complement(9369..9713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38080 assembly_gap 10592..10770 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10778..11029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38090 sequence191 source 1..11092 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(43..2073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS complement(2137..2544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38110 assembly_gap 2579..2723 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3131..3319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38120 assembly_gap 3435..3561 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3658..5049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38130 assembly_gap 5295..5424 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 5628..5830 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6579..6715 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7123..7246 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7492..7621 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7690..8895 product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169830.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS 9326..10444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38150 note possible pseudo, frameshifted assembly_gap 10602..10757 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence192 source 1..10991 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 1087..1193 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1627..1887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38160 assembly_gap 1977..2082 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2211..2645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS complement(2859..3578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS complement(3608..5905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38190 assembly_gap 3902..3977 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5929..6390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS complement(6409..6750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS complement(6935..7126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS 7448..7996 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331069.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 assembly_gap 8786..8883 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8906..9262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS 9329..9634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38250 assembly_gap 10203..10325 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10526..10676 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence193 source 1..10988 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(5189..6058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS complement(6594..6830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38270 assembly_gap 6888..7107 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7177..7608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38280 assembly_gap 7654..7768 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7882..8106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS complement(8103..8537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS complement(8619..8999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS complement(9075..10832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38320 sequence194 source 1..10943 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..771 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119651.1:sodium:solute symporter family protein locus_tag LOCUS_38330 tRNA 949..1021 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(1296..3599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38340 assembly_gap 3685..3828 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4131..4258 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4776..6191 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615621.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 assembly_gap 7979..8150 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8390..8818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38360 assembly_gap 9038..9337 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9833..9979 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence195 source 1..10920 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(48..290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS complement(777..1649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS complement(1961..2611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38390 assembly_gap 3690..3810 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4042..4225 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4559..4703 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 5181..5365 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 5688..5845 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6593..6792 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7152..7269 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7846..7938 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8020..9354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS 9724..10308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38410 assembly_gap 10547..10723 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence196 source 1..10854 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 146..386 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 775..1176 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327186.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS complement(1274..2068) product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942965.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 assembly_gap 2194..2333 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2401..2643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38440 assembly_gap 2832..3028 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3276..3476 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3913..4069 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5082..6377 product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615817.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS 6574..8541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS complement(8922..9125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS complement(9664..10161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38480 assembly_gap 10362..10466 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence197 source 1..10792 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 101..1033 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335393.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS 1316..3259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS 3507..4400 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772094.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 gene ispE CDS 4424..5095 product SpoVG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122807.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 CDS complement(5348..7123) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057111.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS 7349..8380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS 8447..9883 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460525.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 gene rsmB assembly_gap 9914..10002 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10405..10529 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence198 source 1..10745 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2798..4117) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS complement(4191..5201) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933029.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 assembly_gap 5274..5486 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5586..7388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38580 assembly_gap 7555..7760 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7787..9274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS complement(9295..10263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38600 sequence199 source 1..10721 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 327..414 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1181..1317 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1405..2034) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142877.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 assembly_gap 2794..2993 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3323..3404 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3688..3856 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3993..5696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38620 assembly_gap 5724..5946 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6141..7451 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922096.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 CDS 7435..7902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38640 assembly_gap 8100..8259 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8312..10219 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906399.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 gene asnB sequence200 source 1..10709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 421..1761 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921564.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS complement(1783..3492) product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332180.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS complement(3807..7748) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072251.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 gene hrpA CDS complement(7888..8325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38690 assembly_gap 8369..8511 estimated_length known gap_type within scaffold linkage_evidence paired-ends misc_feature complement(9757..>10709) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007325434.1:TlpA disulfide reductase family protein locus_tag LOCUS_38700 sequence201 source 1..10628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..843 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326816.1:preprotein translocase subunit SecY locus_tag LOCUS_38710 CDS 1039..1827 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 gene map CDS 2576..2962 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123828.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 gene rpsM CDS 3132..3515 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328401.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 gene rpsK CDS 3615..4634 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328400.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS 4815..5504 product L17 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123829.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS complement(5654..7174) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 gene cobA CDS 7549..9450 product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327661.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 gene ilvB assembly_gap 7946..8046 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9754..9854 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10043..10387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38790 sequence202 source 1..10500 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38800 assembly_gap 462..539 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 591..1982 product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921646.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS complement(2006..2509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS 2698..2901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS 2898..3248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS complement(3377..5317) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123461.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS complement(5314..5568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS 5801..6289 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 gene tsaE assembly_gap 7069..7200 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7945..8150 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8510..10462 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976178.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 gene asnB sequence203 source 1..10481 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..927 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404993.1:TrkH family potassium uptake protein locus_tag LOCUS_38890 CDS 960..1616 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037344.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS complement(1919..3400) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922489.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS complement(3593..4630) product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 assembly_gap 5177..5356 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5386..7386) product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921313.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 assembly_gap 5583..5759 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8089..8376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS complement(8419..9174) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090604.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS complement(9265..9978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38960 assembly_gap 10006..10209 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence204 source 1..10466 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(259..3561) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340662.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 gene rpoB assembly_gap 308..493 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4080..4565) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324459.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 gene rplL CDS complement(4611..5186) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324458.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 gene rplJ assembly_gap 4929..4981 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5269..5589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39000 assembly_gap 5880..6004 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6161..6586) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324993.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 gene rplK CDS complement(6684..6902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39020 assembly_gap 6971..7118 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7640..8143) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324991.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 gene secE assembly_gap 8229..8398 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8573..8728) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556991.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 gene rpmG CDS complement(8930..9739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39050 assembly_gap 9778..9965 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence205 source 1..10389 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(58..285) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966860.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS complement(275..772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS 911..1177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS 1209..1901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS complement(2166..3710) product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 assembly_gap 5161..5310 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5393..10090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39110 assembly_gap 7063..7172 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence206 source 1..10273 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3..1379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121732.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS 1636..4074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39130 assembly_gap 3922..4059 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4830..4968 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 5500..5626 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5840..6781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39140 assembly_gap 6820..6996 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7018..7221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS 7240..8796 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921691.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 assembly_gap 9034..9106 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9756..9857 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence207 source 1..10252 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1180..4179) product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146849598.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 assembly_gap 1191..1306 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4273..4442 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4651..6099) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS complement(6166..7896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39190 assembly_gap 6727..6852 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 8022..8136 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9518..9682 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9882..10115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39200 sequence208 source 1..10224 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(362..787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS complement(1313..2296) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337669.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS complement(2324..2752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39230 CDS complement(3178..4797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS complement(4918..10068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39250 sequence209 source 1..9948 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 214..777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS complement(1169..1924) product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672317.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS 2287..3159 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 gene rsmH assembly_gap 3241..3438 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3585..5330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS 5423..5614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39300 assembly_gap 7171..7347 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7430..7663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39310 assembly_gap 7708..7965 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8027..8449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39320 assembly_gap 9165..9335 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9351..9680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS 9739..9921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39340 sequence210 source 1..9853 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 160..336 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 661..797 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1535..1618 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3001..3200 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3350..3547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39350 assembly_gap 5278..5423 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5846..6871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39360 assembly_gap 6886..7032 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7776..7925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39370 note possible pseudo, internal stop codon, frameshifted assembly_gap 8570..8675 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9063..9839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39380 sequence211 source 1..9798 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(182..2008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39390 assembly_gap 2054..2178 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2791..2928 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3532..3693 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3960..4065 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4183..5142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS complement(5489..6775) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118185.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 gene serS assembly_gap 6931..7093 estimated_length known gap_type within scaffold linkage_evidence paired-ends misc_feature complement(7214..>9798) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228544.1:S8 family serine peptidase locus_tag LOCUS_39420 sequence212 source 1..9760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 499..645 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(699..938) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214730.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 gene yidD CDS complement(1327..1758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS complement(1755..2495) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056682.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS complement(2692..2952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39460 assembly_gap 3028..3152 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4301..5740) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922220.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 CDS 6025..7068 product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 gene mtnA CDS 7065..7637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS 8292..9329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39500 assembly_gap 9376..9534 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence213 source 1..9757 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(812..2008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39510 assembly_gap 882..969 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2213..2887) product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121464.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS complement(2985..4508) product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121465.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 gene gcvPB CDS complement(4670..6016) product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331407.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 gene gcvPA CDS complement(6196..6462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39550 assembly_gap 6591..6853 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6989..7375) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222781.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 gene gcvH CDS complement(7471..7914) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122948.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 gene rpiB CDS complement(8043..8249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39580 assembly_gap 8254..8374 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence214 source 1..9451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 314..509 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(661..2073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS 2761..4200 product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616050.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 gene tssK CDS 4197..4838 product DotU family type IV/VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922257.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS 4853..6490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS 6832..7905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS complement(7999..9348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39640 assembly_gap 8114..8219 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence215 source 1..9409 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1735..2103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS complement(2135..2566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093116.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS 2980..5346 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123067.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 assembly_gap 4915..5084 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5459..6256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39680 assembly_gap 6135..6202 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6207..6521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS 6960..7931 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325399.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS complement(8005..8439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39710 assembly_gap 8584..8664 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence216 source 1..9406 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 367..541 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1171..1328 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2466..2653 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3172..3285 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3311..4030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS 4121..4366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39730 assembly_gap 4551..4725 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5062..5826 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966198.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 gene panC assembly_gap 6009..6161 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6230..7342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39750 assembly_gap 7672..7802 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 8097..8289 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 8767..8929 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence217 source 1..9319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 628..710 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 907..1073 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1494..2465 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227916.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS 2452..3180 product PaeR7I family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176598.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS complement(3186..4415) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123718.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS complement(4586..5557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39790 assembly_gap 6273..6458 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6532..7191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS 7313..7585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39810 assembly_gap 8597..8842 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence218 source 1..9264 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(275..634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39820 CDS complement(693..1121) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815299.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 gene rnk CDS complement(1228..1647) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815299.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 gene rnk CDS complement(1660..1920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS complement(2282..3670) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922760.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS complement(3663..4829) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119450.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS 5043..5225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39880 assembly_gap 5681..5808 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5974..6495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39890 assembly_gap 7149..7285 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7431..8909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39900 sequence219 source 1..9153 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..606 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121200.1:GTPase HflX locus_tag LOCUS_39910 assembly_gap 644..795 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 941..2272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39920 assembly_gap 2068..2192 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2644..2825 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2860..3378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39930 CDS complement(3440..3970) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938968.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS complement(3973..7335) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615995.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS complement(7379..7837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS 7981..8877 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 sequence220 source 1..9150 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 313..491 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1243..1470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS complement(2134..2469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS complement(2711..3397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS complement(3539..4102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40010 assembly_gap 4399..4530 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 5108..5267 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 5588..5858 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6078..6500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40020 CDS complement(6634..7071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS complement(7165..8115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS complement(8221..8742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40050 sequence221 source 1..9148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(180..419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40060 assembly_gap 556..649 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1803..2336) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120138.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS complement(3182..4726) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS complement(5042..5806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS complement(6981..7478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS complement(7585..8049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS complement(8283..8777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40120 sequence222 source 1..9107 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(124..810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40130 assembly_gap 876..1005 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1187..1402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS complement(2241..2828) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 assembly_gap 2950..3156 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3233..3961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS 4096..6564 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS complement(6670..8640) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143249.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS complement(8766..9107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40190 sequence223 source 1..9017 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1226..2515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40200 assembly_gap 2583..2752 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2756..3259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS complement(3309..4622) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135617729.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 assembly_gap 3683..3762 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4707..5366) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326621.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 gene purN CDS complement(5626..6390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS 6736..7065 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 gene trxA CDS 7316..8824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40260 sequence224 source 1..8972 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 304..1686 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 gene aroE assembly_gap 1761..1901 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2069..2425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS complement(2537..2992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40290 assembly_gap 3068..3191 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3242..3631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS 3632..3955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS complement(4186..4422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40320 note possible pseudo, frameshifted CDS complement(4449..5300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40330 CDS complement(5374..7404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40340 assembly_gap 5414..5612 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7556..7675 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8001..8867 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145885.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 sequence225 source 1..8964 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(64..492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40360 assembly_gap 933..1073 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1248..3851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40370 CDS complement(4019..4633) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122304.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS complement(4998..8381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40390 sequence226 source 1..8918 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(395..3064) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144156.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 note possible pseudo, frameshifted CDS complement(3061..3537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40410 note possible pseudo, frameshifted assembly_gap 3095..3139 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3646..4917) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207560.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS complement(4914..6401) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444660.1 transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS complement(6865..8385) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545380.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 assembly_gap 7182..7278 estimated_length known gap_type within scaffold linkage_evidence paired-ends misc_feature complement(8382..>8918) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025775002.1:response regulator transcription factor locus_tag LOCUS_40450 sequence227 source 1..8812 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1155..2147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40460 note possible pseudo, frameshifted assembly_gap 2018..2076 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2724..2871 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2912..3112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40470 assembly_gap 3201..3314 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3432..4019) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117887.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS complement(4416..5861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40490 CDS complement(6117..6692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40500 tRNA 7046..7121 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 assembly_gap 8476..8638 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence228 source 1..8788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 384..2675 product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146514631.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 assembly_gap 2500..2591 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2782..4779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40520 CDS 4965..5858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS 5858..6229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40540 CDS 6507..8201 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 assembly_gap 8349..8490 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence229 source 1..8751 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 210..357 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1029..3269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40560 assembly_gap 1105..1209 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4074..4182 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4186..4677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS complement(4678..5058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS complement(5213..6268) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260201.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS complement(6378..6563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS complement(6722..7027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40610 assembly_gap 7222..7330 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 8283..8422 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence230 source 1..8659 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(512..2821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS complement(3012..4355) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 gene nhaA assembly_gap 4512..4653 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4860..5038 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5473..6432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40640 assembly_gap 5486..5571 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6420..8432 product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435048.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 sequence231 source 1..8592 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 386..535 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1630..2535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS complement(2740..4029) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329291.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS complement(4084..4947) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS complement(5107..6381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS 7003..7710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40700 CDS complement(7600..7812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS 7813..8379 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229518.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 sequence232 source 1..8511 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 229..1293 product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122045.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS 1354..1809 product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918945.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS 1943..3190 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390320.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 CDS complement(3290..3964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40760 CDS complement(4190..5077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40770 assembly_gap 5309..5404 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5798..5953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS 6149..6901 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118937.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS 7014..7733 product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333582.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS 7844..8143 product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324356.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS 8184..8489 product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388663.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 sequence233 source 1..8497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(127..960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS complement(1068..2072) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS complement(2128..2859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS complement(3050..4429) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122601.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS complement(4622..5176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921915.1 transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS complement(5332..6039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40880 assembly_gap 6052..6139 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6182..6388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40890 assembly_gap 6572..6688 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7123..7239 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7258..7455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40900 misc_feature complement(7473..>8497) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061304.1:PQQ-binding-like beta-propeller repeat protein locus_tag LOCUS_40910 sequence234 source 1..8489 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 157..386 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1664..3091 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120393.1 transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS complement(3127..3693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40930 assembly_gap 3793..3935 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5038..5802 product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731602.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 assembly_gap 5963..6081 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6641..6680 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7119..7445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40950 assembly_gap 7464..7641 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7911..8234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40960 sequence235 source 1..8451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 207..377 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1803..2225) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118238.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 CDS complement(2661..3074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40980 CDS complement(3061..3984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40990 assembly_gap 3083..3142 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4098..4252 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4411..5331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS complement(5427..5723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS 5677..6999 product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260005.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS complement(7687..8136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41030 sequence236 source 1..8417 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(290..3139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS 3433..4980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS 5112..5645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS complement(5756..6481) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340751.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS complement(6581..7924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41080 assembly_gap 6787..6893 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8166..8324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41090 sequence237 source 1..8382 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 373..563 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(760..1155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920749.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 assembly_gap 1505..1597 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1698..1976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41110 assembly_gap 2220..2367 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3165..4433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS 4582..5322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41130 assembly_gap 5552..5641 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5794..6153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41140 assembly_gap 6420..6507 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7523..7702 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 8002..8152 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence238 source 1..8197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 195..1688 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037254759.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS 1785..2102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41160 assembly_gap 2114..2287 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2445..3119 product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914029.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 gene cobC assembly_gap 3169..3285 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3320..3793 product DUF4112 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089783.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 CDS 4025..6067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41190 CDS 6826..7707 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665981.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS complement(7696..7923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41210 sequence239 source 1..8138 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 743..2413 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028668529.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS complement(2737..6303) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615508.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 sequence240 source 1..8077 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 198..343 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 755..842 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1278..1430 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1781..1915 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1963..2625 product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 assembly_gap 3315..3410 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3472..3885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41250 assembly_gap 4083..4175 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4218..4931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41260 CDS complement(5031..5216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41270 assembly_gap 5988..6144 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6233..6784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41280 assembly_gap 7060..7183 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence241 source 1..8042 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(120..758) product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921887.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS 967..2394 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 CDS 2723..4171 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921286.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS 4332..4670 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325418.1 transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS 4836..7490 product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325417.1 transl_table 11 codon_start 1 locus_tag LOCUS_41330 gene glnD assembly_gap 7698..7887 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence242 source 1..7957 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 232..717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41340 CDS complement(857..1426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41350 CDS complement(1489..2229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41360 CDS complement(2300..2686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41370 assembly_gap 2708..2874 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3123..3704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41380 assembly_gap 3752..3849 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4314..4892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41390 CDS complement(5010..5555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41400 CDS 5890..7863 product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922258.1 transl_table 11 codon_start 1 locus_tag LOCUS_41410 gene tssI sequence243 source 1..7936 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(563..1708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41420 CDS complement(1788..2849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS 3206..4423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41440 assembly_gap 5029..5196 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5231..5500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41450 assembly_gap 5549..5701 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6212..6366 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6572..6781 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7060..7257 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7305..7844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41460 sequence244 source 1..7924 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(61..537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41470 CDS complement(582..1004) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921681.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 CDS complement(1298..2425) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 gene aroC CDS 2832..4022 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS complement(4025..5389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41510 CDS complement(5417..6760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41520 sequence245 source 1..7907 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(174..584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41530 assembly_gap 585..700 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 754..933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS complement(1089..1682) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532489.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 assembly_gap 1785..1962 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2373..3683) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS complement(4051..4218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41570 CDS complement(4474..5697) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101181.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 CDS complement(5727..7304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41590 sequence246 source 1..7862 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(82..798) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221202124.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 CDS complement(761..1570) product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250526.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 CDS complement(1725..3746) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921918.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 CDS 4222..4623 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS 4755..6620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41640 assembly_gap 6033..6169 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6611..7123 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721784.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 misc_feature complement(7168..>7862) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703891.1:putative transporter locus_tag LOCUS_41660 sequence247 source 1..7705 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 597..668 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1120..1617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS complement(1716..2771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41680 assembly_gap 2831..2926 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3261..3356 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3901..4072 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4398..4544 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4773..7193 product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197444080.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 sequence248 source 1..7643 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 376..535 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 936..1061 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1645..2532) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920753.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 gene nadC CDS 2624..3967 product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS 4302..5939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41720 assembly_gap 6024..6182 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6606..6689 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6932..7058 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence249 source 1..7548 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 611..754 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 782..1000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41730 assembly_gap 1175..1313 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1450..1848 product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 CDS complement(1834..2019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41750 CDS complement(2050..2217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS 2815..3027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41770 assembly_gap 3752..3857 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3915..4748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41780 CDS 4921..5379 product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087289.1 transl_table 11 codon_start 1 locus_tag LOCUS_41790 gene gspG CDS 5677..6201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS 6198..6596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41810 assembly_gap 6974..7133 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7173..7487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41820 sequence250 source 1..7464 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 280..762 product DUF1569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123270.1 transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS 961..2769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41840 CDS 2886..3347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS complement(3460..4026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41860 assembly_gap 4167..4295 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4450..5523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41870 assembly_gap 5965..6089 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6650..6949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41880 sequence251 source 1..7434 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 528..1106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS complement(1211..2719) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122320.1 transl_table 11 codon_start 1 locus_tag LOCUS_41900 assembly_gap 2833..2958 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3270..6323 product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 CDS complement(6457..7011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41920 assembly_gap 7187..7269 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence252 source 1..7371 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 745..1893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41930 assembly_gap 822..920 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2240..3985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41940 assembly_gap 3511..3559 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4315..4473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41950 assembly_gap 4673..4830 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 5206..5331 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5403..6149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41960 assembly_gap 5941..5998 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6041..6934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41970 assembly_gap 6961..7194 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence253 source 1..7275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 192..411 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 751..839 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1601..2101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS complement(2202..2651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41990 CDS 2650..2802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS complement(2852..5689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42010 CDS 5811..6428 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922102.1 transl_table 11 codon_start 1 locus_tag LOCUS_42020 sequence254 source 1..7225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(170..1552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42030 assembly_gap 1624..1790 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2934..4067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42040 assembly_gap 4143..4262 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4321..5115) product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121724.1 transl_table 11 codon_start 1 locus_tag LOCUS_42050 CDS 5247..5918 product DUF4328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066963.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 CDS complement(5992..7188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42070 sequence255 source 1..7225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 335..491 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1225..1420 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1895..4339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42080 assembly_gap 1968..2042 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4336..5043) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206150.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 CDS complement(5459..5863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42100 CDS complement(5943..6923) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 CDS complement(7013..7225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42120 sequence256 source 1..7222 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 314..602 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1148..1270 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1577..3211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42130 assembly_gap 2942..3080 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3232..5613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42140 CDS 5727..7139 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 assembly_gap 6954..7057 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence257 source 1..7157 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 217..379 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 500..1195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42160 assembly_gap 2115..2222 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2298..2801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42170 CDS complement(2823..3593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42180 assembly_gap 3619..3735 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4289..4450 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5025..5531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42190 CDS complement(5566..6054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42200 CDS 6305..7072 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 transl_table 11 codon_start 1 locus_tag LOCUS_42210 sequence258 source 1..7101 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 1235..1403 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1734..1905 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2176..2349 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2527..2612 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2618..4627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42220 CDS 4810..6192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42230 assembly_gap 6392..6466 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence259 source 1..7071 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 277..490 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(553..1581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42240 assembly_gap 1590..1730 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1974..2122 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2673..2822 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3513..3740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42250 assembly_gap 3816..3913 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4598..4732 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4959..5138 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5380..6588) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123072.1 transl_table 11 codon_start 1 locus_tag LOCUS_42260 assembly_gap 6630..6773 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence260 source 1..6965 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(275..3328) product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149111012.1 transl_table 11 codon_start 1 locus_tag LOCUS_42270 CDS complement(3411..5429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42280 assembly_gap 5500..5561 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6175..6266 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6498..6625 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence261 source 1..6925 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(40..879) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120986.1 transl_table 11 codon_start 1 locus_tag LOCUS_42290 gene kdsA CDS complement(1004..2647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42300 assembly_gap 2688..2776 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3314..3754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42310 CDS 3825..4238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42320 assembly_gap 4356..4460 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4652..5686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42330 CDS complement(5868..6866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42340 assembly_gap 5954..6024 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence262 source 1..6879 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 360..521 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 911..3391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42350 CDS 4105..5055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42360 assembly_gap 6026..6153 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6238..6780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42370 sequence263 source 1..6761 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 215..1099 product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 transl_table 11 codon_start 1 locus_tag LOCUS_42380 assembly_gap 1211..1380 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1585..1845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42390 CDS complement(1886..3265) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001969726.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 assembly_gap 1892..2004 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3495..4145 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887642.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 CDS 4193..5002 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329802.1 transl_table 11 codon_start 1 locus_tag LOCUS_42420 gene sufC CDS 5096..6511 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 transl_table 11 codon_start 1 locus_tag LOCUS_42430 gene sufB sequence264 source 1..6749 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(50..301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42440 CDS complement(473..838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42450 CDS complement(835..2361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42460 CDS complement(2744..3307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42470 CDS complement(3314..6601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42480 sequence265 source 1..6749 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(11..1135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42490 CDS complement(1169..1549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42500 CDS complement(1580..1897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42510 CDS complement(2794..3504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42520 CDS complement(3560..4255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42530 CDS 4446..4895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42540 assembly_gap 5445..5651 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5961..6161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42550 CDS complement(6262..6507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42560 sequence266 source 1..6736 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 632..772 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1403..1497 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2862..3044 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4668..5285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42570 assembly_gap 5303..5431 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5924..6166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42580 sequence267 source 1..6729 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 224..370 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 747..857 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1457..1525 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1543..2322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922325.1 transl_table 11 codon_start 1 locus_tag LOCUS_42590 assembly_gap 2538..2631 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2675..3739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS complement(3754..4689) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922143.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 sequence268 source 1..6729 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(107..325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42620 assembly_gap 813..883 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 991..1512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42630 note possible pseudo, frameshifted assembly_gap 1665..1843 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2045..2947 product DUF6528 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332817.1 transl_table 11 codon_start 1 locus_tag LOCUS_42640 CDS 3642..5009 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123021.1 transl_table 11 codon_start 1 locus_tag LOCUS_42650 assembly_gap 5400..5524 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 5748..5932 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6292..6406 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence269 source 1..6709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(176..409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42660 CDS complement(549..1160) product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922150.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 gene nadD tRNA complement(1620..1695) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(1686..1883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42680 CDS complement(2281..2502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42690 CDS 2730..4571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42700 CDS 4674..5693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42710 sequence270 source 1..6693 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2401 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146390841.1:DUF1549 domain-containing protein locus_tag LOCUS_42720 CDS 2458..3933 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 transl_table 11 codon_start 1 locus_tag LOCUS_42730 CDS 4055..4216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS 4652..5530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42750 tRNA 5633..5706 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 sequence271 source 1..6636 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 276..422 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1048..3060) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122894.1 transl_table 11 codon_start 1 locus_tag LOCUS_42760 gene ligA CDS complement(3159..3926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42770 CDS complement(4039..4383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42780 CDS complement(4516..4935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42790 assembly_gap 5565..5669 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6317..6407 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence272 source 1..6561 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(471..1610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42800 CDS complement(1607..2359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42810 assembly_gap 2989..3133 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3554..3982 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 assembly_gap 3992..4093 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4269..5288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42830 assembly_gap 5318..5491 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6116..6236 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence273 source 1..6498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 126..336 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 346..1221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42840 CDS 1516..2409 product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615890.1 transl_table 11 codon_start 1 locus_tag LOCUS_42850 gene ricT assembly_gap 2489..2719 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2972..3172 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4797..5081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42860 CDS complement(5334..6194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42870 assembly_gap 6209..6363 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence274 source 1..6421 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42880 CDS complement(541..1503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42890 CDS complement(1500..2801) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 transl_table 11 codon_start 1 locus_tag LOCUS_42900 CDS complement(2975..3244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42910 assembly_gap 3351..3440 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5286..5633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42920 assembly_gap 5685..5775 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence275 source 1..6402 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(267..1316) product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921780.1 transl_table 11 codon_start 1 locus_tag LOCUS_42930 CDS complement(1300..2472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933801.1 transl_table 11 codon_start 1 locus_tag LOCUS_42940 CDS complement(2590..3051) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087408.1 transl_table 11 codon_start 1 locus_tag LOCUS_42950 CDS complement(3608..4678) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338403.1 transl_table 11 codon_start 1 locus_tag LOCUS_42960 CDS 4833..5648 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122244.1 transl_table 11 codon_start 1 locus_tag LOCUS_42970 CDS complement(5878..6075) product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 transl_table 11 codon_start 1 locus_tag LOCUS_42980 sequence276 source 1..6393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(82..369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42990 CDS 540..1505 product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881382.1 transl_table 11 codon_start 1 locus_tag LOCUS_43000 CDS 1601..3403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43010 note possible pseudo, frameshifted assembly_gap 3253..3332 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3349..6258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43020 note possible pseudo, frameshifted sequence277 source 1..6200 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 212..349 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 514..1803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43030 assembly_gap 1832..2113 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2260..3246 product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122268.1 transl_table 11 codon_start 1 locus_tag LOCUS_43040 CDS 3249..4145 product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919889.1 transl_table 11 codon_start 1 locus_tag LOCUS_43050 assembly_gap 4205..4345 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4484..4720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43060 assembly_gap 5081..5219 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence278 source 1..6188 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 406..545 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3409..3535 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5318..5506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43070 sequence279 source 1..6128 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 430..1818 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922459.1 transl_table 11 codon_start 1 locus_tag LOCUS_43080 assembly_gap 1993..2145 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2350..3318 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921965.1 transl_table 11 codon_start 1 locus_tag LOCUS_43090 CDS 3452..3841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS 3906..4787 product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325558.1 transl_table 11 codon_start 1 locus_tag LOCUS_43110 CDS complement(4788..5189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43120 assembly_gap 5294..5464 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence280 source 1..6123 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43130 CDS complement(555..1421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43140 CDS 1618..3990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43150 CDS complement(4076..4972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43160 CDS complement(5226..5828) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 transl_table 11 codon_start 1 locus_tag LOCUS_43170 sequence281 source 1..6094 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 345..502 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1260..1357 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1366..1788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43180 CDS 1790..1999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43190 assembly_gap 2820..2997 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3195..3407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43200 assembly_gap 3527..3651 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3727..5784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43210 tRNA 5954..6039 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 sequence282 source 1..5977 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 336..522 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 607..828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43220 CDS 889..1284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43230 assembly_gap 1349..1482 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1759..1968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43240 assembly_gap 3489..3663 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3686..4990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43250 CDS complement(5003..5416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43260 CDS complement(5537..5830) product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 transl_table 11 codon_start 1 locus_tag LOCUS_43270 sequence283 source 1..5963 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(623..1996) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 transl_table 11 codon_start 1 locus_tag LOCUS_43280 tRNA 2226..2309 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 2989..4125 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329385.1 transl_table 11 codon_start 1 locus_tag LOCUS_43290 CDS complement(4260..5717) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118996.1 transl_table 11 codon_start 1 locus_tag LOCUS_43300 sequence284 source 1..5918 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 447..532 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1204..1338 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1527..1805 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2084..2212 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2263..2484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43310 assembly_gap 3087..3284 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3432..3959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43320 CDS 4069..4773 product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 transl_table 11 codon_start 1 locus_tag LOCUS_43330 assembly_gap 5303..5431 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5432..5626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43340 sequence285 source 1..5860 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 585..1526 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122799.1 transl_table 11 codon_start 1 locus_tag LOCUS_43350 CDS complement(1575..3038) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922025.1 transl_table 11 codon_start 1 locus_tag LOCUS_43360 CDS complement(3010..3354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43370 CDS complement(3605..4576) product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 transl_table 11 codon_start 1 locus_tag LOCUS_43380 CDS complement(4614..5039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43390 assembly_gap 5490..5544 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence286 source 1..5824 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 273..398 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(545..3193) product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922871.1 transl_table 11 codon_start 1 locus_tag LOCUS_43400 CDS complement(3568..4776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43410 assembly_gap 4789..4927 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 5434..5618 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence287 source 1..5806 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(161..1669) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 transl_table 11 codon_start 1 locus_tag LOCUS_43420 CDS 2284..2772 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325362.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 gene tadA CDS 2774..3178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43440 CDS complement(3175..4551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43450 assembly_gap 4715..4834 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence288 source 1..5750 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 731..873 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1327..1427 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1705..1832 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1869..2234 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 transl_table 11 codon_start 1 locus_tag LOCUS_43460 CDS 2268..2522 product ethanolamine utilization microcompartment protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762196.1 transl_table 11 codon_start 1 locus_tag LOCUS_43470 gene eutN assembly_gap 2599..2801 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3342..3470 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3937..4022 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4143..4514 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 transl_table 11 codon_start 1 locus_tag LOCUS_43480 assembly_gap 4591..4791 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4935..5687 product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324364.1 transl_table 11 codon_start 1 locus_tag LOCUS_43490 sequence289 source 1..5731 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 323..563 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1249..1512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43500 assembly_gap 1582..1711 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2310..3347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43510 CDS complement(3548..4102) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 transl_table 11 codon_start 1 locus_tag LOCUS_43520 assembly_gap 4657..4773 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 5346..5459 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence290 source 1..5635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(215..763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43530 CDS complement(846..2084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43540 assembly_gap 2684..2919 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4608..5189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43550 rRNA complement(5279..5379) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence291 source 1..5627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 176..1828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43560 assembly_gap 1572..1668 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1845..3116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43570 assembly_gap 3654..3807 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3994..5304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43580 assembly_gap 5208..5276 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5354..5599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43590 sequence292 source 1..5518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 926..1039 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1482..1587 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1615..2112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43600 CDS complement(2737..3297) product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123297.1 transl_table 11 codon_start 1 locus_tag LOCUS_43610 CDS complement(3479..3931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941231.1 transl_table 11 codon_start 1 locus_tag LOCUS_43620 CDS complement(4097..5164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43630 sequence293 source 1..5498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(516..1130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS complement(1292..2476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43650 CDS 2846..3670 product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532025.1 transl_table 11 codon_start 1 locus_tag LOCUS_43660 CDS 3789..5450 product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 transl_table 11 codon_start 1 locus_tag LOCUS_43670 sequence294 source 1..5439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 285..369 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 438..632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43680 CDS 786..1262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43690 CDS 1249..1575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43700 CDS 1572..2228 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665924.1 transl_table 11 codon_start 1 locus_tag LOCUS_43710 CDS 2680..3054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43720 CDS complement(3331..3495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS 3836..4294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43740 sequence295 source 1..5400 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(106..537) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117815.1 transl_table 11 codon_start 1 locus_tag LOCUS_43750 CDS 1009..2196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43760 assembly_gap 3137..3260 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3737..3848 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4116..4289 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4834..5021 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence296 source 1..5330 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 71..292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43770 assembly_gap 703..862 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2215..2367 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2744..2855 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3074..5050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43780 assembly_gap 5052..5159 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence297 source 1..5324 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 1415..1549 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2707..4458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43790 assembly_gap 2803..2921 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4469..4601 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence298 source 1..5217 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(74..352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43800 CDS complement(1224..3035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43810 CDS 3597..3797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43820 assembly_gap 3921..4039 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4156..5178 product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 transl_table 11 codon_start 1 locus_tag LOCUS_43830 gene galT sequence299 source 1..5104 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(56..1954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43840 assembly_gap 2055..2161 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2664..2832 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2942..3184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43850 assembly_gap 3226..3352 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3844..4034 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4086..4745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43860 assembly_gap 4768..4926 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence300 source 1..5092 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1063..2280 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482205.1 transl_table 11 codon_start 1 locus_tag LOCUS_43870 CDS 2247..2492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS 2489..3859 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922160.1 transl_table 11 codon_start 1 locus_tag LOCUS_43890 CDS complement(3861..4862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43900 sequence301 source 1..5087 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 228..384 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1715..2962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43910 CDS 3071..4282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43920 sequence302 source 1..5038 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 838..1779 product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327752.1 transl_table 11 codon_start 1 locus_tag LOCUS_43930 gene floA assembly_gap 1822..1939 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2637..2852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43940 CDS 3107..3463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43950 CDS 3595..4875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43960 sequence303 source 1..5033 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 1871..2008 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2277..2443 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2455..2994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43970 assembly_gap 3048..3303 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3482..4870) product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438012.1 transl_table 11 codon_start 1 locus_tag LOCUS_43980 gene sat assembly_gap 4133..4247 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence304 source 1..5012 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 188..339 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(605..901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43990 CDS complement(1012..1377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44000 CDS complement(1410..2915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44010 CDS 3040..3366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44020 assembly_gap 3960..4072 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4419..4563 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence305 source 1..4972 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 436..508 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 581..2050 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330527.1 transl_table 11 codon_start 1 locus_tag LOCUS_44030 gene tig CDS 2320..4512 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329329.1 transl_table 11 codon_start 1 locus_tag LOCUS_44040 gene thrS sequence306 source 1..4968 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(113..1222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44050 assembly_gap 1236..1397 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1863..3773) product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427755.1 transl_table 11 codon_start 1 locus_tag LOCUS_44060 CDS complement(3770..4366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44070 assembly_gap 4441..4533 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence307 source 1..4965 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 637..1545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44080 CDS complement(1844..3001) product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 transl_table 11 codon_start 1 locus_tag LOCUS_44090 CDS 3155..4480 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615837.1 transl_table 11 codon_start 1 locus_tag LOCUS_44100 assembly_gap 4616..4785 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence308 source 1..4940 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(222..1505) product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 transl_table 11 codon_start 1 locus_tag LOCUS_44110 assembly_gap 1613..1772 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2501..2640 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4556..4722 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence309 source 1..4936 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(593..1213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44120 assembly_gap 1244..1385 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1881..2330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44130 assembly_gap 3324..3413 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3443..3991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44140 assembly_gap 4042..4203 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence310 source 1..4930 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1036..1608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44150 CDS 1676..2032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44160 CDS 2163..3239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44170 assembly_gap 3252..3323 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3885..4055 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4135..4887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44180 sequence311 source 1..4889 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 578..637 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 770..939 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1731..2270 product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909489.1 transl_table 11 codon_start 1 locus_tag LOCUS_44190 CDS 2369..3370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119567.1 transl_table 11 codon_start 1 locus_tag LOCUS_44200 CDS 3434..3904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44210 assembly_gap 4137..4244 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4288..4815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44220 sequence312 source 1..4888 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 249..313 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(333..1202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44230 note possible pseudo, frameshifted CDS complement(1199..1513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44240 note possible pseudo, frameshifted sequence313 source 1..4880 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(268..1617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44250 CDS complement(1726..1935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44260 CDS complement(2856..3530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44270 assembly_gap 3563..3691 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3953..4109 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence314 source 1..4853 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 234..382 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1780..1941 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2163..2348 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2457..3191 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335855.1 transl_table 11 codon_start 1 locus_tag LOCUS_44280 assembly_gap 3240..3382 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3987..4178 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4451..4641 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence315 source 1..4841 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 724..812 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1043..2071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44290 CDS 2205..3617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44300 assembly_gap 3440..3578 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3890..4067 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4421..4627 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence316 source 1..4835 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 208..768 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 transl_table 11 codon_start 1 locus_tag LOCUS_44310 gene dcd CDS 778..1317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44320 CDS 1531..2685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44330 CDS complement(2698..3600) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037249854.1 transl_table 11 codon_start 1 locus_tag LOCUS_44340 CDS 3772..4770 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118196.1 transl_table 11 codon_start 1 locus_tag LOCUS_44350 sequence317 source 1..4753 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(336..1445) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118338.1 transl_table 11 codon_start 1 locus_tag LOCUS_44360 gene ald CDS complement(1520..2143) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560301.1 transl_table 11 codon_start 1 locus_tag LOCUS_44370 CDS complement(2284..3414) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335445.1 transl_table 11 codon_start 1 locus_tag LOCUS_44380 assembly_gap 3609..3773 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3806..4000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44390 assembly_gap 4019..4124 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4406..4560 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence318 source 1..4746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 166..425 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 602..734 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1352..1418 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1866..3020 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791803.1 transl_table 11 codon_start 1 locus_tag LOCUS_44400 gene ftsW CDS complement(3017..3997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44410 misc_feature complement(4058..>4746) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225422.1:TetR/AcrR family transcriptional regulator locus_tag LOCUS_44420 sequence319 source 1..4743 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 139..412 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 491..1243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44430 assembly_gap 1674..1753 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1866..2813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44440 CDS complement(2962..4428) product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 transl_table 11 codon_start 1 locus_tag LOCUS_44450 sequence320 source 1..4653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 191..310 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 734..905 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1084..1941) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887476.1 transl_table 11 codon_start 1 locus_tag LOCUS_44460 CDS complement(2112..3152) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118761.1 transl_table 11 codon_start 1 locus_tag LOCUS_44470 CDS 3612..4625 product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404555.1 transl_table 11 codon_start 1 locus_tag LOCUS_44480 sequence321 source 1..4635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(968..1885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44490 CDS complement(2371..2604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44500 CDS complement(3727..4347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44510 sequence322 source 1..4585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 279..644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44520 CDS complement(1258..2241) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208224.1 transl_table 11 codon_start 1 locus_tag LOCUS_44530 sequence323 source 1..4571 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(53..433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44540 assembly_gap 488..603 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(690..1232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44550 CDS complement(1381..1662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44560 assembly_gap 1753..1892 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1929..2342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44570 CDS 2787..3527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44580 CDS 3520..4092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44590 sequence324 source 1..4528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 159..1205 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615578.1 transl_table 11 codon_start 1 locus_tag LOCUS_44600 assembly_gap 2127..2274 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3114..4157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44610 assembly_gap 4051..4154 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence325 source 1..4493 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 176..892 product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037253881.1 transl_table 11 codon_start 1 locus_tag LOCUS_44620 CDS complement(962..2419) product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120139.1 transl_table 11 codon_start 1 locus_tag LOCUS_44630 CDS 2574..2990 product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123553.1 transl_table 11 codon_start 1 locus_tag LOCUS_44640 assembly_gap 3362..3488 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4025..4156 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence326 source 1..4466 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 170..451 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 901..1098 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1166..2377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44650 CDS complement(2795..3058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44660 assembly_gap 3103..3116 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3416..3724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44670 assembly_gap 3785..3945 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence327 source 1..4450 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(32..1744) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260568.1 transl_table 11 codon_start 1 locus_tag LOCUS_44680 CDS 2161..2937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44690 CDS 3037..3993 product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183508.1 transl_table 11 codon_start 1 locus_tag LOCUS_44700 assembly_gap 4058..4278 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence328 source 1..4415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 995..1141 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2724..2887 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3119..3211 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3341..3655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44710 assembly_gap 3750..3847 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence329 source 1..4389 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 1166..1252 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1607..1834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44720 CDS 1905..2912 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080741.1 transl_table 11 codon_start 1 locus_tag LOCUS_44730 gene rnz assembly_gap 2314..2408 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3028..3207 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3497..3758 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence330 source 1..4383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1007 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328624.1:DUF1552 domain-containing protein locus_tag LOCUS_44740 CDS 1111..2280 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261129.1 transl_table 11 codon_start 1 locus_tag LOCUS_44750 CDS 2346..3140 product DUF455 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174163.1 transl_table 11 codon_start 1 locus_tag LOCUS_44760 sequence331 source 1..4332 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..612 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122091.1:molecular chaperone DnaJ locus_tag LOCUS_44770 CDS 796..1401 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101637.1 transl_table 11 codon_start 1 locus_tag LOCUS_44780 gene grpE CDS 1593..1910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44790 CDS 1926..2168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44800 CDS 2190..2966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44810 CDS 3185..4063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44820 sequence332 source 1..4324 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..789 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921746.1:cytochrome c oxidase subunit II locus_tag LOCUS_44830 CDS 797..3337 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119895.1 transl_table 11 codon_start 1 locus_tag LOCUS_44840 gene ctaD assembly_gap 3577..3726 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3874..4278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44850 sequence333 source 1..4318 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 138..424 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 807..1337 product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122249.1 transl_table 11 codon_start 1 locus_tag LOCUS_44860 gene fae CDS 1456..2493 product nucleoside monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121910.1 transl_table 11 codon_start 1 locus_tag LOCUS_44870 CDS complement(2634..3434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44880 CDS complement(3534..3815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44890 assembly_gap 3965..4128 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence334 source 1..4303 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 551..2080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44900 note possible pseudo, frameshifted assembly_gap 1979..2033 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3749..3939 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4028..4261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44910 sequence335 source 1..4261 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 229..487 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 862..1072 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1898..2034 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2409..2582 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2782..2939 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3664..3711 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence336 source 1..4194 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1073..1627) product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 transl_table 11 codon_start 1 locus_tag LOCUS_44920 misc_feature complement(2022..>4194) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099262126.1:serine/threonine-protein kinase locus_tag LOCUS_44930 sequence337 source 1..4169 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(201..1112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44940 CDS complement(1362..2213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44950 assembly_gap 2466..2607 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2848..2987 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3062..3841 product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258210.1 transl_table 11 codon_start 1 locus_tag LOCUS_44960 gene nfi sequence338 source 1..4080 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 445..620 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1286..1358 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3304..3438 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3595..3819 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence339 source 1..4003 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 217..369 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2787..3452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44970 sequence340 source 1..3988 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2362 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404233.1:DNA topoisomerase IV subunit A locus_tag LOCUS_44980 assembly_gap 198..373 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence341 source 1..3964 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 185..1096 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121783.1 transl_table 11 codon_start 1 locus_tag LOCUS_44990 CDS 1285..2793 product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037250650.1 transl_table 11 codon_start 1 locus_tag LOCUS_45000 CDS 2896..3495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45010 CDS complement(3518..3964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45020 sequence342 source 1..3964 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 267..461 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 680..891 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2419..2597 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2947..3101 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3331..3780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45030 sequence343 source 1..3912 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 561..762 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1286..1424 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1495..1809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45040 CDS 1945..3813 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 transl_table 11 codon_start 1 locus_tag LOCUS_45050 assembly_gap 3493..3658 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence344 source 1..3867 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1033..1803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45060 CDS complement(1859..3454) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778965.1 transl_table 11 codon_start 1 locus_tag LOCUS_45070 gene guaA sequence345 source 1..3851 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(52..369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45080 assembly_gap 421..562 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 943..1080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45090 assembly_gap 1114..1207 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1491..1667 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1727..2371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45100 assembly_gap 2479..2659 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2871..3061 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3271..3409 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence346 source 1..3839 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 385..807 product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 transl_table 11 codon_start 1 locus_tag LOCUS_45110 CDS 855..2381 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 transl_table 11 codon_start 1 locus_tag LOCUS_45120 assembly_gap 989..1097 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2574..3092 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 transl_table 11 codon_start 1 locus_tag LOCUS_45130 gene rplM sequence347 source 1..3781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 123..503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45140 assembly_gap 576..688 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1517..1665 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2487..2680 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2712..3752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45150 sequence348 source 1..3751 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1246..>3751) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008666716.1:PSD1 and planctomycete cytochrome C domain-containing protein locus_tag LOCUS_45160 sequence349 source 1..3744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(280..612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45170 note possible pseudo, internal stop codon, frameshifted CDS complement(857..979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45180 CDS complement(1049..2122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45190 CDS complement(2215..3480) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922363.1 transl_table 11 codon_start 1 locus_tag LOCUS_45200 sequence350 source 1..3711 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1244..2029) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395936.1 transl_table 11 codon_start 1 locus_tag LOCUS_45210 assembly_gap 2152..2232 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2263..2544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45220 assembly_gap 2680..2843 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3219..3416 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence351 source 1..3687 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 290..562 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 680..1816 product IS481-like element ISEc19 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723086.1 transl_table 11 codon_start 1 locus_tag LOCUS_45230 assembly_gap 2551..2723 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence352 source 1..3682 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 185..349 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 986..1171 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1305..2516) product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 transl_table 11 codon_start 1 locus_tag LOCUS_45240 assembly_gap 3273..3409 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence353 source 1..3640 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..608 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120799.1:sulfatase locus_tag LOCUS_45250 CDS 675..1226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45260 CDS 1243..1671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45270 CDS complement(1802..2341) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401881.1 transl_table 11 codon_start 1 locus_tag LOCUS_45280 CDS complement(2338..3237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45290 assembly_gap 3281..3415 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence354 source 1..3626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 687..796 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1115..1276 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1397..1720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45300 CDS complement(2189..3418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45310 sequence355 source 1..3586 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2713..3057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45320 assembly_gap 3250..3317 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence356 source 1..3581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(196..600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45330 CDS 956..1981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45340 CDS 2306..2791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45350 CDS complement(2841..3110) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831302.1 transl_table 11 codon_start 1 locus_tag LOCUS_45360 gene rpsN sequence357 source 1..3572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2322 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122500.1:serine/threonine-protein kinase locus_tag LOCUS_45370 assembly_gap 2182..2287 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3197..3355 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence358 source 1..3452 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 477..1004 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328411.1 transl_table 11 codon_start 1 locus_tag LOCUS_45380 assembly_gap 1412..1564 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1736..1973 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2055..3131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45390 assembly_gap 3019..3094 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3101..3409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45400 sequence359 source 1..3439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..1184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45410 assembly_gap 1110..1177 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1505..1661 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2412..2518 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2773..2900 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence360 source 1..3314 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 115..576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45420 CDS complement(542..1810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45430 assembly_gap 2197..2293 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2890..3094 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence361 source 1..3299 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 153..369 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 481..714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45440 CDS 698..946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45450 CDS 943..1308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45460 CDS 1436..2227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45470 CDS 2372..2746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45480 CDS 2746..3102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45490 sequence362 source 1..3288 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 103..1668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45500 assembly_gap 147..302 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1692..2789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45510 sequence363 source 1..3258 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 823..969 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1345..1481 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1625..2101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45520 CDS 2311..3201 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891044.1 transl_table 11 codon_start 1 locus_tag LOCUS_45530 sequence364 source 1..3229 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(20..1426) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921694.1 transl_table 11 codon_start 1 locus_tag LOCUS_45540 CDS complement(1443..2054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45550 assembly_gap 2441..2561 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence365 source 1..3205 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 473..656 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 891..1565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45560 CDS complement(1866..2471) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122304.1 transl_table 11 codon_start 1 locus_tag LOCUS_45570 assembly_gap 2708..2817 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence366 source 1..3174 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(12..449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45580 CDS 810..2504 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117790.1 transl_table 11 codon_start 1 locus_tag LOCUS_45590 CDS 2602..3009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45600 sequence367 source 1..3122 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(563..691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45610 assembly_gap 998..1182 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1259..1459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45620 assembly_gap 1912..2075 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence368 source 1..3112 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(273..1541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45630 CDS complement(1538..2056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45640 CDS complement(2146..2766) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 transl_table 11 codon_start 1 locus_tag LOCUS_45650 sequence369 source 1..3082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1187 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008666047.1:PSD1 and planctomycete cytochrome C domain-containing protein locus_tag LOCUS_45660 CDS 1233..2702 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334705.1 transl_table 11 codon_start 1 locus_tag LOCUS_45670 sequence370 source 1..3050 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 142..286 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(372..2612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45680 assembly_gap 2708..2857 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence371 source 1..3013 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..789 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003085555.1:translation elongation factor 4 locus_tag LOCUS_45690 CDS complement(878..1474) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 transl_table 11 codon_start 1 locus_tag LOCUS_45700 CDS complement(1687..2832) product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766215.1 transl_table 11 codon_start 1 locus_tag LOCUS_45710 sequence372 source 1..3002 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 391..837 product Dot/Icm type IV secretion system effector PhnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 transl_table 11 codon_start 1 locus_tag LOCUS_45720 gene phnB CDS 867..1187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45730 CDS 1276..2886 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 transl_table 11 codon_start 1 locus_tag LOCUS_45740 assembly_gap 2688..2781 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence373 source 1..2929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 55..738 product FMN-dependent NADH-azoreductase AzoR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114189.1 transl_table 11 codon_start 1 locus_tag LOCUS_45750 gene azoR1 CDS 845..1315 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122365.1 transl_table 11 codon_start 1 locus_tag LOCUS_45760 CDS 1387..1929 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922248.1 transl_table 11 codon_start 1 locus_tag LOCUS_45770 CDS 2037..2666 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090559.1 transl_table 11 codon_start 1 locus_tag LOCUS_45780 sequence374 source 1..2872 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(923..1744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 transl_table 11 codon_start 1 locus_tag LOCUS_45790 assembly_gap 1814..1907 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2035..2790) product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263747.1 transl_table 11 codon_start 1 locus_tag LOCUS_45800 sequence375 source 1..2841 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1604 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878326.1:ABC transporter ATP-binding protein locus_tag LOCUS_45810 CDS 1624..1797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45820 sequence376 source 1..2840 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(23..1105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45830 CDS complement(1117..1617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45840 assembly_gap 1881..2012 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2253..2435 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence377 source 1..2735 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 198..277 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2372..2558 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence378 source 1..2661 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(350..727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45850 assembly_gap 2237..2427 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence379 source 1..2646 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 465..546 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1126..1216 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1338..1568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45860 assembly_gap 2041..2169 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence380 source 1..2592 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(526..966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45870 sequence381 source 1..2569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 485..595 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 843..2387 product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228236.1 transl_table 11 codon_start 1 locus_tag LOCUS_45880 sequence382 source 1..2542 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1048..1719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45890 sequence383 source 1..2508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 266..435 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 531..1883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45900 assembly_gap 1994..2146 estimated_length known gap_type within scaffold linkage_evidence paired-ends